Messenger RNA vaccines targeting dengue virus proteins

Abstract

Disclosed is a construct for preventing antibody-dependent enhancement of dengue virus infection, comprising: (a) a ribonucleic acid encoding a non-structural protein of a dengue virus wherein each of the uridine residues of the ribonucleic acid encoding a non-structural protein of a dengue virus is replaced with pseudouridine; (b) a 7-methylguanylate cap; (c) a 5' untranscribed region preferably comprising a kozak consensus ribonucleic acid sequence; (d) a 3' untranscribed region; and (e) a poly A tail and a method for using the construct to prevent antibody-dependent enhancement of dengue virus infection

Description

DESCRIPTIONTITLE OF INVENTION: [MESSENGER RNA VACCINES TARGETING DENGUE VIRUS PROTEINS]REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the priority to Singapore patent application No. 10202303427Q, filed 5 December 2023, the contents of which are incorporated herein by reference.TECHNICAL FIELD

[0002] The present disclosure relates generally to nucleic acid constructs that can be used to prevent Dengue viral infection or particularly nucleic acid constructs that can be used to prevent antibody-dependent enhancement of dengue virus infection.BACKGROUND

[0003] The following discussion of the background to the invention is intended to facilitate an understanding of the present invention only. It should be appreciated that the discussion is not an acknowledgement or admission that any of the material referred to was published, known or part of the common general knowledge of the person skilled in the art in any jurisdiction as at the priority date of the invention.

[0004] Dengue is emerging as a global public health threat with an estimated 400 million human infections and several hundred thousand cases of severe dengue occurring yearly (Bhatt et al. 2013, Nature 496 (7446): 504-507). Dengue virus (DENV) is a single-stranded positivesense RNA virus, a member of the Flaviviridae family, that has ~11 kb genome encoding three structural proteins Capsid (C), pre-Membrane (prM) and Envelope (E), and seven non-structural (NS) proteins NS1 , NS2A, NS2B, NS3, NS4A, NS4B and NS5 (Fig. 1). Infection with any of the 4 related viral serotypes (DENV1-4) causes a variety of clinical manifestations ranging from selflimiting febrile illness, known as dengue fever (DF), to the life-threatening severe diseases, such as dengue hemorrhagic fever (DHF) or dengue shock syndrome (DSS), characterized by vascular leakage, thrombocytopenia, bleeding and elevated levels of cytokines (Simmons et al. 2012, N Engl J Med 366 (15): 1423-1432). The unique feature of dengue is that severe dengue diseases are often associated with secondary heterotypic infection of one of the four DENV serotypes (DENV1-4). Preexisting cross- reactive antibodies (Abs) or neutralizing Abs at suboptimal concentrations contribute to enhanced DENV infection through the phenomenon termed “antibody-dependent enhancement (ADE) of infection”. In this scenario, any dengue vaccines that are designed to induce neutralizing Abs carry a potential risk of ADE which has hampered the development of universally acceptable dengue vaccines.

[0005] There are currently two vaccines commercially available, Dengvaxia (CYD-TDV) and QDENGA (TAK-003). Dengvaxia, a live-attenuated tetravalent chimeric vaccine comprising the structural proteins (E and prM) from the four DENV serotypes based on a yellow fever 17D vaccine backbone (Hadinegoro et al. 2015, N Engl J Med 373 (13): 1195-1206), is the first licensed vaccine and has been used in 20 dengue-endemic countries. A randomized phase 3 clinical Trial of Dengvaxia revealed that the vaccination produced only serotype-specific Abs neutralizing against DEN 4, and at the same time, DEN 1 , 2 and 3 were neutralized by cross- reactive antibodies, indicating that the immunodominance inclines toward DENV4 (Henein et al. 2017, J Infect Dis 215 (3): 351-358). This trend in immunodominance was also supported by the different rates of viral replication of vaccine components, of which vaccine DENV1-4 were detected in 7%, 0%, 12% and 44% of dengue-naive individuals, respectively (Henein et al. 2017, J Infect Dis 215 (3): 351-358), raising the potential risk for ADE especially when infected with DENV2. A pediatric phase 3 trial conducted in a cohort of 9-16 years old children revealed that the efficacy against symptomatic DENV3 and DENV4 infection was higher (74.0% and 77.0%, respectively) than for DENV1 and DENV2 infection (50.3% and 42.3%, respectively), confirming that the vaccine efficacy varies between serotypes (Villar et al. 2015, N Engl J Med 372 (2): 113- 123). Furthermore, the vaccine efficacy was shown to be age-dependent and importantly, dengue-naive children under 9 years revealed a 1.58-fold higher risk of developing severe dengue following natural infection compared with children who had not received vaccination (Hadinegoro et al. 2015, N Engl J Med 373 (13): 1195-1206). Thus, following the risk of developing severe dengue in dengue-naive individuals, the use of Dengvaxia is mostly limited to individuals who have experienced prior DENV infection (Redoni et al. 2020, Rev Med Virol 30 (4): e2101). QDENGA is a recently licensed live attenuated tetravalent vaccine comprising prM and E proteins from DENV1-4 strains based on a DENV-2 backbone (Huang et al. 2013, Rev Med Virol 30 (4): e2101). Data from the phase 3 clinical trial at 18 months post- vaccination revealed that the vaccine efficacy against symptomatic infection was 76.1% in dengue seropositive individuals and 66.2% in seronegative individuals, while the overall efficacy against dengue requiring hospitalization was 90.4 % (Biswal et al. 2020, PLoS Negl Trap Dis 7 (5): e2243). The highest efficacy against symptomatic infection was observed in DENV2 infection (95.1%) and the lowest in DENV3 (48.9%), indicating that the vaccine-induced immunity biases toward DENV2 probably due to the induction of T cell immunity targeting the DENV2 backbone of this vaccine. The cumulative efficacy data at 3 years post-vaccination showed decreased overall efficacy of 62% for symptomatic infection and 83.6% for severe dengue (Rivera et al. 2022, Clin Infect Dis 75 (1): 107-117). It is notable that in dengue-naive individuals, the efficacy was only observed against following DENV1 (43.5%) and DENV2 (91 .9%) infection, but not against DENV3 infection (Rivera et al. 2022, Clin Infect Dis 75 (1): 107-117). Thus, although the tendency to develop severe dengue after immunization following natural DENV infection has not been reported, a reduction of vaccine efficacy over time evokes the possible risk of ADE when the neutralizing activity isfurther weakened in the future. In addition, several DENV vaccines including live attenuated viruses, inactivated viruses, DNA targeting E and prM, and recombinant E peptides are undergoing different phases of clinical trials (Torres-Flores et al. 2022, .BioDrugs 36 (3): 325-336). Currently all vaccines under clinical investigations are designed to produce DENV neutralizing Abs, therefore, the risk of ADE cannot be completely excluded.

[0006] ADE has been a major obstacle to develop DENV vaccines. Although two dengue vaccines are commercially available and several vaccines are under clinical evaluation at present, all these vaccines are designed to induce neutralizing Abs. Although the production of neutralizing Abs is expected to prevent infection, it is also conceivable that it promotes disease severity when the neutralizing antibody titer is not high enough to control infection.

[0007] Gonpalves et al generated DNA vaccines that comprise DENV2 NS1 gene and showed that this vaccines can induce T cell responses against NS1 and prolong survival of mice infected with a mouse-adapted neurotropic DENV2 strain (Goncalves et al. 2015, PLoS Negl Trop Dis 9 (12): e0004277). The interpretative limitation of this study is that mice died of neurological diseases, which is not relevant to human dengue infection, therefore, the vaccine efficacy in terms of prevention of dengue diseases cannot be assessed accurately. Roth et al generated mRNA vaccines that comprise T cell epitopes specific to HLA-A*0201, -A*2402, -B*0702, and -B*3502 class I alleles located in the DENV1 NS3, NS4B and NS5 (Roth et al. 2019, Front Immunol 10: 1424). The efficacy was tested in HLA-A*0201 , -A*2402, -B*0702, and -B*3501 transgenic mice and showed that viremia can be reduced by the vaccination. However, the use of this vaccine is limited to individuals who have HLA-A*0201 , -A*2402, -B*0702, and -B*3501.

[0008] During the recent COVID-19 pandemic, the first-ever messenger RNA vaccines were shown to be safe and highly effective in humans and furthermore, highlighted a previously unappreciated / underestimated contribution of T cell immunity following vaccination.

[0009] There exists a need to have a vaccine that can be used to prevent, reduce or minimize antibody-dependent enhancement of dengue virus infection and alleviate at least one of the aforementioned problems.SUMMARY

[0010] A nucleic acid construct that can be used in a method of preventing antibody-dependent enhancement of dengue virus infection is envisaged.

[0011] Accordingly, an aspect of the invention refers to a construct for preventing antibodydependent enhancement of dengue virus infection, comprising: (a) a ribonucleic acid encoding a protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particleswherein each of the uridine residues of the ribonucleic acid encoding a protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particles wherein each of the uridine residues of the ribonucleic acid encoding the protein or part thereof is replaced with pseudouridine or N1-methyl pseudo-uridine; (b) a 7-methylguanylate cap; (c) a 5’ untranscribed region preferably comprising a kozak consensus ribonucleic acid sequence; (d) a 3’ untranscribed region; and (e) a poly A tail.

[0012] According to another aspect of the invention there is a construct as described herein above for use in preventing antibody-dependent enhancement of dengue virus infection.

[0013] According to another aspect of the invention there is use of a construct as described herein above in the manufacture of a vaccine for preventing antibody-dependent enhancement of dengue virus infection.

[0014] According to another aspect of the invention there is a method of preventing antibodydependent enhancement of dengue virus infection in an individual comprising: inducing T cell responses by administering a construct for preventing antibody-dependent enhancement of dengue virus infection, the construct comprising: (i) a ribonucleic acid encoding a protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particles wherein each of the uridine residues of the ribonucleic acid encoding a protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particles is replaced with pseudouridine or N1-methylpseudo-uridine; (ii) a 7-methylguanylate cap; (ill) a 5’ untranscribed region preferably comprising a kozak consensus ribonucleic acid sequence; (iv) a 3’ untranscribed region; and (v) a poly A tail.

[0015] Other aspects and features of the present invention will become apparent to those of ordinary skill in the art upon review of the following description of specific embodiments of the invention in conjunction with the accompanying figures.BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In the figures, which illustrate, by way of non-limiting examples only, embodiments of the present invention,

[0017] [Fig. 1]: Known DENV structural and non-structural proteins

[0018] [Fig. 2]: Diagram of DENV2-nonstructural protein mRNA vaccines.

[0019] [Fig. 3]: Effect of immunization with DENV2 NS3 mRNA vaccines upon subsequent DENV2 challenge in AG129 and A129 mice. (A) DENV2 NS3 mRNA vaccines were immunized intraperitoneally in AG129 and A129 mice using Polyplus in v / Vo-jet RNA kit.EDEN2 was also non-lethally infected in mice for control. Following a 1-time booster at 3 weeks post-immunization, mice were challenged intravenous with EDEN2 (5 x 107pfu) in the presence of enhancing Abs (4G2) at 6 weeks post-immunization. In parallel, spleen samples were harvested from mice without receiving challenge infection for ELISPOT assay. (B) Spleen cells harvested from unvaccinated (No Vac), CF18-NS3 mRNA vaccinated (CF18-NS3) and EDEN2 (DENV2) infected mice were stimulated with DEN 2 NS3 pooled peptides and their IFN-y productions were visualized by ELISPOT assay. Average spot counts obtained from peptide stimulation (triplicate) are displayed. (C and D) Survival rate and viremia after EDEN2 challenge for AG129 mice (C) and A129 mice (D) were shown. Mouse survival rate was monitored until day 10 after immunization. Blood samples were collected until day 3 after immunization (AG129 mice) or day 4 after immunization (A129 mice) and subjected to real-time RT-PCR to viral genome copy numbers in blood (viremia).

[0020] [Fig. 4]: Protective efficacy of 3 types of DENV2 NS3 mRNA vaccines in A129 mice. A129 mice were immunized with 3 DENV2 NS3 mRNA vaccines (NS3, CF18-NS3 and CF47-NS3) and lethally challenged with EDEN2 as described. Mouse survival rate (A) and viremia (B) are shown. The average spot counts obtained from peptide stimulation (triplicate) conducted as described were displayed in the table (C).

[0021] [Fig. 5]: Cross-reactive effect of immunization with DENV2 NS3 mRNA vaccine upon subsequent DENV1 challenge in A129 mice. (A) A clinical strain of DENV1 (EDEN1) was inoculated intravenously in adult A129 mice and AG129 mice in the presence of enhancing Antibody (50 pl 4G2). Mouse survival rate was monitored until day 10 post-immunization. (B and C) A129 mice were immunized with DENV2 NS3 mRNA and challenged intravenously with EDEN1 (5 x 106pfu) in the presence of 4G2 at 6 weeks post-immunization as described. Mouse survival rate (B) and viremia (C) are shown.

[0022] [Fig. 6]: Protective efficacy of vaccination at different amount of DENV2 NS3 mRNA. DENV2 NS3 mRNA construct was immunized in A129 mice at 10pg and 1pg (A and B) or 1 pg, 0.1 pg and O.OI pg (C and D) and challenged intravenously with DENV2 as described in [Fig. 3A], Survival rate and viremia after DENV2 challenge were shown.

[0023] [Fig. 7]: Vaccine efficacy of NS3 mRNA mixed with GFP mRNA. (A) 0.5pg of DENV2 NS3 mRNA construct was injected intraperitoneally in A129 mice in the presence or absence of 10pg GFP mRNA construct. Mice were non-lethally challenged intravenously with DENV2 (1 x 106pfu) at 6 weeks post-immunization. (B) Viremia after DENV2 challenge were analyzed until day 5 post-immunization.

[0024] [Fig. 8]: Vaccine efficacy of NS1 mRNA and hlgE-NS1 mRNA. Mice were immunized intraperitoneally with 10pg of DENV2 NS1 mRNA (NS1) or hlgE-NS1 mRNA (hlgE-NS1) and lethal ly challenged intravenously with DENV2 at 6 weeks post-immunization. Mouse survival (A) and viremia (B) after DENV2 challenge were shown. Production of NS1 Antibody at 3- and 6-week post-vaccination (C) and serum NS1 levels after challenge infection (D) were analysed by ELISA. Serum samples collected from mice non-lethally infected with DENV2 were used as control.

[0025] [Fig. 9]: Protective efficacy of DENV2 NS4A and NS4B mRNA vaccines in mice. A129 mice were immunized with 5.4pg of NS4A mRNA or 9.0pg of NS4B mRNA construct and lethally challenged with EDEN2 as described in [Fig. 3A], Mouse survival rate (A) and viremia (B) are shown. Spleen cells harvested from 2 unvaccinated (No Vac) and 3 NS4B mRNA vaccinated mice were stimulated with DENV2 NS4B pooled peptides and their IFN-g productions were visualized by ELISPOT assay. Average spot counts obtained from peptide stimulation were displayed in the table (C).

[0026] [Fig. 10]: Protective efficacy of DENV2 NS5 mRNA vaccine in mice. A129 mice were immunized with 14.2pg of NS5 construct and lethally challenged with EDEN2 as described in [Fig. 3A]. Mouse survival rate (A) and viremia (B) are shown. Spleen cells harvested from 2 unvaccinated (No Vac) and 3 NS5 mRNA vaccinated mice were stimulated with DENV2 NS5 pooled peptides and their IFN-g productions were visualized by ELISPOT assay. Average spot counts obtained from peptide stimulation were displayed in the table (C).

[0027] [Fig. 11]: Protective efficacy of DENV2 NS5-MTase and NS5-RdRp mRNA vaccines in mice. A129 mice were immunized with 4.5pg of NS5-MTase mRNA or 10pg of NS5- RdRp mRNA construct and lethally challenged with EDEN2 as described in [Fig. 3A], Mouse survival rate (A) and viremia (B) are shown. Spleen cells harvested from 2 unvaccinated (No Vac) and 3 NS5-MTase mRNA or NS5-RdRp vaccinated mice were stimulated with pooled peptides of NS5-MTase or NS5-RdRp, respectively, and their IFN-g productions were visualized by ELISPOT assay. Average spot counts obtained from peptide stimulation were displayed in the table (C).

[0028] [Fig. 12]: Development process of a mRNA vaccine targeting all 4 DENV serotypes. Schematic depiction (A) and flow chart (B).DETAILED DESCRIPTION

[0029] Throughout this document, unless otherwise indicated to the contrary, the terms “comprising”, “consisting of’, “having” and the like, are to be construed as non-exhaustive, or in other words, as meaning “including, but not limited to”.

[0030] Furthermore, throughout the document, unless the context requires otherwise, the word “include” or variations such as “includes” or “including” will be understood to imply the inclusionof a stated integer or group of integers but not the exclusion of any other integer or group of integers.

[0031] Unless defined otherwise, all other technical and scientific terms used herein have the same meaning as is commonly understood by a skilled person to which the subject matter herein belongs.

[0032] New mRNA vaccines that express DENV proteins of a dengue virus or part thereof that do not induce antibodies that bind to virus particles, have been designed. Although these vaccines neither produce neutralizing antibodies nor prevent infection, they are expected to induce T cell immunity and prevent progression to severe dengue diseases without any concern for antibodydependent enhancement (ADE) of infection.

[0033] According to various embodiments there is a construct for preventing antibodydependent enhancement of dengue virus infection, comprising: (a) a ribonucleic acid encoding a protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particles, wherein each of the uridine residues of the ribonucleic acid encoding a protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particles is replaced with pseudouridine or N1-methylpseudo-uridine; (b) a 7-methylguanylate cap; (c) a 5’ untranscribed region preferably comprising a kozak consensus ribonucleic acid sequence; (d) a 3’ untranscribed region; and (e) a poly A tail.

[0034] Throughout the description, it is to be appreciated that the term ‘protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particles’ include proteins or part of proteins that do not naturally induce generation of antibodies in humans or other mammals that bind to a Dengue virus particle. In various embodiments the protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particles comprises any one of a Capsid, NS1 , NS2A, NS2B, NS3, NS4A, NS4B, NS5 encoded by a Dengue virus or any combinations of these. In various embodiments the part of a protein of a dengue virus that does not induce antibodies that bind to virus particles may include an mRNA expressing at least 18- 50, or at least 18, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80 amino acids of a Capsid protein. In various embodiments the part of a protein of a dengue virus that does not induce antibodies that bind to virus particles may include an mRNA expressing at least 18-50, or at least 18, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80 amino acids of a NS1 protein. In various embodiments the part of a protein of a dengue virus that does not induce antibodies that bind to virus particles may include an mRNA expressing at least 18-50, or at least 18, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80 amino acids of a NS2A protein. In various embodiments the part of a protein of a dengue virus that does not induce antibodies that bind to virus particles may include an mRNA expressing at least 18-50, or at least 18, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80 amino acids of a NS2B protein. In various embodimentsthe part of a protein of a dengue virus that does not induce antibodies that bind to virus particles may include an mRNA expressing at least 18-50, or at least 18, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80 amino acids of a NS3protein. In various embodiments the part of a protein of a dengue virus that does not induce antibodies that bind to virus particles may include an mRNA expressing at least 18-50, or at least 18, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80 amino acids of a NS4A protein. In various embodiments the part of a protein of a dengue virus that does not induce antibodies that bind to virus particles may include an mRNA expressing at least 18-50, or at least 18, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80 amino acids of a NS4B protein. In various embodiments the part of a protein of a dengue virus that does not induce antibodies that bind to virus particles may include an mRNA expressing at least 18-50, or at least 18, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80 amino acids of a NS5 protein. In various embodiments the protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particles comprises a non-structural protein selected from the group comprising or consisting of NS1 , NS2A, NS2B, NS3, NS4A, NS4B, NS5 encoded by a Dengue virus or any combinations of these. In various embodiments the protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particles, or non-structural protein comprises a chimera which is a combination of at least two different proteins of a dengue virus or part thereof that does not induce antibodies that bind to virus particles. In various embodiments the protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particles comprises a Capsid, encoded by a Dengue virus. In various embodiments the protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particles or non-structural protein comprises NS1 , encoded by a Dengue virus. In various embodiments the protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particles or non-structural protein comprises NS2A, encoded by a Dengue virus. In various embodiments the protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particles or non-structural protein comprises NS2B, encoded by a Dengue virus. In various embodiments the protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particles or non-structural protein comprises NS3, encoded by a Dengue virus. In various embodiments the protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particles or non-structural protein comprises NS4A, encoded by a Dengue virus. In various embodiments the protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particles or non-structural protein comprises NS4B, encoded by a Dengue virus. In various embodiments the protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particles, or non-structural protein comprises NS5 encoded by a Dengue virus. In various embodiments the protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particles, or non-structural protein comprises a NS3-NS2B chimera which is a combination of NS3, and residues of NS2B that facilitate folding of NS3 when encoded by a Dengue virus. In various embodiments the protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particles, or non-structural protein comprises a NS3-NS2B chimera which is a combination of NS3, and residues of NS2B that encode a protease activity of a Dengue virus. In various embodiments the protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particles, or non-structural protein comprises a NS2A-NS2B chimera which is a combination of NS2A, and residues of NS2B that encode a protease activity of a Dengue virus. In various embodiments the protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particles or non-structural protein comprises a nucleic acid encoding a chimeric tetravalent protein that has similarities with each of DENV1 , DENV2, DENV3 and DENV4 Dengue virus serotypes. In various embodiments the protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particles or non-structural protein comprising NS3 is encoded by nucleic acid set forth in SEQ ID NO. 1 or a nucleic acid having 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with SEQ ID NO. 1. In various embodiments the protein of a dengue virus or part thereof that does not induce antibodies or non-structural protein comprising NS3-NS2B chimera is encoded by nucleic acid set forth in SEQ ID NO. 2. It should be noted the SEQ ID NO. 2 encompasses all of the nucleic acids set forth in SEQ ID NO. 1 and an additional 18 nucleic acid residues of NS2B. In various embodiments the protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particles or non-structural protein comprising NS3-NS2B chimera is encoded by nucleic acid set forth in SEQ ID NO. 3. It should be noted the SEQ ID NO. 3 encompasses all of the nucleic acids set forth in SEQ ID NO. 1 and an additional 47 nucleic acid residues of NS2B. In various embodiments the protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particles or non-structural protein comprising NS1 is encoded by nucleic acid set forth in SEQ ID NO. 10, or SEQ ID NO. 14, or a nucleic acid having 69%, 71%, 74%, 77% or 80% sequence identity with SEQ ID NO. 10 or SEQ ID NO. 14. In various embodiments the protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particles or non-structural protein comprising NS4A is encoded by nucleic acid set forth in SEQ ID NO. 11 or a nucleic acid having 59%, 61 %, 64%, 66% or 68% sequence identity with SEQ ID NO. 11. In various embodiments the protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particles or non-structural protein comprising NS4B is encoded by nucleic acid set forth in SEQ ID NO. 12 or a nucleic acid having 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with SEQ ID NO. 12. In various embodiments the protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particles comprising Capsid is encoded by nucleic acid set forth in SEQ ID NO. 13 or a nucleic acid having 60%, 65%, 70%, 75% or 80% sequence identity with SEQ ID NO. 13. In various embodiments the protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particles comprising NS2A / B is encoded by nucleic acid set forth in SEQ ID NO. 15 or a nucleic acid having 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% sequence identity with SEQ IDNO. 15. In various embodiments the protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particles comprising NS5 is encoded by nucleic acid set forth in SEQ ID NO. 16 or a nucleic acid having 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% sequence identity with SEQ ID NO. 16. In various embodiments the part protein of a dengue virus that does not induce antibodies that bind to virus particles comprises NS5-Mtase encoded by nucleic acid set forth in SEQ ID NO. 17 or a nucleic acid having 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% sequence identity with SEQ ID NO. 17. In various embodiments the part protein of a dengue virus that does not induce antibodies that bind to virus particles comprises NS5-RdRp encoded by nucleic acid set forth in SEQ ID NO. 18 or a nucleic acid having 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% sequence identity with SEQ ID NO. 18.

[0035] As used herein ‘sequence identity’ refers to a quantitative measurement of the number of residues which are identical in both of the sequences being compared when they are aligned. In various embodiments the sequence identity is expressed as a percentage calculated from alignment. In various embodiments the term "sequence similarity" may also be used, especially in amino acid sequences, where the larger amino acid alphabet means that some residues are chemically similar but not identical. In the case of nucleic acid sequences, the residues refer to the individual nucleotides in the sequence. In the case of amino acid sequences, the residues refer to individual amino acids in the sequence. In various embodiments the alignment may be pair wise alignment comparing two sequences. In various embodiments the alignment may be multiple alignment comparing a sequence to many sequences. In various embodiments the alignment may be local alignment, comparing similar parts of two sequences. In various embodiments the alignment may be global alignment comparing the whole sequence. Different types of alignments may use different assumptions and methods. Any alignment known in the art may be used to determine sequence identity. Due to the common evolutionary origin of the dengue virus strains and the proteins expressed in each of these, a degree of structural similarity and functional similarity is present and conserved regions are expected.

[0036] Unexpectedly all the constructs comprising a protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particles or non-structural protein that includes NS1 , NS3 NS4A, NS4B NS5 each demonstrated at least a 10-fold reduction in viremia and in many cases, constructs comprising NS3 i.e., including the nucleic acids set forth in SEQ ID NO. 1 , resulted in a 50-fold or more reduction in viremia. Where additional nucleic acid sequences from NS2B were added to NS3 an unexpected reduction in viremia was observed of either 130 or 10-fold. The embodiments with constructs comprising a non-structural protein comprising NS3- NS2B chimera were unexpectedly superior or inferior to constructs where the non-structural protein comprising NS3 alone.

[0037] More surprisingly, a construct comprising a protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particles or non-structural protein that includes NS4B resulted in at least a 300-fold reduction in viremia and in many cases about 350-fold reduction in viremia.

[0038] In various embodiments the 7-methylguanylate cap comprises a nucleic acid set forth as SEQ ID NO. 4.

[0039] In various embodiments the 5’ untranscribed region preferably comprising a kozak consensus ribonucleic acid sequence comprises a nucleic acid set forth as SEQ ID NO. 5.

[0040] In various embodiments the 3’ untranscribed region comprises a nucleic acid set forth as SEQ ID NO. 6.

[0041] In various embodiments the poly A tail comprises a nucleic acid set forth as SEQ ID NO. 7.

[0042] In various embodiments the construct comprises a nucleic acid set forth as SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.1 - SEQ ID NO. 6 - SEQ ID NO. 7. In various embodiments the construct comprises a nucleic acid set forth as SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.2- SEQ ID NO. 6 - SEQ ID NO. 7. In various embodiments the construct comprises a nucleic acid set forth as SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.3 - SEQ ID NO. 6 - SEQ ID NO. 7. In various embodiments the construct comprises a nucleic acid set forth as SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.10 - SEQ ID NO. 6 - SEQ ID NO. 7. In various embodiments the construct comprises a nucleic acid set forth as SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.11 - SEQ ID NO. 6 - SEQ ID NO. 7. In various embodiments the construct comprises a nucleic acid set forth as SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.12 - SEQ ID NO. 6 - SEQ ID NO. 7. In various embodiments the construct comprises a nucleic acid set forth as SEQ ID NO. 4 - SEQ ID NO. 5- SEQ ID NO.13 - SEQ ID NO. 6 - SEQ ID NO. 7. In various embodiments the construct comprises a nucleic acid set forth as SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.14 - SEQ ID NO. 6 - SEQ ID NO. 7. In various embodiments the construct comprises a nucleic acid set forth as SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.15 - SEQ ID NO. 6 - SEQ ID NO. 7. In various embodiments the construct comprises a nucleic acid set forth as SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.16 - SEQ ID NO. 6 - SEQ ID NO. 7. In various embodiments the construct comprises a nucleic acid set forth as SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.17 - SEQ ID NO. 6 - SEQ ID NO. 7. In various embodiments the construct comprises a nucleic acid set forth as SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO. 18 - SEQ ID NO. 6 - SEQ ID NO. 7.

[0043] According to various embodiments there is a vaccine comprising the construct as described herein above formulated with excipients suitable of administration as a single dose ormultiple doses. In various embodiments the excipient comprises a polyvalent transfection reagent such as jetPRIME® transfection reagent, lipofectamine, a lipid nanoparticle for encapsulating the mRNA construct or any other suitable transfection reagent that is able to ensure effective and reproducible mRNA transfection into cells. In various embodiments the excipient comprises a physiological buffer such as a buffered saline solution, jetPRIME® buffer or any other physiological buffer suitable for storage and co-administration of the mRNA construct. In various embodiments the excipient comprises an agent for minimizing or stopping contamination. In various embodiments the vaccine is formulated for injection or to be injected. In various embodiments the vaccine is formulated for intramuscular administration or to be administered intramuscularly. In various embodiments the vaccine is formulated for administration to a human or to be administered to a human. In various embodiments the vaccine comprises a transfection reagent encapsulating the mRNA construct described herein above.

[0044] In this respect, the construct allows vaccines that takes an entirely different approach to known dengue vaccines. Because they are directed to proteins of a dengue virus or part thereof that does not induce antibodies that bind to virus particles such as non-structural proteins or the capsid protein of Dengue viruses it does not result in the production of neutralizing antibodies. The construct does not have any potential risk of ADE. The construct holds the potential to usher in a new paradigm in DENV vaccine development.

[0045] These advantages stem from the fact the mRNA vaccine construct does not comprise elements of DENV E and prM nucleic acids. Therefore, the mRNA vaccine construct does not induce antibodies that bind to DENV particles. Using DENV nucleic acids expressing Non- Structural protein and / or Capsid protein has significant advantage of avoiding ADE. Further the construct using the best performing nucleic acids expressing Non-Structural protein and / or Capsid protein can be easily selected by evaluating the protective efficacy of vaccines constructs containing nucleic acids expressing each single protein in mice. The nucleic acid construct mRNA vaccine is tetravalent containing the mRNA constructs from DENV1-4. This nucleic acid construct mRNA vaccine is expected to prevent severe diseases (DHF / DSS) by inducing T cell immunity while not instigating production of neutralizing antibodies.

[0046] In various embodiments the vaccine comprises 4 different mRNA constructs one directed each from DENV1 , DENV2, DENV3, DENV4 strains wherein the protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particle in each construct may be the equivalent in each strain, for example NS4B from each from DENV1 , DENV2, DENV3 and DENV4 or NS3 from each from DENV1 , DENV2, DENV3 and DENV4 or it may be different for example NS4B from each from DEN V1 and DENV2 and NS3 from each of DEN V3 and DENV4 or any other combination of any protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particle from each strain of DENV1 , DENV2, DENV3 and DENV4. Invarious embodiments the vaccine comprises 3 different mRNA constructs selected from protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particle from any three of the DENV1, DENV2, DENV3, DENV4 strains. In various embodiments the vaccine comprises 2 different mRNA constructs selected from protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particle from any two of the DENV1 , DENV2, DENV3, DENV4 strains.

[0047] According to various embodiments there is a construct as described herein above for use in preventing antibody-dependent enhancement of dengue virus infection. In various embodiments, the term ‘preventing’ refers to stopping or reducing dengue hemorrhagic fever (DHF) in a patient that becomes infected with a dengue virus. In various embodiments the term ‘preventing’ refers to stopping or reducing or dengue shock syndrome (DSS) in a patient that becomes infected with a dengue virus. In various embodiments term ‘preventing’ refers to stopping or reducing vascular leakage in a patient that becomes infected with a dengue virus. In various embodiments the term ‘preventing’ refers to stopping or reducing thrombocytopenia and bleeding in a patient that becomes infected with a dengue virus. In various embodiments, term ‘preventing’ refers to stopping or reducing levels of cytokines in a patient that becomes infected with a dengue virus. In various embodiments, the term ‘preventing’ refers to stopping or reducing any one of DHF, DSS, vascular leakage, thrombocytopenia and bleeding, levels of cytokines or any combination thereof in a patient that becomes infected with a dengue virus.

[0048] According to various embodiments there is use of a construct as described herein above in the manufacture of a vaccine for preventing antibody-dependent enhancement of dengue virus infection.

[0049] According to various embodiments there is a method of preventing antibody-dependent enhancement of dengue virus infection in an individual comprising: inducing T cell responses by administering a construct for preventing antibody-dependent enhancement of dengue virus infection, the construct comprising: (i) a ribonucleic acid encoding a protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particles wherein each of the uridine residues of the ribonucleic acid encoding a protein of a dengue virus or part thereof that does not induce antibodies is replaced with pseudouridine or N1-methylpseudo-uridine; (ii) a 7- methylguanylate cap; (iii) a 5’ untranscribed region preferably comprising a kozak consensus ribonucleic acid sequence; (iv) a 3’ untranscribed region; and (v) a poly A tail.

[0050] In various embodiments the construct is administered in at least two doses, each dose at least three weeks after a prior dose. In various embodiments where a first dose of the construct is administered at time 0 then a second dose of the construct would be administered 3 weeksafter the first dose and where a third dose of the construct may be administered 3 weeks after the second dose which would be 6 weeks after time 0.

[0051] In various embodiments the protein or part thereof that does not induce antibodies that bind to virus particles of the construct for preventing antibody-dependent enhancement of dengue virus infection used in the method comprises any one of a Capsid, NS1 , NS2A, NS2B, NS3, NS4A, NS4B, NS5 encoded by a Dengue virus or any combinations of these.

[0052] In various embodiments the protein or part thereof, that does not induce antibodies that bind to virus particles of the construct for preventing antibody-dependent enhancement of dengue virus infection used in the method comprises a NS3-NS2B chimera.

[0053] In various embodiments the protein or part thereof that does not induce antibodies that bind to virus particles of the construct for preventing antibody-dependent enhancement of dengue virus infection used in the method comprises a NS3-NS2B chimera encoded by nucleic acid set forth in SEQ ID NO. 2.

[0054] In various embodiments the protein or part thereof that does not induce antibodies that bind to virus particles of the construct for preventing antibody-dependent enhancement of dengue virus infection used in the method comprises a NS3-NS2B chimera encoded by nucleic acid set forth in SEQ ID NO. 3.

[0055] In various embodiments the construct for preventing antibody-dependent enhancement of dengue virus infection used in the method comprises a nucleic acid set forth as SEQ ID NO. 4- SEQ ID NO. 5 - SEQ ID NO.1 - SEQ ID NO. 6 - SEQ ID NO. 7.

[0056] In various embodiments the construct for preventing antibody-dependent enhancement of dengue virus infection used in the method comprises a nucleic acid set forth as SEQ ID NO. 4- SEQ ID NO. 5 - SEQ ID NO.2 - SEQ ID NO. 6 - SEQ ID NO. 7.

[0057] In various embodiments the construct for preventing antibody-dependent enhancement of dengue virus infection used in the method comprises a nucleic acid set forth as SEQ ID NO. 4- SEQ ID NO. 5 - SEQ ID NO.3 - SEQ ID NO. 6 - SEQ ID NO. 7.

[0058] In various embodiments the construct for preventing antibody-dependent enhancement of dengue virus infection used in the method comprises a nucleic acid set forth as SEQ ID NO. 4- SEQ ID NO. 5 - SEQ ID NO.10 - SEQ ID NO. 6 - SEQ ID NO. 7.

[0059] In various embodiments the construct for preventing antibody-dependent enhancement of dengue virus infection used in the method comprises a nucleic acid set forth as SEQ ID NO. 4- SEQ ID NO. 5 - SEQ ID NO.11 - SEQ ID NO. 6 - SEQ ID NO. 7.

[0060] In various embodiments the construct for preventing antibody-dependent enhancement of dengue virus infection used in the method comprises a nucleic acid set forth as SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.12 - SEQ ID NO. 6 - SEQ ID NO. 7.

[0061] In various embodiments the construct for preventing antibody-dependent enhancement of dengue virus infection used in the method comprises a nucleic acid set forth as SEQ ID NO. 4- SEQ ID NO. 5 - SEQ ID NO.13 - SEQ ID NO. 6 - SEQ ID NO. 7.

[0062] In various embodiments the construct for preventing antibody-dependent enhancement of dengue virus infection used in the method comprises a nucleic acid set forth as SEQ ID NO. 4- SEQ ID NO. 5 - SEQ ID NO.14 - SEQ ID NO. 6 - SEQ ID NO. 7.

[0063] In various embodiments the construct for preventing antibody-dependent enhancement of dengue virus infection used in the method comprises a nucleic acid set forth as SEQ ID NO. 4- SEQ ID NO. 5 - SEQ ID NO.15 - SEQ ID NO. 6 - SEQ ID NO. 7.

[0064] In various embodiments the construct for preventing antibody-dependent enhancement of dengue virus infection used in the method comprises a nucleic acid set forth as SEQ ID NO. 4- SEQ ID NO. 5 - SEQ ID NO.16 - SEQ ID NO. 6 - SEQ ID NO. 7.

[0065] In various embodiments the construct for preventing antibody-dependent enhancement of dengue virus infection used in the method comprises a nucleic acid set forth as SEQ ID NO. 4- SEQ ID NO. 5 - SEQ ID NO.17 - SEQ ID NO. 6 - SEQ ID NO. 7.

[0066] In various embodiments the construct for preventing antibody-dependent enhancement of dengue virus infection used in the method comprises a nucleic acid set forth as SEQ ID NO. 4- SEQ ID NO. 5 - SEQ ID NO.18 - SEQ ID NO. 6 - SEQ ID NO. 7.

[0067] In various embodiments the construct for preventing antibody-dependent enhancement of dengue virus infection used in the method comprises any of the constructs described herein above.

[0068] The following includes non-limiting examples.

[0069] Examples

[0070] New vaccines with mRNA constructs have been designed that target DENV non- structural (NS) proteins. Although these vaccines neither produce neutralizing antibodies nor prevent infection, they induce T cell immunity and prevent progression to severe dengue diseases without any concern for ADE. The mRNA constructs comprises Cap, 5’UTR, 3’UTR, Poly A tail,and DENV2 (clinical strain: EDEN2) and a target protein that does not induce antibodies that bind to virus particles such as a non-structural protein encoded by dengue virus RNA (Fig. 2).

[0071] Vaccine construct with non-structural NS3

[0072] Examples using NS3 as the target protein were very successful. The data showed that immunization with the DENV2 construct of NS3 mRNA vaccine in IFN-a / p receptor deficient mice (A129 mice) can completely prevent mouse mortality (see for example [Fig. 3]). This suggests a translational potency of mRNA vaccines targeting DENV NS proteins without any risk of ADE.

[0073] We initially selected DENV2 (clinical strain: EDEN2) and NS3 as the target protein since NS3 has been shown to contain highly antigenic T-cell epitopes (Tian et al. 2019, Front Immunol 10: 2125). Since expression of NS3 alone often results in protein mis-folding (Sampath et al. 2006, Sci Rep 7: 46375; Erbel et al. 2006, Exp Cell Res 206 (2): 204-211), two further vaccines were constructed with additional NS3 mRNA variants; one contains the sequence coding for 18 residues from EDEN2 NS2B at the 5’ side of NS3 which allows NS3 folding, and another one includes 47 residues from EDEN2 NS2B which confers NS3 to be an active serine protease ([Table 1]). The mRNA constructs were synthesized in vitro using T7 polymerase-mediated DNA- dependent RNA transcription and then transfected in human embryonic kidney (HEK) 293 cells using jetPRIME® transfection reagent (Polyplus). Gene expression was verified by Western blot analysis (WB) to detect the target proteins using our in-house DENV NS3 specific monoclonal Ab (Moreland et al. 2010, PLoS Negl Trop Dis 4 (11): e881).

[0074] [Table 1]: List of DENV2 NS3 mRNA constructs.

[0075] NS3 vaccine: SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.1 - SEQ ID NO. 6 - SEQ ID NO. 7.

[0076] NS3-NS2B 1stchimera vaccine: SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.2 - SEQ ID NO. 6 - SEQ ID NO. 7.

[0077] NS3-NS2B 2stchimera vaccine: SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.3 - SEQID NO. 6 - SEQ ID NO. 7

[0078] After replacing uridine with pseudouridine (U-to-^ ) (Morais et al. 2021 , Front Cell Dev Biol 9: 789427), 10pg of mRNA constructs were immunized intraperitoneally (ip) in 7-8 weeks old AG129 and A129 mice using in wVo-jetRNA® transfection reagent (Polyplus) according to the manufacturer’s instruction. Following a 1-time booster at 3 weeks post-immunization, mice were challenged intravenously with DENV2 (5 x 107pfu) in the presence of enhancing Abs (4G2) at 6 weeks post-immunization (Fig. 3A). This infection condition was known to be lethal in AG129 mice (Watanabe et al. 2016) but had never been tested in A129 mice before. Enzyme-Linked ImmunoSpot (ELISPOT) assay using splenocytes harvested just before the challenge infection showed that T cell responses specific to NS3 can be induced in both AG129 and A129 mice immunized with CF18-NS3 mRNA at a similar level (Fig. 3B). Interestingly, however, immunization with CF18-NS3 or CF47-NS3 mRNA in AG129 mice did not show efficacy on either mouse survival rate or viremia reduction (Fig. 3C). Significantly, on the other hand, immunization with CF18-NS3 mRNA in A129 mice resulted in 100% mouse survival and significant levels of viremia reduction (33.3-fold on day 4 pi), while unimmunized mice revealed 100% mortality (Fig. 3D). These results suggest an important role of IFN-y signaling in T-cell function and that the use of A129 mice would provide significant advantages in assessing T cell-based protection study and vaccine development.

[0079] Next, A129 mice were immunized with 3 DENV2 NS3 mRNA vaccines (NS3, CF18- NS3 and CF47-NS3) with same regimen as Fig. 3A and their protective efficacy was compared. Immunization with NS3 and CF18-NS3 vaccines induced 100% protective efficacy (Fig. 4A) and similar levels of viremia reduction (Fig. 4B and C), suggesting that there is no correlation between NS3 folding and vaccine efficacy. Interestingly, however, immunization with CF47-NS3 mRNA resulted in 40 % mortality (Fig. 4A) with less prominent reduction in viremia on day 4 after peritoneal injection (12-fold) compared with NS3 (62-fold) and CF18-NS3 (132-fold) (Fig. 4C). Data obtained by ELISPOT assay correspondingly showed less NS3-specific T cell responses in CF47-NS3 vaccination compared with other 2 NS3 mRNA variants (Fig. 4D). These results suggest that the efficiency of epitopes presentation to T cells may decrease for NS3 protein constructs carrying the protease activity.

[0080] Following the finding that a DENV2 clinical strain (EDEN2) is capable of causing lethal infection in A129 mice, the infectivity of a DENV1 clinical strain (EDEN1) was further examined, which has been shown to cause lethality in AG129 mice (Watanabe et al. 2016). Consequently, EDEN1 was also found to have the capability to cause lethal infection in A129 mice (Fig. 5A). Surprisingly, although inoculation with 5 x 106pfu of EDEN1 in the presence of enhancing Antibodies did not induce mortality in AG129 mice, 80% of A129 mice succumbed to infectionunder the same infection condition (Fig. 5A), indicating that EDEN1 is more virulent against A129 mice than AG129 mice. Thus, the lethal models DENV1 and DENV2 would be useful to study the role of serotype cross-reactive T cell immunity on dengue infection, which is still controversial whether it provides protective / pathogenic effects on disease severity (Ngono and Shresta 2018, Annu Rev Immunol 36: 279-308.). Preliminary data showed that DENV1 challenge infection in DENV2 NS3 mRNA immunized A129 mice resulted in a reduced mortality rate (20%) compared with non-immunized mice (80%) (Fig. 5B) accompanied by a significant reduction in viremia on day 4 pi (Fig. 5C), suggesting that NS3-specific T cell immunity cross- reactive to DENV1 and DENV2 facilitates protection against DENV1. Thus, these models of DENV1 and DENV2 would serve to develop vaccines that are effective on different serotypes.

[0081] Cap: m7G(5')ppp(5')G RNA Cap Structure Analog (commercial product: BioLabs). SEQ ID NO. 4: m7G(5')ppp(5')G

[0082] 5’UTR: Human alpha-globin RNA with an optimized Kozak sequence SEQ ID NO. 5: GAAUAAACUAGUAUUCUUCUGGUCCCCACAGACUCAGAGAGAACCCGCCACC.

[0083] 3’UTR: amino-terminal enhancer of split (AES) mRNA and the mitochondrial encoded 12S ribosomal RNA SEQ ID NO. 6:ACAUGAUGACUCGAGCUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCC UGGGUACCCCGAGUCUCCCCCGACCUCGGGUCCCAGGUAUGCUCCCACCUCCACCUGC CCCACUCACCACCUCUGCUAGUUCCAGACACCUCCCAAGCACGCAGCAAUGCAGCUCAA AACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCUUUAGCAAUAAA CGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACC CUGGAGCUAGC.

[0084] Poly A: Up to 110-nucleotide poly(A) residues added using E. coll Poly(A) Polymerase (commercial product: BioLabs). SEQ ID NO. 7:AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0085] DENV2-3295 (EDEN2): Isolated from patients in the Early Dengue Infection and outcome (EDEN) study in Singapore (Low et al. 2011 ; Low et al. 2006) (GenBank accession EU081177.1). SEQ ID NO. 8:

[0086] DENV1-2402 (EDEN1): Isolated from patients in the Early Dengue Infection and outcome (EDEN) study in Singapore (Low et al. 2011 ; Low et al. 2006) (GenBank accession EU081230.1). SEQ ID NO. 9:

[0087] The uridine residues of RNA constructs are substituted with pseudouridine (N1- Methylpseudouridine-5'-Triphosphate; ^ ) (commercial product: TriLink Biotechnologies) in the final mRNA constructs used for the vaccination.

[0088] The construct aims to generate tetravalent DENV mRNA vaccines containing selected multiple protein genes for all DENV1-4 serotypes has not been reported.

[0089] Next, the protective efficacy of vaccination was tested at different amounts of DENV2 NS3 mRNA. Vaccination with 10 g and 1 g of mRNA constructs resulted in 100% protection against DENV challenge (Fig. 6A) with similar levels of viremia reduction on day 4 pi (97-fold for 10 g and 68-fold for 1 pg) (Fig. 6B), suggesting that the capability of this vaccination almost reaches the maximum at 1 g. Further testing of 0.1 g and 0.01 pg vaccinations revealed a reduced or no protective efficacy with 20% and 100% mortality, respectively (Fig. 6C), and no significant reductions in viremia (Fig. 6D).

[0090] For establishing the universally effective vaccine, it would be ideal that one vaccine contains multiple good T-cell antigenic proteins of all 4 serotypes. One of the concerns is whether each mRNA-encoded product can be adequately expressed in the environment where various mRNA constructs are mixed in one. To address this, the efficacy of DENV2 NS3 mRNA (0.5pg) mixed with 10pg GFP mRNA construct was tested. Immunized mice were non-lethally challenged with DENV2 and their viremia was analyzed until day 5 pi (Fig. 7A). Mice vaccinated with NS3 mRNA mixed with GFP mRNA showed similar kinetics of viremia to those with NS3 mRNA alone with a significant reduction in viremia on day 5 pi (Fig. 7B). This indicates that a small amount of mRNA can maintain its efficacy in the presence of a larger amount of other mRNA constructs.

[0091] Vaccine construct with non-structural NS1

[0092] In parallel, DENV2 NS1 mRNA construct vaccines were generated and tested for protective efficacy in A129 mice. NS1 is a unique and multifunctional protein that is secreted into the blood stream (sNS1) and sNS1 is believed to be “pathogenic” by promoting vascular leakage (Beatty et al. 2015, Sci Transl Med 7 (304): 304ra141 ; Puerta-Guardo et al. 2019, Cell Rep 26 (6): 1598-1613 e1598). NS1 secretion induces high level of antibody production in infected individuals (Falconar 1997, Arch Virol 142 (5): 897-916). However, these antibodies do not bind to virus particles, therefore, they do not induce ADE. NS1 antibodies are thought to be therapeutic by neutralizing NS1 pathogenic function (Beatty et al. 2015, Sci Transl Med 7 (304): 304ra141 ; Lai et al. 2017, Sci Rep 7 (1): 6975), and also binding to cell surface-anchored NS1 on the infected cells, resulting in induction of antibody-dependent cell-mediated cytotoxicity (ADCC) (Wessel et al. 2020, Nat Commun 11 (1): 5278). Thus, for NS1 mRNA vaccine, we did not only assess the induction of T cell immunity, but also design the construct to promote the production NS1antibodies. Since a signal peptide is required for NS1 secretion (Falgout and Markoff 1995, J Virol 69 (11): 7232-7243), 2 types of mRNA constructs were generated; (1) “NS1” (SEQ ID NO. 10) that does not induce its secretion, resulting in poor NS1 antibody production, and (2) NS1 with human IgE signal peptide (“hlgE-NS1”) (SEQ ID NO. 14) that secretes sNS1 that would result in high level of NS1 antibody production. These 2 constructs would also serve to examine the contribution of NS1 antibody protection against severe dengue. Vaccination with 10pg of either NS1 mRNA (SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.10 - SEQ ID NO. 6 - SEQ ID NO. 7) or hlgE-NS1 mRNA (SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.14 - SEQ ID NO. 6 - SEQ ID NO. 7) completely protected mice from lethal DENV2 infection (Fig. 8A). Interestingly, NS1 mRNA and hlgE-NS1 mRNA induced similar levels of viremia reduction; 14.9-fold and 15.9-fold reduction on day 4 pi (Fig. 8B). Enzyme-linked immunosorbent assay (ELISA) clearly presented that a high level of NS1 antibodies is produced in hlgE-NS1 mRNA-immunized mice after vaccination, but not in NS1 mRNA-immunized mice (Fig. 80). Consequently, sNS1 was undetectable in the serum of hlgE-NS1 mRNA-immunized mice due to neutralization, while it was detected in serum of NS1 mRNA-immunized mice (Fig. 8D). These results suggested that secreted NS1 is not responsible for the disease severity in mice and the complete protection by mRNA vaccination mainly relies on the induction of T cell immunity, but not on NS1 antibody production.

[0093] NS1 vaccine: SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO. 10 - SEQ ID NO. 6 - SEQ ID NO. 7.

[0094] hlgE-NS1 vaccine: SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.14 - SEQ ID NO. 6 - SEQ ID NO. 7

[0095] Vaccine construct with non-structural NS4A or NS4B

[0096] NS4A and NS4B are membrane proteins that do not possess enzyme activity. DENV2 NS4A and NS4B mRNA constructs were separately generated and tested for protective efficacy in A129 mice. Mice were immunized with 5.4pg of NS4A mRNA or 9.0pg of NS4B mRNA, boosted with the same amounts, followed by lethally challenged with DENV2 at 6 weeks postimmunization. These amounts of mRNA are equivalent to 10pg of NS3 mRNA based on the mRNA copy number. The vaccination completely protected mice from lethal DENV2 infection (Fig. 9A). NS4A mRNA vaccination induced 12.6-fold reduction in viremia on day 4 pi and notably, NS4B mRNA vaccination induced 347.8-fold reduction in viremia (Fig. 9B), suggesting that NS4B is a highly T cell antigenic protein. Indeed, strong T cell responses could be recognized from 3 NS4B mRNA-vaccinated mice when their spleen cells were stimulated with DENV2 NS4B pooled peptides (Fig. 9C).

[0097] NS4A vaccine: SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.11 - SEQ ID NO. 6 - SEQ ID NO. 7.

[0098] NS4B vaccine: SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.12 - SEQ ID NO. 6 - SEQ ID NO. 7

[0099] Vaccine construct with non-structural NS5

[0100] NS5 is a multifunctional protein that possesses RNA-dependent RNA polymerase (RdRp) and RNA methyltransferase (MTase) activities. Intact DENV NS5 mRNA construct were first generated and immunized in A129 mice at 14.2pg, which is equivalent to 10pg of NS3 mRNA based on the mRNA copy number. However, the vaccination failed to protect mice from lethal DENV2 challenge infection (Fig. 10A) and reduce viremia (Fig. 10B). ELIPOT assay suggests that the vaccination did not induce NS5-specific T cell responses (Fig. 10C). Since NS5 is a largest protein (2700 nucleotide base), the length of mRNA construct might affect the efficiency of protein expression. Therefore, mRNA constructs of 2 domains were next generated, NS5- MTase (789 nucleotide base) and NS5-RdRp (1887 nucleotide base). Mice were immunized with 4.5pg of NS5-MTase mRNA or 10pg of NS5-RdRp mRNA, which are equivalent to 10pg of NS3 mRNA based on the mRNA copy number. However, neither NS5-MTase nor NS5-RdRp mRNA vaccination demonstrated clear protective efficacy (Fig. 11 A) and viremia reduction (Fig. 11B). Interestingly, T cell responses specific to MTase and RdRp could be detected by ELISPOT assay (Fig. 11C), suggesting that these specific T cells do not contribute to viral clearance and protection.

[0101] As the future scenario, mRNA vaccines that target other DENV2 NS proteins such as NS2A / B, will be further generated and examined for protective efficacy in A129 mice. Since Capsid protein also does not induce antibodies that bind to virus particle and has shown to contain T cell-epitopes (Lazo et al. 2019), this protein will also be included as a target gene for mRNA vaccination. The final product would comprise multiple proteins selected from the results of each vaccination and can control all DENV serotypes by mixing the mRNA constructs of DENV1-4 (tetravalent vaccine).

[0102] Currently, a DENV vaccine being established is universally effective against all serotypes for prevention of severe dengue. The final vaccine has several highly T cell antigenic proteins from DENV1-4. For this, once the protective efficacies of DENV2 (EDEN2: GenBank accession EU081177) mRNA constructs that encode capsid, NS1 , NS2A / B, NS3, NS4A, NS4B, NS5, NS5-MTase and NS5-RdRp (Fig. 12: step 1) are tested the best performers may be selected. NS3 and NS4B are currently identified as promising candidates. Data on capsid and NS2A / B will be obtained and an optimized vaccine will be produced (Fig. 12: step 2). Once the proteins to be incorporated are determined, an mRNA construct will be generated that comprises multiple protein genes in the same RNA strand (Fig. 12: step 2 (i)). This approach would be beneficial to the manufacturing time and cost on commercial basis. However, it is also conceivablethat the length of coding region of mRNA may alter its expression efficiency. Therefore, an alternative strategy would be making a mixture of mRNAs encoding a single protein (Fig. 12: step 2 (ii)). Although it has a drawback in respect to cost, time and effort during the manufacturing process, it also has an advantage that the amount of each mRNA construct can be flexibly adjusted depending on its efficacy. The data that a small amount of NS3 mRNA (0.5pg) can maintain its efficacy in the presence of a large amount of other mRNA (1Opg) (Fig. 7) further encourages exploration of this strategy. Once the optimal vaccine design is determined, analogous mRNA genes in the other serotypes (Fig. 12: step 3) based on the sequence information of DENV1 (EDEN1 : GenBank accession EU081230), DENV3 (EDEN3: GenBank accession EU081190) and DENV4 (EDEN4: GenBank accession GQ398256) will be generated.

[0103] NS5 vaccine: SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.16 - SEQ ID NO. 6 - SEQ ID NO. 7.

[0104] NS5 Mtase part, vaccine: SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.17 - SEQ ID NO. 6 - SEQ ID NO. 7.

[0105] NS5 RdRp part, vaccine: SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.18 - SEQ ID NO. 6 - SEQ ID NO. 7

[0106] It is anticipated that selected proteins are similarly antigenic against other serotypes since the four DENV serotypes share 65-70% amino acid sequence identity (Holmes and Twiddy. 2003, Infect Genet Evol 3 (1): 19-28; Anoop et al. 2012, Virus Genes 45 (1): 1-13). However, the sequence identity is different among the different proteins. Table 2 shows the percent sequence identity of each protein between EDEN1 , EDEN2, EDEN3 and EDEN4, which will be used for designing of further mRNA vaccine constructs. Notably, NS3 and NS4B, which are shown to be highly protective and promising candidates (Fig. 4, 6 and 9), reveal high sequence identity among the four serotypes (76-85% for NS3 and 77-83% for NS4B). In fact they have the highest sequence identity across the serotypes compared to the other DENV proteins. This highly conserved nature of NS3 and NS4B across all DENV serotypes encourages the generation a tetravalent vaccine that is capable of protecting against all four DENV serotypes without causing the serious effects of ADE.

[0107] Table 2. Amino acid sequence identity for each protein among 4 DENV serotypes. The sequence identity of amino acid sequences of each protein was determined from EDEN1 , EDEN2, EDEN3 and EDEN4.

[0108] In addition, preliminary data on DENV1 challenge infection in DENV2 NS3 mRNA immunized mice (Fig. 5) clearly demonstrates that protection can result in a different serotype and is a good indicator that the antigenicity of the protein against other serotypes will also provide protection. The sequence identity for NS3 between EDEN1 and EDEN2 is 80%. An mRNA construct made with the NS3 protein of DENV2 resulted in a reduced mortality rate upon DENV1 infection, in mice vaccinated with this mRNA construct compared to unvaccinated mice (Fig. 5B). This was also accompanied by a significant reduction in viremia in mice vaccinated with this mRNA construct compared to unvaccinated mice (Fig. 5C) upon DENV1 infection, suggesting that NS3 is similarly T cell antigenic against DENV1 . This protection is facilitated by cross- reactive T cell immunity between DENV1 and DENV2, and serotype-specific T cell responses are expected to show higher protective efficacy across all four serotypes.

[0109] It should be further appreciated by the person skilled in the art that variations and combinations of features described above, not being alternatives or substitutes, may be combined to form yet further embodiments falling within the intended scope of the invention.

[0110] As would be understood by a person skilled in the art, each embodiment, may be used in combination with other embodiment or several embodiments.

[0111] Statements1 . A construct for preventing antibody-dependent enhancement of dengue virus infection, comprising: a. a ribonucleic acid encoding a non-structural protein of a dengue virus wherein each of the uridine residues of the ribonucleic acid encoding a non-structural protein of a dengue virus is replaced with pseudouridine; b. a 7-methylguanylate cap; c. a 5’ untranscribed region preferably comprising a kozak consensus ribonucleic acid sequence; d. a 3’ untranscribed region; and e. a poly A tail.2. The construct according to statement 1, wherein the non-structural protein comprises any one of a Capsid, NS1 , NS2A, NS2B, NS3, NS4A, NS4B, NS5 encoded by a Dengue virus or any combinations of these.3. The construct according to statement 1 , wherein the non-structural protein comprises a NS3-NS2B chimera.4. The construct according to statement 3, wherein the NS3-NS2B chimera is encoded by nucleic acid set forth in SEQ ID NO. 2.5. The construct according to statement 3, wherein the NS3-NS2B chimera is encoded by nucleic acid set forth in SEQ ID NO. 3.6. The construct according to statement 1 or 2, comprising a nucleic acid set forth as SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.1 - SEQ ID NO. 6 - SEQ ID NO. 7.7. The construct according to statement 1 or 2, comprising a nucleic acid set forth as SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.2 - SEQ ID NO. 6 - SEQ ID NO. 7.8. The construct according to statement 1 or 2, comprising a nucleic acid set forth as SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.3 - SEQ ID NO. 6 - SEQ ID NO. 7.9. A construct according to any one of statements 1 to 8 for use in preventing antibodydependent enhancement of dengue virus infection.10. Use of a construct according to any one of statements 1 to 8 in the manufacture of a vaccine for preventing antibody-dependent enhancement of dengue virus infection.11 . A method of preventing antibody-dependent enhancement of dengue virus infection in an individual comprising: a. inducing T cell responses by administering the construct comprising i). a ribonucleic acid encoding a non-structural protein of a dengue virus wherein each of the uridine residues of the ribonucleic acid encoding a non-structural protein of a dengue virus is replaced with pseudouridine; ii). a 7-methylguanylate cap; iii). a 5’ untranscribed region preferably comprising a kozak consensus ribonucleic acid sequence; iv). a 3’ untranscribed region; and v). a poly A tail,12. The method according to statement 11 , wherein the construct is administered in at least two doses, each dose at least three weeks after a prior dose.13. The method according to statement 11 , wherein the non-structural protein comprises any one of a Capsid, NS1 , NS2A, NS2B, NS3, NS4A, NS4B, NS5 encoded by a Dengue virus or any combinations of these.14. The method according to statement 11 , wherein the non-structural protein comprises a NS3-NS2B chimera.15. The method according to statement 11 , wherein the non-structural protein comprises a NS3-NS2B chimera encoded by nucleic acid set forth in SEQ ID NO. 2.16. The method according to statement 11 , wherein the non-structural protein comprises a NS3-NS2B chimera encoded by nucleic acid set forth in SEQ ID NO. 3.17. The method according to statement 11 , wherein the construct comprises a nucleic acid set forth as SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.1 - SEQ ID NO. 6 - SEQ ID NO. 7.18. The method according to statement 11 , wherein the construct comprises a nucleic acid set forth as SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.2 - SEQ ID NO. 6 - SEQ ID NO. 7.19. The method according to statement 11 , wherein the construct comprises a nucleic acid set forth as SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.3 - SEQ ID NO. 6 - SEQ ID NO. 7.

Claims

CLAIMSClaim 1 . A construct for preventing antibody-dependent enhancement of dengue virus infection, comprising: a. a ribonucleic acid encoding a protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particle wherein each of the uridine residues of the ribonucleic acid encoding the protein or part thereof is replaced with pseudouridine or N1- methylpseudo-uridine; b. a 7-methylguanylate cap; c. a 5’ untranscribed region preferably comprising a kozak consensus ribonucleic acid sequence; d. a 3’ untranscribed region; and e. a poly A tail.Claim 2. The construct according to claim 1 , wherein the protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particle comprises any one of a Capsid, NS1 , NS2A, NS2B, NS3, NS4A, NS4B, NS5 encoded by a Dengue virus or any combinations of these.Claim 3. The construct according to Claim 1 , wherein the protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particle comprises a NS3-NS2B chimera.Claim 4. The construct according to claim 3, wherein the NS3-NS2B chimera is encoded by nucleic acid set forth in SEQ ID NO. 2.Claim 5. The construct according to claim 3, wherein the NS3-NS2B chimera is encoded by nucleic acid set forth in SEQ ID NO. 3.Claim 6. The construct according to Claim 1 , wherein the protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particle comprises a NS1 encoded by a Dengue virus.Claim 7. The construct according to Claim 1 , wherein the protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particle comprises a NS4A encoded by a Dengue virus.Claim 8. The construct according to claim 1 or 7, comprising a nucleic acid set forth as SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.11 - SEQ ID NO. 6 - SEQ ID NO. 7.Claim 9. The construct according to Claim 1 , wherein the protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particle comprises a NS4B encoded by a Dengue virus.Claim 10. The construct according to claim 1 or 9, comprising a nucleic acid set forth as SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.12 - SEQ ID NO. 6 - SEQ ID NO. 7.Claim 11 . The construct according to Claim 1 , wherein the protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particle comprises a NS3 encoded by a Dengue virus.Claim 12. The construct according to claim 1 or 11 , comprising a nucleic acid set forth as SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.1 - SEQ ID NO. 6 - SEQ ID NO. 7.Claim 13. The construct according to Claim 1 , wherein the protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particle comprises a NS1 encoded by a Dengue virus.Claim 14. The construct according to claim 1 or 13, comprising a nucleic acid set forth as SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.10 - SEQ ID NO. 6 - SEQ ID NO. 7, or SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.14 - SEQ ID NO. 6 - SEQ ID NO. 7.Claim 15. The construct according to Claim 1, wherein the protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particle comprises a NS5 encoded by a Dengue virus.Claim 16. The construct according to claim 1 or 15, comprising a nucleic acid set forth as SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.16 - SEQ ID NO. 6 - SEQ ID NO. 7; SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.17 - SEQ ID NO. 6 - SEQ ID NO. 7; or SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO. 18 - SEQ ID NO. 6 - SEQ ID NO. 7.Claim 17. The construct according to Claim 1 , wherein the protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particle comprises a NS2A / B encoded by a Dengue virus.Claim 18. The construct according to claim 1 or 17, comprising a nucleic acid set forth as SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.15 - SEQ ID NO. 6 - SEQ ID NO. 7.Claim 19. The construct according to Claim 1 , wherein the protein of a dengue virus or part thereof that does not induce antibodies that bind to virus particle comprises a Capsid encoded by a Dengue virus.Claim 20. The construct according to claim 1 or 19, comprising a nucleic acid set forth as SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.13 - SEQ ID NO. 6 - SEQ ID NO. 7.Claim 21 . A vaccine comprising the construct according to any one of claims 1-20 and one or more excipients.Claim 22. The Vaccine according to claim 21 , formulated for injection or to be injected.Claim 23. The Vaccine according to claim 21 , formulated for intramuscular administration or to be administered.Claim 24. The Vaccine according to claim 21 , formulated for administration or to be administered to a human.Claim 25. The Vaccine according to claim 21 , formulated for a single dose or a multiple dose.Claim 26. A construct according to any one of claims 1 to 20 or a vaccine according to any one of claims 21-25, for use in preventing antibody-dependent enhancement of dengue virus infection.Claim 27. Use of a construct according to any one of claims 1 to 20 or a vaccine according to any one of claims 21-25, in the manufacture of a vaccine for preventing antibody-dependent enhancement of dengue virus infection.Claim 28. A method of preventing antibody-dependent enhancement of dengue virus infection in an individual comprising: a. inducing T cell responses by administering a construct comprising:i). a ribonucleic acid encoding a protein of a dengue virus or part thereof wherein each of the uridine residues of the ribonucleic acid encoding the protein or part thereof is replaced with pseudouridine or N1 -methylpseudo-uridine;II). a 7-methylguanylate cap;Hi). a 5’ untranscribed region preferably comprising a kozak consensus ribonucleic acid sequence; iv). a 3’ untranscribed region; and v). a poly A tail,Claim 29. The method according to claim 28, wherein the construct is administered in at least two doses, each dose at least three weeks after a prior dose.Claim 30. The method according to claim 28, wherein the protein or part thereof comprises any one of a Capsid, NS1 , NS2A, NS2B, NS3, NS4A, NS4B, NS5 encoded by a Dengue virus or any combinations of these.Claim 31 . The method according to claim 28, wherein the protein or part thereof comprises a NS3-NS2B chimera.Claim 32. The method according to claim 28, wherein the protein or part thereof comprises a NS3-NS2B chimera encoded by nucleic acid set forth in SEQ ID NO. 2.Claim 33. The method according to claim 28, wherein the protein or part thereof comprises a NS3-NS2B chimera encoded by nucleic acid set forth in SEQ ID NO. 3.Claim 34. The method according to claim 28, wherein the protein or part thereof comprises a NS1 encoded by a Dengue virus.Claim 35. The method according to claim 28, wherein the protein or part thereof comprises a NS4A encoded by a Dengue virus.Claim 36. The method according to claim 28, wherein the protein or part thereof comprises a NS4B encoded by a Dengue virus.Claim 37. The method according to claim 28, wherein the construct comprises a nucleic acid set forth as SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.1 - SEQ ID NO. 6 - SEQ ID NO. 7.Claim 38. The method according to claim 28, wherein the construct comprises a nucleic acid set forth as SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.2 - SEQ ID NO. 6 - SEQ ID NO. 7.Claim 39. The method according to claim 28, wherein the construct comprises a nucleic acid set forth as SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.3 - SEQ ID NO. 6 - SEQ ID NO. 7.Claim 40. The method according to claim 28, wherein the construct comprises a nucleic acid set forth as SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.10 - SEQ ID NO. 6 - SEQ ID NO. 7.Claim 41 . The method according to claim 28, wherein the construct comprises a nucleic acid set forth as SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.11 - SEQ ID NO. 6 - SEQ ID NO. 7.Claim 42. The method according to claim 28, wherein the construct comprising a nucleic acid set forth as SEQ ID NO. 4 - SEQ ID NO. 5 - SEQ ID NO.12 - SEQ ID NO. 6 - SEQ ID NO. 7.Claim 43. The method according to claim 28, wherein the construct comprising a nucleic acid set forth as SEQ ID NO.4- SEQ ID NO.5 - SEQ ID NO.13-SEQ ID NO.6- SEQ ID NO. 7.Claim 44. The method according to claim 28, wherein the construct comprising a nucleic acid set forth as SEQ ID NO.4- SEQ ID NO.5 - SEQ ID NO.14-SEQ ID NO.6- SEQ ID NO. 7.Claim 45. The method according to claim 28, wherein the construct comprising a nucleic acid set forth as SEQ ID NO.4- SEQ ID NO.5 - SEQ ID NO.15-SEQ ID NO.6- SEQ ID NO. 7.Claim 46. The method according to claim 28, wherein the construct comprising a nucleic acid set forth as SEQ ID NO.4- SEQ ID NO.5 - SEQ ID NO.1 - SEQ ID NO.6- SEQ ID NO.7.Claim 47. The method according to claim 28, wherein the construct comprising a nucleic acid set forth as SEQ ID NO.4- SEQ ID NO.5 - SEQ ID NO.17-SEQ ID NO.6- SEQ ID NO. 7.Claim 48. The method according to claim 28, wherein the construct comprising a nucleic acid set forth as SEQ ID NO.4- SEQ ID NO.5 - SEQ ID NO.18-SEQ ID NO.6- SEQ ID NO. 7.

Images