G protein coupled receptor class C group 5 member D (GPRC5D) specific chimeric antigen receptor

Abstract

The present invention provides a chimeric antigen receptor (CAR) comprising an antibody moiety specific for G protein coupled receptor class C group 5 member D (GPRC5D), and a polynucleotide encoding a GPRC5D specific CAR. The invention further relates to genetically engineered cells containing such GPRC5D binding receptors, and their use in adoptive cell therapy.

Description

[0001] This application is a divisional application of the invention application with the application date of October 31, 2019, Chinese application number 201980087584.1, and invention name “G protein coupled receptor class C 5 family member D (GPRC5D) specific chimeric antigen receptor”.

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of U.S. provisional application No. 62 / 754,576, filed on November 1, 2018, entitled “CHIMERICANTIGEN RECEPTORS SPECIFIC FOR GPROTEIN-COUPLED RECEPTOR CLASS C GROUP5MEMBER D (GPRC5D)”; U.S. provisional application No. 62 / 774,159, filed on November 30, 2018, entitled “CHIMERICANTIGEN RECEPTORS SPECIFIC FOR GPROTEIN-COUPLED RECEPTOR CLASS C GROUP5MEMBER D (GPRC5D)”; and U.S. provisional application No. 62 / 774,159, filed on March 15, 2019, entitled “CHIMERICANTIGEN RECEPTORS SPECIFIC FOR GPROTEIN-COUPLED RECEPTOR CLASS C GROUP5MEMBER D(GPRC5D)”; U.S. Provisional Application No. 62 / 819,422, filed on September 23, 2019, entitled “CHIMERICANTIGEN RECEPTORS SPECIFIC FOR GPROTEIN-COUPLED RECEPTOR CLASS C GROUP5MEMBER D(GPRC5D)”; and U.S. Provisional Application No. 62 / 904,197, filed on September 23, 2019, entitled “BICISTRONIC POLYNUCLEOTIDE CONSTRUCTS ENCODING CHIMERIC ANTIGEN RECEPTORS”, the contents of which are incorporated herein by reference in their entirety for all purposes.

[0004] Sequence Listing Incorporated by Reference

[0005] This application is submitted with a sequence listing in electronic format. The sequence listing is provided as a file named 735042013740SeqList.TXT, created on October 31, 2019, and is 294 kilobytes in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety. Technical Field

[0006] In some aspects, the present invention relates to a chimeric antigen receptor (CAR) containing a G protein-coupled receptor class C 5 family member D (GPRC5D) specific antibody portion, and a polynucleotide encoding a GPRC5D-specific CAR. The present invention further relates to genetically engineered cells containing such GPRC5D binding receptors, and their use in adoptive cell therapy. Background Art

[0007] G protein coupled receptor class C 5 family member D (GPRC5D) is a G protein coupled receptor whose specific function has not yet been determined. GPRC5D is highly expressed in bone marrow samples of patients with multiple myeloma (MM), but GPRC5D is least expressed in bone marrow samples of patients with other hematological malignancies. Based on the expression of GPRC5D, it can be a marker and therapeutic target for MM tumors. Various GPRC5D-binding chimeric antigen receptors (CARs) and cells expressing such CARs are available. However, there is still a need for improved GPRC5D-binding CARs and genetically engineered target cells expressing GPRC5D-CARs, for example, for use in adoptive cell therapy. The present application provides embodiments that meet such needs. Summary of the Invention

[0008] The present application provides a chimeric antigen receptor comprising: (1) an extracellular antigen-binding domain that specifically binds to human G protein-coupled receptor class C family 5 member D (GPRC5D), wherein the extracellular antigen-binding domain comprises: (i) a heavy chain variable (V H ) region, which contains the same V as shown in any one of SEQ ID NO: 21, 23, 25, 27, 29, 31 or 33 H amino acid sequences having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence of the light chain variable region; and (ii) a light chain variable (V L ) region, which contains the same V as shown in any one of SEQ ID NO: 22, 24, 26, 28, 30, 32 or 34 LThe invention further comprises a polypeptide comprising: a polypeptide having an amino acid sequence of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity; (2) a spacer of at least 125 amino acids in length; (3) a transmembrane domain; and (4) an intracellular signaling domain.

[0009] Also provided is a chimeric antigen receptor comprising: (1) an extracellular antigen-binding domain that specifically binds to human G protein-coupled receptor class C family 5 member D (GPRC5D), wherein the extracellular antigen-binding domain comprises: (i) a heavy chain variable region (V) comprising CDR-H1, CDR-H2, and CDR-H3 contained within the amino acid sequence of any one of SEQ ID NOs: 21, 23, 25, 27, 29, 31, or 33; H ); and (ii) containing V selected from any one of SEQ ID NO: 22, 24, 26, 28, 30, 32 or 34 L The light chain variable (V L ) region; (2) a spacer of at least 125 amino acids in length; (3) a transmembrane domain; and (4) an intracellular signaling region.

[0010] Also provided is a chimeric antigen receptor comprising: (1) an extracellular antigen-binding domain that specifically binds to human G protein-coupled receptor class C family 5 member D (GPRC5D), wherein the extracellular antigen-binding domain comprises: (i) a variable heavy chain (V H ), which includes a heavy chain complementary determining region 1 (CDR-H1) comprising an amino acid sequence selected from any one of SEQ ID NO: 75, 78, 80, 82, 90, 93, 95, 97, 105, 108, 110, 112, 120, 123, 125, 127, 135, 138, 140, 142, 135, 152, 162, 165, 167 or 169; (b) comprising a heavy chain complementary determining region 1 (CDR-H1) comprising an amino acid sequence selected from any one of SEQ ID NO: NO: 76, 79, 81, 83, 91, 94, 96, 98, 106, 109, 111, 113, 121, 124, 126, 128, 136, 139, 141, 143, 150, 153, 154, 155, 163, 166, 169 or 170; and (c) a heavy chain complementary determining region 3 (CDR-H3) comprising an amino acid sequence selected from any one of SEQ ID NO: 77, 84, 92, 99, 107, 114, 133, 129, 137, 144, 151, 156, 164 or 171; and (ii) a light chain variable (V L) region, which includes a light chain complementary determining region 1 (CDR-L1) comprising an amino acid sequence selected from any one of SEQ ID NO: 85, 88, 100, 103, 115, 118, 130, 133, 145, 148, 157, 160, 172 or 174; (b) a light chain complementary determining region 2 (CDR-L2) comprising an amino acid sequence selected from any one of SEQ ID NO: 86, 89, 101, 104, 116, 119, 131, 134, 146, 149, 158 or 161; and (c) a light chain complementary determining region 2 (CDR-L3) comprising an amino acid sequence selected from any one of SEQ ID NO: NO: 87, 102, 117, 132, 147, 159, 173, 175 or 297; (2) a spacer of at least 125 amino acids in length; (3) a transmembrane domain; and (4) an intracellular signal transduction region.

[0011] In some of any of the embodiments provided, the extracellular antigen binding domain of the chimeric antigen receptor contains: (i) a heavy chain variable (V H ), which contains V shown in any one of SEQ ID NO: 21, 23, 25, 27, 29, 31 or 33 H amino acid sequences having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence of the light chain variable region; and (ii) a light chain variable (V L ) region, which contains the same V as shown in any one of SEQ ID NO: 22, 24, 26, 28, 30, 32 or 34 L The amino acid sequences of the regions have amino acid sequences with at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity.

[0012] In some of any of the embodiments provided, the spacer is from or about 125 to 300 amino acids, 125 to 250 amino acids, 125 to 230 amino acids, 125 to 200 amino acids, 125 to 180 amino acids, 125 to 150 amino acids, 150 to 300 amino acids, 150 to 250 amino acids, 150 to 230 amino acids, 150 to 200 amino acids, 150 to 180 amino acids, 180 to 300 amino acids, 180 to 250 amino acids, 180 to 230 amino acids, 180 to 200 amino acids, 200 to 300 amino acids, 200 to 250 amino acids, 200 to 230 amino acids, 230 to 300 amino acids, 230 to 250 amino acids, or 250 to 300 amino acids in length. In some of any of the embodiments provided, the spacer is at least or at least about or about 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 221, 222, 223, 224, 225, 226, 227, 228, or 229 amino acids in length, or a length between any two of the foregoing values.

[0013] In some of any of the embodiments provided, the spacer is derived from an immunoglobulin. In some of any of the embodiments provided, the spacer contains sequences of a hinge region, a CH2 region, and a CH3 region. In some of any of the embodiments provided, one or more of the hinge, CH2, and CH3 are derived in whole or in part from IgG4 or IgG2, optionally human IgG4 or human IgG2. In some of any of the embodiments provided, the hinge, CH2, and CH3 are derived from IgG4. In some of any of the embodiments provided, one or more of the hinge, CH2, and CH3 are chimeric and contain sequences derived from IgG4 and IgG2. In some of any of the embodiments provided, the spacer contains an IgG4 / 2 chimeric hinge, or a modified IgG4, IgG2 / 4 chimeric CH2, and IgG4 CH3 region containing at least one amino acid substitution compared to human IgG4.

[0014] In some of any of the embodiments provided, the spacer is or contains (i) the sequence shown in SEQ ID NO: 17; (ii) a functional variant of SEQ ID NO: 17 having at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 17; or (iii) a contiguous portion of (i) or (ii) that is at least 125 amino acids in length. In some of any of the embodiments provided, the spacer is or contains the sequence shown in SEQ ID NO: 17. In some of any of the embodiments provided, the spacer is or contains a sequence encoded by the nucleotide sequence shown in SEQ ID NO: 48 (also shown in SEQ ID NO: 74).

[0015] In some of any of the provided embodiments, the V H area and the V L The V region comprises the amino acid sequences shown in SEQ ID NOs: 21 and 22, respectively, or comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NOs: 21 and 22, respectively; the V H area and the V L The V region contains the amino acid sequences as shown in SEQ ID NOs: 23 and 24, respectively, or amino acid sequences having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NOs: 23 and 24, respectively; H area and the V L The V region contains the amino acid sequences as shown in SEQ ID NOs: 25 and 26, respectively, or amino acid sequences having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NOs: 25 and 26, respectively; H area and the V L The V region contains the amino acid sequences as shown in SEQ ID NOs: 27 and 28, respectively, or amino acid sequences having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NOs: 27 and 28, respectively; H area and the V L The V region contains the amino acid sequences as shown in SEQ ID NOs: 29 and 30, respectively, or amino acid sequences having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NOs: 29 and 30, respectively; H area and the VL The V region contains the amino acid sequences as shown in SEQ ID NOs: 31 and 32, respectively, or amino acid sequences that are at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NOs: 31 and 32, respectively; or the V H area and the V L The region contains the amino acid sequences as shown in SEQ ID NOs: 33 and 34, respectively, or an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NOs: 33 and 34, respectively.

[0016] In some of any of the provided embodiments, the V H The V region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 80, 81 and 77, respectively, and the V L The V region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 85, 86 and 87, respectively; H The V region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 82, 83 and 84, respectively, and the V L The V region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 88, 89 and 87, respectively; H The V region includes CDR-H1, CDR-H2 and CDR-H3 containing the amino acid sequences of SEQ ID NOs: 95, 96 and 92, respectively, and the V L The V region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 100, 101 and 102, respectively; H The V region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 97, 98 and 99, respectively, and the V L The V region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 103, 104 and 102, respectively; H The V region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 110, 111 and 107, respectively, and the V L The V region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 115, 116 and 117, respectively; HThe V region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 112, 113 and 114, respectively, and the V L The V region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 118, 119 and 117, respectively; H The V region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 125, 126 and 122, respectively, and the V L The V region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 130, 131 and 132, respectively; H The V region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 127, 128 and 129, respectively, and the V L The V region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 133, 134 and 132, respectively; H The V region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 140, 141 and 137, respectively, and the V L The V region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 145, 146 and 147, respectively; H The V region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 142, 143 and 144, respectively, and the V L The V region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 148, 149 and 147, respectively; H The V region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 140, 154 and 151, respectively, and the V L The V region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 157, 158 and 159, respectively; H The V region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 142, 155 and 156, respectively, and the V L The V region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 160, 161 and 159, respectively; HThe V region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 167, 168 and 164, respectively, and the V L The V region includes CDR-L1, CDR-L2 and CDR-L3 containing the amino acid sequences of SEQ ID NOs: 172, 86 and 173, respectively; H The V region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 169, 170 and 171, respectively, and the V L The V region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 174, 89 and 175, respectively; or the V H The V region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 169, 170 and 171, respectively, and the V L The region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 174, 89 and 297, respectively.

[0017] In some of any of the provided embodiments, the V H area and the V L The V H area and the V L The V H area and the V L The V H area and the V L The V region contains the amino acid sequences shown in SEQ ID NOs: 27 and 28, respectively; H area and the V L The V H area and the V L The V region contains the amino acid sequences shown in SEQ ID NOs: 31 and 32, respectively; or the V H area and the V L The regions contain the amino acid sequences shown in SEQ ID NOs: 33 and 34, respectively.

[0018] In some of any of the provided embodiments, the V H area and the V LThe V region comprises the amino acid sequences shown in SEQ ID NOs: 21 and 22, respectively, or amino acid sequences having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NOs: 21 and 22, respectively; H area and the V L The V region contains the amino acid sequences shown in SEQ ID NOs: 23 and 24, respectively, or amino acid sequences having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NOs: 23 and 24, respectively; H area and the V L The V region contains the amino acid sequences shown in SEQ ID NOs: 27 and 28, respectively, or amino acid sequences that are at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NOs: 27 and 28, respectively; or the V H area and the V L The region contains the amino acid sequences set forth in SEQ ID NOs:31 and 32, or amino acid sequences that are at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NOs:31 and 32, respectively.

[0019] In some of any of the provided embodiments, the V H The V region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 80, 81 and 77, respectively, and the V L The V region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 85, 86 and 87, respectively; H The V region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 82, 83 and 84, respectively, and the V L The V region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 88, 89 and 87, respectively; H The V region includes CDR-H1, CDR-H2 and CDR-H3 containing the amino acid sequences of SEQ ID NOs: 95, 96 and 92, respectively, and the V L The V region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 100, 101 and 102, respectively; HThe V region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 97, 98 and 99, respectively, and the V L The V region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 103, 104 and 102, respectively; H The V region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 125, 126 and 122, respectively, and the V L The V region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 130, 131 and 132, respectively; H The V region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 127, 128 and 129, respectively, and the V L The V region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 133, 134 and 132, respectively; H The V region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 140, 154 and 151, respectively, and the V L The V region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 157, 158 and 159, respectively; or the V H The V region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 142, 155 and 156, respectively, and the V L The region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 160, 161 and 159, respectively.

[0020] In some of any of the provided embodiments, the V H area and the V L The V H area and the V L The V H area and the V L The V region contains the amino acid sequences shown in SEQ ID NOs: 27 and 28, respectively; or the V H area and the V L The regions contain the amino acid sequences shown in SEQ ID NOs: 31 and 32, respectively.

[0021] In some of any of the embodiments provided, the extracellular antigen binding domain cross-reacts or binds to mouse GPRC5D and / or cross-reacts or binds to cynomolgus macaque GPRC5D. In some of any of the embodiments provided, the extracellular antigen binding domain does not cross-react or bind to mouse GPRC5D or cynomolgus macaque GPRC5D.

[0022] In some of any of the provided embodiments, the V H District V L The region contains the amino acid sequences as shown in SEQ ID NOs: 27 and 28, respectively, or an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NOs: 27 and 28, respectively.

[0023] In some of any of the embodiments provided, the chimeric antigen receptor comprises: a heavy chain variable (V H ), which contains V shown in SEQ ID NO: 27 H CDR-H1, CDR-H2 and CDR-H3 contained in the amino acid sequence of the region; and light chain variable (V L ) region, which contains V shown in SEQ ID NO: 28 L In some of the embodiments provided, the V H The V region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 125, 126 and 122, respectively, and the V L The V region comprises CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 130, 131, and 132, respectively. In some of any of the embodiments provided, the V H The V region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 127, 128 and 129, respectively, and the V L The V region comprises CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 133, 134, and 132, respectively. In some of any of the embodiments provided, the V H The V region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 120, 121 and 122, respectively, and the V LThe V region comprises CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 130, 131, and 132, respectively. In some of any of the embodiments provided, the V H The V region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 123, 124 and 122, respectively, and the V L The V region comprises CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 130, 131, and 132, respectively. In some of any of the embodiments provided, the V H area and the V L The regions contain the amino acid sequences shown in SEQ ID NOs: 27 and 28, respectively.

[0024] In some of any of the provided embodiments, the extracellular antigen binding domain is a single-chain antibody fragment. In some of any of the provided embodiments, the fragment is or contains a single-chain variable fragment (scFv).

[0025] In some of any of the provided embodiments, the V H area and the V L In some of any of the provided embodiments, the V H area and the V L The V region is joined by a linker containing the amino acid sequence GGGGSGGGGSGGGGS (SEQ ID NO: 52). In some of any of the embodiments provided, the V H area and the V L In some of any of the provided embodiments, the V H area and the V L The regions are joined by a linker containing the amino acid sequence GGGGSGGGGSGGGGSGGGGS (SEQ ID NO: 320).

[0026] In some of any of the provided embodiments, the V H In the V LIn some of any of the embodiments provided, the antigen binding domain comprises an amino acid sequence selected from any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, or 13, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to an amino acid sequence selected from any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, or 13. In some of any of the embodiments provided, the antigen binding domain comprises an amino acid sequence selected from any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, or 13. In some of any of the embodiments provided, the antigen binding domain comprises an amino acid sequence selected from any one of SEQ ID NOs: 1, 3, 7, or 11, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to an amino acid sequence selected from any one of SEQ ID NOs: 1, 3, 7, or 11. In some of any of the embodiments provided, the antigen binding domain comprises an amino acid sequence selected from any one of SEQ ID NOs: 1, 3, 7, or 11. In some of any of the embodiments provided, the antigen binding domain comprises an amino acid sequence set forth in SEQ ID NO: 7, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to an amino acid sequence set forth in SEQ ID NO: 7. In some of any of the embodiments provided, the antigen binding domain comprises an amino acid sequence set forth in SEQ ID NO: 7.

[0027] In some of any of the provided embodiments, the V H In the V LIn some of any of the embodiments provided, the antigen binding domain comprises an amino acid sequence selected from any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, or 14, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to an amino acid sequence selected from any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, or 14. In some of any of the embodiments provided, the antigen binding domain comprises an amino acid sequence selected from any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, or 14. In some of any of the embodiments provided, the antigen binding domain comprises an amino acid sequence selected from any one of SEQ ID NOs: 2, 4, 8, or 12, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to an amino acid sequence selected from any one of SEQ ID NOs: 2, 4, 8, or 12. In some of any of the embodiments provided, the antigen binding domain comprises an amino acid sequence selected from any one of SEQ ID NOs: 2, 4, 8, or 12. In some of any of the embodiments provided, the antigen binding domain comprises an amino acid sequence set forth in SEQ ID NO: 8, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to an amino acid sequence set forth in SEQ ID NO: 8. In some of any of the embodiments provided, the antigen binding domain comprises an amino acid sequence set forth in SEQ ID NO: 8. In some of any of the embodiments provided, the antigen binding domain is encoded by the nucleotide sequence shown in SEQ ID NO:264.

[0028] In some of any of the embodiments provided, the intracellular signaling region contains an intracellular cytoplasmic signaling domain. In some of any of the embodiments provided, the intracellular signaling domain is capable of inducing a primary activation signal in T cells, is a T cell receptor (TCR) component and / or contains an immunoreceptor tyrosine-based activation motif (ITAM). In some of any of the embodiments provided, the intracellular signaling domain is or contains a cytoplasmic signaling domain of a CD3-zeta (CD3ζ) chain ζ chain or a functional variant thereof or a signaling portion.

[0029] In some of any of the embodiments provided, the intracellular signaling domain is human or derived from a human protein. In some of any of the embodiments provided, the intracellular signaling domain is or comprises the sequence shown in SEQ ID NO: 20 or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 20.

[0030] In some of any provided embodiments, the intracellular signal transduction district further contains costimulatory signal transduction district.In some of any provided embodiments, the costimulatory signal transduction district contains the intracellular signal transduction domain of T cell costimulatory molecules or its signal transduction moiety.In some of any provided embodiments, the costimulatory signal transduction district contains the intracellular signal transduction domain of CD28, 4-1BB or ICOS or its signal transduction moiety.In some of any provided embodiments, the costimulatory signal transduction district contains the intracellular signal transduction domain of 4-1BB or its signal transduction moiety.In some of any provided embodiments, the costimulatory signal transduction district is human or derived from human protein.In some of any provided embodiments, the costimulatory signal transduction district contains the intracellular signal transduction domain of CD28, such as the intracellular signal transduction domain of human CD28.

[0031] In some of any of the embodiments provided, the costimulatory signaling region is or contains the sequence shown in SEQ ID NO: 46 or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the sequence shown in SEQ ID NO: 46. In some of any of the embodiments provided, the costimulatory signaling region contains the intracellular signaling domain of 4-1BB. In some of any of the embodiments provided, the costimulatory signaling region is or contains the sequence shown in SEQ ID NO: 19 or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the sequence shown in SEQ ID NO: 19.

[0032] In some of the embodiments provided, the costimulatory signal transduction region is between the transmembrane domain and the intracellular signal transduction region. In some of the embodiments provided, the transmembrane domain is a transmembrane domain containing a transmembrane domain derived from CD4, CD28 or CD8. In some of the embodiments provided, the transmembrane domain is or contains a transmembrane domain derived from CD28. In some of the embodiments provided, the transmembrane domain is human or derived from human protein. In some of the embodiments provided, the transmembrane domain is or contains the sequence shown in SEQ ID NO: 18 or an amino acid sequence exhibiting at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 18.

[0033] Also provided is a chimeric antigen receptor comprising: (1) an extracellular antigen-binding domain that specifically binds to human G protein-coupled receptor class C family 5 member D (GPRC5D), wherein the extracellular antigen-binding domain comprises: (i) a heavy chain variable (V H ) region, which contains the same V as shown in SEQ ID NO: 27 H amino acid sequences having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence of the light chain variable region; and (ii) a light chain variable (V L ) region, which contains the same V as shown in SEQ ID NO: 28 L The invention further comprises the following steps: (1) a region amino acid sequence having an amino acid sequence of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity; (2) a spacer as shown in SEQ ID NO: 17; (3) a transmembrane domain derived from human CD28; and (4) an intracellular signaling region comprising the cytoplasmic signaling domain of the ζ chain of the CD3-zeta (CD3ζ) chain and the intracellular signaling domain of a T cell co-stimulatory molecule.

[0034] In some of any of the provided embodiments, the V H The region contains the V shown in SEQ ID NO: 27 H CDR-H1, CDR-H2 and CDR-H3 contained in the amino acid sequence of the V L The region contains the V shown in SEQ ID NO: 28 L CDR-L1, CDR-L2 and CDR-L3 contained in the amino acid sequence of the V HThe V region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 125, 126 and 122, respectively, and the V L The V region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 130, 131 and 132, respectively; H The V region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 127, 128 and 129, respectively, and the V L The V region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 133, 134 and 132, respectively; H The V region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 120, 121 and 122, respectively, and the V L The V region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 130, 131 and 132, respectively; or the V H The V region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 123, 124 and 122, respectively, and the V L The region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 130, 131 and 132, respectively.

[0035] Also provided is a chimeric antigen receptor comprising: (1) an extracellular antigen-binding domain that specifically binds to human G protein-coupled receptor class C family 5 member D (GPRC5D), wherein the extracellular antigen-binding domain comprises: a V sequence as shown in SEQ ID NO: 27; H The heavy chain variable (V H ) region, and containing V shown in SEQ ID NO: 28 L The light chain variable (V L ) region; or V comprising CDR-H1, CDR-H2 and CDR-H3 containing the amino acid sequences of SEQ ID NOs: 125, 126 and 122, respectively. H region, and a V region comprising CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 130, 131 and 132, respectively. LRegion; comprising CDR-H1, CDR-H2 and CDR-H3 containing the amino acid sequences of SEQ ID NO: 127, 128 and 129, respectively; H region, and V regions comprising CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 133, 134, and 132, respectively. L Region; comprising CDR-H1, CDR-H2 and CDR-H3 containing the amino acid sequences of SEQ ID NO: 120, 121 and 122, respectively; H region, and a V region comprising CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 130, 131 and 132, respectively. L or V comprising CDR-H1, CDR-H2 and CDR-H3 containing the amino acid sequences of SEQ ID NOs: 123, 124 and 122, respectively; H region, and a V region comprising CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 130, 131 and 132, respectively. L region; (2) a spacer shown in SEQ ID NO: 17; (3) a transmembrane domain derived from human CD28; and (4) an intracellular signal transduction region comprising the cytoplasmic signal transduction domain of the ζ chain of the human CD3-zeta (CD3ζ) chain and the intracellular signal transduction domain of human CD28 or human 4-1BB.

[0036] Also provided is a chimeric antigen receptor comprising: (1) an extracellular antigen-binding domain that specifically binds to human G protein-coupled receptor class C family 5 member D (GPRC5D), wherein the extracellular antigen-binding domain comprises: a V sequence as shown in SEQ ID NO: 27; H The heavy chain variable (V H ) region, and containing V shown in SEQ ID NO: 28 L The light chain variable (V L ) region; or V comprising CDR-H1, CDR-H2 and CDR-H3 containing the amino acid sequences of SEQ ID NOs: 125, 126 and 122, respectively. H region, and a V region comprising CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 130, 131 and 132, respectively. Lregion; (2) a spacer as shown in SEQ ID NO: 17; (3) a transmembrane domain derived from human CD28; and (4) an intracellular signal transduction region comprising the cytoplasmic signal transduction domain of the ζ chain of the human CD3-zeta (CD3ζ) chain and the intracellular signal transduction domain of human CD28. Also provided is a chimeric antigen receptor comprising: (1) an extracellular antigen-binding domain that specifically binds to human G protein-coupled receptor class C family 5 member D (GPRC5D), wherein the extracellular antigen-binding domain comprises: a V region comprising the V region as shown in SEQ ID NO: 27; and (2) a spacer as shown in SEQ ID NO: 17; and (3) a transmembrane domain derived from human CD28. H The heavy chain variable (V H ) region, and containing V shown in SEQ ID NO: 28 L The light chain variable (V L ) region; or V comprising CDR-H1, CDR-H2 and CDR-H3 containing the amino acid sequences of SEQ ID NOs: 125, 126 and 122, respectively. H region, and a V region comprising CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 130, 131 and 132, respectively. L region; (2) a spacer shown in SEQ ID NO: 17; (3) a transmembrane domain derived from human CD28; and (4) an intracellular signaling region comprising the cytoplasmic signaling domain of the ζ chain of the human CD3-zeta (CD3ζ) chain and the intracellular signaling domain of human 4-1BB.

[0037] In some of any of the embodiments provided, the extracellular antigen binding domain comprises V as shown in SEQ ID NO: 27. H The amino acid sequence of the region and that shown in SEQ ID NO: 28 VL and / or in some of any of the embodiments provided, the extracellular antigen binding domain comprises the scFv set forth in SEQ ID NO: 7 or SEQ ID NO: 8. In some of any of the embodiments provided, the extracellular antigen binding domain comprises the V set forth in SEQ ID NO: 27. H The amino acid sequence of the region and that shown in SEQ ID NO: 28 VL and / or in some of any of the embodiments provided, the extracellular antigen binding domain comprises the scFv set forth in SEQ ID NO: 7. In some of any of the embodiments provided, the extracellular antigen binding domain comprises the V set forth in SEQ ID NO: 27.H The amino acid sequence of the V region and the V region shown in SEQ ID NO: 28 L region amino acid sequence; and / or in some of any of the embodiments provided, the extracellular antigen binding domain contains the scFv shown in SEQ ID NO:8.

[0038] In some of any of the embodiments provided, the transmembrane domain is or contains the sequence shown in SEQ ID NO: 18, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18. In some of any of the embodiments provided, the transmembrane domain is or contains the sequence shown in SEQ ID NO: 18.

[0039] In some of any of the embodiments provided, the intracellular signaling region contains the sequence set forth in SEQ ID NO: 20, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to the sequence set forth in SEQ ID NO: 20, and the sequence set forth in SEQ ID NO: 46, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to the sequence set forth in SEQ ID NO: 46. In some of any of the embodiments provided, the intracellular signaling region is or contains the sequences set forth in SEQ ID NO: 20 and SEQ ID NO: 46. In some of any of the embodiments provided, the intracellular signaling region contains the sequence set forth in SEQ ID NO: 20, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 20, and the sequence set forth in SEQ ID NO: 19, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to the sequence set forth in SEQ ID NO: 19. In some of any of the embodiments provided, the intracellular signaling region is or contains the sequences set forth in SEQ ID NO: 20 and SEQ ID NO: 19.

[0040] In some of any of the embodiments provided, the chimeric antigen receptor contains, in order from its N-terminus to its C-terminus: an antigen binding domain, a spacer, a transmembrane domain, and an intracellular signaling region.

[0041] Also provided are polynucleotides comprising a nucleotide sequence encoding any of the chimeric antigen receptors provided herein.

[0042] In some of any of the embodiments provided, the nucleic acid encoding the spacer contains at least one modified splice donor and / or splice acceptor site containing one or more nucleotide modifications corresponding to a reference splice donor site and / or a reference splice acceptor site contained in the sequence shown in SEQ ID NO:73. In some of any of the embodiments provided, the one or more nucleotide modifications contain an amino acid substitution. In some of any of the embodiments provided, the reference splice donor and / or reference splice acceptor site is a typical, atypical, or cryptic splice site. In some of any of the embodiments provided, the splice site prediction score of the reference splice donor and / or the reference splice acceptor site is at least or at least about 0.4, 0.5, 0.6, 0.70, 0.75, 0.80, 0.85, 0.90, 0.95, 0.99 or 1.0; and / or the probability that the reference splice donor and / or the reference splice acceptor site is involved in a splicing event is predicted to be at least 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100%.

[0043] In some of any of the embodiments provided, the reference splice donor site contains the sequence aatctaagtacggac (SEQ ID NO: 176), tcaactggtacgtgg (SEQ ID NO: 177), acaattagtaaggca (SEQ ID NO: 178) and / or accacaggtgtatac (SEQ ID NO: 179); and / or the reference splice acceptor site contains the sequence aagtttctttctgtattccaggctgaccgtggataaatctc (SEQ ID NO: 180) and / or gggcaacgtgttctcttgcagtgtcatgcacgaagccctgc (SEQ ID NO: 181).

[0044] In some of any of the embodiments provided, the splice site prediction score of the reference splice donor and / or reference splice acceptor site is at least or at least about 0.70, 0.75, 0.80, 0.85, 0.90, 0.95, 0.99, or 1.0; and / or in some of any of the embodiments provided, the probability that the reference splice donor and / or reference splice acceptor site is involved in a splicing event is predicted to be at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%.

[0045] In some of any of the embodiments provided, the reference splice donor site contains the sequence tcaactggtacgtgg (SEQ ID NO: 177); and / or the reference splice acceptor site contains the sequence aagtttctttctgtattccaggctgaccgtggataaatctc (SEQ ID NO: 180).

[0046] In some of any of the embodiments provided, at least one of the one or more nucleotide modifications is within 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 residues of a splice site junction of a reference splice acceptor and / or a reference splice donor site.

[0047] In some of any of the embodiments provided, the one or more nucleotide modifications are silent, and / or generate degenerate codons compared to SEQ ID NO: 73, and / or do not change the amino acid sequence of the encoded spacer.

[0048] In some of any of the embodiments provided, the modified splice donor site is as set forth in agtctaaatacggac (SEQ ID NO: 182), tcaactggtatgtgg (SEQ ID NO: 183), accatctccaaggcc (SEQ ID NO: 184), and / or gccccaggtttacac (SEQ ID NO: 185); and / or the modified splice acceptor site is as set forth in cagtttcttcctgtatagtagactcaccgtggataaatcaa (SEQ ID NO: 186), gggcaacgtgttcagctgcagcgtgatgcacgaggccctgc (SEQ ID NO: 187), and / or cgccttgtcctccttgtcccgctcctcctgttgccggacct (SEQ ID NO: 188). In some of any of the embodiments provided, the modified splice donor site is as set forth in tcaactggtatgtgg (SEQ ID NO: 183), and / or the modified acceptor site is as set forth in cagtttcttcctgtatagtagactcaccgtggataaatcaa (SEQ ID NO: 186) and / or cgccttgtcctccttgtcccgctcctcctgttgccggacct (SEQ ID NO: 188).

[0049] In some of any of the embodiments provided, the spacer is by the nucleotide sequence shown in SEQ ID NO:74 (also as shown in SEQ ID NO:48) or its partial encoding. In some of any of the embodiments provided, the spacer is by the nucleotide sequence shown in SEQ ID NO:73 or its partial encoding. In some of any of the embodiments provided, the spacer is by the nucleotide sequence shown in SEQ ID NO:74 or its partial encoding. In some of any of the embodiments provided, the spacer is by the nucleotide sequence set forth in SEQ ID NO:283 or its partial encoding. In some of any of the embodiments provided, the spacer is by the nucleotide sequence set forth in SEQ ID NO:284 or its partial encoding. In some of any of the embodiments provided, the spacer is by the nucleotide sequence set forth in SEQ ID NO:305 or its partial encoding.

[0050] In some of any of the provided embodiments, when the polynucleotide is expressed in a cell, RNA, optionally messenger RNA (mRNA), transcribed from the polynucleotide exhibits at least 70%, 75%, 80%, 85%, 90%, or 95% RNA homogeneity.

[0051] In some of any of the provided embodiments, when expressed in a cell, RNA, optionally messenger RNA (mRNA), transcribed from the polynucleotide exhibits reduced heterogeneity compared to the heterogeneity of mRNA transcribed from a reference polynucleotide encoding the same amino acid sequence as the polynucleotide, wherein the reference polynucleotide differs in the presence of one or more splice donor sites and / or one or more splice acceptor sites in the nucleic acid encoding the spacer, and / or contains one or more nucleotide modifications compared to the polynucleotide, and / or contains the spacer set forth in SEQ ID NO: 73. In some of any of the provided embodiments, the reduction in RNA heterogeneity is greater than or about 10%, 15%, 20%, 25%, 30%, 40%, 50% or more. In some of any of the provided embodiments, RNA, optionally messenger RNA (mRNA) transcribed from the reference polynucleotide exhibits greater than or about 10%, 15%, 20%, 25%, 30%, 40%, 50% or more RNA heterogeneity. In some of any of the provided embodiments, RNA homogeneity and / or heterogeneity is determined by agarose gel electrophoresis, chip-based capillary electrophoresis, analytical ultracentrifugation, field flow fractionation, or liquid chromatography.

[0052] In some of any of the provided embodiments, the polynucleotide is codon-optimized for expression in human cells.

[0053] In some of any provided embodiments, the chimeric receptor is a first chimeric receptor and the polynucleotide further contains a nucleotide sequence encoding a second chimeric antigen receptor. Therefore, the application also provides polynucleotides encoding a first chimeric receptor (including any chimeric receptor as provided herein) and a second chimeric receptor for GPRC5D. In some of any provided embodiments, the first chimeric receptor and the second chimeric receptor are separated by one or more polycistronic components. In some of any provided embodiments, the one or more polycistronic components are or contain a ribosome skipping sequence. In some embodiments, the ribosome skipping sequence is a T2A, P2A, E2A or F2A component. In some of any provided embodiments, the one or more polycistronic components contain the amino acid sequence shown in SEQ ID NO:37. In some of any provided embodiments, the one or more polycistronic components are encoded by a nucleotide sequence selected from SEQ ID NO:44, 45, 319. In some of any provided embodiments, the nucleotide sequence encoding the one or more polycistronic components is codon divergent. In some of any of the provided embodiments, the nucleotide sequence encoding T2A is codon divergent. In some of any of the provided embodiments, the nucleotide sequence encoding T2A is or comprises the sequence set forth in SEQ ID NO:319.

[0054] In some of any provided embodiments, the second chimeric receptor contains a second antigen expressed on or associated with multiple myeloma, such as an extracellular antigen binding domain of a second antigen that is not GPRC5D. In some of any provided embodiments, the second CAR contains an extracellular antigen binding domain, a spacer, a transmembrane domain, and an intracellular signal transduction region with reference to a second antigen. In some of any provided embodiments, the second antigen is selected from B cell maturation antigen (BCMA), CD38, CD138, CS-1, BAFF-R, TACI, or FcRH5. In some of any provided embodiments, the second antigen is BCMA.

[0055] In some of any of the embodiments provided, the second CAR contains: (1) an extracellular antigen binding domain that specifically binds to BCMA, wherein the extracellular antigen binding domain contains: (i) a heavy chain variable (V H ) region, which contains the same V sequence as that shown in any one of SEQ ID NO: 189, 191, 193, 195 or 197 H amino acid sequences having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence of the light chain variable region; and (ii) a light chain variable (VL ) region, which contains the same V as shown in any one of SEQ ID NO: 190, 192, 194, 196 or 198 L In some of the embodiments provided, the V domain of the second CAR has an amino acid sequence with at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity; (2) a spacer; (3) a transmembrane domain; and (4) an intracellular signaling region. H The region contains the V sequence shown in any one of SEQ ID NOs: 189, 191, 193, 195, or 197. H CDR-H1, CDR-H2 and CDR-H3 contained in the amino acid sequence of the V region; and L The region contains V shown in any one of SEQ ID NO: 190, 192, 194, 196 or 198 L CDR-L1, CDR-L2 and CDR-L3 contained in the amino acid sequence of the region.

[0056] In some of any of the embodiments provided, the second CAR contains: (1) an extracellular antigen binding domain that specifically binds to BCMA, wherein the extracellular antigen binding domain contains: (i) a heavy chain variable (V H ), which includes a heavy chain complementary determining region 1 (CDR-H1) comprising an amino acid sequence selected from any one of SEQ ID NO: 199, 202, 206, 209, 212 or 215; (b) a heavy chain complementary determining region 2 (CDR-H2) comprising an amino acid sequence selected from any one of SEQ ID NO: 200, 203, 207, 210, 213 or 216; and (c) a heavy chain complementary determining region 3 (CDR-H3) comprising an amino acid sequence selected from any one of SEQ ID NO: 201, 204, 205, 208, 211, 214 or 217; and (ii) a light chain variable (V L) region, which includes a light chain complementary determining region 1 (CDR-L1) comprising an amino acid sequence selected from any one of SEQ ID NOs: 218, 221, 224, 227, 230, 233, or 235; (b) a light chain complementary determining region 2 (CDR-L2) comprising an amino acid sequence selected from any one of SEQ ID NOs: 219, 222, 225, 228, 231, 234, or 236; and (c) a light chain complementary determining region 3 (CDR-L3) comprising an amino acid sequence selected from any one of SEQ ID NOs: 220, 223, 226, 229, or 232; (2) a spacer; (3) a transmembrane domain; and (4) an intracellular signaling region. In some of any of the embodiments provided, the second CAR contains: (1) an extracellular antigen binding domain that specifically binds to BCMA, wherein the extracellular antigen binding domain contains: (i) a heavy chain variable (V H ), which includes a heavy chain complementary determining region 1 (CDR-H1) comprising an amino acid sequence selected from any one of SEQ ID NO: 199, 202, 206, 209, 212 or 215; (b) a heavy chain complementary determining region 2 (CDR-H2) comprising an amino acid sequence selected from any one of SEQ ID NO: 200, 203, 207, 210, 213 or 216; and (c) a heavy chain complementary determining region 3 (CDR-H3) comprising an amino acid sequence selected from any one of SEQ ID NO: 201, 204, 205, 208, 211, 214 or 217; and (ii) a light chain variable (V L ) region, which includes a light chain complementary determining region 1 (CDR-L1) comprising an amino acid sequence selected from any one of SEQ ID NO: 218, 221, 224, 227, 230, 233 or 235; (b) a light chain complementary determining region 2 (CDR-L2) comprising an amino acid sequence selected from any one of SEQ ID NO: 219, 222, 225, 228, 231, 234 or 236; and (c) a light chain complementary determining region 3 (CDR-L3) comprising an amino acid sequence selected from any one of SEQ ID NO: 220, 223, 226, 229 or 232; (2) a spacer shown in SEQ ID NO: 17; (3) a transmembrane domain derived from human CD28; and (4) an intracellular signaling region comprising the cytoplasmic signaling domain of the zeta chain of the human CD3-zeta (CD3ζ) chain and the intracellular signaling domain of human 4-1BB. In some of any of the provided embodiments, the V of the second CAR H The region contains the V shown in any one of SEQ ID NO: 197 H CDR-H1, CDR-H2 and CDR-H3 contained in the amino acid sequence of the V region; and LThe region contains the V shown in any one of SEQ ID NO: 198 L In some of the embodiments provided, the second CAR is or comprises the amino acid sequence set forth in SEQ NO: 251. In some of the embodiments provided, the second CAR is encoded by the nucleotide sequence set forth in SEQ NO: 246.

[0057] In some of any of the embodiments provided, the second CAR contains: (1) an extracellular antigen binding domain that specifically binds to BCMA, wherein the extracellular antigen binding domain contains: (i) a heavy chain variable (V H ), which includes a heavy chain complementary determining region 1 (CDR-H1) comprising an amino acid sequence selected from any one of SEQ ID NO: 199, 202, 206, 209, 212 or 215; (b) a heavy chain complementary determining region 2 (CDR-H2) comprising an amino acid sequence selected from any one of SEQ ID NO: 200, 203, 207, 210, 213 or 216; and (c) a heavy chain complementary determining region 3 (CDR-H3) comprising an amino acid sequence selected from any one of SEQ ID NO: 201, 204, 205, 208, 211, 214 or 217; and (ii) a light chain variable (V L ) region, which includes a light chain complementary determining region 1 (CDR-L1) comprising an amino acid sequence selected from any one of SEQ ID NO: 218, 221, 224, 227, 230, 233 or 235; (b) a light chain complementary determining region 2 (CDR-L2) comprising an amino acid sequence selected from any one of SEQ ID NO: 219, 222, 225, 228, 231, 234 or 236; and (c) a light chain complementary determining region 3 (CDR-L3) comprising an amino acid sequence selected from any one of SEQ ID NO: 220, 223, 226, 229 or 232; (2) a spacer; (3) a transmembrane domain; and (4) an intracellular signal transduction region.

[0058] In some of any of the provided embodiments, the V of the second CAR H The V region of the second CAR includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 199, 200 and 201, respectively, and the V L The V region of the second CAR includes CDR-L1, CDR-L2 and CDR-L3 containing the amino acid sequences of SEQ ID NO: 218, 219 and 220, respectively; HThe region includes CDR-H1, CDR-H2 and CDR-H3 containing the amino acid sequences of SEQ ID NOs: 202, 203 and 204, respectively, and the V L The V region of the second CAR includes CDR-L1, CDR-L2 and CDR-L3 containing the amino acid sequences of SEQ ID NO: 221, 222 and 223, respectively; H The region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 199, 200 and 205, respectively, and the V L The V region of the second CAR includes CDR-L1, CDR-L2 and CDR-L3 containing the amino acid sequences of SEQ ID NOs: 224, 225 and 226, respectively; H The region includes CDR-H1, CDR-H2 and CDR-H3 containing the amino acid sequences of SEQ ID NOs: 206, 207 and 208, respectively, and the V L The V region of the second CAR includes CDR-L1, CDR-L2 and CDR-L3 containing the amino acid sequences of SEQ ID NO: 227, 228 and 229, respectively; H The region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 209, 210 and 211, respectively, and the V L The V region of the second CAR includes CDR-L1, CDR-L2 and CDR-L3 containing the amino acid sequences of SEQ ID NO: 230, 231 and 232, respectively; H The region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 212, 213 and 214, respectively, and the V L The V region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 233, 234 and 229, respectively; or the V region of the second CAR H The region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 215, 216 and 217, respectively, and the V L The region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 235, 236 and 232, respectively.

[0059] In some of any of the provided embodiments, the V encoding the second CAR HThe second CAR comprises a CDR-H1, a CDR-H2 and a CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 209, 210 and 211, respectively, and the V L The V region of the second CAR comprises CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 230, 231 and 232, respectively; or the V region of the second CAR H The second CAR comprises a CDR-H1, a CDR-H2 and a CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 215, 216 and 217, respectively, and the V L The V region comprises CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 235, 236, and 232, respectively. In some of any of the embodiments provided, the V region encoding the second CAR H The second CAR comprises a CDR-H1, a CDR-H2 and a CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 209, 210 and 211, respectively, and the V L The V region of the second CAR comprises CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 230, 231, and 232, respectively. In some of any of the embodiments provided, the V region of the second CAR comprises CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 230, 231, and 232, respectively. H The second CAR comprises a CDR-H1, a CDR-H2 and a CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 215, 216 and 217, respectively, and the V L The region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 235, 236 and 232, respectively.

[0060] In some of any of the provided embodiments, the V encoding the second CAR H Area and V L The V region of the second CAR contains the amino acid sequences as shown in SEQ ID NO: 189 and SEQ ID NO: 190, respectively, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 189 and SEQ ID NO: 190; the V region of the second CAR contains the amino acid sequences as shown in SEQ ID NO: 189 and SEQ ID NO: 190, respectively, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 189 and SEQ ID NO: 190; H Area and V LThe V region of the second CAR comprises the amino acid sequences as shown in SEQ ID NO: 191 and SEQ ID NO: 192, respectively, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 191 and SEQ ID NO: 192; the V region of the second CAR comprises the amino acid sequences as shown in SEQ ID NO: 191 and SEQ ID NO: 192, respectively, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 191 and SEQ ID NO: 192; H Area and V L The V region of the second CAR contains the amino acid sequences as shown in SEQ ID NO: 193 and SEQ ID NO: 194, respectively, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 193 and SEQ ID NO: 194; the V region of the second CAR contains the amino acid sequences as shown in SEQ ID NO: 193 and SEQ ID NO: 194, respectively, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 193 and SEQ ID NO: 194; H Area and V L The V region of the second CAR contains the amino acid sequence as shown in SEQ ID NO: 195 and SEQ ID NO: 196, respectively, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 195 and SEQ ID NO: 196; or the V region of the second CAR H Area and V L The region contains the amino acid sequences as shown in SEQ ID NO:197 and SEQ ID NO:198, respectively, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:197 and SEQ ID NO:198.

[0061] In some of any of the provided embodiments, the V encoding the second CAR H Area and V L The V region of the second CAR contains the amino acid sequences shown in SEQ ID NO: 189 and SEQ ID NO: 190 respectively; H Area and V L The V region of the second CAR contains the amino acid sequence shown in SEQ ID NO: 191 and SEQ ID NO: 192; H Area and V L The V region of the second CAR contains the amino acid sequence shown in SEQ ID NO: 193 and SEQ ID NO: 194; H Area and V L The V region of the second CAR contains the amino acid sequence shown in SEQ ID NO: 195 and SEQ ID NO: 196; or the V region of the second CAR H Area and VL The V region of the second CAR comprises the amino acid sequence shown in SEQ ID NO: 197 and SEQ ID NO: 198, respectively. In some of any of the embodiments provided, the V region of the second CAR H Area and V L The regions contain the amino acid sequences shown in SEQ ID NO: 197 and SEQ ID NO: 198, respectively.

[0062] In some of any provided embodiments, the extracellular antigen binding domain of the encoded second CAR is a single-chain antibody fragment. In some of any provided embodiments, the encoded fragment is or contains a single-chain variable fragment (scFv). In some of any provided embodiments, the V domain of the encoded second CAR is or contains a single-chain variable fragment (scFv). H Area and V L In some of the embodiments provided, the encoded second CAR scFv comprises a linker comprising the amino acid sequence GGGGSGGGGSGGGGS (SEQ ID NO: 52). In some of the embodiments provided, the encoded second CAR scFv comprises a linker comprising the amino acid sequence GGGGSGGGGSGGGGSGGGGS (SEQ ID NO: 320). In some of the embodiments provided, the encoded second CAR V H District V L In some of any of the embodiments provided, the V in the encoded second CAR is H District V L The carboxyl terminus of the region.

[0063] In some of any of the embodiments provided, the antigen binding domain of the encoded second CAR contains an amino acid sequence selected from any one of SEQ ID NOs: 227, 238, 239, 240, or 241, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to an amino acid sequence selected from any one of SEQ ID NOs: 227, 238, 239, 240, or 241. In some of any of the embodiments provided, the antigen binding domain of the encoded second CAR contains an amino acid sequence selected from any one of SEQ ID NOs: 227, 238, 239, 240, or 241. In some of any of the embodiments provided, the antigen binding domain of the encoded second CAR comprises the amino acid sequence set forth in SEQ ID NO: 241, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 241. In some of any of the embodiments provided, the antigen binding domain of the encoded second CAR comprises the amino acid sequence set forth in SEQ ID NO: 241.

[0064] In some of any of the provided embodiments, the V of the second CAR H The region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 209, 210 and 211, respectively, and the V L The V region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 230, 231 and 232, respectively; or the V region of the second CAR H The region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 215, 216 and 217, respectively, and the V L The V region comprises CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 235, 236 and 232, respectively; and / or the V region of the second CAR H Area and V LThe V region of the second CAR comprises the amino acid sequence shown in SEQ ID NO: 197 and SEQ ID NO: 198, respectively; and / or the antigen binding domain of the second CAR comprises the amino acid sequence shown in SEQ ID NO: 241 or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the sequence shown in SEQ ID NO: 241. In some of any of the embodiments provided, the V region of the second CAR comprises the amino acid sequence shown in SEQ ID NO: 197 and SEQ ID NO: 198, respectively; and / or the antigen binding domain of the second CAR comprises the amino acid sequence shown in SEQ ID NO: 241 or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the sequence H The region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 209, 210 and 211, respectively, and the V L The V region comprises CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 230, 231 and 232, respectively; and / or the V region of the second CAR H Area and V L The V region of the second CAR comprises the amino acid sequence shown in SEQ ID NO: 197 and SEQ ID NO: 198, respectively; and / or the antigen binding domain of the second CAR comprises the amino acid sequence shown in SEQ ID NO: 241 or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the sequence shown in SEQ ID NO: 241. In some of any of the embodiments provided, the V region of the second CAR comprises the amino acid sequence shown in SEQ ID NO: 197 and SEQ ID NO: 198, respectively; and / or the antigen binding domain of the second CAR comprises the amino acid sequence shown in SEQ ID NO: 241 or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the sequence H The region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 215, 216 and 217, respectively, and the V L The V region comprises CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 235, 236 and 232, respectively; and / or the V region of the second CAR H Area and V L The antigen binding domain of the second CAR comprises the amino acid sequence shown in SEQ ID NO: 241 or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the sequence shown in SEQ ID NO: 241.

[0065] In some of any of the embodiments provided, the transmembrane domain of the encoded second CAR is or contains a transmembrane domain derived from CD4, CD28, or CD8, optionally from human CD4, human CD28, or human CD8.

[0066] In some of any of the embodiments provided, the transmembrane domain of the encoded second CAR is or contains a transmembrane domain derived from human CD28, and / or is or contains the sequence shown in SEQ ID NO: 18 or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 18. In some of any of the embodiments provided, the transmembrane domain of the encoded second CAR is or contains the sequence shown in SEQ ID NO: 18.

[0067] In some of the embodiments provided, the intracellular signal transduction region of the encoded second CAR contains an intracellular signal transduction domain. In some of the embodiments provided, the intracellular signal transduction domain of the encoded second CAR can induce primary activation signals in T cells, T cell receptor (TCR) components and / or contain immunoreceptor tyrosine activation motifs (ITAMs). In some of the embodiments provided, the intracellular signal transduction domain of the encoded second CAR is or contains the ζ chain of the CD3-zeta (CD3ζ) chain or its functional variant or signal transduction portion, optionally the cytoplasmic signal transduction domain of the human CD3ζ chain. In some of the embodiments provided, the intracellular signal transduction region of the encoded second CAR contains the sequence shown in SEQ ID NO:20 or an amino acid sequence with SEQ ID NO:20 having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity.

[0068] In some of the embodiments provided, the intracellular signal transduction region of the second CAR of coding further contains a costimulatory signal transduction region. In some of the embodiments provided, the costimulatory signal transduction region of the second CAR of coding contains the intracellular signal transduction domain of T cell costimulatory molecules or its signal transduction portion. In some of the embodiments provided, the costimulatory signal transduction region of the second CAR of coding contains CD28, 4-1BB or ICOS or its signal transduction portion, optionally the intracellular signal transduction domain of human CD28, human 4-1BB or human ICOS. In some of the embodiments provided, the costimulatory signal transduction region of the second CAR of coding contains the intracellular signal transduction domain of 4-1BB or its signal transduction portion. In some of the embodiments provided, at least one of the first chimeric antigen receptor and the second chimeric antigen receptor includes an intracellular signal transduction domain containing 4-1BB or its signal transduction portion, optionally the intracellular signal transduction domain of the intracellular signal transduction domain of human 4-1BB.

[0069] In some of any of the embodiments provided, the costimulatory signaling region of the encoded second CAR contains: the intracellular signaling domain of human CD28; and / or the sequence shown in SEQ ID NO: 46, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the sequence shown in SEQ ID NO: 46.

[0070] In some of any of the embodiments provided, the costimulatory signaling region of the encoded second CAR contains: the intracellular signaling domain of human 4-1BB; and / or the sequence shown in SEQ ID NO: 19, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the sequence shown in SEQ ID NO: 19.

[0071] In some of any of the embodiments provided, the encoded second chimeric antigen receptor contains, in order from its N-terminus to its C-terminus: an antigen binding domain, a spacer, a transmembrane domain, and an intracellular signaling region.

[0072] In some of any of the embodiments provided, at least one of the polynucleotide sequence encoding the first chimeric antigen receptor and the polynucleotide sequence encoding the second chimeric antigen receptor is codon divergent. In some of any of the embodiments provided, the polynucleotide sequence encoding the first chimeric antigen receptor and the polynucleotide sequence encoding the second chimeric antigen receptor have no more than about 30, no more than about 20, or no more than about 10 consecutive base pairs of sequence homology.

[0073] In some of any of the embodiments provided, the nucleotide sequence encoding the CAR is operably linked to a promoter to control expression of the encoded CAR when expressed by a cell into which the polynucleotide is introduced, optionally wherein the promoter is a heterologous promoter, optionally wherein the heterologous promoter is or contains the human elongation factor 1 alpha (EF1 alpha) promoter or the MND promoter or a variant thereof.

[0074] In some of the embodiments provided in which the polynucleotide encodes two CARs, the nucleotide sequence encoding the first CAR is operably linked to a first promoter to control the expression of the first CAR when expressed by a cell into which the polynucleotide is introduced, and the nucleotide sequence encoding the second CAR is operably linked to a second promoter to control the expression of the second CAR when expressed by a cell into which the polynucleotide is introduced. In some embodiments, the first promoter and the second promoter are independently heterologous promoters, such as wherein the heterologous promoter is or contains human elongation factor 1 alpha (EF1 alpha) promoter or MND promoter or a variant thereof. In some such embodiments, the first promoter is identical to the second promoter. In some such embodiments, the first promoter is different from the second promoter.

[0075] Also provided are vectors containing any of the provided polynucleotides. In some of any of the provided embodiments, the vector is a viral vector. In some of any of the provided embodiments, the viral vector is a lentiviral vector or a retroviral vector.

[0076] Also provided are genetically engineered cells containing any of the chimeric antigen receptors provided herein. In some of any of the provided embodiments, the genetically engineered cells contain a chimeric antigen receptor provided herein and further include a polynucleotide containing a nucleotide sequence encoding a second chimeric antigen receptor.

[0077] Also provided are genetically engineered cells containing any of the polynucleotides provided herein.

[0078] In some of any provided embodiments, the second chimeric receptor of the cell provided contains an extracellular antigen binding domain specifically binding to a second antigen expressed on or associated with multiple myeloma. In some of any provided embodiments, the second CAR contains an extracellular antigen binding domain, a spacer, a transmembrane domain, and an intracellular signal transduction region with reference to a second antigen. In some of any such embodiments, the second antigen is selected from B cell maturation antigen (BCMA), CD38, CD138, CS-1, BAFF-R, TACI, or FcRH5. In some of any provided embodiments, the second antigen is BCMA.

[0079] In some of any of the provided embodiments of the genetically engineered cell, the second CAR contains: (1) an extracellular antigen binding domain that specifically binds to BCMA, wherein the extracellular antigen binding domain contains: (i) a heavy chain variable (V H ) region, which contains the same V as shown in any one of SEQ ID NO: 189, 191, 193, 195 or 197 Hamino acid sequences having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence of the light chain variable region; and (ii) a light chain variable (V L ) region, which contains the same V as shown in any one of SEQ ID NO: 190, 192, 194, 196 or 198 L In some such embodiments, V H The region includes a V sequence shown in any one of SEQ ID NOs: 189, 191, 193, 195, or 197. H CDR-H1, CDR-H2 and CDR-H3 contained in the amino acid sequence of the V region; and L The region contains V shown in any one of SEQ ID NO: 190, 192, 194, 196 or 198 L CDR-L1, CDR-L2 and CDR-L3 contained in the amino acid sequence of the region.

[0080] In some of any of the provided embodiments of the genetically engineered cell, the second CAR contains: (1) an extracellular antigen binding domain that specifically binds to BCMA, wherein the extracellular antigen binding domain contains: (i) a heavy chain variable (V H ), which includes a heavy chain complementary determining region 1 (CDR-H1) comprising an amino acid sequence selected from any one of SEQ ID NO: 199, 202, 206, 209, 212 or 215; (b) a heavy chain complementary determining region 2 (CDR-H2) comprising an amino acid sequence selected from any one of SEQ ID NO: 200, 203, 207, 210, 213 or 216; and (c) a heavy chain complementary determining region 3 (CDR-H3) comprising an amino acid sequence selected from any one of SEQ ID NO: 201, 204, 205, 208, 211, 214 or 217; and (ii) a light chain variable (V L) region, which includes a light chain complementary determining region 1 (CDR-L1) comprising an amino acid sequence selected from any one of SEQ ID NO: 218, 221, 224, 227, 230, 233 or 235; (b) a light chain complementary determining region 2 (CDR-L2) comprising an amino acid sequence selected from any one of SEQ ID NO: 219, 222, 225, 228, 231, 234 or 236; and (c) a light chain complementary determining region 3 (CDR-L3) comprising an amino acid sequence selected from any one of SEQ ID NO: 220, 223, 226, 229 or 232; (2) a spacer; (3) a transmembrane domain; and (4) an intracellular signal transduction region.

[0081] In some of any of the provided embodiments of the genetically engineered cell, the V of the second CAR H The V region of the second CAR includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 199, 200 and 201, respectively, and the V L The V region of the second CAR includes CDR-L1, CDR-L2 and CDR-L3 containing the amino acid sequences of SEQ ID NO: 218, 219 and 220, respectively; H The region includes CDR-H1, CDR-H2 and CDR-H3 containing the amino acid sequences of SEQ ID NOs: 202, 203 and 204, respectively, and the V L The V region of the second CAR includes CDR-L1, CDR-L2 and CDR-L3 containing the amino acid sequences of SEQ ID NO: 221, 222 and 223, respectively; H The region includes CDR-H1, CDR-H2 and CDR-H3 containing the amino acid sequences of SEQ ID NOs: 199, 200 and 205, respectively, and the V L The V region of the second CAR includes CDR-L1, CDR-L2 and CDR-L3 containing the amino acid sequences of SEQ ID NOs: 224, 225 and 226, respectively; H The region includes CDR-H1, CDR-H2 and CDR-H3 containing the amino acid sequences of SEQ ID NOs: 206, 207 and 208, respectively, and the V L The V region of the second CAR includes CDR-L1, CDR-L2 and CDR-L3 containing the amino acid sequences of SEQ ID NO: 227, 228 and 229, respectively; H The region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 209, 210 and 211, respectively, and the V LThe V region of the second CAR includes CDR-L1, CDR-L2 and CDR-L3 containing the amino acid sequences of SEQ ID NO: 230, 231 and 232, respectively; H The region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 212, 213 and 214, respectively, and the V L The V region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 233, 234 and 229, respectively; or the V region of the second CAR H The V region of the second CAR includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 215, 216 and 217, respectively, and the V L The region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 235, 236 and 232, respectively.

[0082] In some of any of the provided embodiments of the genetically engineered cell, the V of the second CAR H The region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 209, 210 and 211, respectively, and the V L The V region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 230, 231 and 232, respectively; or the V region of the second CAR H The region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 215, 216 and 217, respectively, and the V L The region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 235, 236 and 232, respectively.

[0083] In some of any of the provided embodiments of the genetically engineered cell, the V of the second CAR H Area and V L The V region of the second CAR contains the amino acid sequences as shown in SEQ ID NO: 189 and SEQ ID NO: 190, respectively, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 189 and SEQ ID NO: 190; the V region of the second CAR contains the amino acid sequences as shown in SEQ ID NO: 189 and SEQ ID NO: 190, respectively, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 189 and SEQ ID NO: 190; H Area and V LThe V region of the second CAR comprises the amino acid sequences as shown in SEQ ID NO: 191 and SEQ ID NO: 192, respectively, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 191 and SEQ ID NO: 192; the V region of the second CAR comprises the amino acid sequences as shown in SEQ ID NO: 191 and SEQ ID NO: 192, respectively, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 191 and SEQ ID NO: 192; H Area and V L The V region of the second CAR contains the amino acid sequences as shown in SEQ ID NO: 193 and SEQ ID NO: 194, respectively, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 193 and SEQ ID NO: 194; the V region of the second CAR contains the amino acid sequences as shown in SEQ ID NO: 193 and SEQ ID NO: 194, respectively, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 193 and SEQ ID NO: 194; H Area and V L The V region of the second CAR contains the amino acid sequence as shown in SEQ ID NO: 195 and SEQ ID NO: 196, respectively, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 195 and SEQ ID NO: 196; or the V region of the second CAR H Area and V L The region contains the amino acid sequences as shown in SEQ ID NO:197 and SEQ ID NO:198, respectively, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:197 and SEQ ID NO:198.

[0084] In some of any of the provided embodiments of the genetically engineered cell, the V of the second CAR H Area and V L The V region of the second CAR contains the amino acid sequences shown in SEQ ID NO: 189 and SEQ ID NO: 190 respectively; H Area and V L The V region of the second CAR contains the amino acid sequence shown in SEQ ID NO: 191 and SEQ ID NO: 192; H Area and V L The V region of the second CAR contains the amino acid sequence shown in SEQ ID NO: 193 and SEQ ID NO: 194; H Area and V L The V region of the second CAR contains the amino acid sequence shown in SEQ ID NO: 195 and SEQ ID NO: 196; or HArea and V L The regions contain the amino acid sequences shown in SEQ ID NO: 197 and SEQ ID NO: 198, respectively.

[0085] In some of any provided embodiments of genetically engineered cells, the extracellular antigen-binding domains of the second CAR are single-chain antibody fragments. In some of any such embodiments, the fragment is or contains single-chain variable fragments (scFv).

[0086] In some of any of the provided embodiments of the genetically engineered cell, the V H area and the V L The regions are joined by a flexible linker. In some such embodiments, the linker comprises the amino acid sequence GGGGSGGGGSGGGGS (SEQ ID NO: 52). In some such embodiments, the linker comprises the amino acid sequence GGGGSGGGGSGGGGSGGGGS (SEQ ID NO: 320).

[0087] In some of any of the provided embodiments of the genetically engineered cell, the V in the second CAR H District V L In some of any of the provided embodiments of the genetically engineered cells, V H District V L In some of any of the provided embodiments of the genetically engineered cells, the antigen binding domain of the second CAR contains an amino acid sequence selected from any one of SEQ ID NOs: 227, 238, 239, 240, or 241, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to an amino acid sequence selected from any one of SEQ ID NOs: 227, 238, 239, 240, or 241.

[0088] In some of any of the provided embodiments of the genetically engineered cells, the antigen binding domain of the second CAR comprises an amino acid sequence selected from any one of SEQ ID NOs: 227, 238, 239, 240, or 241. In some of any of the provided embodiments of the genetically engineered cells, the V domain of the second CAR comprises an amino acid sequence selected from any one of SEQ ID NOs: 227, 238, 239, 240, or 241. H The region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 209, 210 and 211, respectively, and the V L The V region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 230, 231 and 232, respectively; or the V region of the second CAR HThe region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 215, 216 and 217, respectively, and the V L The V region comprises CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 235, 236 and 232, respectively; and / or the V region of the second CAR H Area and V L The antigen binding domain of the second CAR comprises the amino acid sequence shown in SEQ ID NO: 241 or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the sequence shown in SEQ ID NO: 241.

[0089] In some of any of the provided embodiments of the genetically engineered cells, the antigen binding domain of the second CAR comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 241. In some of any of the provided embodiments of the genetically engineered cells, the V domain of the second CAR comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 241. H The region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 209, 210 and 211, respectively, and the V L The V region comprises CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 230, 231 and 232, respectively; and / or the V region of the second CAR H Area and V L The antigen binding domain of the second CAR comprises the amino acid sequence shown in SEQ ID NO: 241 or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the sequence shown in SEQ ID NO: 241.

[0090] In some of the embodiments provided in any of the genetically engineered cells, the transmembrane domain of the second CAR is or contains a transmembrane domain derived from CD4, CD28 or CD8, optionally derived from human CD4, human CD28 or human CD8. In some of the embodiments provided in any of the genetically engineered cells, the transmembrane domain of the second CAR is or contains a transmembrane domain derived from human CD28; and / or the transmembrane domain is or contains a sequence as shown in SEQ ID NO: 18 or an amino acid sequence exhibiting at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 18. In some of the embodiments provided in any of the genetically engineered cells, the transmembrane domain of the second CAR is or contains a sequence as shown in SEQ ID NO: 18.

[0091] In some of any of the provided embodiments of the genetically engineered cell, the intracellular signaling region of the second CAR contains an intracellular signaling domain.

[0092] In some of the embodiments provided in any of the genetically engineered cells, the intracellular signal transduction domain of the second CAR is capable of inducing a primary activation signal in T cells, is a T cell receptor (TCR) component and / or contains an immunoreceptor tyrosine activation motif (ITAM). In some of the embodiments provided in any of the genetically engineered cells, the intracellular signal transduction domain of the second CAR is or contains the ζ chain of the CD3-zeta (CD3ζ) chain or its functional variant or signal transduction portion, optionally a cytoplasmic signal transduction domain of the human CD3ζ chain. In some of the embodiments provided in any of the genetically engineered cells, the intracellular signal transduction region of the second CAR contains the sequence shown in SEQ ID NO:20 or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:20.

[0093] In some of the embodiments provided in any of the genetically engineered cells, the intracellular signal transduction region of the second CAR further contains a costimulatory signal transduction region. In some of the embodiments provided in any of the genetically engineered cells, the costimulatory signal transduction region of the second CAR contains the intracellular signal transduction domain of a T cell costimulatory molecule or its signal transduction portion. In some of the embodiments provided in any of the genetically engineered cells, the costimulatory signal transduction region of the second CAR contains CD28, 4-1BB or ICOS or its signal transduction portion, optionally the intracellular signal transduction domain of human CD28, human 4-1BB or human ICOS. In some of the embodiments provided in any of the genetically engineered cells, the costimulatory signal transduction region of the second CAR contains the intracellular signal transduction domain of 4-1BB or its signal transduction portion. In some of the embodiments provided in any of the first chimeric antigen receptor and the second chimeric antigen receptor, at least one includes an intracellular signal transduction domain containing 4-1BB or its signal transduction portion, optionally the intracellular signal transduction domain of the intracellular signal transduction domain of human 4-1BB.

[0094] In some of any of the provided embodiments of the genetically engineered cells, the costimulatory signaling region of the second CAR contains: the intracellular signaling domain of human CD28; and / or the sequence shown in SEQ ID NO: 46, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the sequence shown in SEQ ID NO: 46.

[0095] In some of any of the provided embodiments of the genetically engineered cells, the costimulatory signaling region of the second CAR contains: the intracellular signaling domain of human 4-1BB; and / or the sequence shown in SEQ ID NO: 19, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the sequence shown in SEQ ID NO: 19.

[0096] In some of any of the provided embodiments of the genetically engineered cell, the encoded second chimeric antigen receptor contains, in order from its N-terminus to its C-terminus: an antigen binding domain, a spacer, a transmembrane domain, and an intracellular signaling region.

[0097] In some of any provided embodiments, the genetically engineered cells are lymphocytes. In some of any provided embodiments, the genetically engineered cells are NK cells or T cells. In some of any provided embodiments, the genetically engineered cells are T cells, and the T cells are CD4+ or CD8+ T cells.

[0098] In some of any of the provided embodiments, the genetically engineered cells are engineered from primary cells obtained from a subject.

[0099] In some of any of the embodiments provided, the genetically engineered cell is in a plurality of genetically engineered cells, wherein less than or less than about 10%, 9%, 8%, 7%, 5%, 4%, 3%, 2% or 1% of the cells in the plurality of cells contain a chimeric antigen receptor that exhibits tonic signaling and / or antigen-independent activity or signaling.

[0100] Also provided are compositions containing any of the chimeric antigen receptors provided herein. Also provided are compositions containing any of the genetically engineered cells provided herein. In some of any of the embodiments provided, the composition contains CD4+ and CD8+ T cells and the ratio of CD4+ T cells to CD8+ T cells is from or about 1:3 to 3:1, optionally 1:2 to 2:1. In some of any of the embodiments provided, the composition contains CD4+ and CD8+ T cells and the ratio of CD4+ T cells to CD8+ T cells is about 1:1.

[0101] Also provided are compositions comprising: a plurality of first genetically engineered cells comprising a first chimeric antigen receptor, the first chimeric antigen receptor being any of the chimeric antigen receptors provided herein or encoded by any of the polynucleotides provided herein; and a plurality of second genetically engineered cells comprising a second chimeric antigen receptor. In some of any of the embodiments provided, among the plurality of first genetically engineered cells, less than or about 10%, 9%, 8%, 7%, 5%, 4%, 3%, 2%, or 1% of the cells in the plurality of cells comprise a chimeric antigen receptor that exhibits tonic signaling and / or antigen-independent activity or signaling. In some of any of the embodiments provided, among the plurality of second genetically engineered cells, less than or about 10%, 9%, 8%, 7%, 5%, 4%, 3%, 2%, or 1% of the cells in the plurality of cells comprise a chimeric antigen receptor that exhibits tonic signaling and / or antigen-independent activity or signaling.

[0102] In some of the embodiments provided, the second chimeric receptor in the plurality of second genetically engineered cells in the composition contains an extracellular antigen binding domain specifically binding to a second antigen expressed on or associated with multiple myeloma. In some of the embodiments provided, the second CAR in the plurality of second genetically engineered cells in the composition contains an extracellular antigen binding domain-spacer, a transmembrane domain, and an intracellular signal transduction region of the second antigen. In some of the embodiments provided, the second antigen in the plurality of second genetically engineered cells in the composition is selected from B cell maturation antigen (BCMA), CD38, CD138, CS-1, BAFF-R, TACI, or FcRH5. In some of the embodiments provided, the second antigen in the plurality of second genetically engineered cells in the composition is BCMA.

[0103] In some of any of the provided embodiments, the second CAR in the plurality of second genetically engineered cells in the composition comprises: (1) an extracellular antigen binding domain that specifically binds to BCMA, wherein the extracellular antigen binding domain comprises: (i) a heavy chain variable (V H ) region, which contains the same V as shown in any one of SEQ ID NO: 189, 191, 193, 195 or 197 H amino acid sequences having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence of the light chain variable region; and (ii) a light chain variable (V L ) region, which contains the same V as shown in any one of SEQ ID NO: 190, 192, 194, 196 or 198 L In some such embodiments, V H The region includes a V sequence shown in any one of SEQ ID NOs: 189, 191, 193, 195, or 197. H CDR-H1, CDR-H2 and CDR-H3 contained in the amino acid sequence of the V region; and L The region contains V shown in any one of SEQ ID NO: 190, 192, 194, 196 or 198 L CDR-L1, CDR-L2 and CDR-L3 contained in the amino acid sequence of the region.

[0104] In some of any of the provided embodiments, the second CAR in the plurality of second genetically engineered cells in the composition comprises: (1) an extracellular antigen binding domain that specifically binds to BCMA, wherein the extracellular antigen binding domain comprises: (i) a heavy chain variable (V H ), which includes a heavy chain complementary determining region 1 (CDR-H1) comprising an amino acid sequence selected from any one of SEQ ID NO: 199, 202, 206, 209, 212 or 215; (b) a heavy chain complementary determining region 2 (CDR-H2) comprising an amino acid sequence selected from any one of SEQ ID NO: 200, 203, 207, 210, 213 or 216; and (c) a heavy chain complementary determining region 3 (CDR-H3) comprising an amino acid sequence selected from any one of SEQ ID NO: 201, 204, 205, 208, 211, 214 or 217; and (ii) a light chain variable (V L ) region, which includes a light chain complementary determining region 1 (CDR-L1) comprising an amino acid sequence selected from any one of SEQ ID NO: 218, 221, 224, 227, 230, 233 or 235; (b) a light chain complementary determining region 2 (CDR-L2) comprising an amino acid sequence selected from any one of SEQ ID NO: 219, 222, 225, 228, 231, 234 or 236; and (c) a light chain complementary determining region 3 (CDR-L3) comprising an amino acid sequence selected from any one of SEQ ID NO: 220, 223, 226, 229 or 232; (2) a spacer; (3) a transmembrane domain; and (4) an intracellular signal transduction region.

[0105] In some of any of the provided embodiments, the V of the second CAR in the composition is H The V region of the second CAR includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 199, 200 and 201, respectively, and the V L The V region of the second CAR includes CDR-L1, CDR-L2 and CDR-L3 containing the amino acid sequences of SEQ ID NO: 218, 219 and 220, respectively; H The region includes CDR-H1, CDR-H2 and CDR-H3 containing the amino acid sequences of SEQ ID NOs: 202, 203 and 204, respectively, and the V L The V region of the second CAR includes CDR-L1, CDR-L2 and CDR-L3 containing the amino acid sequences of SEQ ID NO: 221, 222 and 223, respectively; HThe region includes CDR-H1, CDR-H2 and CDR-H3 containing the amino acid sequences of SEQ ID NOs: 199, 200 and 205, respectively, and the V L The V region of the second CAR includes CDR-L1, CDR-L2 and CDR-L3 containing the amino acid sequences of SEQ ID NOs: 224, 225 and 226, respectively; H The region includes CDR-H1, CDR-H2 and CDR-H3 containing the amino acid sequences of SEQ ID NOs: 206, 207 and 208, respectively, and the V L The V region of the second CAR includes CDR-L1, CDR-L2 and CDR-L3 containing the amino acid sequences of SEQ ID NO: 227, 228 and 229, respectively; H The region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 209, 210 and 211, respectively, and the V L The V region of the second CAR includes CDR-L1, CDR-L2 and CDR-L3 containing the amino acid sequences of SEQ ID NO: 230, 231 and 232, respectively; H The region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 212, 213 and 214, respectively, and the V L The V region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 233, 234 and 229, respectively; or the V region of the second CAR H The V region of the second CAR includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 215, 216 and 217, respectively, and the V L The region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 235, 236 and 232, respectively.

[0106] In some of any of the provided embodiments, the V of the second CAR in the composition is H The region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 209, 210 and 211, respectively, and the V L The V region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 230, 231 and 232, respectively; or the V region of the second CAR HThe region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 215, 216 and 217, respectively, and the V L The region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 235, 236 and 232, respectively.

[0107] In some of any of the provided embodiments, the V of the second CAR in the composition is H Area and V L The V region of the second CAR contains the amino acid sequences as shown in SEQ ID NO: 189 and SEQ ID NO: 190, respectively, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 189 and SEQ ID NO: 190; the V region of the second CAR contains the amino acid sequences as shown in SEQ ID NO: 189 and SEQ ID NO: 190, respectively, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 189 and SEQ ID NO: 190; H Area and V L The V region of the second CAR comprises the amino acid sequences as shown in SEQ ID NO: 191 and SEQ ID NO: 192, respectively, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 191 and SEQ ID NO: 192; the V region of the second CAR comprises the amino acid sequences as shown in SEQ ID NO: 191 and SEQ ID NO: 192, respectively, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 191 and SEQ ID NO: 192; H Area and V L The V region of the second CAR comprises the amino acid sequence as shown in SEQ ID NO: 193 and SEQ ID NO: 194, respectively, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 193 and SEQ ID NO: 194; the V region of the second CAR comprises the amino acid sequence as shown in SEQ ID NO: 193 and SEQ ID NO: 194, respectively, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 193 and SEQ ID NO: 194; H Area and V L The V region of the second CAR contains the amino acid sequence as shown in SEQ ID NO: 195 and SEQ ID NO: 196, respectively, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 195 and SEQ ID NO: 196; or the V region of the second CAR H Area and V L The region contains the amino acid sequences as shown in SEQ ID NO:197 and SEQ ID NO:198, respectively, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:197 and SEQ ID NO:198.

[0108] In some of any of the provided embodiments, the V of the second CAR in the composition is H Area and V L The V region of the second CAR in the composition contains the amino acid sequences shown in SEQ ID NO: 189 and SEQ ID NO: 190 respectively; H Area and V L The V region of the second CAR in the composition has the amino acid sequence shown in SEQ ID NO: 191 and SEQ ID NO: 192; H Area and V L The V region contains the amino acid sequence shown in SEQ ID NO: 193 and SEQ ID NO: 194; the V region of the second CAR in the composition H Area and V L The V region contains the amino acid sequence shown in SEQ ID NO: 195 and SEQ ID NO: 196; or the V region of the second CAR in the composition H Area and V L The regions contain the amino acid sequences shown in SEQ ID NO: 197 and SEQ ID NO: 198, respectively.

[0109] In some of any of the embodiments provided, the extracellular antigen binding domain of the second CAR in the composition is a single-chain antibody fragment. In some such embodiments, the fragment is or contains a single-chain variable fragment (scFv). In some of any of the embodiments provided, the V of the second CAR in the composition is or contains a single-chain variable fragment (scFv). H Area and V L The regions are joined by a flexible linker. In some of any of the embodiments provided, the linker comprises the amino acid sequence GGGGSGGGGSGGGGS (SEQ ID NO: 52). In some of any of the embodiments provided, the linker comprises the amino acid sequence GGGGSGGGGSGGGGSGGGGS (SEQ ID NO: 320).

[0110] In some of any of the provided embodiments, V in the second CAR in the composition H District V L In some of any of the embodiments provided, the V in the second CAR in the composition is H District V LIn some of any of the embodiments provided, the antigen binding domain in the second CAR in the composition comprises an amino acid sequence selected from any one of SEQ ID NOs: 227, 238, 239, 240, or 241, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to an amino acid sequence selected from any one of SEQ ID NOs: 227, 238, 239, 240, or 241. In some of any of the embodiments provided, the antigen binding domain in the second CAR in the composition comprises an amino acid sequence selected from any one of SEQ ID NOs: 227, 238, 239, 240, or 241.

[0111] In some of any of the provided embodiments, the V of the second CAR in the composition is H The second CAR comprises a CDR-H1, a CDR-H2 and a CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 209, 210 and 211, respectively, and the V L The V region of the second CAR comprises CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 230, 231 and 232, respectively; or the V region of the second CAR H The second CAR comprises a CDR-H1, a CDR-H2 and a CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 215, 216 and 217, respectively, and the V L The V region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 235, 236 and 232, respectively; and / or the V region of the second CAR in the composition H Area and V L The antigen binding domain of the composition comprises the amino acid sequence shown in SEQ ID NO: 197 and SEQ ID NO: 198, respectively; and / or the antigen binding domain of the composition comprises the amino acid sequence shown in SEQ ID NO: 241 or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the sequence shown in SEQ ID NO: 241. In some of any of the embodiments provided, the V domain of the second CAR in the composition H The second CAR comprises a CDR-H1, a CDR-H2 and a CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 209, 210 and 211, respectively, and the V LThe V region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 230, 231 and 232, respectively; and / or the V region of the second CAR in the composition H Area and V L The antigen-binding domain of the composition comprises the amino acid sequence shown in SEQ ID NO: 197 and SEQ ID NO: 198, respectively; and / or the antigen-binding domain in the composition comprises the amino acid sequence shown in SEQ ID NO: 241, or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the sequence shown in SEQ ID NO: 241.

[0112] In some of the embodiments provided, the transmembrane domain of the second CAR in the composition is or contains a transmembrane domain derived from CD4, CD28 or CD8, optionally derived from human CD4, human CD28 or human CD8. In some of the embodiments provided, the transmembrane domain of the second CAR in the composition is or contains a transmembrane domain derived from human CD28; and / or the transmembrane domain of the second CAR in the composition is or contains a sequence as shown in SEQ ID NO: 18 or an amino acid sequence exhibiting at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 18. In some of the embodiments provided, the transmembrane domain of the second CAR in the composition is or contains a sequence as shown in SEQ ID NO: 18.

[0113] In some of the embodiments provided, the intracellular signal transduction region of the second CAR in the composition contains an intracellular signal transduction domain. In some of the embodiments provided, the intracellular signal transduction domain of the second CAR in the composition can induce primary activation signals in T cells that are T cell receptor (TCR) components and / or contain immunoreceptor tyrosine activation motifs (ITAMs). In some of the embodiments provided, the intracellular signal transduction domain of the second CAR in the composition is or contains the ζ chain of CD3-zeta (CD3ζ) chain or its functional variant or signal transduction portion, optionally the cytoplasmic signal transduction domain of human CD3ζ chain. In some of the embodiments provided, the intracellular signal transduction region of the second CAR in the compound contains the sequence shown in SEQ ID NO:20 or with SEQ ID NO:20 having an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity.

[0114] In some of the embodiments provided, the intracellular signal transduction region of the second CAR in the composition further contains a costimulatory signal transduction region. In some of the embodiments provided, the costimulatory signal transduction region of the second CAR in the composition contains the intracellular signal transduction domain of a T cell costimulatory molecule or its signal transduction portion. In some of the embodiments provided, the costimulatory signal transduction region of the second CAR in the composition contains CD28, 4-1BB or ICOS or its signal transduction portion, optionally the intracellular signal transduction domain of human CD28, human 4-1BB or human ICOS. In some of the embodiments provided, the costimulatory signal transduction region of the second CAR in the composition contains 4-1BB or its signal transduction portion, optionally the intracellular signal transduction domain of human 4-1BB. In some of the embodiments provided, at least one of the first chimeric antigen receptor and the second chimeric antigen receptor includes an intracellular signal transduction domain containing 4-1BB or its signal transduction portion, optionally the intracellular signal transduction domain of the intracellular signal transduction domain of human 4-1BB. In some of any of the embodiments provided, the costimulatory signal transduction region of the second CAR in the composition contains: the intracellular signal transduction domain of human CD28; and / or the sequence shown in SEQ ID NO: 46, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the sequence shown in SEQ ID NO: 46. In some of any of the embodiments provided, the costimulatory signal transduction region of the second CAR in the composition contains: the intracellular signal transduction domain of human 4-1BB; and / or the sequence shown in SEQ ID NO: 19, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the sequence shown in SEQ ID NO: 19.

[0115] In some of any of the provided embodiments, the encoded second chimeric antigen receptor in the composition comprises, in order from its N-terminus to its C-terminus: an antigen binding domain, a spacer, the transmembrane domain, and an intracellular signaling region.

[0116] In some of any of the provided embodiments, the plurality of genetically engineered cells in the composition contain T cells, optionally wherein the T cells include CD4+ and CD8+ T cells, optionally wherein the ratio of CD4+ T cells to CD8+ T cells is from or about 1:3 to 3:1, optionally 1:2 to 2: 1. In some of any of the provided embodiments, the plurality of first genetically engineered cells in the composition comprise T cells, optionally wherein the T cells include CD4+ and CD8+ T cells, optionally wherein the ratio of CD4+ T cells to CD8+ T cells is about 1:1.

[0117] In some of any of the provided embodiments, the plurality of second genetically engineered cells in the composition contain T cells, optionally wherein the T cells include CD4+ and CD8+ T cells, optionally wherein the ratio of CD4+CD8+ T cells is from or about 1:3 to 3:1, optionally 1:2 to 2: 1. In some of any of the provided embodiments, the plurality of second genetically engineered cells in the composition comprise T cells, optionally wherein the T cells include CD4+ and CD8+ T cells, optionally wherein the ratio of CD4+ T cells to CD8+ T cells is about 1:1.

[0118] In some of any of the provided embodiments, the composition comprises a first plurality of genetically engineered cells to a second plurality of genetically engineered cells at a ratio of from or about 1:3 to 3:1, optionally 1:2 to 2:1, and optionally at or about 1:1. In some of any of the provided embodiments, the composition comprises a first plurality of cells expressing a first chimeric antigen receptor and a second plurality of cells expressing a second chimeric antigen receptor, the first plurality of cells to the second plurality of cells at a ratio of from about 1:3 to 3:1, optionally about 1:2 to 2:1. In a specific embodiment, the composition comprises a first plurality of genetically engineered cells to the second plurality of genetically engineered cells at a ratio of or about 1:1. In some of any of the provided embodiments, the composition further comprises a pharmaceutically acceptable excipient. In some of any of the provided embodiments, the composition is sterile.

[0119] The application also provides any use of the compositions provided herein. In some of any of the embodiments provided, the composition is used to treat a subject suffering from a disease or condition. In some of any of the embodiments provided, the disease or condition is cancer. In some of any of the embodiments provided, the disease or condition is multiple myeloma, optionally relapsed / refractory multiple myeloma. The provided uses and compositions of the uses provided herein can be used to treat a subject according to any of the aspects of the provided methods.

[0120] The present application also provides methods of treatment comprising administering to a subject having a disease or condition any of the compositions provided herein comprising any of the genetically engineered cells provided herein or any of the compositions provided herein comprising any of the chimeric antigen receptors provided herein. In some of any of the embodiments provided, the cell dose is comprised at or about 1.0×10 7 CAR-expressing T cells and 1.2×10 9 The number of CAR-expressing T cells is between 1.25×10 7 CAR-expressing T cells and 1.2×10 9 The number of CAR-expressing T cells is between 1.5×10 7 CAR-expressing T cells and 1.2×10 9 The number of CAR-expressing T cells is between 5.0×10 7 CAR-expressing T cells and 4.5×10 8 The number of CAR-expressing T cells is between 1.5×10 8 CAR-expressing T cells and 3.0×10 8 In some of any of the provided embodiments, the cell dose is comprised between or about 2.5×10 7 CAR-expressing T cells and 1.2×10 9 CAR-expressing T cells, between or at about 5.0×10 7 CAR-expressing T cells and 4.5×10 8 CAR-expressing T cells, between or at about 1.5×10 8 CAR-expressing T cells and 3.0×10 8 between CAR-expressing T cells.

[0121] In some embodiments of any of the embodiments, the cell dose is at or about 1×10 7 CAR-expressing T cells with or with approximately 2×10 9 In some embodiments, the cell dose is at or about 2.5×10 7 CAR-expressing T cells with or with approximately 1.2×10 9 CAR-expressing T cells, between or at about 5.0×10 7 CAR-expressing T cells with or with approximately 4.5×10 8 CAR-expressing T cells, or between or about 1.5×10 8 CAR-expressing T cells with or with approximately 3.0×10 8In some embodiments, the cell dose contains or comprises about 2.5×10 7 , containing or containing about 5.0×10 7 , containing or containing about 1.5×10 8 , containing or containing about 3.0×10 8 , containing or containing about 4.5×10 8 , containing or containing about 8.0×10 8 or containing about 1.2×10 9 In some embodiments, the cell dose contains or comprises about 5.0×10 7 , containing or containing about 1.5×10 8 , containing or containing about 3.0×10 8 or containing about 4.5×10 8 In some embodiments, the cell dose contains or comprises about 5.0×10 7 , containing or containing about 1.5×10 8 , containing or containing about 3.0×10 8 or containing or containing approximately 4.5 × 10 8 In some embodiments, the cell dose contains or comprises about 5.0×10 7 CAR-expressing T cells.

[0122] The present application also provides the use of a first composition and a second composition, the first composition comprising a plurality of first genetically engineered cells containing a first chimeric antigen receptor, the first chimeric antigen receptor being any of the chimeric antigen receptors provided herein or encoded by any of the polynucleotides provided herein; the second composition comprising a plurality of second genetically engineered cells containing a second chimeric antigen receptor for use. In some of any of the embodiments provided, these compositions are used together to treat a subject having a disease or condition. In some of any of the embodiments provided, the disease or condition is cancer. In some of any of the embodiments provided, the disease or condition is multiple myeloma, optionally relapsed / refractory multiple myeloma. The provided uses and compositions of the uses provided herein can treat a subject according to any aspect of the provided methods.

[0123] The present application also provides a method of treating a disease or condition, comprising: administering to a subject having a disease or condition a composition comprising a plurality of first genetically engineered cells, the plurality of first genetically engineered cells comprising a first chimeric antigen receptor, the first chimeric antigen receptor being any chimeric antigen receptor provided herein or encoded by any of the polynucleotides provided herein; and administering to the subject a composition comprising a plurality of second genetically engineered cells, the plurality of second genetically engineered cells comprising a second chimeric antigen receptor. In some of any of the embodiments provided, the dose of the plurality of first genetically engineered cells and the dose of the plurality of second genetically engineered cells independently contain at or about 1.0×10 7 CAR-expressing T cells and 1.5×10 9 CAR-expressing T cells, between or at about 1.25×10 7 CAR-expressing T cells and 0.6×10 8 CAR-expressing T cells, between or at about 2.5×10 7 CAR-expressing T cells and 2.25×10 8 CAR-expressing T cells, between or at about 7.5×10 7 CAR-expressing T cells and 1.5×10 8 CAR-expressing T cells, between or at about 2.5×10 7 CAR-expressing T cells and 1.2×10 9 CAR-expressing T cells, between or at about 5.0×10 7 CAR-expressing T cells and 4.5×10 8 CAR-expressing T cells, between or at about 1.5×10 8 CAR-expressing T cells and 3.0×10 8 In some embodiments, the dose of the plurality of first genetically engineered cells and the dose of the plurality of second genetically engineered cells independently contain at or about 1×10 7 CAR-expressing T cells with or with approximately 2×10 9 In some embodiments, the cell dose is at or about 2.5×10 7 CAR-expressing T cells with or with approximately 1.2×10 9 CAR-expressing T cells, between or at about 5.0×10 7 CAR-expressing T cells with or with approximately 4.5×10 8 CAR-expressing T cells, or between or about 1.5×10 8 CAR-expressing T cells with or with approximately 3.0×108 In some embodiments, the cell dose contains or comprises about 2.5×10 7 , containing or containing about 5.0×10 7 , containing or containing about 1.5×10 8 , containing or containing about 3.0×10 8 , containing or containing about 4.5×10 8 , containing or containing about 8.0×10 8 or containing about 1.2×10 9 In some embodiments, the cell dose contains or comprises about 5.0×10 7 , containing or containing about 1.5×10 8 , containing or containing about 3.0×10 8 or containing about 4.5×10 8 In some embodiments, the cell dose contains or comprises about 5.0×10 7 , containing or containing about 1.5×10 8 , containing or containing about 3.0×10 8 , or containing or containing about 4.5×10 8 In some embodiments, the cell dose contains or comprises about 5.0×10 7 CAR-expressing T cells.

[0124] In some of any of the provided embodiments, the composition containing the plurality of first genetically engineered cells and the composition containing the plurality of second genetically engineered cells are administered simultaneously, sequentially, or intermittently. In some of any of the provided embodiments, the composition containing the plurality of first genetically engineered cells and the composition containing the plurality of second genetically engineered cells are administered sequentially in any order.

[0125] In some of any of the provided embodiments, in the plurality of first genetically engineered cells of provided methods of treatment or compositions for therapeutic use, less than or less than about 10%, 9%, 8%, 7%, 5%, 4%, 3%, 2%, or 1% of the cells in the plurality of cells contain a chimeric antigen receptor that exhibits tonic signaling and / or antigen-independent activity or signaling.

[0126] In some of any of the provided embodiments, in the plurality of second genetically engineered cells in provided methods of treatment or compositions for therapeutic use, less than or less than about 10%, 9%, 8%, 7%, 5%, 4%, 3%, 2%, or 1% of the cells in the plurality of cells contain a chimeric antigen receptor that exhibits tonic signaling and / or antigen-independent activity or signaling.

[0127] In some of any of the provided embodiments, the second chimeric receptor in the genetically engineered cells of the treatment methods or compositions for therapeutic use contains an extracellular antigen binding domain that specifically binds a second antigen expressed on or associated with multiple myeloma.

[0128] In some of any of the provided embodiments, the second CAR in the genetically engineered cells of the provided methods or compositions for therapeutic use contains an extracellular antigen binding domain that binds a second antigen, a spacer, a transmembrane domain, and an intracellular signaling region.

[0129] In some of any of the provided embodiments, the second antigen that is the target of the second CAR in the genetically engineered cells of the composition provided for use in the method is selected from B cell maturation antigen (BCMA), CD38, CD138, CS-1, BAFF-R, TACI or FcRH5. In some of any of the provided embodiments, the second antigen in the provided methods is BCMA.

[0130] In some of any of the provided embodiments, the second CAR in the genetically engineered cells of the provided methods or compositions for therapeutic use comprises: (1) an extracellular antigen binding domain that specifically binds BCMA, wherein the extracellular antigen binding domain comprises: (i) a heavy chain variable (V H ) region, which contains the same V as shown in any one of SEQ ID NO: 189, 191, 193, 195 or 197 H amino acid sequences having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence of the light chain variable region; and (ii) a light chain variable (V L ) region, which contains the same V as shown in any one of SEQ ID NO: 190, 192, 194, 196 or 198 L In some of the embodiments provided, the V domain of the second CAR in the provided methods is an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity; (2) a spacer; (3) a transmembrane domain; and (4) an intracellular signaling region. HThe region contains V shown in any one of SEQ ID NO: 189, 191, 193, 195 or 197 H CDR-H1, CDR-H2 and CDR-H3 contained in the amino acid sequence of the V region; and L The region contains V shown in any one of SEQ ID NO: 190, 192, 194, 196 or 198 L CDR-L1, CDR-L2 and CDR-L3 contained in the amino acid sequence of the region.

[0131] In some of any of the provided embodiments, the second CAR in the genetically engineered cells of the provided methods or compositions for therapeutic use comprises: (1) an extracellular antigen binding domain that specifically binds BCMA, wherein the extracellular antigen binding domain comprises: (i) a heavy chain variable (V H ), which contains the same V as shown in SEQ ID NO: 197 H amino acid sequences having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence of the light chain variable region; and (ii) a light chain variable (V L ) region, which contains the same V as shown in SEQ ID NO: 198 L In some of the embodiments provided, the V domain of the second CAR in the provided methods is an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity; (2) a spacer; (3) a transmembrane domain; and (4) an intracellular signaling domain. H Region includes V shown in 197 H CDR-H1, CDR-H2 and CDR-H3 contained in the amino acid sequence of the V region; and L The region contains the V shown in SEQ ID NO: 198 L CDR-L1, CDR-L2 and CDR-L3 contained in the amino acid sequence of the region.

[0132] In some of any of the provided embodiments, the second CAR in the genetically engineered cells of the provided methods or compositions for therapeutic use comprises: (1) an extracellular antigen binding domain that specifically binds BCMA, wherein the extracellular antigen binding domain comprises: (i) a heavy chain variable (V H), which includes a heavy chain complementary determining region 1 (CDR-H1) comprising an amino acid sequence selected from any one of SEQ ID NO: 199, 202, 206, 209, 212 or 215; (b) a heavy chain complementary determining region 2 (CDR-H2) comprising an amino acid sequence selected from any one of SEQ ID NO: 200, 203, 207, 210, 213 or 216; and (c) a heavy chain complementary determining region 3 (CDR-H3) comprising an amino acid sequence selected from any one of SEQ ID NO: 201, 204, 205, 208, 211, 214 or 217; and (ii) a light chain variable (V L ) region, which includes a light chain complementary determining region 1 (CDR-L1) comprising an amino acid sequence selected from any one of SEQ ID NO: 218, 221, 224, 227, 230, 233 or 235; (b) a light chain complementary determining region 2 (CDR-L2) comprising an amino acid sequence selected from any one of SEQ ID NO: 219, 222, 225, 228, 231, 234 or 236; and (c) a light chain complementary determining region 3 (CDR-L3) comprising an amino acid sequence selected from any one of SEQ ID NO: 220, 223, 226, 229 or 232; (2) a spacer; (3) a transmembrane domain; and (4) an intracellular signal transduction region.

[0133] In some of any of the provided embodiments, the second CAR in the genetically engineered cells of the provided methods or compositions for therapeutic use contains an extracellular antigen binding domain, wherein the V domain of the second CAR is H The V region of the second CAR includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 199, 200 and 201, respectively, and the V L The V region of the second CAR includes CDR-L1, CDR-L2 and CDR-L3 containing the amino acid sequences of SEQ ID NO: 218, 219 and 220, respectively; H The region includes CDR-H1, CDR-H2 and CDR-H3 containing the amino acid sequences of SEQ ID NOs: 202, 203 and 204, respectively, and the V L The V region of the second CAR includes CDR-L1, CDR-L2 and CDR-L3 containing the amino acid sequences of SEQ ID NO: 221, 222 and 223, respectively; H The region includes CDR-H1, CDR-H2 and CDR-H3 containing the amino acid sequences of SEQ ID NOs: 199, 200 and 205, respectively, and the V LThe V region of the second CAR includes CDR-L1, CDR-L2 and CDR-L3 containing the amino acid sequences of SEQ ID NOs: 224, 225 and 226, respectively; H The region includes CDR-H1, CDR-H2 and CDR-H3 containing the amino acid sequences of SEQ ID NOs: 206, 207 and 208, respectively, and the V L The V region of the second CAR includes CDR-L1, CDR-L2 and CDR-L3 containing the amino acid sequences of SEQ ID NO: 227, 228 and 229, respectively; H The V region of the second CAR includes CDR-H1, CDR-H2 and CDR-H3 containing the amino acid sequences of SEQ ID NO: 209, 210 and 211, respectively. L The V region of the second CAR includes CDR-L1, CDR-L2 and CDR-L3 containing the amino acid sequences of SEQ ID NO: 230, 231 and 232, respectively; H The region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 212, 213 and 214, respectively, and the V L The V region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 233, 234 and 229, respectively; or the V region of the second CAR H The region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 215, 216 and 217, respectively, and the V L The region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 235, 236 and 232, respectively.

[0134] In some of any of the provided embodiments, the second CAR in the genetically engineered cells of the provided methods or compositions for therapeutic use contains an extracellular antigen binding domain, wherein the V domain of the second CAR is H The region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 209, 210 and 211, respectively, and the V L The V region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 230, 231 and 232, respectively; or the V region of the second CAR in the provided method H The region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 215, 216 and 217, respectively, and the V LThe second CAR of the genetically engineered cells of the provided methods or compositions for therapeutic use comprises an extracellular antigen binding domain, wherein the V domain of the second CAR comprises an amino acid sequence of SEQ ID NOs: 235, 236, and 232, respectively. H The region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 209, 210 and 211, respectively, and the V L The region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 230, 231 and 232, respectively.

[0135] In some of any of the provided embodiments, the second CAR in the genetically engineered cells of the provided methods or compositions for therapeutic use contains an extracellular antigen binding domain, wherein V H Area and V L The V region of the second CAR contains the amino acid sequences as shown in SEQ ID NO: 189 and SEQ ID NO: 190, respectively, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 189 and SEQ ID NO: 190; the V region of the second CAR contains the amino acid sequences as shown in SEQ ID NO: 189 and SEQ ID NO: 190, respectively, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 189 and SEQ ID NO: 190; H Area and V L The V region of the second CAR comprises the amino acid sequences as shown in SEQ ID NO: 191 and SEQ ID NO: 192, respectively, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 191 and SEQ ID NO: 192; the V region of the second CAR comprises the amino acid sequences as shown in SEQ ID NO: 191 and SEQ ID NO: 192, respectively, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 191 and SEQ ID NO: 192; H Area and V L The V region of the second CAR contains the amino acid sequences as shown in SEQ ID NO: 193 and SEQ ID NO: 194, respectively, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 193 and SEQ ID NO: 194; the V region of the second CAR contains the amino acid sequences as shown in SEQ ID NO: 193 and SEQ ID NO: 194, respectively, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 193 and SEQ ID NO: 194; H Area and V LThe V region of the second CAR contains the amino acid sequence as shown in SEQ ID NO: 195 and SEQ ID NO: 196, respectively, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 195 and SEQ ID NO: 196; or the V region of the second CAR H Area and V L The region contains the amino acid sequences as shown in SEQ ID NO:197 and SEQ ID NO:198, respectively, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:197 and SEQ ID NO:198.

[0136] In some of any of the provided embodiments, the second CAR in the genetically engineered cells of the provided methods or compositions for therapeutic use contains an extracellular antigen binding domain, wherein V H Area and V L The regions contain the amino acid sequences shown in SEQ ID NO:197 and SEQ ID NO:198, respectively, or amino acid sequences that exhibit at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:197 and SEQ ID NO:198.

[0137] In some of any of the provided embodiments, the second CAR in the genetically engineered cells of the provided methods or compositions for therapeutic use contains an extracellular antigen binding domain, wherein V H Area and V L The V region of the second CAR contains the amino acid sequences shown in SEQ ID NO: 189 and SEQ ID NO: 190 respectively; H Area and V L The V region of the second CAR contains the amino acid sequence shown in SEQ ID NO: 191 and SEQ ID NO: 192; H Area and V L The V region of the second CAR contains the amino acid sequence shown in SEQ ID NO: 193 and SEQ ID NO: 194; H Area and V L The V region of the second CAR contains the amino acid sequence shown in SEQ ID NO: 195 and SEQ ID NO: 196; or H Area and V LThe regions contain the amino acid sequences shown in SEQ ID NO: 197 and SEQ ID NO: 198, respectively. In some of any of the provided embodiments, the second CAR in the genetically engineered cells of the provided methods or compositions for therapeutic use contains an extracellular antigen binding domain, wherein V H Area and V L The regions contain the amino acid sequences shown in SEQ ID NO: 197 and SEQ ID NO: 198, respectively.

[0138] In some of the embodiments provided, the extracellular antigen-binding domain of the second CAR in the genetically engineered cells in the methods provided or for the compositions for therapeutic use is a single-chain antibody fragment. In some of the embodiments provided, the fragment is or contains a single-chain variable fragment (scFv).

[0139] In some of the provided methods or any of the provided embodiments for therapeutic use, the V domain of the extracellular antigen binding domain of the second CAR in the genetically engineered cells in the composition H Area and V L The regions are joined by a flexible connector. In some of any of the embodiments provided, the connector of the second CAR in the genetically engineered cells in the composition contains the amino acid sequence GGGGSGGGGSGGGGS (SEQ ID NO: 52). In some of any of the embodiments provided, the connector of the second CAR in the genetically engineered cells in the composition contains the amino acid sequence GGGGSGGGGSGGGGS (SEQ ID NO: 52).

[0140] In some of the provided methods or any of the provided embodiments for therapeutic use, the V in the extracellular antigen binding domain of the second CAR H District V L In some of the provided methods and embodiments, the V region in the second CAR is amino-terminal. H District V L The carboxyl terminus of the region.

[0141] In some of the provided methods or any of the provided embodiments for therapeutic use, the extracellular antigen binding domain of the second CAR contains an amino acid sequence selected from any one of SEQ ID NOs: 227, 238, 239, 240, or 241, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to an amino acid sequence selected from any one of SEQ ID NOs: 227, 238, 239, 240, or 241. In some of the provided embodiments of the provided methods, the antigen binding domain of the second CAR contains an amino acid sequence selected from any one of SEQ ID NOs: 227, 238, 239, 240, or 241. In some of the provided methods or any of the provided embodiments for therapeutic use, the extracellular antigen binding domain of the second CAR contains the amino acid sequence in SEQ ID NO: 241, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence in SEQ ID NO: 241. In some of the provided methods or any of the provided embodiments for therapeutic use, the extracellular antigen binding domain of the second CAR contains the amino acid sequence in SEQ ID NO: 241.

[0142] In some of the provided methods or any of the provided embodiments for therapeutic use, the extracellular antigen binding domain has a V H Area and V L Area where the second CAR V H The region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 209, 210 and 211, respectively, and the V L The V region includes CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 230, 231 and 232, respectively; or the V region of the second CAR H The region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 215, 216 and 217, respectively, and the V L The V region comprises CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 235, 236 and 232, respectively; and / or the V region of the second CAR H Area and V LThe extracellular antigen binding domain comprises the amino acid sequence set forth in SEQ ID NO: 197 and SEQ ID NO: 198, respectively; and / or the antigen binding domain comprises the amino acid sequence set forth in SEQ ID NO: 241, or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to the sequence set forth in SEQ ID NO: 241. In some of any of the provided embodiments of the methods or for therapeutic use, the extracellular antigen binding domain has V H Area and V L Area where the second CAR V H The region includes CDR-H1, CDR-H2 and CDR-H3 comprising the amino acid sequences of SEQ ID NOs: 209, 210 and 211, respectively, and the V L The V region comprises CDR-L1, CDR-L2 and CDR-L3 comprising the amino acid sequences of SEQ ID NOs: 230, 231 and 232, respectively; and / or the V region of the second CAR H Area and V L The antigen binding domain comprises the amino acid sequence shown in SEQ ID NO: 197 and SEQ ID NO: 198, respectively; and / or the antigen binding domain comprises the amino acid sequence shown in SEQ ID NO: 241, or a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the sequence shown in SEQ ID NO: 241.

[0143] In some of the provided methods or any of the provided embodiments for therapeutic use, the transmembrane domain of the second CAR is or contains a transmembrane domain derived from CD4, CD28 or CD8, optionally derived from human CD4, human CD28 or human CD8. In some of the provided embodiments of the provided methods, the transmembrane domain of the second CAR is or contains a transmembrane domain derived from human CD28; and / or the transmembrane domain is or contains the sequence shown in SEQ ID NO: 18 or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 18. In some of the provided embodiments of the provided methods, the transmembrane domain of the second CAR is or contains the sequence shown in SEQ ID NO: 18.

[0144] In some of the provided methods or any provided embodiments for therapeutic use, the intracellular signal transduction region of the second CAR contains an intracellular signal transduction domain. In some of the provided embodiments of the provided methods, the intracellular signal transduction domain of the second CAR is capable of inducing primary activation signals in T cells, is a T cell receptor (TCR) component and / or contains an immunoreceptor tyrosine activation motif (ITAM). In some of the provided embodiments of the provided methods, the intracellular signal transduction domain of the second CAR is or contains the ζ chain of the CD3-zeta (CD3ζ) chain or its functional variant or signal transduction portion, optionally the cytoplasmic signal transduction domain of the human CD3ζ chain. In some of the provided embodiments of the provided methods, the intracellular signal transduction region of the second CAR contains the sequence shown in SEQ ID NO:20 or SEQ ID NO:20 has an amino acid sequence of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity.

[0145] In some of the provided methods or any provided embodiments for therapeutic use, the intracellular signal transduction region of the second CAR further contains a costimulatory signal transduction region. In some of the provided embodiments of the method provided, the costimulatory signal transduction region of the second CAR contains the intracellular signal transduction domain of a T cell costimulatory molecule or its signal transduction portion. In some of the provided embodiments of the method provided, the costimulatory signal transduction region of the second CAR contains CD28, 4-1BB or ICOS or its signal transduction portion, optionally the intracellular signal transduction domain of human CD28, human 4-1BB or human ICOS. In some of the provided embodiments of the method provided, the costimulatory signal transduction region of the second CAR contains 4-1BB or its signal transduction portion, optionally the intracellular signal transduction domain of human 4-1BB. In some of the provided embodiments, at least one of the first chimeric antigen receptor and the second chimeric antigen receptor includes an intracellular signal transduction domain containing 4-1BB or its signal transduction portion, optionally the intracellular signal transduction domain of the intracellular signal transduction domain of human 4-1BB.

[0146] In some of the provided methods or any of the provided embodiments for therapeutic use, the costimulatory signaling region of the second CAR contains: the intracellular signaling domain of human CD28; and / or the sequence shown in SEQ ID NO: 46, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the sequence shown in SEQ ID NO: 46.

[0147] In some of the provided methods or any of the provided embodiments for therapeutic use, the costimulatory signaling region of the second CAR contains: the intracellular signaling domain of human 4-1BB; and / or the sequence shown in SEQ ID NO: 19, or an amino acid sequence that exhibits at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the sequence shown in SEQ ID NO: 19.

[0148] In some of the provided methods or any of the provided embodiments for therapeutic use, the encoded chimeric antigen receptor contains, in order from its N-terminus to its C-terminus: an antigen binding domain, a spacer, a transmembrane domain, and an intracellular signaling region.

[0149] Among the polynucleotides provided herein are polynucleotides comprising: (i) a first nucleic acid sequence encoding a first chimeric antigen receptor (CAR), the first CAR containing a first antigen binding domain; and (ii) a second nucleic acid sequence encoding a second chimeric antigen receptor (CAR), the second CAR containing a second antigen binding domain; wherein the first CAR and the second CAR each contain the following: (a) the first antigen binding domain or the second antigen binding domain, (b) a spacer, (c) a transmembrane domain, and (d) an intracellular signaling region comprising an intracellular signaling domain and a costimulatory signaling region; wherein one or more of (b) to (d) in the first CAR and the same one or more of (b) to (d) in the second CAR contain a consistent amino acid sequence; and wherein the nucleotide sequence encoding the one or more of (b) to (d) in the first CAR is different in sequence from the nucleotide sequence encoding the same one or more of (b) to (d) in the second CAR.

[0150] The present application also provides a polynucleotide containing the following: (i) a first nucleic acid sequence encoding a first chimeric antigen receptor (CAR), the first CAR containing a first antigen binding domain capable of binding to one of GPRC5D or BCMA and (ii) a second nucleic acid sequence encoding a second chimeric antigen receptor (CAR), the second CAR containing a second antigen binding domain capable of binding to the other of GPRC5D or BCMA; wherein the first CAR and the second CAR each contain the following: (a) the first antigen binding domain or the second antigen binding domain, (b) a spacer, (c) a transmembrane domain, and (d) an intracellular signaling region comprising an intracellular signaling domain and a costimulatory signaling region; wherein one or more of (b) to (d) in the first CAR and the same one or more of (b) to (d) in the second CAR contain a consistent amino acid sequence; and wherein the nucleotide sequence encoding the one or more of (b) to (d) in the first CAR is different in sequence from the nucleotide sequence encoding the same one or more of (b) to (d) in the second CAR.

[0151] In some of any of the provided embodiments, the first binding domain and the second antigen binding domain bind to the same antigen. In some of any of the provided embodiments, the first binding domain and the second antigen binding domain bind to different antigenic determinants of the same antigen. In some of any of the provided embodiments, the first binding domain and the second antigen binding domain bind to different antigens. In some of any of the provided embodiments, the first antigen binding domain binds to a first antigen expressed by or associated with cells of a disease or condition and the second antigen binding domain binds to a second antigen expressed by or associated with cells of the same disease or condition.

[0152] In some of any of the provided embodiments, the disease or condition is cancer. In some of any of the provided embodiments, the disease or condition is a cancer that expresses GPRC5D. In some of any of the provided embodiments, the disease or condition is a cancer that expresses BCMA. In some of any of the provided embodiments, the disease or condition is a cancer that expresses BCMA and expresses GPRC5D. In some of any of the provided embodiments, the cancer is a plasma cell malignancy, and the plasma cell malignancy is multiple myeloma (MM) or plasmacytoma. In some of any of the provided embodiments, the cancer is multiple myeloma. In some of any of the provided embodiments, the cancer is relapsed / refractory multiple myeloma.

[0153] In some of any of the provided embodiments, the first antigen binding domain and the second antigen binding domain independently bind to an antigen selected from the group consisting of: GPRC5D, BCMA, CD38, CD138, CS-1, BAFF-R, TACI, and FcRH5. In some of any of the provided embodiments, the first antigen binding domain binds to B cell maturation antigen (BCMA). In some of any of the provided embodiments, the first antigen binding domain binds to G protein-coupled receptor class C 5 family member D (GPRC5D). In some of any of the provided embodiments, the second antigen binding domain binds to BCMA. In some of any of the provided embodiments, the second antigen binding domain binds to GPRC5D.

[0154] In some of any provided embodiments, (a) is or contains the first antigen binding domain or the second antigen binding domain, (b) is or contains a spacer, (c) is or contains a transmembrane domain, and (d) is or includes an intracellular signal transduction domain and a costimulatory signal transduction domain. In some of any provided embodiments, one or more of (b) to (d) is one of (b) to (d). In some of any provided embodiments, one or more of (b) to (d) is two of (b) to (d). In some of any provided embodiments, one or more of (b) to (d) is each of (b) to (d).

[0155] In some of the embodiments provided, (a) is or contains a first antigen binding domain or a second antigen binding domain, (b) is or contains a spacer, (c) is or contains a transmembrane domain, and (d) is or includes an intracellular signal transduction domain and a costimulatory signal transduction domain. In some of the embodiments provided, the nucleotide sequence encoding one or more of (a) to (d) in the first CAR and the nucleotide sequence encoding the same one or more of (a) to (d) in the second CAR contain no more than about 20 consecutive base pairs of sequence homology; and / or the first nucleic acid sequence encoding the first CAR and the second nucleic acid sequence encoding the second CAR contain no more than about 20 consecutive base pairs of sequence homology. In some of the embodiments provided, the nucleotide sequence encoding one or more of (a) to (d) in the first CAR and the nucleotide sequence encoding the same one or more of (a) to (d) in the second CAR contain no more than about 5 and about 15 consecutive base pairs of sequence homology; and / or the first nucleic acid sequence encoding the first CAR and the second nucleic acid sequence encoding the second CAR contain no more than about 5 and about 15 consecutive base pairs of sequence homology. In some of the embodiments provided, the nucleotide sequence encoding one or more of (a) to (d) in the first CAR and the nucleotide sequence encoding the same one or more of (a) to (d) in the second CAR contain no more than about 10 consecutive base pairs of sequence homology; and / or the first nucleic acid sequence encoding the first CAR and the second nucleic acid sequence encoding the second CAR contain no more than about 10 consecutive base pairs of sequence homology.

[0156] In some of any of the embodiments provided, the first nucleic acid encoding the first CAR and the second nucleic acid encoding the second CAR are separated by a nucleotide sequence encoding a polycistronic component, optionally wherein the polycistronic component is a bicistronic component. In some of any of the embodiments provided, the polycistronic component is an IRES or a ribosome skipping sequence or a self-cleaving peptide. In some of any of the embodiments provided, the polycistronic component is a ribosome skipping sequence or a self-cleaving peptide and the ribosome skipping sequence or self-cleaving peptide is a T2A, P2A, E2A or F2A component. In some of any of the embodiments provided, the nucleotide sequence encoding the one or more polycistronic components is codon divergent. In some of any of the embodiments provided, the nucleotide sequence encoding T2A is codon divergent. In some of any of the embodiments provided, the nucleotide sequence encoding T2A is or contains the sequence shown in SEQ ID NO:319.

[0157] In some of the embodiments provided, the first nucleic acid sequence encoding the first CAR is codon-optimized for expression in human cells. In some of the embodiments provided, the second nucleic acid sequence encoding the second CAR is codon-optimized for expression in human cells. In some of the embodiments provided, the polynucleotide is codon-optimized for expression in human cells. In some of the embodiments provided, after transcribing the polynucleotide in a human cell, optionally in a human T cell, the messenger RNA transcribed from the polynucleotide, optionally exhibits at least about 70%, 75%, 80%, 85%, 90% or 95% RNA homogeneity. In some of the embodiments provided, after transcribing the first nucleic acid of the first CAR encoding the polynucleotide in a human cell, optionally in a human T cell, the mRNA transcribed from the first nucleic acid, optionally messenger RNA exhibits at least about 70%, 75%, 80%, 85%, 90% or 95% RNA homogeneity. In some of any of the embodiments provided, after transcription of a second nucleic acid encoding a second CAR of the polynucleotide in a human cell, optionally in a human T cell, mRNA, optionally messenger RNA, transcribed from the second nucleic acid exhibits at least about 70%, 75%, 80%, 85%, 90% or 95% RNA homogeneity.

[0158] In some of any of the embodiments provided, any potential splice donor and / or splice acceptor sites present in the first nucleic acid encoding the first CAR exhibit a splicing prediction score of about or at least about less than 0.70, 0.65, 0.60, 0.55, 0.50, 0.45, 0.40, 0.35, 0.30, 0.25, 0.20 and / or a probability of being involved in a splicing event is predicted to be less than 70%, less than 65%, less than 60%, less than 55%, less than 50%, less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, or less than 20%. In some of any of the embodiments provided, any potential splice donor or acceptor site present in the second nucleic acid encoding the second CAR exhibits a splicing prediction score of about or at least about less than 0.70, 0.65, 0.60, 0.55, 0.50, 0.45, 0.40, 0.35, 0.30, 0.25, 0.20 and / or has a probability of being involved in a splicing event that is predicted to be less than 70%, less than 65%, less than 60%, less than 55%, less than 50%, less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, or less than 20%. In some of any of the embodiments provided, any potential splice donor or acceptor site in the polynucleotide exhibits a splicing prediction score of about or at least about less than 0.70, 0.65, 0.60, 0.55, 0.50, 0.45, 0.40, 0.35, 0.30, 0.25, 0.20 and / or is predicted to be involved in a splicing event with a probability of less than 70%, less than 65%, less than 60%, less than 55%, less than 50%, less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, or less than 20%.

[0159] In some of any of the provided embodiments, the first antigen-binding domain and / or the second antigen-binding domain of (a) is a single-chain antibody fragment. In some of any of the provided embodiments, the first antigen-binding domain and / or the second antigen-binding domain of (a) is or contains a single-chain variable fragment (scFv). In some of any of the provided embodiments, the first antigen-binding domain and / or the second antigen-binding domain of (a) contains a heavy chain variable (VH) region and a light chain variable (VL) region.

[0160] In some of any of the embodiments provided, the first antigen-binding domain or the second antigen-binding domain comprises a VH region comprising CDR-H1 as set forth in SEQ ID NO: 209, CDR-H2 as set forth in SEQ ID NO: 210, and CDR-H3 as set forth in SEQ ID NO: 211; and a VL region comprising CDR-L1 as set forth in SEQ ID NO: 230, CDR-L2 as set forth in SEQ ID NO: 231, and CDR-L3 as set forth in SEQ ID NO: 232. In some of any of the embodiments provided, one of the first antigen-binding domain or the second antigen-binding domain comprises a VH region and a VL region comprising the amino acid sequences set forth in SEQ ID NOs: 197 and 198, respectively. In any of the provided embodiments, the first antigen binding domain or the second antigen binding domain contains the amino acid sequence set forth in SEQ ID NO: 241, or an amino acid sequence that exhibits at least or at least about 90%, at least about or about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least about 99% sequence identity to SEQ ID NO: 241.

[0161] In some of any of the embodiments provided, the first antigen-binding domain or the second antigen-binding domain comprises a VH region comprising CDR-H1 as set forth in SEQ ID NO: 125, CDR-H2 as set forth in SEQ ID NO: 126, and CDR-H3 as set forth in SEQ ID NO: 127; and a VL region comprising CDR-L1 as set forth in SEQ ID NO: 130, CDR-L2 as set forth in SEQ ID NO: 131, and CDR-L3 as set forth in SEQ ID NO: 132. In any of the embodiments provided, one of the first antigen-binding domain or the second antigen-binding domain comprises a VH region and a VL region comprising the amino acid sequences set forth in SEQ ID NOs: 27 and 28, respectively. In any of the provided embodiments, one of the first antigen binding domain or the second antigen binding domain contains the amino acid sequence set forth in SEQ ID NO:8, or an amino acid sequence that exhibits at least or at least about 90%, at least about or about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least about 99% sequence identity to SEQ ID NO:8.

[0162] In any of the provided embodiments, one of the first or second antigen binding domains comprises: a VH region comprising a CDR-H1 as set forth in SEQ ID NO: 209, a CDR-H2 as set forth in SEQ ID NO: 210, and a CDR-H3 as set forth in SEQ ID NO: 211; and a VL region comprising a CDR-L1 as set forth in SEQ ID NO: 230, a CDR-L2 as set forth in SEQ ID NO: 231, and a CDR-L3 as set forth in SEQ ID NO: 232; and the other of the first or second antigen binding domains comprises a VH region comprising a CDR-H1 as set forth in SEQ ID NO: 125, a CDR-H2 as set forth in SEQ ID NO: 126, and a CDR-H3 as set forth in SEQ ID NO: 127; and a VL region comprising a CDR-L1 as set forth in SEQ ID NO: 130, a CDR-L2 as set forth in SEQ ID NO: 131, and a CDR-L3 as set forth in SEQ ID NO: In some of the embodiments provided, one of the first or second antigen-binding domain comprises a VH region and a VL region comprising the amino acid sequences set forth in SEQ ID NOs: 197 and 198, respectively; and the other of the first or second antigen-binding domain comprises a VH region and a VL region comprising the amino acid sequences set forth in SEQ ID NOs: 27 and 28, respectively. In some of the embodiments provided, the first or second antigen-binding domain comprises the amino acid sequence set forth in SEQ ID NO: 241 and the other of the first or second antigen-binding domain comprises the amino acid sequence set forth in SEQ ID NO: 8.

[0163] In some of any of the embodiments provided, one of the first antigen binding domain or the second antigen binding domain is encoded by the nucleotide sequence shown in SEQ ID NO: 310. In some of any of the embodiments provided, one of the first antigen binding domain or the second antigen binding domain is encoded by the nucleotide sequence shown in SEQ ID NO: 264 or SEQ ID NO: 311. In some of any of the embodiments provided, the first antigen binding domain or the second antigen binding domain is encoded by the nucleotide sequence shown in SEQ ID NO: 310, and the other of the first antigen binding domain or the second antigen binding domain is encoded by the nucleotide sequence shown in SEQ ID NO: 311.

[0164] In some of any of the provided embodiments, (b) is or contains a spacer. In some of any of the provided embodiments, (b) contains a portion of an immunoglobulin. In some of any of the provided embodiments, (b) contains sequences of a hinge region, a CH2 region, and a CH3 region. In some of any of the provided embodiments, the hinge region contains all or a portion of an IgG4 hinge region and / or an IgG2 hinge region, wherein the IgG4 hinge region is optionally a human IgG4 hinge region and the IgG2 hinge region is optionally a human IgG2 hinge region; C H Region 2 contains IgG4 C H 2 and / or IgG2 C H 2, wherein the IgG4 C H 2Optionally human IgG4 C H 2 and the IgG2 C H 2Optionally human IgG2C H 2; and / or C H Region 3 contains IgG4 C H 3 and / or IgG2 C H 3, wherein the IgG4 C H 3Optionally human IgG4 C H 3 and the IgG2 C H 3Optionally human IgG2 C H 3. In some of any of the provided embodiments, the hinge region, CH2, and CH3 contain all or a portion of the hinge, C H All or part of 2 and C H 3. In some of any of the embodiments provided, the hinge region, C H 2 and C H One or more of 3 is chimeric and contains hinge, C from human IgG4 and human IgG2 H 2 and C H 3. In some of any of the embodiments provided, (b) contains an IgG4 / 2 chimeric hinge region, or a modified IgG4 hinge region containing at least one amino acid substitution compared to a human IgG4 hinge; H Region 2; and IgG4C H Zone 3.

[0165] In some of any of the embodiments provided, (b) is or contains a spacer. In some of any of the embodiments provided, (b) is or contains a spacer. In some of any of the embodiments provided, the length of (b) is from or about 125 to 300 amino acids, 125 to 250 amino acids, 125 to 230 amino acids, 125 to 200 amino acids, 125 to 180 amino acids, 125 to 150 amino acids, 150 to 300 amino acids, 150 to 250 amino acids, 150 to 230 amino acids, 150 to 200 amino acids, 150 to 180 amino acids, 180 to 300 amino acids, 180 to 250 amino acids. In some embodiments, the first or second CAR comprises a nucleic acid sequence of at least about 224, at least about 225, at least about 226, at least about 227, at least about 228, or at least about 229 amino acids in length. ...6, or at least about 229 amino acids in length. In some embodiments, the first or second CAR comprises a nucleic acid sequence of at least about 224, at least about 225, at least about 226, at least about 226, at least about 227, at least about 226, or at least about 229 amino acids in length. In some embodiments, the first or second CAR comprises a nucleic acid sequence of at least about 224, at least about 225, at least about 226, at least about 226, at least about 226, at least about 226, at least about 226, at least about 226, at least about 226, at

[0166] In some of the embodiments provided, (c) is or contains a transmembrane domain. In some of the embodiments provided, (c) is or contains a transmembrane domain of CD4, CD28 or CD8, optionally from a transmembrane domain of human CD4, human CD28 or human CD8. In some of the embodiments provided, (c) is or contains a human CD28 transmembrane domain. In some of the embodiments provided, (c) is or contains the amino acid sequence shown in SEQ ID NO: 18. In some of the embodiments provided, (c) in one of the first CAR or the second CAR is encoded by the nucleotide sequence shown in SEQ ID NO: 56, and (c) in the other of the first CAR or the second CAR is encoded by the nucleotide sequence shown in SEQ ID NO: 307.

[0167] In some of the embodiments provided, (d) is or includes an intracellular signal transduction domain containing an intracellular signal transduction domain and a costimulatory signal transduction domain. In some of the embodiments provided, the intracellular signal transduction domain of (d) is capable of inducing a primary activation signal in T cells, is a T cell receptor (TCR) component and / or contains an immunoreceptor tyrosine-based activation motif (ITAM). In some of the embodiments provided, the intracellular signal transduction domain of (d) is or contains a CD3-zeta (CD3ζ) chain or a functional variant thereof or a signal transduction portion, optionally a cytoplasmic signal transduction domain of a human CD3ζ chain. In some of the embodiments provided, the intracellular signal transduction domain of (d) is or contains the amino acid sequence shown in SEQ ID NO:20. In some of the embodiments provided, the intracellular signal transduction domain of (d) of one of the first CAR or the second CAR is encoded by the nucleotide sequence shown in SEQ ID NO:58 and the intracellular signal transduction domain of (d) in another of the first CAR or the second CAR is encoded by the nucleotide sequence shown in SEQ ID NO:309. In some of any provided embodiments, (d) is or includes an intracellular signal transduction domain containing an intracellular signal transduction domain and a costimulatory signal transduction domain. In some of any provided embodiments, the costimulatory signal transduction domain of (d) contains the intracellular signal transduction domain of a T cell costimulatory molecule or its signal transduction portion. In some of any provided embodiments, the costimulatory signal transduction domain of (d) contains the intracellular signal transduction domain of CD28, 4-1BB or ICOS or its signal transduction portion, optionally human CD28, human 4-1BB or human ICOS. In some of any provided embodiments, the costimulatory signal transduction domain of (d) contains the intracellular signal transduction domain of 4-1BB. In some of any provided embodiments, the costimulatory signal transduction domain of (d) is or contains the amino acid sequence shown in SEQ ID NO:19. In some of any of the embodiments provided, the costimulatory signaling region of (d) in one of the first CAR or the second CAR is encoded by the nucleotide sequence shown in SEQ ID NO:60 and the costimulatory signaling region of (d) in the other of the first CAR or the second CAR is encoded by the nucleotide sequence shown in SEQ ID NO:308.

[0168] In some of any of the embodiments provided, (a) is or contains a first antigen binding domain or a second antigen binding domain, (b) is or contains a spacer, (c) is or contains a transmembrane domain, and (d) is or includes an intracellular signaling region comprising an intracellular signaling domain and a costimulatory signaling region. In some of any of the embodiments provided, one of the first CAR or the second CAR contains (a) a first antigen binding domain that binds to GPRC5D, optionally wherein the first antigen binding domain is encoded by the nucleotide sequence shown in SEQ ID NO: 311; (b) a spacer encoded by the nucleotides shown in SEQ ID NO: 305; (c) a transmembrane domain encoded by the nucleotide sequence shown in SEQ ID NO: 307; and (d) an intracellular signaling domain containing an intracellular signaling domain encoded by the nucleotide sequence shown in SEQ ID NO: 309 and a costimulatory signaling region encoded by the nucleotide sequence shown in SEQ ID NO: 308; the other of the first CAR and the second CAR contains (a) an antigen binding domain that binds to BCMA, optionally wherein the antigen binding domain is encoded by the nucleotide sequence shown in SEQ ID NO: 310; (b) a spacer encoded by the nucleotides shown in SEQ ID NO: 48; (c) a transmembrane domain encoded by the nucleotide sequence shown in SEQ ID NO: 56; and (d) a transmembrane domain encoded by the nucleotide sequence shown in SEQ ID NO: The intracellular signal transduction domain is encoded by the nucleotide sequence shown in NO:58 and the intracellular signal transduction domain is encoded by the nucleotide sequence shown in SEQ ID NO:60.

[0169] In some of any of the embodiments provided, the first nucleic acid sequence encoding the first CAR is located at the 5' end of the polynucleotide relative to the second nucleic acid sequence encoding the first CAR. In some of any of the embodiments provided, the first CAR contains an antigen binding domain that binds to GPRC5D and the second CAR contains an antigen binding domain that binds to BCMA. In some of any of the embodiments provided, the first CAR contains an antigen binding domain that binds to BCMA and the second CAR contains an antigen binding domain that binds to GPRC5D.

[0170] The present application also provides a polynucleotide comprising (i) a first nucleic acid sequence encoding a first chimeric antigen receptor (CAR), (ii) a second nucleic acid sequence encoding a second chimeric antigen receptor (CAR), and (iii) a nucleotide sequence encoding a multicistronic module, wherein the first nucleic acid encoding the first CAR and the second nucleic acid encoding the second CAR are separated by the multicistronic module; wherein the first CAR comprises a first antigen binding domain that binds to GPRC5D, optionally wherein the first antigen binding domain is encoded by the nucleotide sequence shown in SEQ ID NO: 311; a spacer encoded by the nucleotide sequence shown in SEQ ID NO: 305; a transmembrane domain encoded by the nucleotide sequence shown in SEQ ID NO: 307; and an intracellular signaling region comprising an intracellular signaling domain encoded by the nucleotide sequence shown in SEQ ID NO: 309 and a costimulatory signaling region encoded by the nucleotide sequence shown in SEQ ID NO: 308; wherein the second CAR comprises a second antigen binding domain that binds to BCMA, optionally wherein the second antigen binding domain is encoded by the nucleotide sequence shown in SEQ ID NO: 310; a spacer encoded by the nucleotide sequence shown in SEQ ID NO: 311; a spacer encoded by the nucleotide sequence shown in SEQ ID NO: 312; a spacer encoded by the nucleotide sequence shown in SEQ ID NO: 313; a spacer encoded by the nucleotide sequence shown in SEQ ID NO: 314; a spacer encoded by the nucleotide sequence shown in SEQ ID NO: 315; a spacer encoded by the nucleotide sequence shown in SEQ ID NO: 316; a spacer encoded by the nucleotide sequence shown in SEQ ID NO: 317; a spacer encoded by the nucleotide sequence shown in SEQ ID NO: 318; a spacer encoded by the nucleotide sequence shown in SEQ ID NO: 319; a spacer encoded by the nucleotide sequence shown in SEQ ID NO: 320; a spacer encoded by the nucleotide sequence shown in SEQ ID NO:48, a spacer encoded by the nucleotide sequence shown in SEQ ID NO:48; a transmembrane domain encoded by the nucleotide sequence shown in SEQ ID NO:56; and an intracellular signal transduction region containing an intracellular signal transduction domain encoded by the nucleotide sequence shown in SEQ ID NO:58 and a costimulatory signal transduction domain region encoded by the nucleotide sequence shown in SEQ ID NO:60; and wherein the first nucleic acid sequence encoding the first CAR is located at the 5' end of the polynucleotide relative to the second nucleic acid sequence encoding the second CAR.

[0171] The present application also provides a polynucleotide comprising (i) a first nucleic acid sequence encoding a first chimeric antigen receptor (CAR), (ii) a second nucleic acid sequence encoding a second chimeric antigen receptor (CAR), and (iii) a nucleotide sequence encoding a multicistronic module, wherein the first nucleic acid encoding the first CAR and the second nucleic acid encoding the second CAR are separated by the multicistronic module; wherein the first CAR comprises a first antigen binding domain that binds to BCMA, optionally wherein the first antigen binding domain is encoded by the nucleotide sequence shown in SEQ ID NO: 310; a spacer encoded by the nucleotide sequence shown in SEQ ID NO: 48; a transmembrane domain encoded by the nucleotide sequence shown in SEQ ID NO: 56; and an intracellular signaling region comprising an intracellular signaling domain encoded by the nucleotide sequence shown in SEQ ID NO: 58 and a costimulatory signaling domain region encoded by the nucleotide sequence shown in SEQ ID NO: 60; wherein the second CAR comprises a second antigen binding domain that binds to GPRC5D, optionally wherein the second antigen binding domain is encoded by the nucleotide sequence shown in SEQ ID NO: 311; a spacer encoded by the nucleotide sequence shown in SEQ ID NO: 48; a transmembrane domain encoded by the nucleotide sequence shown in SEQ ID NO: 56; and a transcellular signaling region comprising an intracellular signaling domain encoded by the nucleotide sequence shown in SEQ ID NO: 58 and a costimulatory signaling domain region encoded by the nucleotide sequence shown in SEQ ID NO: 60; NO: 305 encoding a spacer; a transmembrane domain encoded by the nucleotide sequence shown in SEQ ID NO: 307; and an intracellular signal transduction region containing an intracellular signal transduction domain encoded by the nucleotide sequence shown in SEQ ID NO: 309 and a costimulatory signal transduction region encoded by the nucleotide sequence shown in SEQ ID NO: 308; and wherein the first nucleic acid sequence encoding the first CAR is located at the 5' end of the polynucleotide relative to the second nucleic acid sequence encoding the second CAR.

[0172] In some of any of the embodiments provided, the polycistronic module comprises the amino acid sequence set forth in SEQ ID NO: 37. In some of any of the embodiments provided, the polycistronic module is encoded by the nucleotide sequence set forth in SEQ ID NO: 44 or SEQ ID NO: 45. In some of any of the embodiments provided, the polycistronic module is encoded by the nucleotide sequence set forth in SEQ ID NO: 319.

[0173] In some of any of the embodiments provided, the polynucleotide contains the nucleotide sequence shown in SEQ ID NO: 299. In some of any of the embodiments provided, the polynucleotide encodes the sequence shown in SEQ ID NO: 298.

[0174] In some of any of the embodiments provided, the polynucleotide contains the nucleotide sequence shown in SEQ ID NO: 302. In some of any of the embodiments provided, the polynucleotide encodes the sequence shown in SEQ ID NO: 301.

[0175] In some of any of the embodiments provided, the polynucleotide contains the nucleotide sequence set forth in SEQ ID NO: 315. In some of any of the embodiments provided, the polynucleotide contains the nucleotide sequence set forth in SEQ ID NO: 316.

[0176] The application also provides polynucleotides, wherein the polynucleotide encodes a GPRC5D binding domain, a BCMA binding domain, and an intracellular signaling region containing an intracellular signaling domain of 4-1BB. In some of any of the embodiments provided, the polynucleotide contains the nucleotide sequence shown in SEQ ID NO:317.

[0177] Also provided are vectors containing any of the provided polynucleotides. In some of any of the provided embodiments, the vector is a viral vector. In some of any of the provided embodiments, the viral vector is a lentiviral vector or a retroviral vector.

[0178] Also provided are genetically engineered cells containing any of the chimeric antigen receptors provided herein. In some of any of the provided embodiments, the genetically engineered cells contain a chimeric antigen receptor provided herein and further include a polynucleotide containing a nucleotide sequence encoding a second chimeric antigen receptor.

[0179] Also provided are genetically engineered cells containing any of the polynucleotides provided herein.

[0180] In some of any provided embodiments, the genetically engineered cells are lymphocytes. In some of any provided embodiments, the genetically engineered cells are NK cells or T cells. In some of any provided embodiments, the genetically engineered cells are T cells, and the T cells are CD4+ or CD8+ T cells.

[0181] In some of any of the provided embodiments, the genetically engineered cells are genetically engineered from primary cells obtained from a subject.

[0182] In some of any of the embodiments provided, the genetically engineered cell is in a plurality of genetically engineered cells, wherein less than or less than about 10%, 9%, 8%, 7%, 5%, 4%, 3%, 2% or 1% of the cells in the plurality of cells contain a chimeric antigen receptor that exhibits tonic signaling and / or antigen-independent activity or signaling.

[0183] Also provided are compositions containing any of the chimeric antigen receptors provided herein. In some of any of the embodiments provided, the composition contains CD4+ and CD8+ T cells and the ratio of CD4+ T cells to CD8+ T cells is from or about 1:3 to 3:1. In some embodiments, the ratio of CD4+ T cells to CD8+ T cells in the composition is from 1:2 to 2:1. In some embodiments, the ratio of CD4+ T cells to CD8+ T cells in the composition is 1:1. In some of any of the embodiments provided, the composition further contains a pharmaceutically acceptable excipient. In some of any of the embodiments provided, the composition is sterile.

[0184] The present application also provides methods of treatment comprising administering to a subject having a disease or condition any of the compositions provided herein containing any of the genetically engineered cells provided herein or any of the compositions provided herein containing any of the chimeric antigen receptors provided herein. In some of any of the embodiments provided, the cell dose comprises at least or at least about 2.5×10 7 CAR-expressing T cells and 1.2×10 9 CAR-expressing T cells, at least or at least about 5.0×10 7 CAR-expressing T cells and 4.5×10 8 CAR-expressing T cells, at least or at least about 1.5×10 8 CAR-expressing T cells and 3.0×10 8 In some embodiments, the cell dose is at or about 1×10 7 CAR-expressing T cells with or with approximately 2×10 9 In some embodiments, the cell dose is at or about 2.5×10 7 CAR-expressing T cells with or with approximately 1.2×10 9 CAR-expressing T cells, between or at about 5.0×10 7 CAR-expressing T cells with or with approximately 4.5×10 8 CAR-expressing T cells, or between or about 1.5×10 8 CAR-expressing T cells with or with approximately 3.0×10 8 In some embodiments, the cell dose contains or comprises about 2.5×10 7 , containing or containing about 5.0×10 7 , containing or containing about 1.5×108 , containing or containing about 3.0×10 8 , containing or containing about 4.5×10 8 , containing or containing about 8.0×10 8 or containing about 1.2×10 9 In some embodiments, the cell dose contains or comprises about 5.0×10 7 , containing or containing about 1.5×10 8 , containing or containing about 3.0×10 8 or containing about 4.5×10 8 In some embodiments, the cell dose contains or comprises about 5.0×10 7 , containing or containing about 1.5×10 8 , containing or containing about 3.0×10 8 or containing about 4.5×10 8 In some embodiments, the cell dose contains or comprises about 5.0×10 7 CAR-expressing T cells.

[0185] The present application also provides methods of treatment comprising administering to a subject having a disease or condition any of the compositions provided herein containing any of the genetically engineered cells provided herein or any of the compositions provided herein containing any of the chimeric antigen receptors provided herein. In some of any of the embodiments provided, the cell dose comprises at least or at least about 1.0×10 7 CAR-expressing T cells and 1.2×10 9 CAR-expressing T cells, at least or at least about 1.5×10 7 CAR-expressing T cells and 4.5×10 8 between CAR-expressing T cells, at least or at least about 2.0×10 7 CAR-expressing T cells and 3.0×10 8 between CAR-expressing T cells.

[0186] The present application also provides a method of treating a disease or condition, comprising: administering to a subject having a disease or condition a composition comprising a plurality of genetically engineered cells, the plurality of genetically engineered cells comprising a first chimeric antigen receptor and a second chimeric antigen receptor, wherein each of the plurality of genetically engineered cells is any chimeric antigen receptor provided herein or encoded by any of the polynucleotides provided herein; and administering to the subject a composition comprising a plurality of second genetically engineered cells, the plurality of second genetically engineered cells comprising a second chimeric antigen receptor. In some of any of the embodiments provided, the dose of the plurality of first genetically engineered cells and the dose of the plurality of second genetically engineered cells independently contain at or about 1.0×10 7 CAR-expressing T cells and 1.5×10 9 CAR-expressing T cells, between or at about 1.25×10 7 CAR-expressing T cells and 0.6×10 8 CAR-expressing T cells, between or at about 2.5×10 7 CAR-expressing T cells and 2.25×10 8 CAR-expressing T cells, between or at about 7.5×10 7 CAR-expressing T cells and 1.5×10 8 CAR-expressing T cells, between or at about 2.5×10 7 CAR-expressing T cells and 1.2×10 9 CAR-expressing T cells, between or at about 5.0×10 7 CAR-expressing T cells and 4.5×10 8 CAR-expressing T cells, between or at about 1.5×10 8 CAR-expressing T cells and 3.0×10 8 between CAR-expressing T cells.

[0187] In some of any of the provided embodiments of the provided methods, the disease or disorder is associated with expression of G protein coupled class C group 5, member D (GPRC5D).

[0188] In some of any of the provided embodiments of the provided methods, the disease or disorder is further associated with expression of B-cell maturation antigen (BCMA).

[0189] In some of any of the provided embodiments of the provided methods, the disease or disorder is a B cell-related disorder. In some of any of the provided embodiments of the provided methods, the BCMA-related disease or disorder is an autoimmune disease or disorder. In some of any of the provided embodiments of the provided methods, the autoimmune disease or disorder is systemic lupus erythematosus (SLE), lupus nephritis, inflammatory bowel disease, rheumatoid arthritis, ANCA-associated vasculitis, idiopathic thrombocytopenic purpura (ITP), thrombotic thrombocytopenic purpura (TTP), autoimmune thrombocytopenia, Chagas' disease, Grave's disease, Wegener's granulomatosis, polyarteritis nodosa, Sjogren's syndrome, pemphigus vulgaris, scleroderma, multiple sclerosis, psoriasis, IgA nephropathy, IgM polyneuropathy, vasculitis, diabetes, Reynaud's syndrome, antiphospholipid syndrome, Goodpasture's disease, Kawasaki disease, disease), autoimmune hemolytic anemia, myasthenia gravis, or progressive glomerulonephritis.

[0190] In some of the embodiments of any of the methods provided, the disease or condition is cancer. In some of the embodiments of any of the methods provided, the cancer is a cancer that expresses GPRC5D. In some of the embodiments of any of the methods provided, the cancer is a plasma cell malignancy, and the plasma cell malignancy is multiple myeloma (MM) or plasmacytoma. In some of the embodiments of any of the methods provided, the cancer is multiple myeloma (MM). In some of the embodiments of any of the methods provided, the cancer is relapsed / refractory multiple myeloma.

[0191] In some of the embodiments of any of the methods provided, the subject is refractory to treatment or has relapsed after administration of BCMA-targeted therapy, optionally after administration of T cells comprising a CAR that specifically binds BCMA. In some of the embodiments of any of the methods provided, the following subjects are selected for treatment, which are refractory to treatment or have relapsed after administration of BCMA-targeted therapy, optionally after administration of T cells comprising a CAR that specifically binds BCMA. In some of the embodiments of any of the methods provided, prior to administering the cell dose, the subject has previously received administration of a BCMA-targeted therapy for treating the disease or condition. In some of the embodiments of any of the methods provided, prior to administering the first dose of cells and the second dose of cells, the subject has previously received administration of a BCMA-targeted therapy for treating the disease or condition.

[0192] In some of the embodiments of any of the provided methods, the BCMA-targeted therapy comprises a composition comprising T cells comprising a CAR that specifically binds to BCMA. In some of the embodiments of any of the provided methods, the subject is refractory or has relapsed after administration of a BCMA-targeted therapy, optionally after administration of a T cell comprising a CAR that specifically binds to BCMA. In some of the embodiments of any of the provided methods, the subject comprises multiple myeloma cells that exhibit loss of the BCMA antigen or antigenic determinant, downregulation of BCMA, and / or BCMA-negative tumor cells after prior administration. BRIEF DESCRIPTION OF THE DRAWINGS

[0193] Figure 1ACancer Cell Line Encyclopedia CD138 mRNA expression data (in log2) are shown. Cancer types from left to right: upper aerodigestive tract cancer (32); esophageal cancer (25); prostate cancer (7); multiple myeloma (30); bile duct cancer (8); lung cancer (131); pancreatic cancer (44); kidney cancer (34); breast cancer (58); colorectal cancer (61); gastric cancer (38); meningioma (3); liver cancer (28); glioma (62); osteosarcoma (10); thyroid cancer (12); endometrial cancer (27); soft tissue cancer (21); mesothelioma (11); ovarian cancer (51); chondrosarcoma (4); small cell lung cancer (53); melanoma (61); neuroblastoma (17); medulloblastoma (4); Ewing sarcoma (12); Hodgkin's lymphoma (12); lymphoma (12); DLBCL (18); other lymphomas (28); B-cell cancer (15); CML (15); Burkitt lymphoma (11); T-cell cancer (16); AML (34); other leukemias (1).

[0194] Figure 1B Figure 5. GPRC5D mRNA expression in malignant cell lines [n=1036; Cancer Cell Line Encyclopedia (CCLE)]. RMA, robust multiarray average; DLBCL, diffuse large B-cell lymphoma; CML, chronic myeloid leukemia; ALL, acute lymphoblastic leukemia; AML, acute myeloid leukemia; NSC, non-small cell lung cancer. Cancer types from left to right: multiple myeloma (30); other leukemias (1); DLBCL (18); CML (15); meningioma (3); other lymphomas (28); Burkitt's lymphoma (11); Hodgkin's lymphoma (12); T-cell carcinoma (16); B-cell carcinoma (15); bile duct carcinoma (8); AML (34); pancreatic cancer (44); thyroid cancer (12); colorectal cancer (61); kidney cancer (34); osteosarcoma (10); urinary tract cancer ( 27); breast cancer (58); neuroblastoma (17); non-small cell lung cancer (131); Ewing's sarcoma (12); prostate cancer (7); melanoma (61); upper aerodigestive tract cancer (32); endometrial cancer (27); medulloblastoma (4); liver cancer (28); ovarian cancer (51); gastric cancer (38); glioma (62); small cell lung cancer (53); mesothelioma (11); esophageal cancer (25); other cancers (150); chondrosarcoma (4).

[0195] Figure 2ACD138 GTEx RNASeq expression data for various organs are shown. Tissue types (from left to right) are: cerebellum, cerebral hemisphere, anterior cingulate cortex, frontal cortex, cortex, amygdala, hippocampus, nucleus accumbens, caudate nucleus, putamen, sigmoid colon, tibial nerve, skeletal muscle, uterus, esophageal muscularis, esophagogastric junction, hypothalamus, adipose tissue, cervix, coronary artery, cervical spinal cord, substantia nigra, ovary, tibial artery, breast tissue, fallopian tube, adipose tissue, kidney, left ventricle, cervix, adrenal gland, bladder, whole blood, skin (exposed to sunlight), skin (unexposed to sunlight), aorta, tonsil, small intestine, pancreas, liver, auricle, vagina, stomach, prostate, spleen, umbilical cord blood, thyroid gland, transverse colon, pituitary gland, esophageal mucosa, testis, minor salivary gland, lung, and bone marrow.

[0196] Figure 2B Figure 5. GPRC5D mRNA expression in normal tissues based on Gtex RNASeq data (Gtex 708ENSG00000111291.4). The dashed line indicates GPRC5D expression in CD138-sorted primary MM cells (Blueprint RNAseq; n=9). FPKM, fragments per kilobase of transcript per million mapped reads. The types of tissues from left to right are: cerebellum, cerebral hemisphere, anterior cingulate cortex, frontal cortex, cortex, amygdala, hippocampus, nucleus accumbens, caudate nucleus, putamen, sigmoid colon, tibial nerve, skeletal muscle, uterus, esophageal muscularis, esophagogastric junction, hypothalamus, adipose tissue, cervix, coronary artery, cervical spinal cord, substantia nigra, ovary, tibial artery, breast tissue, fallopian tube, adipose tissue, kidney, left ventricle, cervix, adrenal gland, bladder, whole blood, skin (exposed to sunlight), skin (not exposed to sunlight), aorta, tonsil, small intestine, pancreas, liver, auricle, vagina, stomach, prostate, spleen, umbilical cord blood, thyroid gland, transverse colon, pituitary gland, esophageal mucosa, testis, minor salivary gland, lung, primary MM (bone marrow).

[0197] Figure 2C Shown is GPRC5D mRNA expression in primary human tissue cell types as determined by Blueprint RNAseq. FPKM, fragments per kilobase of transcript per million mapped reads.

[0198] Figure 3A Shown are Kaplan-Meier curves for progression-free survival (PFS) stratified by subjects with MM whose GPRC5D expression was above (>) or below (<) the median GPRC5D expression as determined by RNA-seq. The significance of the equal risk was determined by the log-rank test (p = 0.0031; n = 765).

[0199] Figure 3B Shown are the International Staging System (ISS) scores of subjects with MM stratified by GPRC5D expression (n=369 above the median, 374 below the median).

[0200] Figure 3C-3H Shown are the frequencies of common cytogenetic abnormalities in MM subjects stratified by GPRC5D expression (n=287-291 above the median, 280-282 below the median).

[0201] Figure 4A Shown are outlier box plots quantifying GPRC5D protein in cell lines following immunohistochemical detection. Outlier box plots indicate median membrane optical density and interquartile range (IQR); whiskers are 1.5 × IQR. The mean fluorescence intensity (MFI) of GPRC5D expression in K562 cells genetically engineered to express the protein is given by the number following the cell line designation K562-GPRC5D.

[0202] Figure 4B Automated quantitative immunofluorescence in 83 bone marrow samples from MM patients is shown. Each bar represents an individual patient sample.

[0203] Figure 4C Shown are the percentages of patient samples in which greater than 50% of CD138+ cells expressed BCMA, GPRC5D, or either BCMA or GPRC5D as determined by automated quantitative immunofluorescence in 83 bone marrow samples from MM patients.

[0204] Figure 4D Shows the correlation between BCMA and GPRC5D expression on CD138+ cells; R 2 =0.156.

[0205] Figure 5 Linear, conformational, and discontinuous epitope binding of a subset of GPRC5D-targeting scFvs assessed by ELISA-based techniques are shown.

[0206] Figure 6A and Figure 6B Antigen-independent (tonic) signaling of CARs containing the indicated scFv and spacer is shown. Jurkat Nur77-RFP reporter cells were transduced with one of 42 CAR / GFP bicistronic constructs. Eleven days after transduction, 5×10 5Live GFP+ Jurkat cells were cultured and RFP expression was monitored. Expression of both RFP and GFP indicates tonic signaling; expression of GFP alone indicates transduction by CAR without tonic signaling.

[0207] Figure 6C-6E Depicts the expression of long spacer ( Figure 6C ), medium-length spacers ( Figure 6D ) and short spacers ( Figure 6E Comparison of antigen-dependent signaling with antigen-independent signaling of candidate CARs. Percent CAR T cell signaling was determined as follows: RFP+GFP+ cells / total GFP+ cells. Data are representative of two experiments.

[0208] Figure 6F Shown along the y-axis are cells transduced with GFP+ indicated by CAR. RFP is shown along the x-axis and is a surrogate for Nur77 expression. The percentage shown is only for transduced GFP+ cells that are RFP+ (top quadrant only).

[0209] Figure 7A Depicts binding of HEK293 cells transiently expressing one of the human G protein-coupled receptor (GPCR) libraries and cytoplasmic GFP to co-cultured HEK293 cells transiently expressing anti-GPRC5D scFv clone 203, a long spacer, and cytoplasmic mCherry 761 (both in suspension), quantified by automated flow cytometry analysis. Prespecified significance threshold (red line): Z score 3; p < 0.0027.

[0210] Figure 7B Binding of the anti-GPRC5D scFv clone 203mIgG2a Fc chimeric antibody to HEK293 cells expressing the indicated cell surface proteins is shown. Binding to potential off-target proteins and nonspecific binders identified in a microarray screen of >4400 transmembrane proteins is demonstrated. ZsGreen1, transfection control; isotype, irrelevant scFv-mIgG2aFc, negative control; CTLA-4 / CD86 interaction, positive control.

[0211] Figure 7CResults are shown for the evaluation of potential off-target proteins PCDH1A or FCGR2A activated by GPRC5D(203)CAR. Jurkat Nur77-RFP activation reporter cells expressing a bicistronic plasmid containing GPRC5D(203)CAR and GFP were co-cultured with K562 cells expressing the indicated antigens, GPRC5D (positive control), or BCMA (negative control). Activation was measured as % RFP+GFP+ cells / total GFP+ cells.

[0212] Figure 7D We showed that CRISPR-Cas9-mediated knockout of GPRC5D in MM cell lines abolished activation of GPRC5D(203)CAR-Jurkat Nur77 reporter cells as assessed by changes in RFP expression measured by flow cytometry.

[0213] Figure 8A GPRC5D mRNA expression in MM cell lines and primary MM cells (boxed) is shown.

[0214] Figure 8B Shown are the results of cytotoxicity of GPRC5D(203)-expressing CAR T cells against MM1.S, OPM2, and RPMI-8226 target cells after 24 h of co-culture as indicated by the percentage of lysis normalized to donor-matched, mock-transduced CAR T cells (two donors each in technical triplicate; mean ± SD).

[0215] Figure 9A Shown are cell killing of OPM2-ffLuc MM cells induced by CAR T cells incorporating the indicated scFvs after 24 hours of co-culture as indicated by ATP-dependent bioluminescence after addition of luciferin; normalized to tumor cell-only control (data pooled from 2 experiments performed in triplicate, mean ± SEM; p < 0.001).

[0216] Figure 9B and Figure 9C Depicts flow cytometric analysis of killing of primary bone marrow mononuclear cells (BMMCs) from a patient with multiply relapsed MM following overnight co-culture with anti-GPRC5D CAR T cells at a 1:1 CAR+T cell:BMMC ratio. MM cells, CD138+ / CD38hi; curves are gated for live CD3- cells.

[0217] Figure 9D Depicted are flow cytometry analyses of primary BMMCs from additional patients, plotted for CD138+ / CD3-.

[0218] Figures 10A to 10C Shown are cytokine production by CAR T cells incorporating the indicated scFvs after 24 h of 1:1 co-culture with OPM2 MM cells or culture alone, as measured in supernatants by multiplex luminex analysis.

[0219] Figure 11A and Figure 11B Proliferation of mock-transduced or GPRC5D-expressing (203) CAR T cells cultured alone or in a 1:1 ratio with B-ALL cells (Nalm6; GPRC5D-) or MM cells (OPM2; endogenous GPRC5D+) is shown. Figure 11C and Figure 11D T cells were stained with CellTrace violet (CTV) before co-culture and stained for CD4, CD8 and CD25 after 72 hours. Figure 11A and Figure 11B ) Proliferation is indicated by dilution of CTV fluorescence. ( Figure 11C and Figure 11D ) Activation is indicated by increased CD25 fluorescence.

[0220] Figure 12A Depicted are representative FACS analyses of CAR expression in CAR T cells measured using spacer-specific antibodies.

[0221] Figure 12B Depicts 14 days after OPM2 injection, in which 3 × 10 cells were injected with CAR T cells incorporating the indicated anti-GPRC5D scFv clones. 6 Survival rate of 4-1BB-treated mice (n=8 / group).

[0222] Figure 12C Depicted are tumor volume and survival of mice in an RPMI-8226 xenograft model from one of two experiments; median survival days 29 vs. 50 days (p<0.05; n=5 / group, representative of two experiments).

[0223] Figure 12D Figure 2. Tumor volume and CAR T cell expansion in mice in an RPMI-8226 xenograft model as monitored by flow cytometry of peripheral blood as detected by antibodies against the spacer (p<0.001; n=10 / group; two time points).

[0224] Figure 13A Depicted are 3×10 cells modified to express a bicistronic construct 21 days after injection of OPM2. 6Survival of mice (n=5 / group) treated with T cell gene therapy using a bicistronic construct encoding extGLuc and a CAR incorporating the scFv CD19 (SJ25C1) or GPRC5D (203) and either the 4-1BB or CD28 costimulatory domain.

[0225] Figure 13B , C and D depict from Figure 13A Figure 3. Tumor burden in mice treated with OPM-ffLuc (D-luciferin bioluminescence images [BLI] of OPM-ffLuc).

[0226] Figure 13E showed that CAR T cell therapy can effectively treat Figure 13A Results of CAR T cell homing (coelenterazine BLI of extGLuc CAR T cells) performed on mice.

[0227] Figure 14A and 14B Shown is the dose response of GPRC5D-targeted and BCMA-targeted CART cell therapies administered 14 days after OPM2 injection (n=8 mice / group). Figure 14A In the figure, tumor burden assessed by BLI of OPM-ffLuc is shown. Figure 14B In the middle, the percentage of survival is shown (p-values ​​shown are relative to mock-transduced or irrelevant targeted CAR T cells).

[0228] Figures 15A-15C Figure 5. IFN-γ expression in GPRC5D(203), anti-BCMA, or mock-treated T cells after 20 h of co-culture with twenty different normal primary human cell types or OPM2 cells. Figure 15A ), TNF-α( Figure 15B ) and IL-2( Figure 15C ) levels (mean ± SD).

[0229] Figure 15D Depicts the results of screening murine and cynomolgus macaque cross-reactive scFv clones for tonic signaling. RFP+% indicates activation following co-culture at a 1:1 effector:target ratio (relative to GFP+CAR-transduced cells).

[0230] Figures 16A-16C In mice injected with 3×10 6 Body mass changes after administration of human T cells expressing a CAR containing a human / murine cross-reactive anti-GPRC5D scFv (clone 205) Figure 16A ),body temperature( Figure 16B ) or BLI of OPM2-ffLuc cells ( Figure 16C ).

[0231] Figure 17A Shown are representative FACs analyses of CAR expression as measured using a truncated receptor surrogate marker in non-human primate (NHP) T cells transduced to express a cynomolgus macaque cross-reactive GPRC5D CAR or cynomolgus macaque GPRC5D.

[0232] Figure 17B Shown are target lysis by NHP T cells or mock T cells transduced to express the cynomolgus macaque cross-reactive GPRC5D CAR against autologous target antigen-presenting cells (tAPCs) at various effector:target (E:T) ratios.

[0233] Figure 17C show Figure 17B IFNγ production of cells.

[0234] Figure 17D Shown are target lysis by NHP T cells or mock T cells transduced to express the cynomolgus macaque cross-reactive GPRC5D CAR against target K562 or K562-GPRC5D cells at various effector:target (E:T) ratios.

[0235] Figure 17E show Figure 17D IFNγ production of cells.

[0236] Figure 18A Shown are PCR results for CAR-encoding DNA as a measure of CAR T cell persistence in peripheral blood and bone marrow on day 21 after infusion. CAR-transduced NHP T cells were used as a positive control.

[0237] Figures 18B-18D Shown are the results of pathological evaluation 1 to 21 days after injection of cynomolgus macaque T cells modified to express a CAR containing the human / cynomolgus macaque cross-reactive anti-GPRC5D scFv clone 202 into cynomolgus macaques. Figure 18B Describe body temperature, Figure 18C Describe changes in body mass, and Figure 18D Describe body mass.

[0238] Figure 19A Depicted is the injection of 1 × 10 6 Mixed OPM2WT cells and OPM2 BCMA-KO (GFP / ffLuc+) cell population and injected 3×10 6 BLI images of mice injected with the indicated CAR T cells on days 7 and 15. n = 5 mice / group, representative of 2 experiments.

[0239] Figure 19B depiction Figure 19A Images of mice on day 34. n = 5 mice / group, representative of 2 experiments.

[0240] Figure 20A and 20B Display as Figure 19A and 19B OPM2 cells in the bone marrow of mice injected with a mixed population of OPM2 cells and CAR T cells as described in . Representative images are of 3 mice per group. Live / dead cell gating was performed but not shown (n=2 replicates with similar results).

[0241] Figure 21A Minimal tonic signaling via an exemplary anti-BCMA CAR is shown.

[0242] Figure 21B Shown is lysis of target cells by primary human T cells expressing an exemplary anti-BCMA CAR.

[0243] Figure 21C Shown is IFN-γ secretion by primary human T cells expressing an exemplary anti-BCMA CAR when co-cultured with target cells.

[0244] Figure 22A Shown are the loss of GPRC5D expression or BCMA expression assessed by flow cytometry in GPRC5D or BCMA knockout OPM2 cells, respectively.

[0245] Figure 22B Antigen-specific activation of exemplary anti-BCMA and anti-GPRC5D CARs is shown.

[0246] Figure 23 Shown are the gene expression levels of BCMA and GPRC5D in multiple myeloma cell lines.

[0247] Figure 24 Shown are the BCMA and GPRC5D protein expression levels in multiple myeloma and control cell lines.

[0248] Figure 25A and 25B Injection of OPM2 WT cells ( Figure 25A ), OPM2 BCMA KO cells ( Figure 25B ; upper panel) or OPM2 GPRC5D KO cells ( Figure 25BOPM2 tumor burden in mice (Figure 2 ; lower panel). Mice were treated with cell compositions containing cells expressing anti-BCMA CAR (BCMA) or anti-GPRC5D CAR (GPRC5D), or a panel of cells generated containing a 1:1 ratio of cells expressing anti-BCMA CAR and cells expressing anti-GPRC5D CAR (GPRC5D and BCMA pooled cells).

[0249] Figure 26 Shown are the percentage survival rates of mice injected with OPM2 tumor cells and treated with three different doses of cells expressing anti-GPRC5D CAR (GPRC5D) or anti-BCMA CAR (BCMA), or a combination of cells expressing anti-BCMA CAR and cells expressing anti-GPRC5D CAR (GPRC5D and BCMA pooled cells).

[0250] Figure 27 Shown are tumor volumes in mice injected with RPMI8226 cells and treated with three different doses of cells expressing anti-GPRC5D CAR (GPRC5D) or anti-BCMA CAR (BCMA), or a panel of cells expressing anti-BCMA CAR and cells expressing anti-GPRC5D CAR (GPRC5D and BCMA pooled cells).

[0251] Figure 28 Show from Figure 27 The survival rate of mice.

[0252] Figure 29 Depicts an anti-BCMA and anti-GPRC5D dual targeting strategy. (i) and (ii) represent collections of cells expressing anti-BCMA CAR and anti-GPRC5D CAR (GPRC5D and BCMA pooled cells). (iii) and (iv) represent bicistronic constructs, each containing an anti-BCMA CAR and an anti-GPRC5D CAR separated by a self-cleaving peptide. (v) represents a "single stalk" CAR approach, in which an anti-BCMA scFv is tandem with an anti-GPRC5D scFv, separated only by a linker.

[0253] Figure 30 Display in use from Figure 29 After retroviral transduction of cells with the respective constructs, the indicated constructs are expressed on the cell surface.

[0254] Figure 31 showed that as assessed by flow cytometry analysis Figure 29 The retroviral transduction efficiency of each of the depicted constructs is shown.

[0255] Figure 32A Depicts expression as indicated by the percentage of lysed tumor cells Figure 29 Figure 2. Cytotoxicity of T cells expressing the construct depicted in Figure 2 after co-culture with the wild-type OPM2 multiple myeloma cell line. CAR-expressing T cells and target cells were cultured at increasing E:T ratios.

[0256] Figure 32B Depicts expression of BCMA after co-culture with BCMA knockout OPM2 cell line as indicated by the percentage of lysed tumor cells Figure 29 The cytotoxicity of the constructs depicted in Figure 1 was determined. CAR-expressing T cells were cultured with target cells at increasing E:T ratios.

[0257] Figure 33A Shown are the abilities of T cells expressing the indicated CAR constructs to secrete various cytokines when co-cultured with target cells expressing BCMA and GPRC5D for 24 hours.

[0258] Figure 33B Shown are the abilities of T cells expressing the indicated CAR constructs to secrete various cytokines when co-cultured with BCMA-expressing GPRC5D-negative target cells for 24 hours.

[0259] Figure 33C Shown are the abilities of T cells expressing the indicated CAR constructs to secrete various cytokines when co-cultured with GPRC5D-expressing BCMA-negative target cells for 24 hours.

[0260] Figure 34A Depicted are the survival rates of mice injected with OPM2 wild-type cells after treatment with T cells expressing the indicated CARs.

[0261] Figure 34B Depicts the second injection of BCMA knockout OPM2 cells after treatment with T cells expressing the indicated CARs. Figure 34A The survival rate of mice.

[0262] Figures 35A-35C Depicted in 3×10 6 After treatment with CAR-expressing T cells, the primary injection of BCMA knockout OPM2 cells (2×10 6 30 days after Figure 35A ) or 105 days ( Figure 35B ), or in the second injection of BCMA gene knockout OPM2 cells (3×10 6 36 days after Figure 35C ) in mice.

[0263] Figure 36Shown in injection of 2×10 6 After 100 wild-type OPM2 cells were grown, a lower dose (5×10 5 ) Survival rate of mice treated with cells expressing the indicated CARs.

[0264] Figures 37A-37C Depicted are the cells expressing the indicated CARs at day 0 ( Figure 37A ), 15 days( Figure 37B ) or 22 days ( Figure 37C ) after tumor burden in mice injected with wild-type OPM2 cells as assessed via bioluminescence imaging.

[0265] Figure 38 Depicted in 5×10 5 Tumor burden in mice injected with a mixed composition of wild-type OPM2 cells and 5-10% BCMA knockout OPM2 cells after treatment with cells expressing the indicated CARs, as assessed by bioluminescence imaging of wild-type OPM2 cells and BCMA knockout OPM2 cells.

[0266] Figure 39 Display in use 2.5×10 5 Survival rate of mice injected with a mixed composition of wild-type OPM2 cells and 5-10% BCMA knockout OPM2 cells after treatment with cells expressing the indicated CARs.

[0267] Figures 40A-40C Depicted in 5×10 5 Day 0 after treatment with cells expressing designated CARs ( Figure 40A )、22 days( Figure 40B ) or 34 days ( Figure 40C ), tumor burden in mice injected with a mixed composition of wild-type OPM2 cells and 5-10% BCMA knockout OPM2 cells, as assessed via bioluminescence imaging.

[0268] Figure 41A and 41B Loss of expression of post-positioned CARs (BCMA and GPRC5D, respectively) in bicistronic constructs showing no codon divergence.

[0269] Figure 42A and 42B Codon divergence of the bicistronic construct is shown to rescue expression of the post-located CARs (BCMA and GPRC5D, respectively).

[0270] Figure 43 Shown are stimulation of Jurkat Nur77-RFP reporter cells expressing the indicated CARs following co-culture with target cells.

[0271] Figures 44A-44C Shown are the expressions of IFN-γ, IL-2, and TNF-α (respectively) in primary human T cells expressing the indicated CARs when co-cultured with target cells.

[0272] Figure 45 Shown are antigen-specific activation of Jurkat Nur77-RFP reporter cells transduced with the indicated CARs when co-cultured with OPM2 WT cells, OPM2 BCMA KO cells, or OPM2GPRC5D KO cells.

[0273] Figures 46A-46C Figure 3 shows the expression of IFN-γ in primary human T cells expressing the indicated CARs when cultured with OPM2 WT cells, OPM2 BCMA KO cells, or OPM2 GPRC5D KO cells. Figure 46A ), IL-2( Figure 46B ) and TNF-α( Figure 46C )(respectively).

[0274] Figure 47A Shown are tumor burdens (as assessed by BLI) in mice injected with OPM2 WT cells and treated with cells expressing the indicated CARs.

[0275] Figure 47B and 47C The combination of OPM2 WT and BCMA KO cells was shown ( Figure 47B ) or the combination of OPM2 WT and GPRC5DKO cells ( Figure 47C ) and treated with cells expressing the indicated CARs (assessed by BLI).

[0276] Figure 48 Show from Figures 47A-47C The survival rate of mice. DETAILED DESCRIPTION

[0277] The present application provides chimeric antigen receptors (CARs) targeting or for G protein-coupled receptor C class 5 family member D (GPRC5D) and cells and diseases expressing GPRC5D. Cells genetically engineered to express the provided anti-GPRC5D CAR, such as T cells, and compositions containing such cells are also provided. It has been observed that GPRC5D is expressed in certain diseases and conditions, such as malignancies, or on its tissues or cells, for example, on malignant plasma cells such as from recurrent or newly diagnosed myeloma patients, for example, heterogeneously expressed, and for example, very little expressed on normal tissues. In the embodiments provided, there are methods that can be used to treat diseases and conditions and / or can be used to target such cell types, including nucleic acid molecules encoding GPRC5D binding receptors (including chimeric antigen receptors (CARs)), and encoded receptors (such as encoded CARs), and compositions and products comprising them. These receptors generally may contain GPRC5D-specific antibodies (including antigen-binding antibody fragments, such as heavy chain variable (V H ) regions, single domain antibody fragments and single chain fragments, including scFv). Also provided are cells expressing such GPRC5D binding receptors, e.g., anti-GPRC5D CARs and / or containing nucleic acids encoding such receptors, such as genetically engineered or recombinant cells, as well as compositions and products containing such cells and therapeutic agents.

[0278] Adoptive T cell therapy, such as CAR-T cell therapy, shows promise in treating multiple myeloma, and clinical work mainly focuses on targeting B cell maturation antigen (BCMA). However, although BCMA is expressed on many malignant plasma cells, in some cases, expression can be heterogeneous. In some aspects, the heterogeneity of target antigen expression can cause changes or inconsistent reactions. In some aspects, it has also been observed that the expression of BCMA on the cell surface changes over time due to the shedding of the extracellular domain mediated by gamma secretase. Similar to the observations obtained with CD19 and CD22 CAR antigens, it is reported that BCMA antigen reduction occurs in patients with multiple myeloma (MM) who relapse after BCMA-targeted T cell therapy (Brudno et al. (2018) J.Clin.Oncol., JCO2018778084; Cohen et al. (2017) Blood 130:505). In addition, in some cases, the recombinant receptor may exhibit antigen-independent activity or signal transduction (also known as "tonic signal transduction"), which may result in undesirable effects, such as increased differentiation and / or depletion of T cells expressing the recombinant receptor. In some aspects, such activity may limit the activity, effect or effectiveness of T cells. In some cases, during genetic engineering and ex vivo expansion of cells for recombinant receptor expression, cells may exhibit a phenotype indicating depletion due to tonic signal transduction caused by the recombinant receptor. In some cases, alternative or additional MM-targeted T cell therapies are needed.

[0279] The embodiments provided relate to GPRC5D as a CAR T cell target for multiple myeloma. GPRC5D (Uniprot accession number Q9NZD1, e.g., as shown in SEQ ID NO: 49) is a G protein-coupled receptor class C, group 5, member D, belonging to the retinoic acid-inducible gene-1 (RAIG) family. It is a 39 kDa G protein-coupled receptor with seven transmembrane helices and two reported isoforms, with the difference in isoforms occurring at the intracellular C-terminus of the protein. The results presented in this application show that GPRC5D is expressed at high levels in multiple myeloma and, in general, is expressed at low levels in most normal tissues.

[0280] The observation results in this application show that there is protein expression of GPRC5D on multiple myeloma cells, which confirms that it is a feasible CAR T cell target for treating MM, including evaluation based on potential on-target / off-target tumor toxicity. In addition, there is a chimeric antigen receptor in the chimeric antigen receptor provided, which shows low tonic signal transduction, thereby minimizing the possibility of antigen-independent (tonic) signal transduction. Specifically, the anti-GPRC5D CAR provided in this application includes CAR with high antigen-dependent activation and minimum signal transduction. Specifically, it has been found that some constructs, including constructs in which heavy chain variable (VH) and light chain variable (VL) are in a specific orientation and / or contain a certain length of spacer in the extracellular portion of the antibody fragment of CAR, exhibit favorable properties, including compared to alternative anti-GPRC5D CAR forms, such as forms with shorter spacers, higher antigen-dependent activation and lower tonic signal transduction.

[0281] In some embodiments, the spacer is generally an amino acid sequence located between the extracellular antigen binding domain and the transmembrane domain of the CAR, thereby connecting the extracellular antigen binding domain to the transmembrane domain. In a specific embodiment of the anti-GPRC5D CAR, the spacer is an immunoglobulin, for example, a portion from IgG4 or IgG2, such as a portion containing a hinge domain, a CH2 domain, and a CH3 domain. Among such spacers are portions of human immunoglobulins or modified forms thereof, including portions greater than 125 amino acids in length, such as greater than 150 amino acids, greater than 180 amino acids, greater than 200 amino acids, or greater than 200 amino acids in length. In some embodiments, the immunoglobulin spacer is a mixed or chimeric spacer and / or modified to reduce or prevent glycosylation. In some embodiments, the anti-GPRC5D CAR provided includes a spacer of a mixed / modified IgG4 / IgG2 hinge-IgG4 / IgG2 CH2-IgG4 CH3 immunoglobulin, such as the spacer shown in SEQ ID NO: 17.

[0282] In some embodiments, there is a CAR encoded by a polynucleotide in the CAR provided herein, and these polynucleotides are optimized, or contain certain features designed for optimization, such as certain features optimized for codon usage, to reduce RNA heterogeneity and / or modification, for example, to increase the expression of the encoded receptor, such as surface expression, or to make the expression of the receptor encoded in multiple cell product batches, such as surface expression more consistent. In some embodiments, the polynucleotides encoding GPRC5D binding cell surface proteins are modified compared to the reference polynucleotides to remove hidden or hidden splicing sites to reduce RNA heterogeneity. In some embodiments, the polynucleotides encoding GPRC5D binding cell surface proteins are codon optimized such as for use in mammalian (eg, human) cells, such as in human T cells. In some aspects, when expressed in cells, the modified polynucleotides cause expression levels, such as improvements in surface expression levels, such as increased expression levels or more uniform or more consistent expression levels. Such polynucleotides can be used to generate constructs of genetically engineered cells expressing encoded GPRC5D binding cell surface proteins. Thus, cells expressing recombinant receptors encoded by the polynucleotides provided herein and their use in adoptive cell therapy, such as for treating diseases and disorders associated with GPRC5D expression, such as multiple myeloma, are also provided.

[0283] Provided is a monotherapy for multiple myeloma plasma cells using an anti-GPRC5D CAR expressed on autologous primary T cells. In some embodiments, it is known or suspected that the patient has or has selected MM plasma cells with low or no expression of BCMA, and / or has relapsed after treatment with an anti-BCMA CAR, is difficult to treat with an anti-BCMA CAR, has failed or is intolerant to anti-BCMA CAR treatment, and may wish to have monotherapy.

[0284] The application also provides a multidrug targeting strategy targeting a first antigen and a second antigen associated with a specific disease or condition, such as multiple myeloma. In some embodiments, multiple recombinant receptors specifically bind to or target different antigens encoded by the same polynucleotide construct or included in the cells, compositions and methods provided herein. In some embodiments, a plurality of antigens, such as a first antigen and a second antigen, are expressed or suspected to be expressed on a targeted cell, tissue, disease or condition, such as on a cancer cell. In some aspects, the cell, tissue, disease or condition is multiple myeloma or multiple myeloma cells.

[0285] For example, the present application also provides a dual-drug therapy targeting method using a combination of cells expressing anti-GPRC5D CAR and cells expressing anti-BCMA CAR as a therapeutic agent for plasma cells. In some aspects, the dual targeting method can advantageously address the limitations associated with heterogeneous expression of BCMA and / or GPRC5D on MM plasma cells. It has been observed that GPRC5D and BCMA are expressed in certain diseases and conditions, such as malignancies, or on their tissues or cells, for example, on malignant plasma cells such as from recurrent or newly diagnosed myeloma patients, for example, heterogeneously expressed, and for example, very little expression on normal tissues. Due to the role of GPRC5D and BCMA in various diseases and conditions, including cancer, GPRC5D and BCMA have become therapeutic targets.

[0286] In some cases, simultaneously targeting two antigens as provided in the present application can improve the depth of reaction and durability in patients, while minimizing the recurrence caused by antigen escape. As confirmed by the data from CAR T cell trials in B cell malignancies, the mechanism of resistance to CAR T cell therapy can be the loss or downward regulation ("escape") of the target antigen. (Robbie G.Majzner and Crystal L.Mackall, Cancer Discov August 22 2018; DOI10.1158 / 2159-8290.CD-18-0442). Compared to monotherapy involving only targeting a single antigen, such combinations or dual targeting strategies based on targeting two antigens can achieve synergistic or improved tumor response. In fact, the research in this application shows that BCMA and GPRC5D expression are independent of each other. Dual targeting methods can advantageously solve the problems caused by the possibility of antigen loss and / or target the antigens in MM to the greatest extent. The observations presented herein demonstrate protein expression of GPRC5D, BCMA, or both on multiple myeloma cells, confirming that both antigens may serve as viable CAR T cell targets for the treatment of MM, including based on evaluation of potential on-target / off-target tumor toxicity.

[0287] In the embodiments provided, there are methods useful for treating such diseases and conditions and / or for targeting such cell types, including nucleic acid molecules encoding GPRC5D binding receptors and BCMA binding receptors (including chimeric antigen receptors (CARs)), and encoded receptors, such as encoded CARs, and compositions and articles comprising the same. These receptors can generally contain GPRC5D or BCMA specific antibodies (including antigen-binding antibody fragments, such as heavy chain variable (V H) region, single domain antibody fragments and single chain fragments, including single chain variable fragments (scFv). Also provided are cells expressing such GPRC5D binding receptors (e.g., anti-GPRC5D CAR), BCMA binding receptors (e.g., anti-BCMA CAR) and / or nucleic acids encoding such receptors, such as genetically engineered or recombinant cells, and compositions and products containing such cells and therapeutic agents. In the embodiments provided, there are polynucleotides for expressing a variety of CARs, such as anti-GPRCD CAR and anti-BCMA CAR bicistronic polynucleotides. The observations in this application show that the expression of a variety of CARs in cells, such as anti-GPRC5D CAR and anti-BCMA CAR, can be improved by making the codons of the polynucleotide sequence encoding one or more CARs diverge. It has been found that the codon divergence of the polynucleotide constructs encoding two CARs improves the expression of the nucleotide sequence encoding CAR, which is at the 3' end (or C-terminus) relative to the nucleotide sequence encoding another CAR.

[0288] In addition, it has been found that the CAR containing a certain length of spacer exhibits advantageous properties, including higher high-dependence activation and lower tonic signal transduction compared to alternative anti-GPRC5D or anti-BCMA CAR formats, such as formats with shorter spacers. In some embodiments, the spacer component in the CAR is generally an amino acid sequence located between the extracellular antigen binding domain and the transmembrane domain of the CAR, thereby connecting the extracellular antigen binding domain to the transmembrane domain. In specific embodiments of anti-GPRC5D or anti-BCMA CAR, the spacer is an immunoglobulin, for example, a portion from IgG4 or IgG2, such as a portion containing a hinge domain, a CH2 domain, and a CH3 domain. In such spacers, there is a portion of a human immunoglobulin or a modified form thereof, including a portion greater than 125 amino acids in length, such as greater than 150 amino acids, greater than 180 amino acids, greater than 200 amino acids, or greater than 200 amino acids in length. In some embodiments, the immunoglobulin spacer is a mixed or chimeric spacer and / or modified to reduce or prevent glycosylation. In some embodiments, the anti-GPRC5D or anti-BCMA CAR provided includes a spacer of IgG4 / IgG2 hinge-IgG4 / IgG2CH2-IgG4 CH3 immunoglobulin mixing / modification, such as the spacer shown in SEQ ID NO: 17. In a specific embodiment, the polynucleotide encoding CAR contains a spacer region modified to eliminate splice sites, such as cryptic splicing and / or receptor sites. Exemplary nucleotides encoding spacers have been described. In some embodiments, the coding sequence of the spacer includes a nucleic acid sequence shown in SEQ ID NO: 48 (also as shown in SEQ ID NO: 74). In some embodiments, when expressed in cells (e.g., T cells), the CAR provided exhibits reduced RNA heterogeneity. In some embodiments, the polynucleotide encoding CAR may also be codon optimized to further improve expression.

[0289] All publications, including patent documents, scientific papers, and databases, mentioned in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication were individually incorporated by reference. If definitions set forth in this application are contrary to or otherwise inconsistent with definitions set forth in patents, applications, published applications, and other publications incorporated by reference in this application, the definitions set forth in this application shall control with respect to the definitions incorporated by reference in this application.

[0290] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

[0291] I. GPRC5D Binding Receptors and Encoding Polynucleotides

[0292] In some aspects, there is provided a GPRC5D binding agent, such as a recombinant receptor or a chimeric antigen receptor in conjunction with a GPRC5D molecule, and encoding a GPRC5D binding cell surface protein, such as a polynucleotide of a recombinant receptor (e.g., CAR), and cells expressing such receptors. GPRC5D binding cell surface proteins generally contain antibodies that specifically bind to GPRC5D, such as antibodies (e.g., antigen-binding antibody fragments) and / or other binding peptides that specifically bind to GPRC5D proteins, such as human GPRC5D proteins. In some aspects, these agents are bound to the extracellular portion of GPRC5D.

[0293] Among the polynucleotides provided are polynucleotides encoding recombinant receptors, such as antigen receptors, that specifically bind GPRC5D. In some aspects, encoded receptors, such as receptors containing GPRC5D binding polypeptides, as well as compositions, articles of manufacture, and uses thereof are also provided.

[0294] Among these GPRC5D binding polypeptides are antibodies, such as single-chain antibodies (e.g., antigen-binding antibody fragments), or portions thereof. In some examples, the recombinant receptor is a chimeric antigen receptor, such as a chimeric antigen receptor containing an anti-GPRC5D antibody or antigen-binding fragment thereof. The provided polynucleotides can be incorporated into constructs, such as deoxyribonucleic acid (DNA) or RNA constructs, such as constructs that can be introduced into cells for expressing the encoded recombinant GPRC5D binding receptor.

[0295] 1. Encoded recombinant GPRC5D binding receptor components

[0296] The GPRC5D binding receptors provided generally contain an extracellular binding molecule and an intracellular signal transduction domain. Among the receptors provided are polypeptides containing antibodies, such as recombinant cell surface receptors containing anti-GPRC5D antibodies. Such receptors include chimeric antigen receptors containing such antibodies.

[0297] Among the recombinant receptors provided are antigen receptors including GPRC5D binding fragments. These recombinant receptors include antigen receptors that specifically bind to GPRC5D, such as antigen receptors containing anti-GPRC5D antibodies, such as GPRC5D antigen binding fragments. Among these antigen receptors, there are functional non-TCR antigen receptors, such as chimeric antigen receptors (CARs). Cells expressing these recombinant receptors and their uses in adoptive cell therapy are also provided, such as for treating diseases and disorders associated with GPRC5D expression, such as multiple myeloma.

[0298] a. Extracellular antigen-binding domain

[0299] Among these chimeric receptors are chimeric antigen receptors (CARs). These chimeric receptors, such as CARs, generally include an extracellular antigen binding domain that includes, is, or comprises an anti-GPRC5D antibody. Therefore, chimeric receptors, such as CARs, typically include one or more GPRC5D binding molecules, such as one or more antigen binding fragments, domains, or portions, or one or more antibody variable regions, and / or antibody molecules, such as those described herein, in their extracellular portion.

[0300] The term "antibody" is used in the broadest sense in this application and includes polyclonal and monoclonal antibodies, including whole antibodies and functional (antigen-binding) antibody fragments, including fragments antigen-binding fragments (Fab), F(ab')2 fragments, Fab' fragments, Fv fragments, recombinant IgG (rIgG) fragments, heavy chain variable (V) fragments capable of specific binding to an antigen, H ) region, single-chain antibody fragments, including single-chain variable fragments (scFv) and single-domain antibody (e.g., sdAb, sdFv, nanobody) fragments. The term encompasses genetically engineered and / or otherwise modified forms of immunoglobulins, such as intrabodies, peptibodies, chimeric antibodies, fully human antibodies, humanized antibodies, and heterotypic conjugate antibodies, multispecific (e.g., bispecific or trispecific) antibodies, bifunctional antibodies, trifunctional antibodies and tetrafunctional antibodies, tandem di-scFv, tandem tri-scFv. Unless otherwise stated, the term "antibody" should be understood to encompass functional antibody fragments thereof, also referred to herein as "antigen-binding fragments." The term also encompasses intact or full-length antibodies, including antibodies of any class or subclass, including IgG and its subclasses, IgM, IgE, IgA, and IgD.

[0301] The terms "complementarity determining region" and "CDR" are synonymous with "hypervariable region" or "HVR" and are known in the art to refer to non-contiguous amino acid sequences within an antibody variable region that confer antigen specificity and / or binding affinity. Generally, there are three CDRs (CDR-H1, CDR-H2, CDR-H3) in each heavy chain variable region and three CDRs (CDR-L1, CDR-L2, CDR-L3) in each light chain variable region. "Framework region" and "FR" are known in the art to refer to the non-CDR portions of the heavy and light chain variable regions. Generally, there are four FRs (FR-H1, FR-H2, FR-H3, and FR-H4) in each full-length heavy chain variable region and four FRs (FR-L1, FR-L2, FR-L3, and FR-L4) in each full-length light chain variable region.

[0302] The exact amino acid sequence boundaries of a given CDR or FR can be readily determined using any of a number of well-known schemes, including those described in Kabat et al. (1991), "Sequences of Proteins of Immunological Interest", 5th ed. Public Health Service, National Institutes of Health, Bethesda, MD ("Kabat" numbering scheme); Al-Lazikani et al. (1997) JMB 273, 927-948 ("Chothia" numbering scheme); MacCallum et al., J. Mol. Biol. 262:732-745 (1996), "Antibody-antigen interactions: Contact analysis and binding site topography", J. Mol. 262, 732-745. ("Contact" numbering scheme); Lefranc MP et al., "IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains", Dev Comp Immunol, 2003 Jun;27(1):55-77 (“IMGT” numbering scheme); Honegger A and Plückthun A, “Yet another numbering scheme for immunoglobulin variable domains: an automatic modeling and analysis tool”, J Mol Biol, 2001 Jul 8;309(3):657-70, (“Aho” numbering scheme); and Martin et al., “Modeling antibody hypervariable loops: a combined algorithm”, PNAS, 1989, 86(23):9268-9272, (“AbM” numbering scheme).

[0303] The boundary of given CDR or FR can change according to the scheme used to mark.For example, the Kabat scheme is based on structural comparison, and the Chothia scheme is based on structural information.The numbering of Kabat and Chothia schemes is based on the most commonly used antibody region sequence length, wherein in some antibodies, there occurs the insertion and deletion represented by the insertion letter (such as "30a"). These two schemes are placed in different positions with certain insertions and deletions ("indels"), resulting in different numbering. The contact scheme is based on the analysis of complex crystal structure, and is similar to the Chothia numbering scheme in many aspects. The AbM scheme is a compromise between the Kabat and Chothia definitions determined based on the scheme used by Oxford Molecular's AbM antibody modeling software.

[0304] Table 1 below lists exemplary position boundaries for CDR-L1, CDR-L2, CDR-L3 and CDR-H1, CDR-H2, CDR-H3 as identified by Kabat, Chothia, AbM, and contact schemes, respectively. The residue numbering for CDR-H1 is listed using both the Kabat and Chothia numbering schemes. FRs are positioned between the CDRs, e.g., where FR-L1 precedes CDR-L1, FR-L2 is between CDR-L1 and CDR-L2, FR-L3 is between CDR-L2 and CDR-L3, and so on. It should be noted that since the Kabat numbering scheme shown places insertions at H35A and H35B, the ends of the Chothia CDR-H1 loop vary between H32 and H34 when numbered using the Kabat numbering convention shown, depending on the loop length.

[0305]

[0306] 1-Kabat et al. (1991), "Sequences of Proteins of Immunological Interest", 5th ed. Public Health Service, National Institutes of Health, Bethesda, MD

[0307] 2-Al-Lazikani et al. (1997) JMB 273, 927-948

[0308] Thus, unless otherwise indicated, a "CDR" or "complementarity determining region" of a given antibody or region thereof (such as its variable region) or an individually designated CDR (e.g., CDR-H1, CDR-H2, CDR-H3) should be understood to encompass the complementarity determining regions (or specific complementarity determining regions) as defined by any of the aforementioned schemes or other known schemes. For example, when stating that a particular CDR (e.g., CDR-H3) contains a given V H or V L In some embodiments, specific CDR sequences are specified. Exemplary CDR sequences of the antibodies provided are described using various numbering schemes, but it is understood that the antibodies provided may include CDRs as described according to any other of the aforementioned numbering schemes or other numbering schemes known to those skilled in the art.

[0309] Likewise, unless otherwise indicated, the FRs or individually designated FRs (e.g., FR-H1, FR-H2, FR-H3, FR-H4) of a given antibody or region thereof (such as its variable region) should be understood to encompass framework regions (or specific framework regions) as defined by any known scheme. In some cases, a scheme for identifying a specific CDR, FR, or multiple FRs or CDRs is specified, such as CDRs defined by Kabat, Chothia, AbM, or contact methods, or other known schemes. In other cases, a specific amino acid sequence of a CDR or FR is given.

[0310] The term "variable region" or "variable domain" refers to the domain of an antibody heavy chain or light chain that is involved in binding the antibody to the antigen. H and V L ) generally have a similar structure, and each domain comprises four conserved framework regions (FRs) and three CDRs. (See, for example, Kindt et al., Kuby Immunology, 6th edition, WH Freeman and Co., page 91 (2007)). A single V H or V L A domain may be sufficient to confer antigen binding specificity. In addition, a V domain from an antibody that binds to the antigen may be used. H or V L Domain separation of antibodies that bind to specific antigens to screen for complementary V H or V LLibraries of domains. (See, e.g., Portolano et al., J. Immunol. 150:880-887 (1993); Clarkson et al., Nature 352:624-628 (1991)).

[0311] Among the antibodies included in the provided CARs are antibody fragments. An "antibody fragment" or "antigen-binding fragment" refers to a molecule other than an intact antibody that contains a portion of an intact antibody that binds to the antigen to which the intact antibody binds. Examples of antibody fragments include, but are not limited to, Fv, Fab, Fab', Fab'-SH, F(ab')2; bifunctional antibodies; linear antibodies; heavy chain variable (V H ) region, single-chain antibody molecules such as scFv and those containing only V H In some embodiments, the antigen binding domain in the provided CAR is or includes a heavy chain variable (V H ) and light chain variable (V L In a specific embodiment, the antibody is an antibody fragment comprising a heavy chain variable (V H ) region and / or light chain variable (V L ) region, such as a single-chain antibody fragment, such as scFv.

[0312] Single domain antibodies (sdAbs) are antibody fragments that contain all or a portion of the heavy chain variable region or all or a portion of the light chain variable region of an antibody. In certain embodiments, the single domain antibody is a human single domain antibody.

[0313] Antibody fragments can be prepared by various techniques, including but not limited to proteolytic digestion of intact antibodies and production by recombinant host cells. In some embodiments, antibodies are recombinantly produced fragments, such as fragments comprising non-naturally occurring arrangements, such as fragments in which two or more antibody regions or chains are joined by synthetic linkers, e.g., peptide linkers, and / or fragments that cannot be produced by enzymatic digestion of naturally occurring intact antibodies. In some aspects, antibody fragments are scFvs.

[0314] "Humanized" antibodies are antibodies in which all or substantially all of the CDR amino acid residues are derived from non-human CDRs and all or substantially all of the FR amino acid residues are derived from human FRs. Humanized antibodies optionally may include at least a portion of an antibody constant region derived from a human antibody. A "humanized form" of a non-human antibody refers to a non-human antibody variant that has undergone humanization, typically to reduce immunogenicity to humans while maintaining the specificity and affinity of the parent non-human antibody. In some embodiments, some FR residues in the humanized antibody are substituted with corresponding residues from a non-human antibody (e.g., an antibody from which the CDR residues were derived), e.g., to restore or improve antibody specificity or affinity.

[0315] Among the anti-GPRC5D antibodies included in the CAR provided are human antibodies. "Human antibodies" are antibodies having an amino acid sequence corresponding to the amino acid sequence of an antibody produced by a human or human cell or a non-human source using a human antibody repertoire or other human antibody coding sequence (including a human antibody library). The term does not include humanized forms of non-human antibodies containing non-human antigen binding regions, such as those in which all or substantially all CDRs are non-human CDRs. The term includes antigen-binding fragments of human antibodies.

[0316] Human antibodies can be prepared by administering an immunogen to a transgenic animal that has been modified to produce complete human antibodies or complete antibodies with human variable regions in response to an antigenic attack. Such animals typically contain all or a portion of a human immunoglobulin locus that replaces an endogenous immunoglobulin locus, or is present outside the chromosome or is randomly integrated into the animal's chromosome. In such transgenic animals, the endogenous immunoglobulin locus is generally not activated. Human antibodies can also be derived from human antibody libraries, including phage display libraries and cell-free libraries, which contain antibody coding sequences derived from human pedigrees.

[0317] Among the antibodies included in the CAR provided are those that are monoclonal antibodies, including monoclonal antibody fragments. As used herein, the term "monoclonal antibody" refers to an antibody obtained from a substantially homogeneous antibody group or in a substantially homogeneous antibody group, that is, the individual antibodies constituting the group are consistent except for the possible variants containing naturally occurring mutations or produced during the preparation of monoclonal antibody preparations, and these variants are generally present in trace amounts. Compared with polyclonal antibody preparations that generally include different antibodies for different antigenic determinants, each monoclonal antibody in a monoclonal antibody preparation is for a single antigenic determinant on an antigen. The term should not be interpreted as requiring antibodies to be produced by any particular method. Monoclonal antibodies can be prepared by a variety of techniques, including but not limited to self-fusion tumor production, recombinant DNA methods, phage display, and other antibody presentation methods.

[0318] In some embodiments, the CAR comprises one or more GPRC5D binding portions of an antibody molecule, such as a heavy chain variable (V H ) region and / or light chain variable (V L ) region, such as an scFv antibody fragment. In some embodiments, the GPRC5D binding CAR provided contains an antibody that imparts the GPRC5D binding properties of the provided CAR, such as an anti-GPRC5D antibody, or an antigen binding fragment thereof. In some embodiments, the antibody or antigen binding domain may be any anti-GPRC5D antibody described or derived from any anti-GPRC5D antibody described (see, for example, WO 2016 / 090312, WO 2016 / 090329, WO2018 / 017786). Any of such anti-GPRC5D antibodies or antigen binding fragments can be used in the CAR provided. In some embodiments, the anti-GPRC5D CAR contains an antigen binding domain that contains a heavy chain variable (V) derived from an antibody described in WO 2016 / 090312, WO 2016 / 090329 or WO 2018 / 017786. H ) and / or light chain variable (V L ) region of the scFv.

[0319] In some embodiments, the antibody, such as an anti-GPRC5D antibody, or antigen-binding fragment comprises a heavy chain and / or light chain variable (V H or V L ) region sequence or a sufficient antigen-binding portion thereof. In some embodiments, an anti-GPRC5D antibody, such as an antigen-binding fragment, comprises a V region comprising CDR-H1, CDR-H2 and / or CDR-H3 as described. H In some embodiments, an anti-GPRC5D antibody, such as an antigen-binding fragment, comprises a V region comprising CDR-L1, CDR-L2, and / or CDR-L3 as described. L In some embodiments, an anti-GPRC5D antibody, such as an antigen-binding fragment, comprises a V region comprising CDR-H1, CDR-H2, and / or CDR-H3 as described. H region sequence, and including a V region comprising CDR-L1, CDR-L2 and / or CDR-L3 as described L Additionally, among these antibodies are antibodies having sequences that are at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% identical to such sequences.

[0320] In some embodiments, the antibody or antibody fragment in the provided CAR has a V of any of the antibodies or antibody binding fragments described in any of WO 2016 / 090312, WO 2016 / 090329, and WO 2018 / 017786. H district.

[0321] In some embodiments, the CAR comprises an antibody or antigen-binding fragment thereof having a heavy chain variable (V H ) area, the V H The region has an amino acid sequence selected from any one of SEQ ID NO: 21, 23, 25, 27, 29, 31 or 33, or a V sequence selected from any one of SEQ ID NO: 21, 23, 25, 27, 29, 31 or 33. H The amino acid sequences of the V region having at least or about 90%, at least or about 91%, at least or about 92%, at least or about 93%, at least or about 94%, at least or about 95%, at least or about 96%, at least or about 97%, at least or about 98%, or at least about 99% sequence identity, or containing such V H CDR-H1, CDR-H2 and / or CDR-H3 present in the sequence.

[0322] In some embodiments, the V of the antibody or antigen-binding fragment thereof is H The V region comprises CDR-H1, CDR-H2 and / or CDR-H3 according to Kabat numbering. In some embodiments, the V region of the antibody or antigen-binding fragment thereof is H The V region comprises CDR-H1, CDR-H2 and / or CDR-H3 according to Chothia numbering. In some embodiments, the V region of the antibody or antigen-binding fragment thereof is H The region comprises CDR-H1, CDR-H2 and / or CDR-H3 according to AbM numbering.

[0323] In some embodiments, the CAR comprises an antibody or antigen-binding fragment thereof having a heavy chain variable (V H ) area, the V HThe present invention relates to a CDR-H1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 75, 78, 80, 82, 90, 93, 95, 97, 105, 108, 110, 112, 120, 123, 125, 127, 135, 138, 140, 142, 152, 162, 165, 167, and 169; (b) a CDR-H2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 76, 79, 81, 83, 91, 94, 96, 98, 106, 109, 111, 113, 121, 124, 126, 128, 136, 139, 141, 143, 150, 153, 154, 155, 163, 166, 168, and 170; and (c) a CDR-H3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: CDR-H3 of the amino acid sequence of NO:77, 84, 92, 99, 107, 114, 122, 129, 137, 144, 151, 156, 164 and 171.

[0324] In some embodiments, the antibody or antigen-binding fragment thereof comprises V Ha region comprising a CDR-H1, a CDR-H2, and a CDR-H3 comprising the following amino acid sequences, respectively: SEQ ID NOs: 75, 76, and 77; SEQ ID NOs: 78, 79, and 77; SEQ ID NOs: 80, 81, and 77; SEQ ID NOs: 82, 83, and 84; SEQ ID NOs: 90, 91, and 92; SEQ ID NOs: 93, 94, and 92; SEQ ID NOs: 95, 96, and 92; SEQ ID NOs: 97, 98, and 99; SEQ ID NOs: 105, 106, and 107; SEQ ID NOs: 108, 109, and 107; SEQ ID NOs: 110, 111, and 107; SEQ ID NOs: 112, 113, and 114; SEQ ID NOs: 120, 121, and 122; SEQ ID NOs: 123, 124, and 122; SEQ ID NOs: 124, 125, and 126; NO:125, 126 and 122; SEQ ID NO:127, 128 and 129; SEQ ID NO:135, 136 and 137; SEQ ID NO:138, 139 and 137; SEQ ID NO:140, 141 and 137; SEQ ID NO:142, 143 and 144; SEQ ID NO:135, 150 and 151; SEQ ID NO:152, 153 and 151; SEQ ID NO:140, 154 and 151; SEQ ID NO:142, 155 and 156; SEQ ID NO:162, 163 and 164; SEQ ID NO:165, 166 and 164; SEQ ID NO:167, 168 and 164; SEQ ID NO:169, 170 and 171.

[0325] In some embodiments, the antibody or antigen-binding fragment thereof comprises V Ha region comprising the following amino acid sequences: SEQ ID NOs: 75, 76, and 77, respectively; SEQ ID NOs: 78, 79, and 77, respectively; SEQ ID NOs: 80, 81, and 77, respectively; SEQ ID NOs: 82, 83, and 84, respectively; SEQ ID NOs: 90, 91, and 92, respectively; SEQ ID NOs: 93, 94, and 92, respectively; SEQ ID NOs: 95, 96, and 92, respectively; SEQ ID NOs: 97, 98, and 99, respectively; SEQ ID NOs: 105, 106, and 107, respectively; SEQ ID NOs: 108, 109, and 107, respectively; SEQ ID NOs: 110, 111, and 107, respectively; SEQ ID NOs: 112, 113, and 114, respectively; SEQ ID NOs: 120, 121, and 122, respectively; SEQ ID NOs: 123, 124, and 122, respectively; SEQ ID NOs: 124, 125, and 126, respectively. NO: 125, 126 and 122; SEQ ID NO: 127, 128 and 129, respectively; SEQ ID NO: 135, 136 and 137, respectively; SEQ ID NO: 138, 139 and 137, respectively; SEQ ID NO: 140, 141 and 137, respectively; SEQ ID NO: 142, 143 and 144, respectively; SEQ ID NO: 135, 150 and 151, respectively; SEQ ID NO: 152, 153 and 151, respectively; SEQ ID NO: 140, 154 and 151, respectively; SEQ ID NO: 142, 155 and 156, respectively; SEQ ID NO: 162, 163 and 164, respectively; SEQ ID NO: 165, 166 and 164, respectively; SEQ ID NO: 167, 168 and 164, respectively; SEQ ID NO: 169, 170 and 171, respectively. NO:169, 170 and 171.

[0326] In some embodiments, the antibody or antigen-binding fragment thereof comprises CDR-H1, CDR-H2, and CDR-H3, which respectively comprise V sequences shown in any one of SEQ ID NOs: 21, 23, 25, 27, 29, 31, or 33. H The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 contained in the amino acid sequence of the region.

[0327] In some embodiments of the antibodies or antigen-binding fragments thereof provided herein, V H The region comprises any one of CDR-H1, CDR-H2 and CDR-H3 as described and comprises a V region corresponding to any one of SEQ ID NOs: 21, 23, 25, 27, 29, 31 or 33, respectively.H In some embodiments, the amino acid sequence of the framework region 1 (FR1), FR2, FR3 and / or FR4 comprises at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% sequence identity to the FR1, FR2, FR3 and / or FR4 contained within the region.

[0328] In some embodiments, the antibody or antigen-binding fragment thereof comprises a V comprising the amino acid sequence set forth in any one of SEQ ID NOs: 21, 23, 25, 27, 29, 31, or 33. H district.

[0329] In some embodiments, a CAR (e.g., an anti-GPRC5D CAR) is provided that comprises a V H The antibody or antibody fragment further comprises a light chain or a sufficient antigen binding portion thereof. For example, in some embodiments, the antibody or antigen binding fragment thereof comprises a V H Area and V L Area, or V H and V L In such embodiments, V H The region sequence may be the V H In some embodiments, the antibody is an antigen-binding fragment, such as a Fab or scFv. In some embodiments, the antibody is a full-length antibody that also contains a constant region.

[0330] In some embodiments, the CAR provided herein comprises the above V H For example, in some embodiments, a CAR comprises a light chain variable region or a sufficient antigen-binding portion thereof, such as an anti-GPRC5D antibody, or an antigen-binding fragment thereof. H region and light chain variable (V L ) area, or V H and V L In such embodiments, V H The region sequence may be the V H In some embodiments, the antibody is an antigen-binding fragment, such as a Fab or scFv. In some embodiments, the antibody is a full-length antibody that also contains a constant region.

[0331] In some embodiments, the antibody or antigen-binding fragment has a V as described in any one of WO 2016 / 090312, WO 2016 / 090329, and WO 2018 / 017786. L district.

[0332] In some embodiments, the CAR comprises an antibody or antigen-binding fragment thereof having a light chain variable (V L ) area, the V L The region has an amino acid sequence selected from any one of SEQ ID NO: 22, 24, 26, 28, 30, 32, 34, 63, 64, 65, 66, 67, 68 or 69, or a V sequence selected from any one of SEQ ID NO: 22, 24, 26, 28, 30, 32, 34, 63, 64, 65, 66, 67, 68 or 69 L The amino acid sequences of the V region having at least or about 90%, at least or about 91%, at least or about 92%, at least or about 93%, at least or about 94%, at least or about 95%, at least or about 96%, at least or about 97%, at least or about 98%, or at least about 99% sequence identity, or containing such V L In some embodiments, the CAR comprises an antibody or antigen-binding fragment thereof having a light chain variable (V L ) area, the V L The region has an amino acid sequence selected from any one of SEQ ID NO: 22, 24, 26, 28, 30, 32 or 34, or a V sequence selected from any one of SEQ ID NO: 22, 24, 26, 28, 30, 32 or 34. L The amino acid sequences of the V region having at least or about 90%, at least or about 91%, at least or about 92%, at least or about 93%, at least or about 94%, at least or about 95%, at least or about 96%, at least or about 97%, at least or about 98%, or at least about 99% sequence identity, or containing such V L In some embodiments, the CAR comprises an antibody or antigen-binding fragment thereof having a light chain variable (V L ) area, the V L The region has an amino acid sequence selected from any one of SEQ ID NO: 63, 64, 65, 66, 67, 68 or 69, or a V sequence selected from any one of SEQ ID NO: 63, 64, 65, 66, 67, 68 or 69 LThe amino acid sequences of the V region having at least or about 90%, at least or about 91%, at least or about 92%, at least or about 93%, at least or about 94%, at least or about 95%, at least or about 96%, at least or about 97%, at least or about 98%, or at least about 99% sequence identity, or containing such V L CDR-L1, CDR-L2 and / or CDR-L3 present in the sequence.

[0333] In some embodiments, the V of the antibody or antigen-binding fragment thereof is L The V region comprises CDR-L1, CDR-L2 and / or CDR-L3 according to Kabat numbering. In some embodiments, the V region of the antibody or antigen-binding fragment thereof is L The V region comprises CDR-L1, CDR-L2 and / or CDR-L3 according to Chothia numbering. In some embodiments, the V region of the antibody or antigen-binding fragment thereof is L The region comprises CDR-L1, CDR-L2 and / or CDR-L3 according to AbM numbering.

[0334] In some embodiments, the CAR comprises an antibody or antigen-binding fragment thereof having a light chain variable (V L ) area, the V L The present invention relates to a CDR-L1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 85, 88, 100, 103, 115, 118, 130, 133, 145, 148, 157, 160, 172 and 174; (b) a CDR-L2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 86, 89, 101, 104, 116, 119, 131, 134, 146, 149, 158 and 161; and (c) a CDR-L3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 87, 102, 117, 132, 147, 159, 173 and 175.

[0335] In some embodiments, the antibody or antigen-binding fragment thereof comprises V La region comprising a CDR-L1, a CDR-L2, and a CDR-L3 comprising the following amino acid sequences, respectively: SEQ ID NOs: 85, 86, and 87; SEQ ID NOs: 88, 89, and 87; SEQ ID NOs: 100, 101, and 102; SEQ ID NOs: 103, 104, and 102; SEQ ID NOs: 115, 116, and 117; SEQ ID NOs: 118, 119, and 117; SEQ ID NOs: 130, 131, and 132; SEQ ID NOs: 133, 134, and 132; SEQ ID NOs: 145, 146, and 147; SEQ ID NOs: 148, 149, and 147; SEQ ID NOs: 157, 158, and 159; SEQ ID NOs: 160, 161, and 159; SEQ ID NOs: 172, 86, and 173; SEQ ID NOs: 174, 175, and 176; NO: 174, 89 and 175; SEQ ID NO: 174, 89 and 297.

[0336] In some embodiments, the antibody or antigen-binding fragment thereof comprises V L a region comprising the following amino acid sequences: SEQ ID NOs: 85, 86, and 87, respectively; SEQ ID NOs: 88, 89, and 87, respectively; SEQ ID NOs: 100, 101, and 102, respectively; SEQ ID NOs: 103, 104, and 102, respectively; SEQ ID NOs: 115, 116, and 117, respectively; SEQ ID NOs: 118, 119, and 117, respectively; SEQ ID NOs: 130, 131, and 132, respectively; SEQ ID NOs: 133, 134, and 132, respectively; SEQ ID NOs: 145, 146, and 147, respectively; SEQ ID NOs: 148, 149, and 147, respectively; SEQ ID NOs: 157, 158, and 159, respectively; SEQ ID NOs: 160, 161, and 159, respectively; SEQ ID NOs: 172, 86, and 173, respectively; SEQ ID NOs: 174, 89, and 175, respectively; SEQ ID NOs: 176, 177, and 178, respectively; NO:174, 89 and 297.

[0337] In some embodiments, the antibody or antigen-binding fragment thereof comprises a V sequence selected from any one of SEQ ID NO: 22, 24, 26, 28, 30, 32, 34, 63, 64, 65, 66, 67, 68, or 69. LIn some embodiments, the antibody or antigen-binding fragment thereof comprises a V sequence selected from any one of SEQ ID NO: 22, 24, 26, 28, 30, 32 or 34. L In some embodiments, the antibody or antigen-binding fragment thereof comprises a V sequence selected from any one of SEQ ID NO: 63, 64, 65, 66, 67, 68 or 69. L The amino acid sequences of the two regions respectively include CDR-L1, CDR-L2 and CDR-L3.

[0338] Among the CARs provided herein is a CAR wherein the antibody, such as an anti-GPRC5D antibody or antibody fragment, in the CAR provided comprises a V sequence having at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% sequence identity to the amino acid sequence shown in any one of SEQ ID NO: 21, 23, 25, 27, 29, 31 or 33. H 64, 65, 66, 67, 68, or 69 having at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% sequence identity to the amino acid sequence shown in any one of SEQ ID NO: 22, 24, 26, 28, 30, 32, 34, 63, 64, 65, 66, 67, 68, or 69. L district.

[0339] In some embodiments, the V of the antibody or antigen-binding fragment thereof is H The region includes V and V sequences selected from any one of SEQ ID NOs: 21, 23, 25, 27, 29, 31, or 33. H CDR-H1, CDR-H2, CDR-H3 of the amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 contained in the amino acid sequence of the region; and including V sequences respectively comprising any one selected from SEQ ID NO: 22, 24, 26, 28, 30, 32, 34, 63, 64, 65, 66, 67, 68 or 69. LThe amino acid sequences of CDR-L1, CDR-L2 and CDR-L3 contained in the amino acid sequence of the region are CDR-L1, CDR-L2 and CDR-L3.

[0340] In some embodiments, the V of the antibody or antigen-binding fragment thereof is H The V region comprises the amino acid sequence of SEQ ID NO: 21, 23, 25, 27, 29, 31 or 33 and the V region of the antibody or antigen-binding fragment L The region comprises the amino acid sequence of SEQ ID NO: 22, 24, 26, 28, 30, 32 or 34. In some embodiments, the V region of the antibody or antigen-binding fragment thereof is H and V L The regions respectively comprise the following amino acid sequences: SEQ ID NOs: 21 and 22; SEQ ID NOs: 23 and 24; SEQ ID NOs: 25 and 26; SEQ ID NOs: 27 and 28; SEQ ID NOs: 29 and 30; SEQ ID NOs: 31 and 32; or SEQ ID NOs: 33 and 34, or a combination thereof with the above V H and V L Any of the antibodies or antigen-binding fragments thereof has at least 90% sequence identity thereto, such as any antibody or antigen-binding fragment thereof having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

[0341] For example, the V of the antibody or antigen-binding fragment thereof provided herein is H and V L The region comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 21 and 22; SEQ ID NOs: 23 and 24; SEQ ID NOs: 25 and 26; SEQ ID NOs: 27 and 28; SEQ ID NOs: 29 and 30; SEQ ID NOs: 31 and 32; and SEQ ID NOs: 33 and 34. In other examples, the V region of the antibody or antigen-binding fragment thereof provided herein is selected from the group consisting of SEQ ID NOs: 21 and 22; SEQ ID NOs: 23 and 24; SEQ ID NOs: 25 and 26; SEQ ID NOs: 27 and 28; SEQ ID NOs: 29 and 30; SEQ ID NOs: 31 and 32; and SEQ ID NOs: 33 and 34. H and V L The regions comprise an amino acid sequence selected from the group consisting of: SEQ ID NOs: 21 and 63; SEQ ID NOs: 23 and 64; SEQ ID NOs: 25 and 65; SEQ ID NOs: 27 and 66; SEQ ID NOs: 29 and 67; SEQ ID NOs: 31 and 68; and SEQ ID NOs: 33 and 69, respectively.

[0342] In some embodiments, the antibody or antigen binding fragment thereof in the provided CAR is a single chain antibody fragment, such as a single chain variable fragment (scFv), or a bifunctional antibody, or a single domain antibody (sdAb). In some embodiments, the antibody or antigen binding fragment is a fragment comprising only V H In some embodiments, the antibody or antigen-binding fragment is a single domain antibody comprising a heavy chain variable (V H ) region and light chain variable (V L In some embodiments, a single-chain antibody fragment (e.g., scFv) comprises two antibody domains or regions, such as a heavy chain variable (V H ) region and light chain variable (V L ) region. The linker is typically a peptide linker, such as a flexible and / or soluble peptide linker. Among these linkers are linkers rich in glycine and serine and / or in some cases rich in threonine. In some embodiments, the linker further includes charged residues that can improve solubility, such as lysine and / or glutamic acid. In some embodiments, the linker further includes one or more proline residues.

[0343] Thus, the provided CARs contain anti-GPRC5D antibodies, including single-chain antibody fragments, such as scFv and diabodies, particularly human single-chain antibody fragments, which generally comprise two antibody domains or regions joined, i.e., these V H and V L The linker is typically a peptide linker, for example a flexible and / or soluble peptide linker, such as a glycine- and serine-rich peptide linker.

[0344] In some aspects, the glycine- and serine- (and / or threonine-)-rich linker comprises at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of such amino acids. In some embodiments, it comprises at least or at least about 50%, 55%, 60%, 70%, or 75% glycine, serine, and / or threonine. In some embodiments, the linker is composed essentially entirely of glycine, serine, and / or threonine. The length of the connector is generally between about 5 and about 50 amino acids, typically between or about 10 and or about 30, for example, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30, and in some instances, the length is between 10 and 25 amino acids. Exemplary connectors include connectors having various numbers of repeats of the sequence GGGGS (4GS; SEQ ID NO: 50) or GGGS (3GS; SEQ ID NO: 51), such as repeats of 2, 3, 4 and 5 such sequences. Exemplary connectors include connectors having or consisting of the sequence shown in SEQ ID NO: 52 (GGGGSGGGGSGGGGS). Exemplary linkers further include linkers having or consisting of the sequence shown in SEQ ID NO: 53 (GSTSGSGKPGSGEGSTKG). Exemplary linkers further include linkers having or consisting of the sequence shown in SEQ ID NO: 54 (SRGGGGSGGGGSGGGGSLEMA). Exemplary linkers include linkers having or consisting of the sequence shown in SEQ ID NO: 47 (GSRGGGGSGGGGSGGGGSLEMA).

[0345] Thus, in some embodiments, provided embodiments include single-chain antibody fragments, e.g., scFvs, comprising one or more of the aforementioned linkers, such as glycine / serine-rich linkers, including linkers having repeats of GGGS (SEQ ID NO: 51) or GGGGS (SEQ ID NO: 50), such as those shown in SEQ ID NO: 47, 52, or 54.

[0346] In some embodiments, V H The area can be V L In some embodiments, V H The area can be V L In certain embodiments, a fragment, such as an scFv, may include a V H region or portion thereof, followed by a linker, followed by V LIn other embodiments, a fragment, such as a scFv, may include a V L region or portion thereof, followed by a linker, followed by V H area or part thereof.

[0347] In some aspects, the scFv provided herein comprises an amino acid sequence selected from any one of SEQ ID NOs: 1-14, or an amino acid sequence having at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% sequence identity to an amino acid sequence selected from any one of SEQ ID NOs: 1-14.

[0348] Among the anti-GPRC5D CARs provided is a CAR wherein the antibody or antigen-binding fragment comprises a V H a region comprising the sequence shown in SEQ ID NO:21, or an amino acid sequence having at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% identity to SEQ ID NO:21; and containing V L A region comprising the sequence shown in SEQ ID NO: 22 or an amino acid sequence having at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% identity to SEQ ID NO: 22. In some embodiments, a CAR is provided wherein the antibody or antigen-binding fragment comprises a V H a region comprising the sequence shown in SEQ ID NO: 21, or an amino acid sequence having at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% identity to SEQ ID NO: 21; and containing V LA region comprising the sequence shown in SEQ ID NO: 63 or an amino acid sequence having at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% identity to SEQ ID NO: 63. In some embodiments, the antibody or antigen-binding fragment in the provided CAR comprises: V H A region having CDRH1, CDRH2, and CDRH3 comprising the amino acid sequences of SEQ ID NOs: 75, 76, and 77, respectively; and V L A region having CDRL1, CDRL2, and CDRL3 comprising the amino acid sequences of SEQ ID NOs: 85, 86, and 87, respectively. In some embodiments, the antibody or antigen-binding fragment of the provided CAR comprises: V H A region having CDRH1, CDRH2 and CDRH3 comprising the amino acid sequences of SEQ ID NOs: 78, 79 and 77, respectively; and V L A region comprising CDRL1, CDRL2, and CDRL3 comprising the amino acid sequences of SEQ ID NOs: 85, 86, and 87, respectively. In some embodiments, the antibody or antigen-binding fragment of the provided CAR comprises: V H A region having CDRH1, CDRH2 and CDRH3 comprising the amino acid sequences of SEQ ID NOs: 80, 81 and 77, respectively; and V L A region comprising CDRL1, CDRL2, and CDRL3 comprising the amino acid sequences of SEQ ID NOs: 85, 86, and 87, respectively. In some embodiments, the antibody or antigen-binding fragment of the provided CAR comprises: V H A region having CDRH1, CDRH2 and CDRH3 comprising the amino acid sequences of SEQ ID NOs: 82, 83 and 84, respectively; and V L A region comprising CDRL1, CDRL2 and CDRL3 comprising the amino acid sequences of SEQ ID NOs: 88, 89 and 87, respectively. In some embodiments, the V H The region comprises the sequence shown in SEQ ID NO: 21 and the V L The V region comprises the sequence shown in SEQ ID NO: 22. In some embodiments, the V H The region comprises the sequence shown in SEQ ID NO: 21 and the V LThe region comprises the sequence shown in SEQ ID NO: 63. In some embodiments, the antibody or antigen-binding fragment is a single-chain antibody fragment, such as an scFv. In some embodiments, the scFv comprises the amino acid sequence shown in SEQ ID NO: 1, or an amino acid sequence that is at least or about 90%, at least or about 91%, at least or about 92%, at least or about 93%, at least or about 94%, at least or about 95%, at least or about 96%, at least or about 97%, at least or about 98%, or at least or about 99% identical to SEQ ID NO: 1. In some embodiments, the scFv is encoded by the nucleotide sequence set forth in SEQ ID NO: 257, or a nucleotide sequence that is at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% identical to SEQ ID NO: 257. In some embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 2, or an amino acid sequence that is at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% identical to SEQ ID NO: 2. In some embodiments, the scFv is encoded by the nucleotide sequence shown in SEQ ID NO: 258, or a nucleotide sequence that is at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% identical to SEQ ID NO: 258.

[0349] The anti-GPRC5D CAR provided is a CAR wherein the antibody or antigen-binding fragment comprises a V H a region comprising the sequence shown in SEQ ID NO: 23, or an amino acid sequence that is at least or about 90%, at least or about 91%, at least or about 92%, at least or about 93%, at least or about 94%, at least or about 95%, at least or about 96%, at least or about 97%, at least or about 98%, or at least or about 99% identical to SEQ ID NO: 23; and containing V LA region comprising the sequence shown in SEQ ID NO: 24 or an amino acid sequence having at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% identity to SEQ ID NO: 24. In some embodiments, a CAR is provided wherein the antibody or antigen-binding fragment comprises a V H The region comprises the sequence shown in SEQ ID NO:23, or an amino acid sequence that is at least or about 90%, at least or about 91%, at least or about 92%, at least or about 93%, at least or about 94%, at least or about 95%, at least or about 96%, at least or about 97%, at least or about 98%, or at least or about 99% identical to SEQ ID NO:23; and contains V L A region comprising the sequence shown in SEQ ID NO: 64 or an amino acid sequence having at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% identity to SEQ ID NO: 64. In some embodiments, the antibody or antigen-binding fragment in the CAR provided comprises: V H A region comprising CDRH1, CDRH2 and CDRH3 comprising the amino acid sequences of SEQ ID NOs: 90, 91 and 92, respectively; and V L A region having CDRL1, CDRL2, and CDRL3 comprising the amino acid sequences of SEQ ID NOs: 100, 101, and 102, respectively. In some embodiments, the antibody or antigen-binding fragment of the provided CAR comprises: V H A region having CDRH1, CDRH2, and CDRH3 comprising the amino acid sequences of SEQ ID NOs: 93, 94, and 92, respectively; and V L A region comprising CDRL1, CDRL2 and CDRL3 comprising the amino acid sequences of SEQ ID NOs: 100, 101 and 102, respectively. In some embodiments, the antibody or antigen-binding fragment of the provided CAR comprises: V H A region having CDRH1, CDRH2 and CDRH3 comprising the amino acid sequences of SEQ ID NOs: 95, 96 and 92, respectively; and V LA region comprising CDRL1, CDRL2 and CDRL3 comprising the amino acid sequences of SEQ ID NOs: 100, 101 and 102, respectively. In some embodiments, the antibody or antigen-binding fragment of the provided CAR comprises: V H A region having CDRH1, CDRH2 and CDRH3 comprising the amino acid sequences of SEQ ID NOs: 97, 98 and 99, respectively; and V L A region comprising CDRL1, CDRL2 and CDRL3 comprising the amino acid sequences of SEQ ID NOs: 103, 104 and 102, respectively. In some embodiments, the V H The region comprises the sequence shown in SEQ ID NO: 23 and the V L The V region comprises the sequence shown in SEQ ID NO: 24. In some embodiments, the V H The region comprises the sequence shown in SEQ ID NO: 23 and the V LThe region comprises the sequence shown in SEQ ID NO: 64. In some embodiments, the antibody or antigen-binding fragment is a single-chain antibody fragment, such as an scFv. In some embodiments, the scFv comprises the amino acid sequence shown in SEQ ID NO: 3, or an amino acid sequence that is at least or about 90%, at least or about 91%, at least or about 92%, at least or about 93%, at least or about 94%, at least or about 95%, at least or about 96%, at least or about 97%, at least or about 98%, or at least or about 99% identical to SEQ ID NO: 3. In some embodiments, the scFv is encoded by the nucleotide sequence set forth in SEQ ID NO: 259, or a nucleotide sequence that is at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% identical to SEQ ID NO: 259. In some embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 4, or an amino acid sequence that is at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% identical to SEQ ID NO: 4. In some embodiments, the scFv is encoded by the nucleotide sequence shown in SEQ ID NO: 260, or a nucleotide sequence that is at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% identical to SEQ ID NO: 260.

[0350] Among the anti-GPRC5D CARs provided is a CAR wherein the antibody or antigen-binding fragment comprises a V H a region comprising the sequence shown in SEQ ID NO: 25, or an amino acid sequence that is at least or about 90%, at least or about 91%, at least or about 92%, at least or about 93%, at least or about 94%, at least or about 95%, at least or about 96%, at least or about 97%, at least or about 98%, or at least or about 99% identical to SEQ ID NO: 25; and containing V LA region comprising the sequence shown in SEQ ID NO: 26 or an amino acid sequence having at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% identity to SEQ ID NO: 26. In some embodiments, a CAR is provided wherein the antibody or antigen-binding fragment comprises a V H a region comprising the sequence shown in SEQ ID NO: 25, or an amino acid sequence that is at least or about 90%, at least or about 91%, at least or about 92%, at least or about 93%, at least or about 94%, at least or about 95%, at least or about 96%, at least or about 97%, at least or about 98%, or at least or about 99% identical to SEQ ID NO: 25; and containing V L A region comprising the sequence shown in SEQ ID NO: 65 or an amino acid sequence having at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% identity to SEQ ID NO: 65. In some embodiments, the antibody or antigen-binding fragment in the provided CAR comprises: V H A region having CDRH1, CDRH2 and CDRH3 comprising the amino acid sequences of SEQ ID NOs: 105, 106, and 107, respectively; and V L A region having CDRL1, CDRL2, and CDRL3 comprising the amino acid sequences of SEQ ID NOs: 115, 116, and 117, respectively. In some embodiments, the antibody or antigen-binding fragment of the provided CAR comprises: V H A region having CDRH1, CDRH2 and CDRH3 comprising the amino acid sequences of SEQ ID NOs: 108, 109 and 107, respectively; and V L A region comprising CDRL1, CDRL2, and CDRL3 comprising the amino acid sequences of SEQ ID NOs: 115, 116, and 117, respectively. In some embodiments, the antibody or antigen-binding fragment of the provided CAR comprises: V H A region having CDRH1, CDRH2 and CDRH3 comprising the amino acid sequences of SEQ ID NOs: 110, 111 and 107, respectively; and V LA region comprising CDRL1, CDRL2 and CDRL3 comprising the amino acid sequences of SEQ ID NOs: 115, 116 and 117, respectively. In some embodiments, the antibody or antigen-binding fragment of the provided CAR comprises: V H A region having CDRH1, CDRH2 and CDRH3 comprising the amino acid sequences of SEQ ID NOs: 112, 113 and 114, respectively; and V L A region comprising CDRL1, CDRL2 and CDRL3 comprising the amino acid sequences of SEQ ID NOs: 118, 119 and 117, respectively. In some embodiments, the V H The region comprises the sequence shown in SEQ ID NO: 25 and the V L The V region comprises the sequence shown in SEQ ID NO: 26. In some embodiments, the V H The region comprises the sequence shown in SEQ ID NO: 25 and the V LIn some embodiments, the antibody or antigen-binding fragment comprises the sequence shown in SEQ ID NO: 65. In some embodiments, the antibody or antigen-binding fragment is a single-chain antibody fragment, such as an scFv. In some embodiments, the scFv comprises the amino acid sequence shown in SEQ ID NO: 5, or an amino acid sequence that is at least or about 90%, at least or about 91%, at least or about 92%, at least or about 93%, at least or about 94%, at least or about 95%, at least or about 96%, at least or about 97%, at least or about 98%, or at least or about 99% identical to SEQ ID NO: 5. In some embodiments, the scFv is encoded by the nucleotide sequence set forth in SEQ ID NO: 261, or a nucleotide sequence that is at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% identical to SEQ ID NO: 261. In some embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 6, or an amino acid sequence that is at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% identical to SEQ ID NO: 6. In some embodiments, the scFv is encoded by the nucleotide sequence shown in SEQ ID NO: 262, or a nucleotide sequence that is at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% identical to SEQ ID NO: 262.

[0351] Among the anti-GPRC5D CARs provided is a CAR wherein the antibody or antigen-binding fragment comprises a V H a region comprising the sequence shown in SEQ ID NO: 27, or an amino acid sequence that is at least or about 90%, at least or about 91%, at least or about 92%, at least or about 93%, at least or about 94%, at least or about 95%, at least or about 96%, at least or about 97%, at least or about 98%, or at least or about 99% identical to SEQ ID NO: 27; and containing V LA region comprising the sequence shown in SEQ ID NO: 28 or an amino acid sequence having at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% identity to SEQ ID NO: 28. In some embodiments, a CAR is provided wherein the antibody or antigen-binding fragment comprises a V H a region comprising the sequence shown in SEQ ID NO: 27, or an amino acid sequence that is at least or about 90%, at least or about 91%, at least or about 92%, at least or about 93%, at least or about 94%, at least or about 95%, at least or about 96%, at least or about 97%, at least or about 98%, or at least or about 99% identical to SEQ ID NO: 27; and containing V L A region comprising the sequence shown in SEQ ID NO: 66 or an amino acid sequence having at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% identity to SEQ ID NO: 66. In some embodiments, the antibody or antigen-binding fragment in the CAR provided comprises: V H A region having CDRH1, CDRH2 and CDRH3 comprising the amino acid sequences of SEQ ID NOs: 120, 121 and 122, respectively; and V L A region having CDRL1, CDRL2, and CDRL3 comprising the amino acid sequences of SEQ ID NOs: 130, 131, and 132, respectively. In some embodiments, the antibody or antigen-binding fragment of the provided CAR comprises: V H A region having CDRH1, CDRH2 and CDRH3 comprising the amino acid sequences of SEQ ID NOs: 123, 124 and 122, respectively; and V L A region comprising CDRL1, CDRL2, and CDRL3 comprising the amino acid sequences of SEQ ID NOs: 130, 131, and 132, respectively. In some embodiments, the antibody or antigen-binding fragment of the provided CAR comprises: V H A region having CDRH1, CDRH2 and CDRH3 comprising the amino acid sequences of SEQ ID NOs: 125, 126 and 122, respectively; and V LA region comprising CDRL1, CDRL2, and CDRL3 comprising the amino acid sequences of SEQ ID NOs: 130, 131, and 132, respectively. In some embodiments, the antibody or antigen-binding fragment of the provided CAR comprises: V H A region having CDRH1, CDRH2 and CDRH3 comprising the amino acid sequences of SEQ ID NOs: 127, 128 and 129, respectively; and V L A region comprising CDRL1, CDRL2 and CDRL3 comprising the amino acid sequences of SEQ ID NOs: 133, 134 and 132, respectively. In some embodiments, the V H The region comprises the sequence shown in SEQ ID NO: 27 and the V L The V region comprises the sequence shown in SEQ ID NO: 28. In some embodiments, the V H The region comprises the sequence shown in SEQ ID NO: 27 and the V LIn some embodiments, the antibody or antigen-binding fragment comprises the sequence shown in SEQ ID NO: 66. In some embodiments, the antibody or antigen-binding fragment is a single-chain antibody fragment, such as an scFv. In some embodiments, the scFv comprises the amino acid sequence shown in SEQ ID NO: 7, or an amino acid sequence that is at least or about 90%, at least or about 91%, at least or about 92%, at least or about 93%, at least or about 94%, at least or about 95%, at least or about 96%, at least or about 97%, at least or about 98%, or at least or about 99% identical to SEQ ID NO: 7. In some embodiments, the scFv is encoded by the nucleotide sequence set forth in SEQ ID NO: 263, or a nucleotide sequence that is at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% identical to SEQ ID NO: 263. In some embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 8, or an amino acid sequence that is at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% identical to SEQ ID NO: 8. In some embodiments, the scFv is encoded by the nucleotide sequence shown in SEQ ID NO: 264, or a nucleotide sequence that is at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% identical to SEQ ID NO: 264.

[0352] Among the anti-GPRC5D CARs provided is a CAR wherein the antibody or antigen-binding fragment comprises a V H a region comprising the sequence shown in SEQ ID NO: 29, or an amino acid sequence that is at least or about 90%, at least or about 91%, at least or about 92%, at least or about 93%, at least or about 94%, at least or about 95%, at least or about 96%, at least or about 97%, at least or about 98%, or at least or about 99% identical to SEQ ID NO: 29; and containing V LA region comprising the sequence shown in SEQ ID NO: 30 or an amino acid sequence having at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% identity to SEQ ID NO: 30. In some embodiments, a CAR is provided wherein the antibody or antigen-binding fragment comprises a V H a region comprising the sequence shown in SEQ ID NO: 29, or an amino acid sequence that is at least or about 90%, at least or about 91%, at least or about 92%, at least or about 93%, at least or about 94%, at least or about 95%, at least or about 96%, at least or about 97%, at least or about 98%, or at least or about 99% identical to SEQ ID NO: 29; and containing V L A region comprising the sequence shown in SEQ ID NO: 67 or an amino acid sequence having at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% identity to SEQ ID NO: 67. In some embodiments, the antibody or antigen-binding fragment in the CAR provided comprises: V H A region having CDRH1, CDRH2 and CDRH3 comprising the amino acid sequences of SEQ ID NOs: 135, 136 and 137, respectively; and V L A region having CDRL1, CDRL2, and CDRL3 comprising the amino acid sequences of SEQ ID NOs: 145, 146, and 147, respectively. In some embodiments, the antibody or antigen-binding fragment of the provided CAR comprises: V H A region having CDRH1, CDRH2 and CDRH3 comprising the amino acid sequences of SEQ ID NOs: 138, 139 and 137, respectively; and V L A region comprising CDRL1, CDRL2 and CDRL3 comprising the amino acid sequences of SEQ ID NOs: 145, 146 and 147, respectively. In some embodiments, the antibody or antigen-binding fragment of the provided CAR comprises: V H A region having CDRH1, CDRH2 and CDRH3 comprising the amino acid sequences of SEQ ID NOs: 140, 141 and 137, respectively; and V LA region comprising CDRL1, CDRL2 and CDRL3 comprising the amino acid sequences of SEQ ID NOs: 145, 146 and 147, respectively. In some embodiments, the antibody or antigen-binding fragment of the provided CAR comprises: V H A region having CDRH1, CDRH2 and CDRH3 comprising the amino acid sequences of SEQ ID NOs: 142, 143 and 144, respectively; and V L A region comprising CDRL1, CDRL2 and CDRL3 comprising the amino acid sequences of SEQ ID NOs: 148, 149 and 147, respectively. In some embodiments, the V H The region comprises the sequence shown in SEQ ID NO: 29 and the V L The V region comprises the sequence shown in SEQ ID NO: 30. In some embodiments, the V H The region comprises the sequence shown in SEQ ID NO: 29 and the V LIn some embodiments, the antibody or antigen-binding fragment comprises the sequence shown in SEQ ID NO: 67. In some embodiments, the antibody or antigen-binding fragment is a single-chain antibody fragment, such as an scFv. In some embodiments, the scFv comprises the amino acid sequence shown in SEQ ID NO: 9, or an amino acid sequence that is at least or about 90%, at least or about 91%, at least or about 92%, at least or about 93%, at least or about 94%, at least or about 95%, at least or about 96%, at least or about 97%, at least or about 98%, or at least or about 99% identical to SEQ ID NO: 9. In some embodiments, the scFv is encoded by the nucleotide sequence set forth in SEQ ID NO: 265, or a nucleotide sequence that is at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% identical to SEQ ID NO: 265. In some embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 10, or an amino acid sequence that is at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% identical to SEQ ID NO: 10. In some embodiments, the scFv is encoded by the nucleotide sequence shown in SEQ ID NO: 266, or a nucleotide sequence that is at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% identical to SEQ ID NO: 266.

[0353] Among the anti-GPRC5D CARs provided is a CAR wherein the antibody or antigen-binding fragment comprises a V H a region comprising the sequence shown in SEQ ID NO:31, or an amino acid sequence that is at least or about 90%, at least or about 91%, at least or about 92%, at least or about 93%, at least or about 94%, at least or about 95%, at least or about 96%, at least or about 97%, at least or about 98%, or at least or about 99% identical to SEQ ID NO:31; and containing V LA region comprising the sequence shown in SEQ ID NO: 32 or an amino acid sequence having at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% identity to SEQ ID NO: 32. In some embodiments, a CAR is provided wherein the antibody or antigen-binding fragment comprises a V H a region comprising the sequence shown in SEQ ID NO:31, or an amino acid sequence that is at least or about 90%, at least or about 91%, at least or about 92%, at least or about 93%, at least or about 94%, at least or about 95%, at least or about 96%, at least or about 97%, at least or about 98%, or at least or about 99% identical to SEQ ID NO:31; and containing V L A region comprising the sequence shown in SEQ ID NO: 68 or an amino acid sequence having at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% identity to SEQ ID NO: 68. In some embodiments, the antibody or antigen-binding fragment in the CAR provided comprises: V H A region having CDRH1, CDRH2 and CDRH3 comprising the amino acid sequences of SEQ ID NOs: 135, 150 and 151, respectively; and V L A region having CDRL1, CDRL2, and CDRL3 comprising the amino acid sequences of SEQ ID NOs: 157, 158, and 159, respectively. In some embodiments, the antibody or antigen-binding fragment of the provided CAR comprises: V H A region having CDRH1, CDRH2 and CDRH3 comprising the amino acid sequences of SEQ ID NOs: 152, 153 and 151, respectively; and V L A region comprising CDRL1, CDRL2 and CDRL3 comprising the amino acid sequences of SEQ ID NOs: 157, 158 and 159, respectively. In some embodiments, the antibody or antigen-binding fragment of the CAR provided comprises: V H A region having CDRH1, CDRH2 and CDRH3 comprising the amino acid sequences of SEQ ID NOs: 140, 154 and 151, respectively; and V LA region comprising CDRL1, CDRL2 and CDRL3 comprising the amino acid sequences of SEQ ID NOs: 157, 158 and 159, respectively. In some embodiments, the antibody or antigen-binding fragment of the CAR provided comprises: V H A region having CDRH1, CDRH2 and CDRH3 comprising the amino acid sequences of SEQ ID NOs: 142, 155 and 156, respectively; and V L A region comprising CDRL1, CDRL2 and CDRL3 comprising the amino acid sequences of SEQ ID NOs: 160, 161 and 159, respectively. In some embodiments, the V H The region comprises the sequence shown in SEQ ID NO: 31 and the V L The V region comprises the sequence shown in SEQ ID NO: 32. In some embodiments, the V H The region comprises the sequence shown in SEQ ID NO: 31 and the V LThe region comprises the sequence shown in SEQ ID NO: 68. In some embodiments, the antibody or antigen-binding fragment is a single-chain antibody fragment, such as an scFv. In some embodiments, the scFv comprises the amino acid sequence shown in SEQ ID NO: 11, or an amino acid sequence that is at least or about 90%, at least or about 91%, at least or about 92%, at least or about 93%, at least or about 94%, at least or about 95%, at least or about 96%, at least or about 97%, at least or about 98%, or at least or about 99% identical to SEQ ID NO: 11. In some embodiments, the scFv is encoded by the nucleotide sequence set forth in SEQ ID NO: 267, or a nucleotide sequence that is at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% identical to SEQ ID NO: 267. In some embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 12, or an amino acid sequence that is at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% identical to SEQ ID NO: 12. In some embodiments, the scFv is encoded by the nucleotide sequence shown in SEQ ID NO: 268, or a nucleotide sequence that is at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% identical to SEQ ID NO: 268.

[0354] Among the anti-GPRC5D CARs provided is a CAR wherein the antibody or antigen-binding fragment comprises a V H a region comprising the sequence shown in SEQ ID NO:33, or an amino acid sequence that is at least or about 90%, at least or about 91%, at least or about 92%, at least or about 93%, at least or about 94%, at least or about 95%, at least or about 96%, at least or about 97%, at least or about 98%, or at least or about 99% identical to SEQ ID NO:33; and containing V LA region comprising the sequence shown in SEQ ID NO: 34 or an amino acid sequence having at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% identity to SEQ ID NO: 34. In some embodiments, a CAR is provided wherein the antibody or antigen-binding fragment comprises a V H a region comprising the sequence shown in SEQ ID NO:33, or an amino acid sequence that is at least or about 90%, at least or about 91%, at least or about 92%, at least or about 93%, at least or about 94%, at least or about 95%, at least or about 96%, at least or about 97%, at least or about 98%, or at least or about 99% identical to SEQ ID NO:33; and containing V L A region comprising the sequence shown in SEQ ID NO: 69 or an amino acid sequence having at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% identity to SEQ ID NO: 69. In some embodiments, the antibody or antigen-binding fragment in the provided CAR comprises: V H A region having CDRH1, CDRH2 and CDRH3 comprising the amino acid sequences of SEQ ID NOs: 162, 163 and 164, respectively; and V L Region, which has CDRL1, CDRL2 and CDRL3 containing the amino acid sequence of SEQ ID NO: 172, 86, 173, respectively. In some embodiments, the antibody or antigen-binding fragment in the provided CAR contains: V H A region having CDRH1, CDRH2 and CDRH3 comprising the amino acid sequences of SEQ ID NOs: 165, 166 and 164, respectively; and V L A region comprising CDRL1, CDRL2, and CDRL3 comprising the amino acid sequences of SEQ ID NOs: 172, 86, and 173, respectively. In some embodiments, the antibody or antigen-binding fragment of the provided CAR comprises: V H A region having CDRH1, CDRH2 and CDRH3 comprising the amino acid sequences of SEQ ID NOs: 167, 168 and 164, respectively; and V LA region comprising CDRL1, CDRL2, and CDRL3 comprising the amino acid sequences of SEQ ID NOs: 172, 86, and 173, respectively. In some embodiments, the antibody or antigen-binding fragment of the provided CAR comprises: V H A region comprising CDRH1, CDRH2 and CDRH3 comprising the amino acid sequences of SEQ ID NOs: 169, 170 and 171, respectively; and V L A region comprising CDRL1, CDRL2, and CDRL3 comprising the amino acid sequences of SEQ ID NOs: 174, 89, and 175, respectively. In some embodiments, the antibody or antigen-binding fragment of the CAR provided comprises: V H A region comprising CDRH1, CDRH2 and CDRH3 comprising the amino acid sequences of SEQ ID NOs: 169, 170 and 171, respectively; and V L A region comprising CDRL1, CDRL2 and CDRL3 comprising the amino acid sequences of SEQ ID NOs: 174, 89 and 297, respectively. In some embodiments, the V H The region comprises the sequence shown in SEQ ID NO: 33 and the V L The V region comprises the sequence shown in SEQ ID NO: 34. In some embodiments, the V H The region comprises the sequence shown in SEQ ID NO: 33 and the V LThe region comprises the sequence shown in SEQ ID NO: 69. In some embodiments, the antibody or antigen-binding fragment is a single-chain antibody fragment, such as an scFv. In some embodiments, the scFv comprises the amino acid sequence shown in SEQ ID NO: 13, or an amino acid sequence that is at least or about 90%, at least or about 91%, at least or about 92%, at least or about 93%, at least or about 94%, at least or about 95%, at least or about 96%, at least or about 97%, at least or about 98%, or at least or about 99% identical to SEQ ID NO: 13. In some embodiments, the scFv is encoded by the nucleotide sequence set forth in SEQ ID NO: 269, or a nucleotide sequence that is at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% identical to SEQ ID NO: 269. In some embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 14, or an amino acid sequence that is at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least a...

Claims

1. A chimeric antigen receptor (CAR), comprising: (1) An extracellular antigen-binding domain that specifically binds to human G protein-coupled receptor class C family 5 member D (GPRC5D), wherein the extracellular antigen-binding domain comprises: (i) Heavy chain variable (V H ) region, which contains the V contained in SEQ ID NO: 27 H heavy chain complementary determining region 1 (CDR-H1), heavy chain complementary determining region 2 (CDR-H2), and heavy chain complementary determining region 3 (CDR-H3) of the amino acid sequence of the region; and (ii) Light chain variable (V L ) region, which contains the V contained in SEQ ID NO: 28 or 66 L light chain complementary determining region 1 (CDR-L1), light chain complementary determining region 2 (CDR-L2), and light chain complementary determining region 3 (CDR-L3); (2) a spacer comprising an IgG4 / 2 chimeric hinge or a modified IgG4 hinge, an IgG2 / 4 chimeric CH2 region, and an IgG4 CH3 region; (3) transmembrane domain; and (4) Intracellular signal transduction region.

2. The chimeric antigen receptor of claim 1, wherein the extracellular antigen binding domain comprises: (i) Heavy chain variable (V H ) region, which comprises a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 125; (b) a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 126; and (c) a CDR-H3 comprising the amino acid sequence of SEQ ID NO: 122; and (ii) Heavy chain variable (V L ) region, which comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 130; (b) a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 131; and (c) a CDR-L3 comprising the amino acid sequence of SEQ ID NO:

132.

3. The chimeric antigen receptor of claim 1, wherein the extracellular antigen binding domain comprises: (i) Heavy chain variable (V H ) region comprising an amino acid sequence having at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% sequence identity to the amino acid sequence shown in SEQ ID NO:27; and (ii) Light chain variable (V L ) region, which comprises an amino acid sequence having at least or at least about 90%, at least or at least about 91%, at least or at least about 92%, at least or at least about 93%, at least or at least about 94%, at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% sequence identity to the amino acid sequence shown in SEQ ID NO:66 or SEQ ID NO:

28.

4. The chimeric antigen receptor of claim 1, wherein the V H area and the V L The regions comprise the amino acid sequences shown in SEQ ID NOs: 27 and 66, respectively.

5. The chimeric antigen receptor of claim 1, wherein the V H area and the V L The regions comprise the amino acid sequences shown in SEQ ID NOs: 27 and 28, respectively.

6. The chimeric antigen receptor of claim 1, wherein the spacer comprises (i) the sequence shown in SEQ ID NO: 17; (ii) a functional variant of SEQ ID NO: 17 having at least or at least about 95%, at least or at least about 96%, at least or at least about 97%, at least or at least about 98%, or at least or at least about 99% sequence identity to SEQ ID NO: 17; or (iii) a contiguous portion of (i) or (ii) having a length of at least 125 amino acids.

7. The chimeric antigen receptor of claim 1, wherein the extracellular antigen binding domain is or comprises a single chain variable fragment (scFv).

8. A chimeric antigen receptor comprising (1) An extracellular antigen-binding domain that specifically binds to human G protein-coupled receptor class C family 5 member D (GPRC5D), wherein the extracellular antigen-binding domain comprises: (i) Heavy chain variable (V H ) region, which comprises the amino acid sequence shown in SEQ ID NO: 27; and (ii) a light chain variable (V L ) region, which contains the amino acid sequence shown in SEQ ID NO:66; (2) a spacer comprising an amino acid sequence having at least or at least about 95% sequence identity to SEQ ID NO: 17; (3) a transmembrane domain derived from human CD28; and (4) An intracellular signal transduction region, which includes the cytoplasmic signal transduction domain of the CD3-zeta (CD3ζ) chain and the extracellular signal transduction domain of 4-1BB.

9. A chimeric antigen receptor comprising (1) An extracellular antigen-binding domain that specifically binds to human G protein-coupled receptor class C family 5 member D (GPRC5D), wherein the extracellular antigen-binding domain comprises: (i) Heavy chain variable (V H ) region, which comprises the amino acid sequence shown in SEQ ID NO: 27; and (ii) a light chain variable (V L ) region, which contains the amino acid sequence shown in SEQ ID NO:28; (2) a spacer comprising an amino acid sequence having at least or at least about 95% sequence identity to SEQ ID NO: 17; (3) a transmembrane domain derived from human CD28; and (4) An intracellular signal transduction region, which includes the cytoplasmic signal transduction domain of the CD3-zeta (CD3ζ) chain and the extracellular signal transduction domain of 4-1BB.

10. A chimeric antigen receptor comprising (1) An extracellular antigen-binding domain that specifically binds to human G protein-coupled receptor class C family 5 member D (GPRC5D), wherein the extracellular antigen-binding domain comprises: V containing CDR-H1, CDR-H2 and CDR-H3 H A region comprising the amino acid sequences of SEQ ID NOs: 125, 126 and 122, respectively; and a V region comprising CDR-L1, CDR-L2 and CDR-L3. L regions comprising the amino acid sequences of SEQ ID NOs: 130, 131 and 132, respectively; (2) a spacer comprising an amino acid sequence having at least or at least about 95% sequence identity to SEQ ID NO: 17; (3) a transmembrane domain derived from human CD28; and (4) An intracellular signal transduction region, which includes the cytoplasmic signal transduction domain of the CD3-zeta (CD3ζ) chain and the extracellular signal transduction domain of 4-1BB.

Images