Construction of an active immunization animal model of anti-IgLON5 antibody-related encephalopathy

Abstract

This invention provides the construction and application of an active immunization animal model for anti-IgLON5 antibody-related encephalopathy. The construction method is as follows: A PKN-IgLON5(1-313aa)-His(8×) recombinant plasmid is constructed in vitro and transfected into HEK293S suspension cells to express the protein. The cell supernatant is collected, purified twice, and the protein solvent is replaced with PBS. An immunoemulsion is prepared by mixing the IgLON5 protein solution with Freund's adjuvant and subcutaneously injected into mice. Pertussis toxin disrupts the blood-brain barrier, promoting the invasion of peripheral antibodies into the central nervous system, ultimately constructing an active immunization mouse model of anti-IgLON5 antibody-related encephalopathy. This invention discloses for the first time a method for constructing an active immunization animal model of anti-IgLON5 antibody-related encephalopathy, filling the gap in current research on active immunization models for anti-IgLON5 antibody-related encephalopathy. This helps to reconstruct the full picture of antibody attack on the central nervous system and to conduct more comprehensive phenotypic analysis of cognitive, sleep, and motor disorders.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to the construction of animal models, and more specifically to the construction and application of an active immunization animal model for anti-IgLON5 antibody-related encephalopathy. Background Technology

[0002] Anti-IgLON5 antibody-associated encephalopathy (AEE) is a newly discovered rare autoimmune neurological disease characterized by the presence of anti-IgLON5 antibodies in the serum and / or cerebrospinal fluid, and abnormalities in cognition, motor function, sleep, gait, and medullary function. Furthermore, autopsy results of AEE patients reveal highly phosphorylated tau (p-tau) protein deposition in the brain. Most patients present with a chronic onset and progression, exhibiting high heterogeneity in clinical manifestations. The neurodegenerative pathological features, particularly p-tau deposition, further complicate diagnosis and treatment. Currently, only a few hundred cases have been reported worldwide, with only a few dozen in my country. As a newly discovered rare disease, the pathogenesis of AEE remains unclear, and classic first- and second-line immunotherapies have shown limited efficacy. Animal models capable of reproducing the clinical phenotype of patients will contribute to the study of the disease's pathogenesis and provide more reliable directions and strategies for clinical diagnosis and treatment.

[0003] There is still a lack of basic research on anti-IgLON5 antibody-related encephalopathy, with most of the existing studies being in vitro cell experiments. This includes: Sabater et al. (2016, 2020) used primary hippocampal neurons extracted from fetal rat brains to study the mechanism of antibody action (Sabater L, Planagumà J, Dalmau J, Graus F. Cellular investigations with human antibodies associated with the anti-IgLON5 syndrome. J Neuroinflammation. 2016 Sep 1;13(1):226.; Landa J, Gaig C, Plagumà J, Saiz A, Antonell A, Sanchez-Valle R, Dalmau J, Graus F, Sabater L. Effects of IgLON5 Antibodies on Neuronal Cytoskeleton: A Link between Autoimmunity and Neurodegeneration. Ann Neurol. 2020 Nov;88(5):1023-1027.); Ryding et al. (2021) used human neurons derived from induced pluripotent stem cells to conduct research (Ryding M, Gamre M, Nissen MS, NilssonAC, Okarmus J, Poulsen AAE, Meyer M, Blaabjerg M. Neurodegeneration Induced by Anti-IgLON5 Antibodies Studied in Induced Pluripotent Stem Cell-Derived Human Neurons. Cells. 2021 Apr 8;10(4):837.). Some studies used a mouse passive immunization model, that is, directly injecting the patient's serum antibodies into specific brain regions of mice to induce disease in mice.Including: Alvente et al. (2022) used a mouse model of patients with chronic lateral ventricle perfusion who were infected with anti-IgLON5 antibodies to reproduce the clinically reported phenotype of p-tau deposition in the brain of patients (Alvente S, Matteoli G, Molina-Porcel L, Landa J, Alba M, Bastianini S, Berteotti C, Graus F, Lo Martire V, Sabater L, Zoccoli G, Silvani A. Pilot Study of the Effects of Chronic Intracerebroventricular Infusion of Human Anti-IgLON5 Disease Antibodies in Mice. Cells. 2022 Mar 17;11(6):1024.).

[0004] The inventors' team has established a passive immunization model of cognitive impairment in mice by injecting patient-derived anti-IgLON5 antibodies into the lateral ventricle and hippocampus of mice (Ni Y, Feng Y, Shen D, Chen M, Zhu X, Zhou Q, Gao Y, Liu J, Zhang Q, Shen Y, Peng L, Zeng Z, Yin D, Hu J, Chen S. Anti-IgLON5 antibodies cause progressive behavioral and neuropathological changes in mice. J Neuroinflammation. 2022 Jun 11;19(1):140.). In this model, patient-derived anti-IgLON5 antibodies can affect the synaptic homeostasis of neurons at the injection site in the long term, disrupt cognitive-related neural circuits, and lead to cognitive impairment and anxiety-like behavior in mice. In addition, the inventors' team also established a passive immunization model of movement disorders by injecting patients' anti-IgLON5 antibodies into the substantia nigra of the midbrain of mice (Gao Y, Li H, Luo H, Ni Y, Feng Y, He L, Zhou Q, Hu J, Chen S. Purified Serum IgG from a Patient with Anti-IgLON5 Antibody Cause Long-Term Movement Disorders with Impaired Dopaminergic Pathways in Mice. Biomedicines. 2023 Sep 7;11(9):2483.). This model revealed the long-term damage of patients' anti-IgLON5 antibodies to the substantia nigra-striatal dopaminergic system and can induce an increase in substantia nigra p-tau. The process of establishing the model animals mentioned above is a process of passive immunization of animals by injecting human antibodies. Although the passive immunization method of injecting human antibodies into specific brain regions of animals provides a strategy for studying the "partial" pathogenicity of antibodies, it cannot provide the "full picture" of disease occurrence, nor can it simulate the "entire process" from the production of autoantibodies to pathogenicity. To better explore the pathogenicity of autoantibodies, the establishment of active immunization models is particularly important.

[0005] Freund's adjuvant is a commonly used adjuvant for active immunization against autoimmune diseases. Freund's adjuvant is mixed with an antigen to prepare a water-in-oil emulsion. Subcutaneous injection of this emulsion into an animal slowly releases the antigen, generating a highly stimulating and sustained antibody response, ultimately inducing the development of autoimmune diseases. The mycobacteria in complete Freund's adjuvant can attract other cells, such as macrophages, to the injection site, thereby enhancing the immune response. Typically, complete Freund's adjuvant is used for initial injections, while incomplete Freund's adjuvant is used for booster injections. The method of preparing immunoemulsions by mixing Freund's adjuvant with antigens has been used in the study of neuroimmune diseases. For example, the experimental autoimmune encephalomyelitis (EAE) animal model of multiple sclerosis is induced by mixing Freund's adjuvant with sensitizers such as myelin basic protein (MBP) or myelin oligodendrocyte glycoprotein (MOG) peptides (Constantinescu CS, Farooqi N, O'Brien K, Gran B. Experimental autoimmune encephalomyelitis (EAE) as a model for multiple sclerosis (MS). Br JPharmacol. 2011 Oct;164(4):1079-106.); and the active immune model of myasthenia gravis is induced by mixing Freund's adjuvant with acetylcholine receptor (AChR) protein or peptides (Li Z, Li M, Wood K, Hettwer S, Muley SA, Shi FD, Liu Q, Ladha SS. Engineered agrin attenuates the severity of experimental autoimmune myasthenia gravis). Muscle Nerve. 2018 May;57(5):814-820.).In the spectrum of autoimmune encephalitis, Wagnon et al. used a sequence containing N368 / G369 amino acids in the NMDAR receptor to immunize mice and construct an active immunization animal model of anti-NMDAR encephalitis (Wagnon I, Hélie P, Bardou I, Regnauld C, Lesec L, Leprince J, Naveau M, Delaunay B, Toutirais O, Lemauff B, Etard O, Vivien D, Agin V, Macrez R, Maubert E, Docagne F. Autoimmuneencephalitis mediated by B-cell response against N-methyl-d-aspartatereceptor. Brain. 2020 Oct 1;143(10):2957-2972.).

[0006] There are currently no studies on active immunization models of anti-IgLON5 antibody-related encephalopathy. Compared to passive immunization, which focuses more on the pathophysiological changes in specific brain regions after injection, active immunization can better reconstruct the overall picture of antibody attack on the central nervous system. Therefore, based on the research on passive transfer of IgLON5 antibodies to different brain regions, it is urgent and important to further establish animal models of active immunization-induced IgLON5 antibody-related encephalopathy for more comprehensive phenotypic analysis (cognitive, sleep, and motor disorder phenotypes). Summary of the Invention

[0007] The purpose of this invention is to overcome the aforementioned defects and deficiencies in the prior art and provide an active immunization animal model of anti-IgLON5 antibody-related encephalopathy. A second purpose is to provide applications for the aforementioned active immunization animal model of anti-IgLON5 antibody-related encephalopathy, such as in mechanism studies or drug screening.

[0008] This invention provides a method for the in vitro synthesis and purification of IgLON5 protein, and provides a method and steps for establishing an active immunization animal model of anti-IgLON5 antibody-related encephalopathy.

[0009] The research process of this invention is summarized as follows: Based on the NCBI database and previous literature reports, the extracellular sequence of the IgLON5 protein, namely IgLON5(1-313aa), was determined. The GPI anchor site (amino acid 314) and subsequent gene sequences were removed, allowing the IgLON5 protein to be expressed freely in the cell supernatant, facilitating collection and purification. Using homologous recombination technology, a PKN-IgLON5(1-313aa)-His(8×) recombinant plasmid was constructed in vitro and transfected into HEK293S suspension cells to express the protein. The cell supernatant was collected, and the IgLON5(1-313aa) protein was purified using a HisCap Smart 6FF pre-packed column. Further purification was performed using an AKTA purifyer 10 protein chromatography system, replacing the protein solvent with PBS. The protein was then analyzed by Western blotting (WB). Figure 1 ), and dyeing ( Figure 2 , Figure 3 Mass spectrometry sequencing identified the obtained protein solution as IgLON5 protein solution.

[0010] An immunoemulsion was prepared by mixing IgLON5 protein solution with Freund's adjuvant and subcutaneously injected into C57BL6 / J mice. Pertussis toxin was used to disrupt the blood-brain barrier, promoting the invasion of peripheral antibodies into the central nervous system, ultimately establishing an active immunization mouse model of anti-IgLON5 antibody-related encephalopathy. Behavioral and peripheral serum antibody detection were also performed. Figure 4 The results showed that mice injected with the IgLON5 immunogen exhibited progressively worsening anxiety-like behaviors, cognitive impairment, and motor dysfunction. High titers of serum anti-IgLON5 antibodies were detected at 1 and 3 months post-injection. These results indicate that mice injected with the IgLON5 immunogen exhibited emotional, cognitive, and motor abnormalities similar to those in patients, and that anti-IgLON5 antibodies were present in their serum. This model can be used to study the antibody production and pathogenic mechanisms of anti-IgLON5 antibody-related encephalopathy.

[0011] Specifically, the steps for constructing the active immunization animal model of anti-IgLON5 antibody-related encephalopathy according to the present invention are as follows:

[0012] A. In vitro construction of PKN-IgLON5-His recombinant plasmid

[0013] Using the IgLON5 gene sequence (i.e., amino acid sequence 1-313) in pUC57-IgLON5 plasmid and the PKN-His plasmid sequence as templates, primers for IgLON5 and PKN-vector were designed, and the primer sequences are shown in SEQ ID NO.1-4; then PCR amplification was performed and the products were verified.

[0014] IgLON5: Forward primer GGGTACCCGGTTCTACCGGCATGCCCCCCCCTGCGCCCGG (SEQ IDNO.1),

[0015] Reverse primer TTAGTGGTGGTGGTGGTGGTGGTGGTGCTCCAGGGATCCTGGGCGCAG (SEQ IDNO.2);

[0016] PKN-vector: forward primer TGCGCCCAGGATCCCTGGAGCACCACCACCACCACCACCACCACTAAG (SEQ ID NO.3),

[0017] Reverse primer CGCAGGGGGGGGCATGCCGGTAGAACCGGGTACCC (SEQ ID NO.4).

[0018] The PKN-IgLON5-His recombinant plasmid was constructed by seamless DNA cloning and transformed into competent cells. Single clones were selected, and the plasmid was extracted for enzyme digestion and sequencing identification.

[0019] B. Synthesis and purification of recombinant IgLON5 protein

[0020] PKN-IgLON5-His recombinant plasmid was extracted and diluted to 1 mg / ml with double-distilled water. It was then transiently transfected into 250 ml of HEK293S cells using the PEI method (DNA:PEI = 1:6). Four hours after transfection, 250 ml of culture medium was added, mixed well, and half of the volume was transferred to a new culture flask and placed on a shaker for incubation. Twenty-four hours after transfection, when the cell density was approximately 3 × 10⁶ cells / ml... 6 Add 500 μl of sodium valproate to each flask when the cell density is 1 / ml; add 2.5 ml of D-glucose to each flask between 48-72 hours after transfection, and collect the supernatant for protein purification after 5-6 days of culture.

[0021] First, a 5ml HisCap Smart 6FF pre-packed column and a 30kDa concentration tube were used for the first purification and concentration. Then, an AKTA purifyer 10 protein chromatography system was used for the second purification, and the protein solvent was replaced with PBS in this step.

[0022] C. Construction of an immunized mouse model

[0023] Prepare a protein solution with a final IgLON5 protein concentration of 0.4 mg / ml, add an equal volume of complete or incomplete Freund's adjuvant and emulsify completely; at the same time, prepare a pertussis toxin solution with a final concentration of 2 μg / ml.

[0024] Immunization injection:

[0025] (1) On day 0, the first subcutaneous injection of protein and complete Freund's adjuvant immunoemulsion was given to mice at four points: the back of both shoulders and both hind limbs. At the same time, the first intraperitoneal injection of pertussis toxin was given.

[0026] (2) A second intraperitoneal injection of pertussis toxin was administered on day 2;

[0027] (3) On day 14, a second subcutaneous injection of protein and incomplete Freund's adjuvant immunoemulsion was given, with the same injection site and dosage as before.

[0028] In a second aspect, the present invention provides an active immunization animal model of anti-IgLON5 antibody-related encephalopathy, which is constructed using the method described above.

[0029] In a third aspect, this invention provides the application of the aforementioned active immunization animal model for anti-IgLON5 antibody-related encephalopathy in the construction of mechanistic models of anti-IgLON5 antibody-related encephalopathy or in the screening of therapeutic drugs. Results show that mice injected with the IgLON5 immunogen exhibit emotional, cognitive, and motor abnormalities similar to those of patients, and anti-IgLON5 antibodies are present in the mouse serum. This model can be used to study the antibody production mechanism and pathogenic mechanism of anti-IgLON5 antibody-related encephalopathy.

[0030] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0031] This invention discloses for the first time a method for constructing an active immunization animal model of anti-IgLON5 antibody-related encephalopathy, filling the gap in current research on this condition, which lacks an active immunization model. This helps to reconstruct the full picture of antibody attack on the central nervous system. Therefore, based on the study of damage to different brain regions by passively transferring IgLON5 antibodies, further establishing an active immunization animal model of anti-IgLON5 antibody-related encephalopathy will facilitate a more comprehensive phenotypic analysis of cognitive, sleep, and motor disorders. Attached Figure Description

[0032] Figure 1 The results of IgLON5 expression detection in HEK293S suspension cell lysate and cell supernatant;

[0033] Figure 2 , Figure 3 The results of coccidial staining assays show the purification efficiency of IgLON5 protein;

[0034] Figure 4The modeling process and validation results of the mouse model of anti-IgLON5 antibody-related encephalopathy are shown, including the modeling flowchart (A). Open field test: There was no statistically significant difference in the total distance traveled between the two groups of mice at one month (1M) and three months (3M) (B). Elevated cross maze: At one month, IgLON5... 1-313 Mice spent less time in the open arm (n=10, p<0.05, t-test); at three months, there was no statistically significant difference between the two groups (C). Y-maze: at one month, IgLON5 1-313 The accuracy rate of the Y-maze in mice decreased (n=10 (Control) and 11 (IgLON5)). 1-313 (p < 0.001, t-test); at three months, IgLON5 1-313 The accuracy of the mouse Y-maze decreased (n=10 and 11, p<0.01, t-test) (D). Rotamado test: At one month, there was no statistically significant difference between the two groups; at three months, IgLON5... 1-313 Mice spent less time on the rotarod (n=10, p<0.05, t-test) (E). There was no statistically significant difference in body weight between the two groups of mice (F). At one month, IgLON5... 1-313 Mouse serum tested positive for anti-IgLON5 antibody (1:600) (G). At three months, IgLON5... 1-313 Mouse serum was positive for anti-IgLON5 antibody (1:100-1:300) (H). OFT: Open Field Test; EPM: Elevated Plus Maze; RT: Rotard Test. Scale bar = 50 μm. Detailed Implementation

[0035] The present invention will now be described in detail with reference to the embodiments and accompanying drawings, but the implementation of the present invention is not limited thereto.

[0036] All reagents and raw materials used in this invention are commercially available or can be prepared according to literature methods. Experimental methods in the following examples, unless otherwise specified, are generally performed under conventional conditions as described in Sambrook et al., *Molecular Cloning: A Laboratory Guide* (New York: Cold Spring Harbor Laboratory Press, 1989), or under conventional conditions, or as recommended by the manufacturer.

[0037] Example 1: Construction of an animal model of active immunization for anti-IgLON5 antibody-related encephalopathy

[0038] I. Synthesis, purification and identification of IgLON5 protein

[0039] 1. Construction of PKN-IgLON5(1-313aa)-His(8×) plasmid

[0040] (1) Using the IgLON5 (1-939bp) sequence in pUC57-IgLON5 plasmid and the PKN-His (8×) plasmid sequence as templates, IgLON5 primers were designed according to the instructions of Vazyme's ClonExpress II One Step Cloning Kit (Table 1).

[0041] (2) Using the IgLON5 (1-939bp) sequence in pUC57-IgLON5 plasmid and the PKN-His(8x) plasmid sequence as templates, PKN-vector primers were designed (Table 1).

[0042] Table 1 PCR primer sequences

[0043]

[0044] (2) PCR amplification of IgLON5 (1-939bp) and PKN-His (8×) was performed using 2× Phanta Max Master Mix (Vazyme), with DMSO (1 / 40 of the total volume) added to the IgLON5 amplification system.

[0045] (3) Electrophoretic verification and gel extraction of PCR amplification products: The PCR amplification products were detected by agarose gel electrophoresis at 1.5% (IgLON5 fragment) and 1% (PKN fragment) (130V, 35min). The band size was verified according to the marker. The correctly positioned band was observed under UV light and extracted using the Vazyme gel extraction kit. The concentration of the recovered DNA was detected using a Nanodrop instrument, and the concentration and time were recorded. The DNA was stored at -20℃.

[0046] (4) Seamless cloning and transformation: The PKN-IgLON5(1-313aa)-His(8×) recombinant plasmid was constructed using the Vazyme ClonExpress II One Step Cloning Kit. DH5αCompetent E. coli Strain cells (50 μl) were thawed on ice. 5 μl of the crude product was added to 50 μl of competent cells, and the mixture was gently tapped to mix (without shaking). The mixture was then incubated on ice for 30 min. The cells were then heat-shocked in a 42℃ water bath for 90 seconds and immediately cooled on ice for 3-5 minutes. 900 μl of LB liquid medium (without antibiotics) was added, and the cells were incubated at 37℃ for 1 hour (200-250 rpm). The transformation product was centrifuged at 5000 rpm for 5 minutes, the supernatant was discarded, and approximately 200 μl of medium was used to resuspend the cells. The cells were then added to a plate (with ampicillin resistance) and gently spread evenly using a sterile spreader. Incubate upside down in a 37℃ incubator for 12-16 hours.

[0047] (5) Picking single clones and amplification by shaking: Add 3 ml of LB liquid medium and 3 μl (1:1000) ampicillin to a 15 ml centrifuge tube. Pick single clones with a sterile pipette tip and insert the tip into the centrifuge tube. Shake the tube at 37°C for 12 hours.

[0048] (6) Plasmid extraction: The FastPure Plasmid Mini Kit from Vazyme was used for plasmid extraction.

[0049] (7) Enzyme digestion identification: Enzyme digestion was performed using 10x FastDigest Green Buffer (Thermo Fisher Scientific). The enzyme digestion reaction system was prepared in 10 μl, as detailed in Table 2:

[0050] Table 2 Enzyme digestion reaction system

[0051]

[0052] React in a 37°C water bath for 30 min. Detect using 1% agarose gel electrophoresis (130V, 35 min).

[0053] (8) Plasmid sequencing: Select plasmid solutions with correct enzyme digestion and have them sequenced and identified by Shanghai Saiheng Biotechnology Co., Ltd.

[0054] 2. IgLON5-His(8×) protein synthesis

[0055] (1) Plasmid extraction of PKN-IgLON5(1-313aa)-His(8×): Plasmid extraction was performed using a MACHEREY-NAGEL NucleoBond Xtra Midi / Maxi. The concentration was determined using a Nanodrop instrument. The plasmid concentration was diluted to 1 mg / ml with ddH2O. The plasmid was stored at -20℃.

[0056] (2) Cell culture: HEK293S suspension cells were cultured using 293ProCD293M serum-free medium (Shanghai Yuanpei Biotechnology Co., Ltd., catalog number: H731KJ). 100 μl of cell suspension was taken for cell counting, and the required cell suspension was calculated based on the cell density to achieve a final seeding concentration of 0.5 × 10⁻⁶. 6 Cells / ml. Seed the cell suspension into a 1L fresh cell culture flask, add culture medium to a final volume of 250ml, and take 100μl of the cell suspension for cell counting. Record the cell density and date of passage. Incubate the flask at 37℃ in an 8% CO2 incubator with a shaker speed of 120rpm.

[0057] (3) Transient plasmid transfection: Two days before transfection, 293 suspension cells were seeded in a 1L cell shake flask with 250ml of culture medium at a seeding density of 0.8×10⁻⁶. 6 Cells / ml. Cell counting was performed on the day of transfection, with a cell density of 3.5-4 × 10⁻⁴. 6 Transfection was performed at a cell density of 3 × 10⁶ cells / ml. 250 μg of plasmid was diluted with 2.5 ml of serum-free medium. 1500 μg of PEI (DNA:PEI = 1:6) (Polyscience) was diluted with 2.5 ml of serum-free medium, and immediately 2.5 ml of plasmid was added to 2.5 ml of PEI and mixed well. The mixture was incubated at room temperature for 5 minutes. The plasmid / PEI mixture was then added to the cell suspension and incubated on a shaker at 37°C. Four hours after transfection, 250 ml of medium was added, mixed well, and half of the volume was transferred to a new 1 L culture flask and incubated on a shaker. Twenty-four hours after transfection, when the cell density was approximately 3 × 10⁶ cells / ml… 6 Add 500 μl of sodium valproate (Sigma) to each flask when the cell density is 3.8 mM / ml. Add 2.5 ml of D-glucose (Sangon Biotech) to each flask between 48 and 72 hours after transfection (final concentration 4 g / L). Collect the supernatant after 5-6 days of culture for protein purification.

[0058] 3. Purification of IgLON5-His(8x) protein

[0059] Protein purification was performed at 4°C using a 5ml HisCap Smart 6FF pre-packed column from Tiandi Renhe Biotechnology Co., Ltd.

[0060] (1) Prepare 500 ml each of solution A (equilibrium buffer) (7.425 ml of 1 M Tris, 15 ml of 5 M sodium chloride, 0.5 ml of 1 M DTT, and ddH2O) and solution B (elution buffer) (7.425 ml of 1 M Tris, 15 ml of 5 M sodium chloride, 0.5 ml of 1 M DTT, 62.5 ml of 2 M imidazole, and ddH2O). Filter each solution through a 0.22 μm filter membrane and store at 4 °C for later use.

[0061] (2) Collecting protein solution: Pour the cell suspension into a centrifuge bottle, centrifuge at 4000 rpm for 20 minutes at 4°C, collect the supernatant, and filter it through a 0.45 μm filter membrane. The protein solution can be temporarily stored at -20°C, and for long-term storage, it needs to be frozen at -80°C.

[0062] (3) Connect the sample tube to the protein purification instrument, start the instrument, press the fast forward button to fill the sample tube with solution A and remove air bubbles.

[0063] (4) Connect the pre-packed column to the sample loading tube, set the flow rate to 5 ml / min, and use solution A to equilibrate for at least 10 minutes.

[0064] (5) After equilibration, place the sample tube in the protein solution, set the flow rate to less than 5 ml / min, and start protein loading. Calculate the required time to prevent flow cavitation and the generation of air bubbles.

[0065] (6) Wash 50 ml of the impurities with 20 mM imidazole (92% solution A + 8% solution B) into a centrifuge tube. Elute 50 ml of the target protein with 100 mM imidazole (60% solution A + 40% solution B) into a centrifuge tube. Place the washing and elution solutions on ice.

[0066] (7) Equilibrate the pre-packed column: After purification, equilibrate the pre-packed column with 15ml of solution A, 25ml of ddH2O and 25ml of 20% ethanol in sequence, and store at 4℃.

[0067] 4. IgLON5-His(8×) protein concentrate

[0068] (1) Concentrate using a 30kDa Millipore concentrator. Add solution A to the concentrator and centrifuge at 3000xg for 5 minutes to rinse the concentrator. Add an appropriate amount of protein elution buffer to the concentrator and centrifuge at 3000xg for 20 minutes at 4°C. Repeat until all elution buffer is concentrated.

[0069] (2) Use a Nanodrop instrument to detect the concentration of protein concentrate, dispense into 1.5ml EP tubes and label them, quick-freeze in liquid nitrogen and store at -80℃.

[0070] 5. Protein purification efficiency detection

[0071] (1) Prepare a 10% SDS-PAGE gel. Load the equilibration buffer, elution buffer and washing buffer for sample loading and electrophoresis: 80V, 30min; 100V, 80min.

[0072] (2) Coomassie staining: After electrophoresis, remove the gel. Wash away the electrophoresis buffer with ddH2O and discard. Add ddH2O, microwave for 1 minute (avoid overheating to prevent gel curling), shake slowly for 3-5 minutes, and discard. Add Coomassie brilliant blue staining solution, microwave for 1 minute, shake slowly for 5-10 minutes, and recover the staining solution. Wash with ddH2O and discard. Add ddH2O, microwave for 1-2 minutes, shake slowly for 5-10 minutes, and discard. Add ddH2O again, microwave for 1-2 minutes, and wash slowly for 5-10 minutes. Develop.

[0073] 6. AKTA purifyer 10 protein chromatography system for secondary purification

[0074] The protein was purified using an AKTA purifyer 10 protein chromatography system, and the protein solvent was replaced with PBS.

[0075] (1) Clean the Superdex 200 10 / 300 chromatography column and sample loading tubing sequentially with PBS, ddH2O, NaOH, ddH2O, and PBS. Remove the sample loading needle, install a new syringe, rinse the sample loading needle and syringe with PBS, and remove air bubbles from the syringe. Draw 1 ml of PBS into the sample loop for rinsing. Slowly draw 1 ml of protein solution into the sample loop with the sample loading needle (avoiding air bubbles), and slowly and evenly push the solution into the sample loop. Set the instrument parameters: select the Superdex 200 10 / 300 program, set the flow rate to 0.5 ml / min, column pressure (MPa) to 3.0, sample loop to 1.5 ml (empty loop with 1.5 ml), and elution volume to 1.3 column volumes (length of elution 1.3 column volumes). Start the program and begin sample loading. Repeat the above steps until all protein solutions are purified.

[0076] (2) The concentration of the purified protein solution was detected using Nanodrop. A small amount was used for Coq staining, and the rest was aliquoted into 1.5ml EP tubes, labeled, and flash-frozen in liquid nitrogen and stored at -80℃.

[0077] 7. Protein spectrum identification: The final protein solution was identified by mass spectrometry by Shanghai Zhongke New Life Biotechnology Co., Ltd.

[0078] 8. Results Analysis

[0079] Western blot analysis of IgLON5 expression in HEK293S suspension cell lysates and cell supernatants confirmed successful transfection of PKN-IgLON5(1-313aa)-His(8×) in HEK293S suspension cells, and the expression of IgLON5 protein in the cell supernatant. Figure 1 ).

[0080] The successful purification of IgLON5 protein was confirmed by detecting the equilibration buffer, washing buffer, elution buffer, and elution buffer after secondary purification using the Coomassie brilliant blue staining method. Figure 2 , Figure 3 ).

[0081] Mass spectrometry sequencing confirmed that the final protein solution contained IgLON5 protein.

[0082] II. Construction of an Active Immunization Mouse Model for Anti-IgLON5 Antibody-Related Encephalopathy

[0083] 1. Preparation of Immunoemulsions

[0084] Immunoemulsions were prepared in a clean bench and used immediately after preparation. The experimental group drug was prepared by mixing protein solution and Freund's adjuvant, while the control group drug was prepared by mixing PBS and Freund's adjuvant.

[0085] (1) Full Freund's adjuvant (Chondrex, catalog number: 7023) or incomplete Freund's adjuvant (Sigma, catalog number: F5506), fully vortexed.

[0086] (2) Calculate the required protein solution dose and PBS volume to achieve a final IgLON5 protein concentration of 0.4 mg / ml. Take a 5 ml EP tube, add the corresponding doses of PBS and protein solution sequentially, and mix thoroughly.

[0087] (3) Connect the two syringes with a three-way stopcock, remove the stopcock from one of the syringes, and add the diluted protein solution to the bottom of the syringe needle. Add an equal dose of Freund's adjuvant or incomplete Freund's adjuvant and mix by pipetting. Install the stopcock, push the mixture into the other syringe, adjust the three-way stopcock connection, and slowly purge the air bubbles from the syringe.

[0088] (4) Bury the device in ice, push the two syringes back and forth to mix the emulsion, keep the frequency at about 100 times / minute, and continue for about 1 hour.

[0089] (5) Determine the endpoint of emulsion preparation: When the emulsion is dropped onto water, it should not spread within 1 minute.

[0090] (6) Push the prepared emulsion into a 1ml syringe, remove air bubbles, and place it in ice for later use.

[0091] 2. Preparation of pertussis toxin (List Labs, catalog number: 180): Add 1 ml of ddH2O to each vial to a final concentration of 50 μg / ml. Add 24 ml of PBS to a final concentration of 2 μg / ml. Aliquot into 1.5 ml EP tubes and store at 4°C.

[0092] 3. Immunization injection

[0093] (1) On day 0, mice received their first subcutaneous injection of an immunoemulsion at four sites: the shoulders and backs of both hind limbs. Each site received 50 μl of the immunoemulsion, for a total of 200 μl per mouse. The immunoemulsion injected into the experimental group consisted of a protein solution (40 μg IgLON5 protein per mouse) and a complete Freund's adjuvant mixture; the immunoemulsion injected into the control group consisted of a mixture of PBS and complete Freund's adjuvant. In addition, both the experimental and control groups received their first intraperitoneal injection of 200 ng of pertussis toxin per mouse.

[0094] (2) On day 2 (48 hours later), a second intraperitoneal injection of 200 ng / animal pertussis toxin was given.

[0095] (3) On day 14, the second subcutaneous injection of the immunoemulsion was administered at the same injection site as before. The immunoemulsion injected into the experimental group was a mixture of protein solution (40 μg IgLON5 protein / animal) and incomplete Freund's adjuvant; the immunoemulsion injected into the control group was a mixture of PBS and incomplete Freund's adjuvant.

[0096] Behavioral tests were performed on mice at the first and third month after immunization. Figure 4 A). The results showed that, compared with the control group, IgLON5-immunized mice exhibited anxiety-like behavior and spatial cognitive impairment one month after the first injection, and still showed spatial cognitive impairment three months after the first injection, along with new-onset motor disorders. Figure 4 B-4E).

[0097] Serum antibody levels were measured in mice at the first and third month after immunization. Figure 4 The results showed that, compared with the control group mice, mice immunized with IgLON5 had higher titers of serum anti-IgLON5 antibodies one month (titer 1:600) and three months (titer 1:100-1:300) after the first injection.

[0098] The above results demonstrate that the present invention successfully synthesized and purified the IgLON5 (1-313aa) protein and successfully established the world's first active immunization mouse model of anti-IgLON5 antibody-related encephalopathy.

[0099] Compared with passive immunization models, active immunization models have the following advantages:

[0100] (1) The active immunization model exhibited a broader spectrum of symptoms, with mice injected with the IgLON5 immunogen showing progressive behavioral abnormalities and persistent serum anti-IgLON5 antibodies. The symptoms exhibited by the active immunization mouse model encompassed the behavioral abnormalities of the two previously established passive immunization mouse models, including anxiety, cognitive and motor disorders.

[0101] (2) Active immunization models are more flexible in terms of modeling schemes. Different disease models can be established by adjusting the single protein injection dose, number of injections and interval time. For example, a large dose of immunogen can be given at once to establish an acute or fulminant disease model (such as an active immunization model against NMDAR encephalitis), or a small dose of immunogen can be given multiple times to establish a chronic progressive disease model (such as the dose currently used in this invention).

[0102] (3) In terms of operation and efficiency, passive immunization models require stereotactic injection of antibodies into the brain, which is difficult to operate and takes a long time to inject a single mouse, resulting in low efficiency. Active immunization models are mainly established through subcutaneous injection and intraperitoneal injection, which are easier to operate, more convenient and faster, and therefore suitable for large-scale modeling.

[0103] (4) In terms of mechanical damage to the mouse brain, the passive immunization model causes greater damage to the mouse brain tissue due to stereotactic injection and may result in local infection, while the active immunization model can avoid this situation.

[0104] In summary, active immunization models are superior to passive immunization models in simulating the disease process, presenting the full picture of the disease, modeling flexibility, operational difficulty and efficiency, and causing mechanical damage to the mouse brain. Therefore, they are beneficial for studying the disease mechanism of anti-IgLON5 antibody-related encephalopathy.

[0105] The preferred embodiments of the present invention have been described in detail above, but the present invention is not limited to the embodiments described. Those skilled in the art can make various equivalent modifications or substitutions without departing from the spirit of the present invention, and these equivalent modifications or substitutions are all included within the scope defined by the claims of this application.

Claims

1. A method for constructing an active immunization animal model of anti-IgLON5 antibody-related encephalopathy, characterized in that, Includes the following steps: A. In vitro construction of PKN-IgLON5-His recombinant plasmid Using the nucleotide sequence of IgLON5 (nucleotides 1-939) in the pUC57-IgLON5 plasmid and the PKN-His plasmid sequence as templates, primers for IgLON5 and PKN-vector were designed, respectively. The primer sequences are shown in SEQ ID NO. 1-4. PCR amplification was then performed, and the products were verified. The PKN-IgLON5-His recombinant plasmid was constructed through seamless DNA cloning and transformed into competent cells. Single clones were selected, and plasmids were extracted for enzyme digestion and sequencing identification. Nucleotides 1-939 correspond to amino acid sequences at positions 1-313 of the extracellular domain of the IgLON5 protein; the His tag is an 8×His tag; B. Synthesis and purification of recombinant IgLON5 protein PKN-IgLON5-His recombinant plasmid was extracted and diluted to 1 mg / ml with sterile double-distilled water. A certain volume of HEK293S cells was transiently transfected using the PEI method at a DNA:PEI ratio of 1:

6. Four hours after transfection, the same volume of culture medium as the cells was added, mixed well, and half of the volume was transferred to a new culture flask and placed in a shaker for incubation. Twenty-four hours after transfection, when the cell density reached 3 × 10⁶ cells / mL... 6 Add 1 / 500 volume of sodium valproate to each flask when the cell density is 1 ml; add 1 / 100 volume of D-glucose to each flask between 48-72 hours after transfection, and collect the supernatant after 5-6 days of culture for protein purification. First, a HisCap Smart 6FF pre-packed column and 30kDa concentration tube were used for the first purification and concentration. Then, an AKTA purifyer 10 protein chromatography system was used for the second purification, and the protein solvent was replaced with PBS in this step. C. Construction of an immunized mouse model Prepare an IgLON5 protein solution with a final concentration of 0.4 mg / ml using PBS, add an equal volume of complete or incomplete Freund's adjuvant, and mix thoroughly; at the same time, prepare a pertussis toxin solution with a final concentration of 2 μg / ml using PBS. Immunization injection: (1) On day 0, the first subcutaneous injection of protein and complete Freund's adjuvant immunoemulsion was given to mice at four points: the shoulders and backs of the hind limbs. At the same time, the first intraperitoneal injection of pertussis toxin was given. Each mouse was injected with a total of 40 μg of protein in 200 μl of emulsion, and the dose of pertussis toxin was 200 ng per mouse per injection. (2) On day 2, the mice were given a second intraperitoneal injection of pertussis toxin at a dose of 200 ng per mouse. (3) On day 14, a second subcutaneous injection of an immunoemulsion containing protein and incomplete Freund's adjuvant was administered, at the same injection site and dosage as before.

2. The construction method according to claim 1, characterized in that: in, In step A, PCR amplification of IgLON5 and PKN-His was performed using 2×Phanta Max Master Mix, with 1 / 40 of the total volume of DMSO added to the IgLON5 amplification system. The method for transforming competent cells is as follows: Thaw DH5α Competent E. coli Strain cells on ice, add 10 times the volume of recombinant product to competent cells, gently tap the tube wall to mix, and let stand on ice for 30 min; heat shock in a 42℃ water bath for 90 seconds, and immediately place on ice to cool for 3-5 minutes; add 180 times the volume of recombinant product in antibiotic-free LB liquid medium, and shake at 37℃ and 200-250 rpm for 1 hour; centrifuge the transformation product at 5000 rpm for 5 minutes, discard the supernatant, resuspend the cells in an appropriate amount of medium, drop it onto a plate, and gently spread it evenly on an ampicillin-resistant plate using a sterile spreader, and incubate upside down in a 37℃ incubator for 12-16 hours; Ampicillin was used for monoclonal screening. After plasmid extraction, enzyme digestion and sequencing identification, the correct plasmid solution was selected.

3. The construction method according to claim 1, characterized in that: in, In step B, the transient transfection procedure for plasmids is as follows: Two days before transfection, HEK293S suspension cells are seeded into a cell shake flask with 1 / 4 volume of culture medium at a seeding density of 0.8 × 10⁻⁶. 6 Cells / ml; cell counting was performed on the day of transfection, with a cell density of 3.5-4 × 10⁻⁴. 6 Transfection was performed at a cell / ml ratio; the plasmid was diluted with serum-free medium at a volume-to-mass ratio of 10:1, and PEI was diluted with serum-free medium at a volume-to-mass ratio of 5:3; the plasmid was immediately added to an equal volume of PEI and mixed thoroughly, with the plasmid DNA:PEI ratio of 1:6, and incubated at room temperature for 5 minutes; the plasmid / PEI mixture was added to the cell suspension and incubated on a shaker at 37°C; 4 hours after transfection, an equal volume of medium was added, mixed well, and half of the volume was transferred to another new culture flask and incubated on a shaker.

4. The construction method according to claim 1, Its features are: in, Step B, the protein purification process using a HisCap Smart 6FF pre-packed column at 4°C, is as follows: (1) Prepare the equilibrium buffer (A solution) and elution buffer (B solution), filter them separately using a 0.22 μm filter membrane, and store them at 4℃ for later use. The equilibrium solution consists of the following components by volume percentage: 5% 1M Tris buffer solution at pH 7.4, 3% 5M sodium chloride solution, 0.1% 1M DTT, and the balance being ddH₂O. The eluent consists of the following components by volume percentage: 5% 1M Tris buffer solution at pH 7.4, 3% 5M sodium chloride solution, 0.1% 1M DTT, 12.5% ​​2M imidazole, and the balance being ddH2O. (2) Collect protein solution: Pour the cell suspension into a centrifuge bottle, centrifuge at 4000 rpm for 20 minutes at 4℃, collect the supernatant, filter with a 0.45 μm filter membrane, the protein solution can be temporarily stored at -20℃, and long-term storage requires freezing at -80℃; (3) Connect the sample tube to the peristaltic pump, start the instrument, press the fast forward button to fill the sample tube with solution A, remove air bubbles, connect the pre-packed column to the sample tube, and balance the sample tube with equilibration solution for at least 10 minutes. After equilibration, set the flow rate to less than 5 ml / min, start protein loading, and prevent empty flow and air bubbles. (4) Wash 50 ml of the impurity with 20 mM imidazole washing buffer consisting of 92% A solution + 8% B solution in a centrifuge tube, and elute 50 ml of the target protein with 100 mM imidazole elution buffer consisting of 60% A solution + 40% B solution in a centrifuge tube. Both the washing buffer and the elution buffer should be placed on ice beforehand. (5) Equilibrate the pre-packed column: After purification, equilibrate the pre-packed column sequentially with 15ml of solution A, 25ml of ddH2O, and 25ml of 20% ethanol, and store at 4℃. The protein concentration process is as follows: Add equilibration buffer to the concentration tube, centrifuge at 3000×g for 5 minutes to rinse the concentration tube, add an appropriate amount of protein elution buffer to the concentration tube, and centrifuge at 3000×g for 20 minutes at 4°C; repeat the above process until all the elution buffer is concentrated.

5. The construction method according to claim 1, Its features are: In step B, the second purification using the AKTA purifyer 10 protein chromatography system is as follows: Clean the Superdex 200 10 / 300 chromatography column and sample loading tubing sequentially with PBS, ddH2O, NaOH, ddH2O, and PBS; remove the sample loading needle, install a new syringe, rinse the sample loading needle and syringe with PBS, and remove air bubbles from the syringe; Aspirate PBS into the sample loop using the sample syringe and rinse. Slowly aspirate 1 ml of protein solution into the sample loop, avoiding air bubbles, and gently and evenly push the solution into the sample loop. Set the instrument parameters: select the Superdex 200 10 / 300 program, set the flow rate to 0.5 ml / min, the column pressure to 3.0 MPa, the sample loop size to 1.5 ml, and the elution volume to 1.3 column volumes. Start the program and begin loading the sample. Repeat the above steps until all protein solutions are purified. The concentration of the purified protein solution was detected using Nanodrop. A small amount was used for Coq staining, and the remainder was aliquoted into 1.5ml EP tubes, labeled, flash-frozen in liquid nitrogen, and stored at -80℃.

6. The construction method according to claim 1, characterized in that: in, In step C, the criterion for determining complete emulsification is as follows: when the emulsion is dropped onto water, it should not spread within 1 minute. The single injection dose of IgLON5 protein per mouse per injection site is 50 μl of emulsion.

7. The application of the active immunization animal model of anti-IgLON5 antibody-related encephalopathy constructed by the construction method according to any one of claims 1 to 6 in the construction of mechanism models of anti-IgLON5 antibody-related encephalopathy or in the screening of therapeutic drugs.

Images