Modified self-replicating mRNA

Abstract

The invention belongs to the field of nucleotide mRNA (messenger ribonucleic acid), and particularly relates to modified self-replicating mRNA. A polynucleotide fragment of the gene comprises one or more non-structural replicase domains from the alpha virus and an integrated target fragment, and the polynucleotide fragment comprises a functional nucleotide analogue; the functional nucleotide analogue is prepared from at least one of pseudouridine, N1-methyl pseudouridine, 5-hydroxymethoxy cytidine and N6-methyladenosine.

Description

Modified self-replicating mRNA

[0001] Priority Declaration

[0002] This application claims priority to and the benefit of CN 2022108058522, filed on July 8, 2022, and is incorporated by reference in its entirety. Technical Field

[0003] The present invention belongs to the field of nucleotide mRNA, and in particular, relates to a modified self-replicating mRNA. Background Art

[0004] Traditional inactivated vaccines and recombinant protein vaccines have long production cycles and complex processes, making them unable to meet the large-scale vaccination needs of sudden, large-scale epidemics. mRNA, on the other hand, offers a rapid-response vaccine development platform for addressing outbreaks. In 2020, Moderna and BioNTech launched mRNA-1273 and Tozinameran, two mRNA vaccines developed with modified nucleotides to combat the COVID-19 pandemic, respectively, for vaccination against COVID-19, demonstrating their safety and effectiveness.

[0005] mRNA vaccines are synthesized in vitro using linearized plasmid DNA as a template through an enzymatic transcription reaction. This synthesis strategy avoids the safety and complex production processes associated with live cell culture production. The mRNA vaccine platform is safe and effective, with a short production cycle and simple process, making it particularly suitable for responding to outbreaks.

[0006] Self-replicating mRNA vaccines have strong immunogenicity in animal experiments and can replicate their own sequences using themselves as templates. Therefore, compared with conventional mRNA vaccines, they require fewer vaccination doses. In addition, the adjuvant effect formed by the immune response induced during self-replication can induce a stronger immune response and further enhance humoral and cellular immune responses.

[0007] However, further research is needed on nucleotide-modified self-replicating mRNA.

[0008] Summary of the Invention

[0009] The first object of the present invention is to provide a modified self-replicating mRNA, wherein the polynucleotide fragment comprises one or more non-structural replicase domains from an alphavirus and an integrated target fragment, wherein the polynucleotide fragment comprises a functional nucleotide analog;

[0010] The functional nucleotide analogs include pseudouridine, N1-methyl pseudouridine, 5-hydroxymethoxycytidine and N 6 -At least one of methyladenosine.

[0011] The second object of the present invention is to provide a vaccine composition comprising the modified self-replicating mRNA as described above.

[0012] The third object of the present invention is to provide a kit of parts comprising the vaccine composition as described above, and optionally a container for administering the vaccine composition.

[0013] A fourth object of the present invention is to provide a method for modifying the following properties of mRNA after inoculation into an animal:

[0014] a) improving the immunogenicity of the mRNA; and / or

[0015] b) improving the ability of the mRNA to evade immune surveillance;

[0016] The method comprises the step of replacing the corresponding unmodified form of nucleosides in the mRNA with functional nucleotide analogs.

[0017] Studies have found that modified self-replicating mRNA has better expression effects than self-replicating mRNA without nucleotide modification, and it was found that it can escape immune surveillance in cell experiments, induce weaker IFN-B1 and / or RIG-1 transcription, and then maintain long-term expression, which can induce immune response. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the specific embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0019] FIG1 is a diagram of the structure of an mRNA-RBD plasmid according to an embodiment of the present invention, which contains a kanamycin resistance gene (Kan), a T7 promoter element, an nsp gene, an RBD gene, and a polyA element.

[0020] Figure 2 is an electrophoresis result diagram of the self-replicating mRNA-RBD (labeled as SAM-CD5-RBD in the figure) after in vitro transcription according to an embodiment of the present invention; wherein Ψ-UTP / 1mΨ-UTP / 5m-CTP represent pseudouridine / N1-methylpseudouridine / 5-hydroxymethoxycytidine, respectively, 0%, 10%, 20%, ..., 90%, 100% represent the ratio of pseudouridine / N1-methylpseudouridine / 5-hydroxymethoxycytidine modification during in vitro transcription of modified nucleotides of the self-replicating mRNA-RBD, and M represents an RNA molecular weight standard (RNA ladder).

[0021] Figure 3 is a graph comparing RBD protein expression after in vitro transfection of BHK cells with modified nucleotides and conventional nucleotide self-replicating mRNA-RBD (labeled as SAM-CD5-RBD in the figure) by western blot detection according to the embodiment, wherein AC represents the RBD expression results in the cell lysate of self-replicating mRNA-RBD modified with different ratios of nucleotide pseudouridine / N1-methylpseudouridine / 5-hydroxymethoxycytidine, and DF represents the RBD expression results in the cell supernatant of self-replicating mRNA-RBD modified with different ratios of nucleotide pseudouridine / N1-methylpseudouridine / 5-hydroxymethoxycytidine.

[0022] Figure 4 is a graph showing RBD protein expression after in vitro transfection of BHK cells with modified nucleotides and conventional nucleotide self-replicating mRNA-RBD (labeled SAM-CD5-RBD in the figure) by western blot detection according to the embodiment, and quantitative analysis of RBD protein expression was performed with Actin as an internal reference, wherein the AC graph, the upper half of the graph shows the RBD expression results in cell lysates of self-replicating mRNA-RBD modified nucleotides pseudouridine / N1-methylpseudouridine / 5-hydroxymethoxycytidine at different ratios, and the lower half of the graph corresponds to the quantitative analysis of RBD expression.

[0023] FIG5 is a graph showing the expression of the natural immune regulatory factor IFN-B1 gene after Hela cells were transfected in vitro using qPCR detection comparing modified nucleotides and conventional nucleotide self-replicating mRNA-RBD (labeled as SAM-CD5-RBD in the figure) according to the embodiment.

[0024] FIG6 is a graph comparing the gene expression of IFN-B1 in mouse spleen cells using qPCR detection using modified nucleotides and conventional nucleotide self-replicating mRNA-RBD (labeled as SAM-CD5-RBD in the figure) according to an embodiment.

[0025] FIG7 is an animal experiment design according to an embodiment. BALB / c female mice aged 6 to 8 weeks were adaptively fed for 3 days and then divided into groups, with 6 mice in each group. One group was the control group, which was injected with the preparation buffer; the other ten groups were injected with conventional nucleotide self-replicating mRNA-RBD-LNP (labeled as SAM-CD5-RBD (0% ψ-UTP) in the figure), 10%, 20%, and 30% pseudouridine-modified self-replicating mRNA-RBD-LNP (labeled as SAM-CD5-RBD (10%, 20%, 30% ψ-UTP) in the figure), 10%, 20%, and 30% N1-methylpseudouridine-modified self-replicating mRNA-RBD-LNP, and 10%, 20%, and 30% N1-methylpseudouridine-modified self-replicating mRNA-RBD-LNP. LNP (marked as SAM-CD5-RBD (10%, 20%, 30% 1mψ-UTP) in the figure), 100% ratio of 5-methylcytidine modified self-replicating mRNA-RBD-LNP (marked as SAM-CD5-RBD (100% 5m-CTP) in the figure), 100% ratio of pseudouridine modified non-self-replicating mRNA-RBD-LNP (marked as nSAM-CD5-RBD (100% ψ-UTP) in the figure), 100% ratio of N1-methylpseudouridine modified non-self-replicating mRNA-RBD-LNP (marked as nSAM-CD5-RBD (100% 1mψ-UTP) in the figure). Each mouse received a spinal injection of 3ug mRNA-RBD-LNP on day 0, and the spleens of the three mice in each group were harvested on day 2 to detect IFN-B1 expression. The remaining three mice in each group received serum samples on days 7 and 14, and each mouse received a second spinal injection of 3ug mRNA-RBD-LNP. Serum was then collected on days 21 and 28 to detect RBD antibody titers.

[0026] FIG8 is a diagram showing the serum antibody titer detection in an animal experiment according to an embodiment, in which antibodies specific to RBD in the serum are detected by ELISA. The vertical axis shows the logarithm of the antibody titer, and the horizontal axis represents the corresponding sample.

[0027] FIG9 is an embodiment of the m 6 Effect of A modification on SAM-RNA expression.

[0028] FIG10 is the WB detection result of RBD expression in the embodiment.

[0029] FIG. 11 is an example of an evaluation m 6 A. The effect of modification on IFN-B1 gene expression; As can be seen from the figure, m 6 A modification can effectively reduce IFN-B1 expression. DETAILED DESCRIPTION

[0030] Reference will now be made in detail to embodiments of the present invention, one or more examples of which are described below. Each example is provided to illustrate, not to limit, the present invention. Indeed, it will be apparent to those skilled in the art that various modifications and variations may be made to the present invention without departing from the scope or spirit of the invention. For example, features illustrated or described as part of one embodiment may be used in another embodiment to produce further embodiments.

[0031] Unless otherwise indicated, all terms (including technical and scientific terms) used to disclose the present invention have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs. By way of further guidance, the following definitions are provided to better understand the teachings of the present invention. The terms used herein in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0032] The terms "and / or", "or / and", and "and / or" used herein include any one of two or more related listed items, and also include any and all combinations of the related listed items, wherein the arbitrary and all combinations include any combination of two related listed items, any more related listed items, or all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or", "or / and", and "and / or", it should be understood that in this application, the technical solution undoubtedly includes technical solutions connected by "logical and" and also undoubtedly includes technical solutions connected by "logical or". For example, "A and / or B" includes three parallel solutions of A, B and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, the technical solution of all being connected by "logical OR"), and also includes any and all combinations of A, B, C, and D, that is, the combination of any two or any three of A, B, C, and D, and also includes the four-item combination of A, B, C, and D (that is, the technical solution of all being connected by "logical AND").

[0033] As used herein, the terms "comprising," "including," and "comprising" are synonymous and are inclusive or open-ended and do not exclude additional, unrecited members, elements, or method steps.

[0034] The recitation of numerical ranges herein by endpoints includes all numbers and fractions subsumed within the range, as well as the recited endpoints.

[0035] Concentration values ​​used in this invention include fluctuations within a certain range. For example, fluctuations within a certain precision range are permitted. For example, for 2%, fluctuations within ±0.1% are permitted. For larger values ​​or values ​​that do not require overly precise control, greater fluctuations are permitted. For example, for 100 mM, fluctuations within ±1%, ±2%, ±5%, etc. are permitted. Regarding molecular weight, fluctuations within ±10% are permitted.

[0036] In the present invention, descriptions such as "plurality" and "multiple" refer to quantities greater than or equal to 2 unless otherwise specified.

[0037] In the present invention, the technical features described in an open manner include closed technical solutions composed of the listed features, and also include open technical solutions containing the listed features.

[0038] In the present invention, "preferably", "better", "more preferably", and "suitably" are merely descriptions of preferred implementation methods or examples, and should be understood to not limit the scope of protection of the present invention. In the present invention, "optionally", "optional", and "optional" refer to being optional, that is, to being selected from either of the two parallel options of "with" or "without". If multiple "options" appear in a technical solution, unless otherwise specified and without contradiction or mutual restriction, each "optional" is independent.

[0039] As used herein, the term "functional nucleotide analogue" refers to a modified version of a classical nucleotide A, G, C, U, or T that (a) retains the base pairing properties of the corresponding classical nucleotide and (b) contains at least one chemical modification of the corresponding natural nucleotide to (i) a nucleobase, (ii) a sugar group, (iii) a phosphate group, or (iv) any combination of (i) to (iii). As used herein, base pairing encompasses not only the classical Watson-Crick adenine-thymine, adenine-uracil, or guanine-cytosine base pairs, but also base pairs formed between a classical nucleotide and a functional nucleotide analogue, or between a pair of functional nucleotide analogues, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors allows hydrogen bonds to form between the modified nucleobase and the classical nucleobase, or between two complementary modified nucleobase structures. For example, a functional analogue of guanosine (G) retains the ability to base pair with cytosine (C) or a functional analogue of cytosine. An example of such non-classical base pairing is base pairing between the modified nucleotide inosine and adenine, cytosine or uracil. As described herein, functional nucleotide analogs can be naturally occurring or non-naturally occurring. Thus, nucleic acid molecules containing functional nucleotide analogs can have at least one modified nucleobase, sugar group and / or internucleoside linkage. Exemplary chemical modifications to the nucleobases, sugar groups or internucleoside linkages of nucleic acid molecules are provided herein. Examples of functional nucleotide analogs include 4-acetylcytidine, 5-(carboxyhydroxymethyl)uridine, dihydrouridine, 2'-O-methylpseudouridine, β, D-galactosyl Q nucleoside, 2'-O-methylguanosine, inosine, N- 6 -Isopentenyl adenosine, 1-methyladenosine, 1-methylpseudouridine, 1-methylinosine, 2'2-dimethyladenosine, 2-methyladenosine, 2-methylguanosine, 5-methyluridine, 3-methylcytidine, 5-methylcytidine, N 6 -methyladenosine, 7-methylguanosine, 5-methylaminomethyluridine, 5-carboxymethylaminomethyluridine, 5-carboxymethylaminomethyl-2-thiouridine, β, D-mannose Q nucleoside, 5-methoxycarbonylmethyl-2-thiouridine, 5-methoxycarbonylmethyluridine, 5-methoxyuridine, 2-thiomethyl-N 6-Isopentenyl adenosine, N-((9-β-D-ribofuranosyl-2-thiomethylpurine-6-yl)carbamoyl)threonine, N-((9-β-D-ribofuranosylpurine-6-yl)N-methylcarbamoyl)threonine, uridine-5-oxyacetic acid-methyl ester, uridine-5-oxyacetic acid, wybutoxosine, pseudouridine, N1-methylpseudouridine, 5-hydroxymethoxycytidine , Q nucleoside, 2-thiocytidine, 5-methyl-2-thiouridine, 2-thiouridine, 4-thiouridine, 5-thiouridine, N-((9-β-D-ribofuranosyl-6-yl)-carbamoyl)threonine, 2'-O-methyladenosine-5-methyluridine, 2'-O-methyladenosine, 2'-O-methylcytidine, Wybutosine, 3-(3-amino-3-carboxy-propyl)uridine, N 6 -acetyladenosine and 2-methylthio-N 6 -methyladenosine; preferred functional nucleotide analogs include: at least one, two or three of pseudouridine, N1-methylpseudouridine and 5-hydroxymethoxycytidine.

[0040] The present invention relates to mRNA comprising functional nucleotide analogs.

[0041] In some embodiments, the mRNA comprises a self-replicating mRNA.

[0042] In some embodiments, the mRNA comprises one or more polynucleotide segments from a nonstructural replicase domain of an alphavirus.

[0043] In some embodiments, the mRNA comprises an integrated polynucleotide fragment of interest.

[0044] The present invention relates to a modified self-replicating mRNA, the polynucleotide segment of which comprises one or more non-structural replicase domains from an alphavirus and an integrated target segment, wherein the polynucleotide segment comprises functional nucleotide analogs.

[0045] In some embodiments, the content of any one type of the functional nucleotide analogs in the mRNA / self-replicating mRNA is 0.01% to 100%, and 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, or 90% can also be selected.

[0046] In some embodiments, the total amount of all types of the functional nucleotide analogs in the mRNA / self-replicating mRNA is 0.01% to 100%, and 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, or 90% can also be selected.

[0047] The functional nucleotide analogs can be located at any position in the mRNA, for example, in the nonstructural replicase domain of the alphavirus, or in the integrated target polynucleotide fragment, or both. In some embodiments, 0% to 100% of the functional nucleotide analogs are located in the nonstructural replicase domain of the alphavirus, for example, at least 0.01%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%. In some embodiments, 0% to 100% of the functional nucleotide analogs are located in the target fragment, for example, at least 0.01%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%.

[0048] It is easy to understand that in the present invention, the "unmodified form" refers to the nucleotide before modification of the functional nucleotide analog, which generally has the same base. For example, the unmodified form of pseudouridine and N1-methylpseudouridine can be uridine, and the unmodified form of 5-hydroxymethoxycytidine can be cytidine.

[0049] In some embodiments, the functional nucleotide analogs include pseudouridine, N1-methyl pseudouridine, 5-hydroxymethoxycytidine, and N 6 -At least one of methyladenosine.

[0050] In some embodiments, the functional nucleotide analogue comprises at least one of pseudouridine, N1-methylpseudouridine, and 5-hydroxymethoxycytidine.

[0051] In some embodiments, the uridine in the unmodified form of the polynucleotide fragment is modified to pseudouridine at a ratio of 1% to 100%, or 1% to 50%, or 10% to 50%, or 20% to 40%, or 25% to 35%; the modification ratio can also be selected from 5%, 10%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, or 90%.

[0052] In some embodiments, the uridine in the unmodified form of the polynucleotide fragment is modified to N1-methylpseudouridine at a ratio of 1% to 100%, or 1% to 60%, or 10% to 60%, or 10% to 20%; the modification ratio can also be selected from 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%.

[0053] In some embodiments, the cytidine in the unmodified form of the polynucleotide fragment is modified to 5-hydroxymethoxycytidine at a ratio of 1% to 100%, or 80% to 100%, or 90% to 100%; the modification ratio can also be selected from 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%.

[0054] In some embodiments, the adenosine in the unmodified form of the polynucleotide fragment is modified to N at a ratio of 1% to 100%, or 1% to 30%, or 1% to 10%, or 1% to 5%. 6 -methyladenosine (m 6 A); the modification ratio can also be selected from 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%.

[0055] In some embodiments, the target fragment comprises at least one mRNA encoding an antigen or a fragment or epitope thereof; preferably, the antigen is a pathogenic antigen, more preferably, the antigen is a viral antigen, a bacterial antigen, a parasitic antigen, a fungal antigen, a protozoan antigen, a prion antigen or a tumor antigen.

[0056] Optionally, the virus includes one or more of: adenoviridae, arenaviridae, astroviridae, bunyaviridae, caliciviridae, flaviviridae, hepeviridae, mononegavirales, nidovirales, picornaviridae, orthocoronavirinae, orthomyxoviridae, papillomaviridae, parvoviridae, polyomaviridae, poxviridae, reoviridae, retroviridae and togaviridae.

[0057] Optionally, the bacteria include: one or more of Staphylococcus, Streptococcus, Listeria, Erysipelothrix, Nephrobacterium, Bacillus, Clostridium, Mycobacterium, Actinomyces, Nocardia, Corynebacterium, and Rhodococcus, and / or, one or more of Bacillus anthracis, Bacillus erysipelothrix, Bacillus tetani, Listeria, Bacillus anthracis, Mycobacterium tuberculosis, Escherichia coli, Proteus, Shigella dysenteriae, Klebsiella pneumoniae, Brucella, Bacillus perfringens, Haemophilus influenzae, Haemophilus parainfluenzae, Moraxella catarrhalis, Acinetobacter, Yersinia, Legionella pneumophila, Bordetella pertussis, Bordetella parapertussis, Shigella, Pasteurella, Vibrio cholerae, and Vibrio parahaemolyticus.

[0058] Optionally, the fungi include: Coccidioides immitis, Coccidioides spp., Histoplasma capsulatum, Histoplasma durnei, Blastomyces lobogensis, Paracoccidioides brasiliensis, Blastomyces dermatitidis, Sporothrix schenckii, Penicillium marneffei, Candida albicans, Candida glabrata, Candida tropicalis, Candida lupulus, Aspergillus, Exophial mold Zhen, Peyer's mold, compact mold, verrucous mold, dermatitis mold, Geotrichum candidum, Boyer's foot swollen fungus, Cryptococcus neoformans, Trichosporon, Rhizopus oryzae, Mucor indiae, Absidia corymbifera, Coprosporon racemosus, Frog feces mold, Coronary ear mold, Heterosporium, Rhinosporium sibiricum, Transparent Trichosporon and Dark Trichosporon.

[0059] Optionally, the parasites include one or more of: digestive tract parasites, liver parasites, lung parasites, brain tissue parasites, vascular parasites, lymphatic vessel parasites, muscle tissue parasites, intracellular parasites, bone tissue parasites and intraocular parasites.

[0060] Optionally, the tumor includes: a tumor generated by lesions in any of the following: bones, bone connections, muscles, lungs, trachea, heart, spleen, arteries, veins, blood, capillaries, lymph nodes, lymphatic vessels, lymph fluid, oral cavity, pharynx, esophagus, stomach, duodenum, small intestine, colon, rectum, anus, appendix, liver, gallbladder, pancreas, parotid gland, sublingual gland, urinary kidney, ureter, bladder, urethra, ovary, fallopian tube, uterus, vagina, vulva, scrotum, testicle, vas deferens, penis, eye, ear, nose, tongue, skin, brain, brainstem, medulla oblongata, spinal cord, cerebrospinal fluid, nerves, thyroid gland, parathyroid gland, adrenal gland, pituitary gland, pineal gland, pancreatic islets, thymus, gonads, sublingual gland and parotid gland.

[0061] In some embodiments, the target fragment is mRNA derived from SARS-CoV-2, preferably spike protein mRNA or a fragment thereof, more preferably it comprises the RBD gene or a fragment thereof.

[0062] In some embodiments, the alphavirus is selected from at least one of Venezuelan Equine Encephalitis Virus (VEEV), Sindbis virus, Chikungunya virus, Eastern Equine Encephalitis Virus, Western Equine Encephalitis Virus, Mayarovirus, Semliki Forest Virus, and Venezuelan Equine Encephalitis Virus. Preferably, the virus in the alphavirus family is Venezuelan Equine Encephalitis Virus (VEEV). However, it should be understood that the viruses in the alphavirus family listed herein are merely exemplary and not limiting.

[0063] In some embodiments, the nucleotide sequence of the unmodified form of the modified self-replicating mRNA is as shown in SEQ ID NO: 3.

[0064] The present invention also relates to a vaccine composition comprising the modified self-replicating mRNA as described above.

[0065] In some embodiments, the vaccine composition further comprises at least one of a pharmaceutically acceptable carrier, a diluent, and an excipient.

[0066] The term "pharmaceutically acceptable" means that when the molecule itself, molecule fragment or composition is appropriately administered to an animal or a human, they do not produce adverse, allergic or other untoward reactions. Specific examples of some substances that can be used as pharmaceutically acceptable carriers or components thereof include phosphoric acid, citric acid, and other organic acids; antioxidants (e.g., ascorbic acid and methionine); antibacterial agents (e.g., octadecyldimethylbenzyl ammonium chloride, hexamethonium chloride, benzalkonium chloride, phenol, butyl or benzyl alcohol, alkylparabens, catechol, resorcinol, cyclohexanol, 3-pentanol, or m-cresol); low molecular weight (less than about 10 kDa) polypeptides; proteins, e.g., serum albumin, gelatin, or immunoglobulins; hydrophilic polymers, e.g., polyvinylpyrrolidone; amino acids (e.g., glycine, glutamine, asparagine, histidine, arginine, or lysine); monosaccharides, disaccharides and other carbohydrates (including, e.g., glucose,

[0014] The vaccine composition may be prepared from a mixture of a monohydrate (e.g., mannose, or dextran); a chelating agent (e.g., EDTA); a sugar (e.g., sucrose, mannitol, trehalose, or sorbitol); a salt-forming counterion; a metal complex; and / or a nonionic surfactant (e.g., including TWEEN™, PLURONICS™, or polyethylene glycol). Furthermore, depending on the formulation method, a person of ordinary skill in the art may appropriately select commonly used fillers, diluents, binders, wetting agents, disintegrants, and / or surfactants. The vaccine composition may be in solid, semisolid, or liquid form, preferably in liquid form.

[0067] In some embodiments, the vaccine composition further comprises a nucleic acid stabilizer.

[0068] Examples of stabilizing agents for stabilizing and maintaining nucleic acids include cationic compounds, detergents, chaotropic salts, ribonuclease inhibitors, chelating agents, and mixtures thereof. Stabilizing agents can include, for example, cross-linking fixatives such as paraformaldehyde or precipitants such as ethanol. Stabilizing agents can act by forming covalent bonds between cellular molecules or by precipitating some intracellular molecules or by other methods. In some embodiments, the stabilizer includes a cell lysis buffer. Cell permeabilization buffers are also known in the art and can contain detergents that permeabilize the cell membrane, thereby allowing probes and dyes to pass through the membrane. Examples of detergents used in cell lysis buffers include, but are not limited to, Tweeru Triton X-100, saponin, NP-40, and the like. The concentrations of cell lysis and permeabilization agents are adjusted for a given end use. When present at too low a concentration, cell lysis and permeabilization may not be optimal. At too high a concentration, undesirable cell damage may occur. Conventional empirical procedures can be performed to determine the preferred route in each case. In some embodiments, the stabilizer includes chloroform, phenol, or TRIZOL. However, in a more preferred embodiment, the stabilizer is a component that is easily removed or has low cytotoxicity, and most preferably is a pharmaceutically acceptable component.

[0069] The vaccines provided herein preferably also include an adjuvant. Suitable adjuvants for use in the vaccines of the present invention include those that enhance the immunogenicity of self-replicating mRNA, particularly target fragments thereof. For example, adjuvants that stimulate antibody responses to B cell epitopes of the antigen, and adjuvants that enhance cell-mediated responses to T cell epitopes of the antigen, are examples. These adjuvants are well known in the art.

[0070] In some embodiments, the adjuvant is selected from one or more of alum, complete Freund's adjuvant, incomplete Freund's adjuvant, squalene, squalane, muramyl dipeptide, MF59, AS03, monophosphatidyl lipid A, flagellin, CpG-ODN, Poly(I:C), and small molecules of aluminum or calcium salts. These adjuvants are well known in the art and can be obtained through several commercial channels.

[0071] Among them, complete Freund's adjuvant, incomplete Freund's adjuvant, squalane and alum are generally not used in humans.

[0072] In some embodiments, the vaccine is a water-in-oil emulsion having an aqueous phase and an oily phase.

[0073] In some embodiments, the vaccine is an oil-in-water emulsion having an aqueous phase and an oily phase.

[0074] Vaccines are typically formulated for parenteral administration. Typical immunizations are by oral and subcutaneous (SC), nasal route, intramuscular (IM), intravenous (IV), intraperitoneal (IP) or intradermal (ID) injection.

[0075] The above-mentioned vaccine is administered in a manner compatible with the dosage formulation, and in an amount such as a therapeutically effective amount and an immunogenic effective amount. The dosage depends on the subject being treated, the ability of the subject's immune system to synthesize antibodies, and the expected degree of protection. The exact amount of active ingredient to be administered depends on the physician's judgment, and the dosage varies from individual to individual. The appropriate regimen for initial administration and booster vaccination may also vary, but typically, an injection is given or administered in another manner after a certain interval (several weeks or months) after the first administration.

[0076] In some embodiments, the vaccine composition is packaged and delivered in the form of a plasmid, a viral vector, a liposome, a dendrimer, an inorganic nanoparticle, or a cell-penetrating peptide.

[0077] The mRNA molecule can be packaged directly or in the form of a precursor. The plasmid and viral vectors can contain a selection marker (e.g., a tag that facilitates enrichment, such as a his tag; or a tag that facilitates detection, such as GFP), as well as a replication origin that matches the cell type specified by the cloning vector, while the expression vector contains the necessary regulatory elements for affecting expression in the specified target cells. The viral vector can be a bacteriophage, lentivirus, retrovirus, adenovirus, or adeno-associated virus.

[0078] Liposomes can be cationic liposomes or neutral liposomes, which can be prepared or modified by known methods. For example, liposomes modified with polyethylene glycol (PEG) can effectively prevent aggregation of liposome carriers and increase their stability.

[0079] Dendrimers, a family of specialized polymers with well-defined molecular structures, precisely controlled chemical structures, and unique multivalent properties, are increasingly becoming non-viral vectors for gene delivery. Typical dendrimers include poly(amidoamine) (PAMAM) dendrimers, which can be further modified, such as by modifying the PAMAM surface with the nucleobase analog 2-amino-6-chloropurine to create AP-PAMAM derivatives or by coupling chondroitin sulfate (CS) to PAMAM to create CS-PAMAM.

[0080] Inorganic nanoparticles can be selected from gold nanoparticles (AuNPs), magnetic nanoparticles, mesoporous silica nanoparticles (MSNs), etc.

[0081] Cell-penetrating peptides (CPPs) are a class of small peptides with strong transmembrane transport capabilities that can carry a variety of macromolecules, including peptides, proteins, and nucleic acids, into cells. They can be cationic CPPs (such as TAT, Penetratin, Polyarginine, P22N, DPV3, and DPV6), amphiphilic CPPs (which can be formed by covalently linking hydrophobic peptide sequences and NLSs, or isolated from natural proteins, such as pVEC, ARF(1-22), and BPrPr(1-28)), or hydrophobic CPPs (which generally contain only non-polar amino acid residues and have a net charge of less than 20% of the total charge of the amino acid sequence).

[0082] Another embodiment of the present invention relates to a kit of parts, comprising the vaccine as described above, and a container for administering the vaccine composition.

[0083] The inoculation container is preferably a medical syringe.

[0084] The present invention also relates to methods for altering the following properties of mRNA after inoculation into an animal:

[0085] a) improving the immunogenicity of the mRNA; and / or

[0086] b) improving the ability of the mRNA to evade immune surveillance;

[0087] The method comprises the step of replacing the corresponding unmodified form of nucleosides in the mRNA with functional nucleotide analogs.

[0088] In some embodiments, the mRNA is a self-replicating mRNA, preferably a modified self-replicating mRNA as described above after replacement.

[0089] In some embodiments, the animal is a chicken, duck, goose, cat, dog, cow, sheep, horse, donkey, pig, giant panda, monkey, rabbit, mouse or human.

[0090] The embodiments of the present invention will be described in detail below with reference to the examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the invention. For experimental methods in the following examples where specific conditions are not specified, reference is made to the guidance provided in the present invention, and may also be made to experimental manuals or conventional conditions in the art, other experimental methods known in the art, or conditions recommended by the manufacturer.

[0091] In the following specific examples, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument testing accuracy or operational accuracy are allowed.

[0092] Example 1

[0093] 1. Synthesis of RBD gene fragments

[0094] The receptor binding domain (RBD) gene was designed by searching the spike protein (SARS-CoV-2) on NCBI and then optimized according to human codons. The nucleotide sequence is shown in SEQ ID NO: 1. An ApaI restriction site and promoter were added upstream, and a NotI restriction site was added downstream. Finally, the DNA sequence was directly synthesized (obtained in the form of the cloning plasmid pUC57-RBD provided by the company).

[0095] 2. Construction of TC83 self-replicating vector

[0096] The self-replicating mRNA is designed based on the genome of Venezuelan equine encephalitis virus (TC83, VEEV) in the alphavirus family. It contains genes that can encode the self-replication components of the alphavirus, but lacks the structural proteins that encode for producing infectious alphavirus particles. The designed sequence is directly obtained by synthesis, and the nucleotide sequence is shown in SEQ ID NO: 2.

[0097] 3. The preparation method of recombinant plasmid JCXH-107 is as follows (the prepared recombinant plasmid JCXH-107 is shown in Figure 1)

[0098] pUC57-RBD and the TC83 self-replicating vector were double-digested with Apa I and Not I. The digestion system (20 μL) consisted of <1 μg of pUC57-RBD or TC83 self-replicating vector, 1 μL of Apa I, 1 μL of Not I, 2 μL of 10× CutSmart buffer, and ddH₂O to a final volume of 20 μL. The plasmids were digested in a 25°C water bath for 1 hour, followed by an incubation at 37°C for 1 hour. The vector fragments were dephosphorylated by adding 0.5 μL of CIP and incubating at 37°C for 30 minutes. The digestion mixture was mixed with 6× loading buffer and subjected to electrophoresis (1% agarose gel at 94 V). Fragments of the appropriate length (2574 bp for the RBD gene fragment of pUC57-RBD and approximately 9.5 kb for the TC83 self-replicating vector) were recovered from the gel and eluted with 30 μL of elution buffer.

[0099] Separately, the RBD gene fragment and the TC83 self-replicating vector fragment were ligated using the following system: 50 ng of vector, insert: vector molar ratio = 5:1, 1 μL of T4 ligase, 5 μL of 10× ligase buffer, and ddH₂O to make up the volume to 10 μL. Ligation was performed at 22°C for 1 hour. The ligation product was gently mixed with competent E. coli DH5α cells at a volume ratio of 1:10, incubated on ice for 30 minutes, heat-shocked at 42°C for 45 seconds, and then incubated on ice for 3 minutes. 500 μL of antibiotic-free LB medium was added, mixed, and incubated at 37°C, 180 rpm, for 1 hour. The cells were then plated onto LK plates (LB-Kan plates: LB plates containing 50 μg / mL Kan) and incubated at 37°C for 16-20 hours.

[0100] PCR screening: Using the bacterial plasmid extracted by the boiling method as a template, the target spike protein was amplified with upstream primer F: 5'-TATGGCCATGACTACTCTAGCTA-3', downstream primer R: 5'-GGGAAAC GCCTGGTATCTTT-3'. The reaction cycle conditions were: 94°C 3 min → (94°C 1 min, 47°C 30 s, 72°C 3 min) × 30 cycles → 72°C 10 min → 4°C. PCR results were observed by electrophoresis (electrophoresis conditions: 1% agarose gel, 90V, sample volume: 5 μl PCR product). Expected result: RBD fragment approximately 2977 bp.

[0101] Enzyme digestion verification: plasmids were extracted from positive bacteria screened and verified by PCR, and digested with ApaⅠ and NotⅠ according to the above enzyme digestion system. The digestion mixture was mixed with 6× loading buffer and electrophoresed (1% agarose, 94V).

[0102] Sequencing verification: Plasmids that meet expectations after PCR and enzyme digestion are extracted and sent to a sequencing company for sequencing. E. coli carrying the positive plasmid that has been completely verified by sequencing are stored at -80°C.

[0103] 4. The linearization and recovery methods of JCXH-107 plasmid using BspQI enzyme are as follows

[0104] 10 μg of JCXH-107 plasmid, 1 μL of BspQI, 3.15 μL of 10× NE buffer, and ddH₂O were added to 50 μL of the system. The plasmid was digested in a 50°C water bath for 1 h. The digestion mixture was mixed with 6× loading buffer and subjected to electrophoresis (1% agarose gel, 94 V). The fragment of the corresponding length (for JCXH-107 plasmid, approximately 12 kb in length) was recovered and eluted with 30 μL of elution buffer.

[0105] 5. Linearize the JCXH-107 plasmid using T7 RNA polymerase to initiate in vitro transcription (IVT). Turbo DNase is used to degrade the template DNA, and Vaccinia capping enzyme is used to add a 7-methylguanylate cap structure (called Cap 0) to the 5' end of the transcribed mRNA. The specific method is as follows:

[0106] 2 μL of 10× reaction buffer, 0.5 mM each of NTPs, uridine (U) can be replaced with pseudouridine at a ratio of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or uridine (U) can be replaced with N1-methylpseudouridine at a ratio of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or cytidine (C) can be replaced with 5-hydroxymethoxycytidine at a ratio of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%; 1 μg of linearized JCXH-107, 2 μL of T7 RNA Polymerase, add water to 20 μL, react at 30°C for 1 hour, and then add 1 μL of TURBO TM DNase, 4 μL of 10× capping buffer, 2 μL of 10mM GTP, 2 μL of 2mM SAM, and 2 μL of capping enzyme were added to a total volume of 40 μL and reacted at 30°C for 1 hour. The volume was then made up to 200 μL and 120 μL of 7.5M lithium chloride was added and mixed. The mixture was allowed to stand at -20°C for 30 minutes, then centrifuged at 14,000 g for 30 minutes at 4°C. The supernatant was discarded, and the pellet was washed with 70% ethanol and centrifuged at 14,000 g for 5 minutes at 4°C. The supernatant was discarded, air-dried for 5 minutes, and dissolved in 40 μL of water. After spectrophotometric quantification, 400 ng of the pellet was mixed with 10 μL of Northern Max-Gly Sample Loading Dye, incubated at 50°C for 30 minutes, and subjected to electrophoresis using Northern Max-Gly Gel Prep / Running buffer (1% agarose, 70V). The electrophoresis results of the self-replicating mRNA-RBD (labeled as SAM-CD5-RBD in the figure) after in vitro transcription are shown in Figure 2, and the nucleotide sequence of the unmodified form is shown in SEQ ID NO: 3.

[0107] 6. Western blot analysis of the expression of self-replicating mRNA-RBD in cells. BHK cells purchased from the Shanghai Cell Center were subcultured. Once sufficient cells were present, they were trypsinized and plated onto each well of a 6-well cell culture plate. The plates were then plated and incubated overnight at 37°C in a CO2 incubator. The next day, liposome-encapsulated mRNA-RBD was transfected into the plated BHK cells. After 24 hours of culture, the cells were lysed and protein samples were collected. Specific methods:

[0108] 1) Cell culture and plating: The revived BHK cells were inoculated in a 75 cm 2 Incubate the cells in a culture flask containing DMEM high-glucose medium, 5% double-antibody-containing solution, and 10% fetal bovine serum. Once the cell density at the bottom of the flask reaches over 80%, trypsinize the cells and count them. Plate an appropriate number of cells in a 6-well cell culture plate and incubate them in a 37°C CO2 incubator overnight.

[0109] 2) Lipofectamine mRNA transfection of BHK or HeLa cells: Aspirate the medium from the prepared 6-well plates, wash once with PBS, mix 0.5 μg of liposome-encapsulated mRNA with 200 μL of Opti-MEM medium, add to the washed 6-well plates, and incubate at 37°C in a CO2 incubator for 6 hours. Then, supplement with 200 μL of DMEM high-glucose medium containing 20% ​​fetal bovine serum. Incubate at 37°C in a CO2 incubator for another 18 hours.

[0110] 3) Protein Sample Treatment: After 24 hours, add 200 μL of cell lysis buffer and 1% PMSF to the BHK cells. Place on ice for 5 minutes and centrifuge at 14,000 g for 5 minutes. Transfer the supernatant to a new centrifuge tube and add 5× SDS in a 95°C metal bath for 12 minutes. Store at -20°C until ready for use.

[0111] 4) Western blot detection:

[0112] Electrophoresis: The concentration of polyacrylamide separation gel was 6%, the protein loading volume was 20 μL, the stacking gel electrophoresis conditions were 150 V, 10 min, and the separation gel electrophoresis conditions were 200 V, 30 min.

[0113] Electrotransfer: Use nitrocellulose membrane and transfer at 100V for 1 hour.

[0114] Blocking: Prepare 5% BSA in 1×PBST as blocking solution and block overnight at 4°C.

[0115] Primary antibody incubation: Dilute SARA-Cov-2 (2019-nCov) spike protein antibody at 1:2000 in blocking buffer and incubate at room temperature for 1 hour. Wash three times with 1× PBST, 10 minutes each time.

[0116] Secondary antibody incubation: Dilute the secondary antibody in blocking buffer at a dilution ratio of 1:5000 and incubate at room temperature for 1 hour. Wash three times with 1× PBST, 10 minutes each time.

[0117] Development: Developing solution A:B = 1:1, and development is performed in an imaging system.

[0118] The experimental results are shown in Figures 3-1 and 3-2. Figures 3-1 and 3-2 are graphs comparing the RBD protein expression of modified nucleotide and conventional nucleotide self-replicating mRNA-RBD (labeled as SAM-CD5-RBD in the figures) after in vitro transfection of BHK cells, including the expression detection of RBD protein in cell lysate and cell supernatant, where Actin protein was used as an internal reference in the cell lysate and protein Coomassie staining was used as an internal reference in the cell supernatant; Figure 4 is a quantitative statistical graph of RBD protein in cell lysate in Figures 3-1 and 3-2. It can be seen from Figures 3-1, 3-2 and 4 that the RBD protein expression is good after self-replicating mRNA-RBD is transfected into BHK cells in vitro.

[0119] 7. The present invention uses real-time fluorescence quantitative PCR to detect the transcription level of the innate immune regulator IFN-B1 after in vitro transfection of Hela cells with mRNA-RBD obtained by in vitro transcription reaction using modified nucleotides and conventional nucleotides (labeled as SAM-CD5-RBD in the figure). The specific method is as follows:

[0120] 1) Cell RNA Extraction: Aspirate the cell culture medium, wash the cells once with PBS, add 1 mL of RNAiso, pipette around the cells, and collect in an EP tube. Add 0.2 mL of chloroform, vortex to mix, let stand for 5 minutes, centrifuge at 12,000 g for 15 minutes, and aspirate the supernatant. Add an equal volume of isopropanol to the supernatant, vortex to mix, and let stand at room temperature for 10 minutes. Centrifuge at 12,000 g for 10 minutes and discard the supernatant. Add 1 mL of 75% ethanol in Nuclease-Free Water to wash the pellet. Centrifuge at 12,000 g for 5 minutes and discard the supernatant. Air dry the pellet, add 20 μL of Nuclease-Free Water, and gently pipette to dissolve the pellet. Measure the OD260 / OD280 value and RNA concentration using a UV spectrophotometer.

[0121] 2) Preparation of cDNA samples: 1.5 μg RNA sample was added to 5×g DNA Digester Mix and Nuclease-Free water to make up to 15 μL, and incubated at 42°C for 2 minutes. III Super Buffer 2μL, Mix 1 μL of III RT Enzyme Mix, 1 μL of Random Primers N6, and 1 μL of Nuclease-Free Water, and proceed with the reverse transcription reaction. The reverse transcription program is: 25°C for 5 min; 60°C for 15 min; and 85°C for 5 min.

[0122] 3) Real-time fluorescence quantitative PCR detection: The cDNA sample was diluted 5-fold and the reaction system was prepared: 5 μL of 2× ChamQ Universal SYBR qPCR Master Mix, 0.2 μL of 10 μM upstream primer, 0.2 μL of 10 μM downstream primer, 1 μL of diluted cDNA sample, and 3.6 μL of Nuclease-Free water. Mix well and detect. The upstream primer sequence for detecting IFN-B1 gene expression was CA TTACCTGAAGGCCAAGGA, and the downstream primer sequence was CAGCATCTGCTGGTTGA AGA. The upstream primer sequence for detecting internal control GAPDH gene expression was GAAGGCTGGG GCTCATTT, and the downstream primer sequence was CAGGAGGCATTGCTGATGAT. The upstream primer sequence for detecting RI GI gene expression was GTTGTCCCCATGCTGTTCTT, and the downstream primer sequence was GCAAGTCTTACATGGCAGCA. Detection was performed using the Thermo Fisher Quant Studio 1 Real-time Fluorescence Quantitative PCR System. The detection procedure is as follows: stage 1: 95°C, 3 min, repeated once; stage 2: 95°C, 10 s, 60°C, 30 s, repeated 40 times; stage 3 melting curve: 95°C, 15 s; 60°C, 60 s; 95°C, 15 s, repeated once. The relative quantitative method was used to analyze the expression of the target gene: fold change = 2 -ΔΔCT5 , as a positive control, 100% pseudouridine-modified non-self-replicating mRNA-RBD and 100% N1-methyl pseudouridine-modified non-self-replicating mRNA-RBD transfected cells hardly stimulated the high expression of the natural immune regulatory factor IFN-B1 gene; while conventional nucleotide-modified self-replicating mRNA-RBD transfected cells stimulated high expression of IFN-B1; compared with conventional nucleotide-modified self-replicating mRNA-RBD, 10%, 20%, and 30% pseudouridine-modified self-replicating mRNA-RBD transfected cells can reduce the stimulation of IFN-B1, and with the increase of the modified nucleotide ratio, the IFN-B1 reduction is more obvious, and the modified nucleotide has little effect on the translation of RBD protein; 10%, 20%, and 30% N1-methyl pseudouridine-modified self-replicating mRNA-RBD transfected cells also have the effect of reducing the high expression of IFN-B1. The results showed that the expression of IFN-B1 gene was significantly inhibited after transfection of cells with 100% pseudouridine-modified self-replicating mRNA-RBD and 100% N1-methylpseudouridine-modified self-replicating mRNA-RBD, while the expression of IFN-B1 gene was significantly inhibited after transfection of cells with 100% 5-methylcytidine-modified self-replicating mRNA-RBD. However, the effect of 100% 5-methylcytidine-modified self-replicating mRNA-RBD was not as good as that of 30% pseudouridine-modified self-replicating mRNA-RBD, and the effect of 10% pseudouridine-modified self-replicating mRNA-RBD on RBD protein translation was not significant. A comprehensive comparison of the effects of different types and degrees of nucleotide modifications on IFN-B1 gene expression and RBD protein translation showed that 30% pseudouridine-modified self-replicating mRNA-RBD had a better inflammatory gene inhibitory effect than conventional nucleotide-modified self-replicating mRNA-RBD and retained a better RBD protein translation expression.

[0123] 8. The steps for mRNA-RBD and lipid packaging are as follows.

[0124] mRNA is rapidly mixed with lipids (including 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG-PEG2000), cholesterol, distearoylphosphatidylcholine (DSPC), and cationic lipids dissolved in alcohol) using a Nanoassembly mixer, causing lipid precipitation and mRNA encapsulation within the LNPs through charge interaction. The mRNA-RBD-LNP complex is then concentrated and the solution exchanged to the formulation solution.

[0125] 9. Detection of anti-spike protein antibody titers induced by mRNA-RBD-LNP vaccine in mice

[0126] 6-8 week old BALB / c female mice were adaptively fed for 3 days and then divided into groups, with 6 mice in each group. One group was the control group and was injected with preparation buffer; the other ten groups were injected with conventional nucleotide self-replicating mRNA-RBD-LNP, 10%, 20%, and 30% pseudouridine-modified self-replicating mRNA-RBD-LNP, 10%, 20%, and 30% N1-methylpseudouridine-modified self-replicating mRNA-RBD-LNP, 100% 5-methylcytidine-modified self-replicating mRNA-LNP, 100% pseudouridine-modified non-self-replicating mRNA-RBD-LNP, and 100% N1-methylpseudouridine-modified non-self-replicating mRNA-RBD-LNP. Each mouse was injected with 3 μg mRNA-RBD-LNP via the spine on day 0, and the spleens of the three mice in each group were harvested on day 2 to detect IFN-B1 expression. The results are shown in Figure 6 . The remaining three mice in each group were serum-collected on days 7 and 14. Each mouse was injected with a second dose of 3 μg mRNA-RBD-LNP via the spine, and then the serum was collected on days 21 and 28, respectively, and the RBD antibody titer was detected by ELISA. The experimental process and design are shown in Figure 7 .

[0127] Antibody titer was determined by ELISA. Each well of a 96-well microtiter plate was coated with 50 ng of the spike protein RBD domain protein at room temperature overnight. The next day, the plate was washed three times with PBST, blocked with 5% milk, incubated at 37°C for 1 hour, and then washed three times with PBST. Mouse serum at the corresponding dilution ratio was added. The plate was incubated at 37°C for 1 hour, then washed three times with PBST. Anti-mouse IgG heavy chain-light chain HRP was added. The plate was incubated at 37°C for 1 hour, then washed three times with PBST. Finally, a colorimetric solution was added for color development. The experimental results are shown in Figure 8. Mice injected with 100% pseudouridine-modified non-self-replicating mRNA-RBD-LNPs and 100% N1-methylpseudouridine-modified non-self-replicating mRNA-RBD-LNPs had higher levels of RBD-specific antibodies in their serum. Among the self-replicating mRNA-RBD-LNPs, mice injected with 30% pseudouridine-modified self-replicating mRNA-RBD-LNPs had higher levels of RBD-specific antibodies in their serum.

[0128] From the results of the above examples, it can be seen that the self-replicating mRNA obtained by nucleotide modification using the method of the present invention can be well expressed in cells and can induce a good antibody response in animals.

[0129] Example 2

[0130] Based on Example 1, the modification type was changed to m 6 A. Briefly:

[0131] 1. Experimental Methods

[0132] 1. Cell-level detection

[0133] 1.1 This experiment uses the SrRNA-TC83 self-replicating mRNA system, with the insert being the RBD;

[0134] 1.2 In vitro synthesis of m 6 A modified self-replicating mRNA: design and synthesis of different m 6 A modification ratio of self-replicating mRNA: 0%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%;

[0135] 1.3 Cell transfection: This experiment used BHK and Hela cell lines for transfection using Lipofectamine liposome transfection reagent with a transfection dose of 0.5 μg and samples were collected after 24 hours.

[0136] 1.4 Result detection: Western blot was used to detect changes in RBD protein expression levels in BHK and Hela cells, and to detect changes in IFN-B1 and / or RIG-I gene expression in Hela cells.

[0137] 2. Animal Experiments

[0138] 2.1 Using LNP to wrap different proportions of m 6 A modified self-replicating mRNA for animal experiments;

[0139] 2.2 Using SrRNA-TC83 as a vector, the expression of hEPO (human erythropoietin) and luciferase gene proteins was detected in animal experiments;

[0140] 2.3 LNP-hEPO-mRNA animal experiments were performed using intravenous injection, while LNP-Luciferase-mRNA animal experiments were performed using intramuscular injection.

[0141] 2.4 The in vivo expression of hEPO protein was detected by WB, and the in vivo expression of Luciferase protein was detected by fluorescence imaging.

[0142] 2. Experimental results:

[0143] 1. Cell-level experiments

[0144] 1.1 RBD protein expression is at a specific ratio (e.g., less than 20%, or less than 10%, or less than 5%) 6 The expression of A was basically unaffected or significantly increased under the modification, and the results are shown in Figures 9 and 10; in Figure 9, A and C are the protein expressions in the cell lysate, and B and D are the protein expressions in the supernatant. It can be seen that less than 10% of m6 A modification did not significantly reduce the expression of RBD. The results of WB detection of RBD expression are shown in Figure 10. It can be seen from the figure that 1% and 5% m 6 A modification does not disrupt RBD expression.

[0145] 1.2 The expression results of IFN-B1 gene are shown in Figure 11. 6 A modification can effectively reduce IFN-B1 expression.

[0146] 2. Animal level experiments

[0147] 2.1 Luciferase fluorescence signal at a specific ratio m 6 Under A modification, the signal is enhanced;

[0148] 2.2 hEPO protein expression at a specific ratio m 6 Under A modification, protein expression increased and the expression of inflammatory genes in mice was significantly decreased.

[0149] From the above, we can see that m 6 A modified self-replicating mRNA has little effect on protein expression, or may have a promoting effect; m 6 A modified self-replicating mRNA can effectively reduce the expression of inflammatory genes.

[0150] The above-described embodiments merely represent several implementation methods of the present invention, and their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the patent. It should be noted that a person skilled in the art may make several modifications and improvements without departing from the concept of the present invention, and these modifications and improvements fall within the scope of protection of the present invention. Therefore, the scope of protection of the patent for this invention shall be based on the appended claims, and the description and drawings may be used to interpret the content of the claims.

Claims

1. A modified self-replicating mRNA, wherein the polynucleotide segment comprises one or more nonstructural replicase domains from an alphavirus and an integrated target segment, wherein the polynucleotide segment comprises a functional nucleotide analog; The functional nucleotide analogs include: Pseudouridine, N1-methylpseudouridine, 5-hydroxymethoxycytidine and N 6 -At least one of methyladenosine.

2. The modified self-replicating mRNA according to claim 1, wherein the uridine in the unmodified form of the polynucleotide fragment is modified to pseudouridine at a ratio of 1% to 100%, or 1% to 50%, or 10% to 50%, or 20% to 40%, or 25% to 35%.

3. The modified self-replicating mRNA according to claim 1, wherein the uridine in the unmodified form of the polynucleotide fragment is modified to N1-methylpseudouridine at a ratio of 1% to 100%, or 1% to 60%, or 10% to 60%, or 10% to 20%.

4. The modified self-replicating mRNA according to claim 1, wherein the cytidine in the unmodified form of the polynucleotide fragment is modified to 5-hydroxymethoxycytidine at a ratio of 1% to 100%, or 80% to 100%, or 90% to 100%.

5. The modified self-replicating mRNA according to claim 1, wherein the adenosine in the unmodified form of the polynucleotide fragment is modified to N at a ratio of 1% to 100%, or 1% to 10%. 6 -methyladenosine.

6. The modified self-replicating mRNA according to any one of claims 1 to 5, wherein the target fragment comprises at least one mRNA encoding an antigen or a fragment or epitope thereof, preferably the antigen is a pathogenic antigen, more preferably the antigen is a viral antigen, bacterial antigen, parasitic antigen, fungal antigen, protozoan antigen, prion antigen or tumor antigen.

7. The modified self-replicating mRNA according to claim 6, wherein the target fragment is an mRNA derived from SARS-CoV-2, preferably a spike protein mRNA or a fragment thereof, more preferably comprising an RBD gene or a fragment thereof.

8. The modified self-replicating mRNA according to any one of claims 1 to 5 and 7, wherein the alphavirus is selected from at least one of Venezuelan Equine Encephalitis Virus (VEEV), Sindbis virus, Chikungunya virus, Eastern equine encephali-tis virus, Western equine encephalitis virus, Mayarovirus, Semliki forest virus, and Venezuelan equine encephalitis virus. 9 . The modified self-replicating mRNA according to claim 8 , wherein the nucleotide sequence of the unmodified mRNA is shown in SEQ ID NO:

3.

10. A vaccine composition comprising the modified self-replicating mRNA according to any one of claims 1 to 9. The vaccine composition according to claim 10 , further comprising at least one of a pharmaceutically acceptable carrier, a diluent and an excipient.

12. The vaccine composition according to claim 10, further comprising a nucleic acid stabilizer and / or an immune adjuvant.

13. The vaccine composition according to any one of claims 10 to 12, which is packaged and delivered in the form of plasmids, viral vectors, liposomes, dendrimers, inorganic nanoparticles or cell-penetrating peptides.

14. A kit of parts comprising the vaccine composition according to any one of claims 10 to 12, and optionally a container for vaccination with the vaccine composition.

15. A method for altering the following properties of mRNA after inoculation into an animal: a) improving the immunogenicity of the mRNA; and / or b) improving the ability of the mRNA to evade immune surveillance; The method comprises the step of replacing the corresponding unmodified form of nucleosides in the mRNA with functional nucleotide analogs.

16. The method according to claim 15, wherein the mRNA is a self-replicating mRNA, and preferably the modified self-replicating mRNA according to any one of claims 1 to 9 is obtained after the replacement.

17. The method according to claim 15 or 16, wherein the animal is a chicken, duck, goose, cat, dog, cow, sheep, horse, donkey, pig, giant panda, monkey, rabbit, mouse or human.

Images