A method for constructing a self-assembling enzyme for the directional synthesis of uniform low-molecular-weight dextran and its application

Abstract

The present invention discloses a self-assembling enzyme for the directed synthesis of uniform low-molecular-weight dextran, named YG-SpyTag-SpyCatcher-padex. YG represents the dextransucrase gene (GenBank No. DQ345760), padex represents the dextranase gene (GenBank No. KF999646.1), SpyTag and SpyCatcher represent two specific short peptides, and the aspartic acid in SpyTag spontaneously forms an isopeptide bond with the lysine in SpyCatcher. The present invention belongs to the field of biotechnology and relates to enzyme engineering technology. The present invention combines dextran sucrase derived from the genetically engineered Escherichia coli bacterium BL21(DE3)-YG-SpyTag with dextranase derived from the genetically engineered Pichia pastoris bacterium X33-SpyCatcher-padex through the SpyTag-SpyCatcher protein covalent coupling system. The obtained self-assembling enzyme can catalyze the direct conversion of the substrate sucrose into dextran with a molecular weight of 3000-4000Da.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to enzyme engineering technology, and in particular to a method for constructing a self-assembling enzyme for directed synthesis of uniform low-molecular-weight dextran and its application. Background Art

[0002] Dextran is a water-soluble polysaccharide composed of glucose units linked by α(1,6) glycosidic bonds. It has a wide range of applications in the food and pharmaceutical industries. In the food industry, dextran is commonly used as a thickener, stabilizer, and sweetener to improve the taste and texture of food. In the pharmaceutical field, dextran can be used as a drug carrier, plasma expander, or anticoagulant, with diverse functions depending on its molecular weight. In pharmaceutical applications, dextran is an ideal plasma volume expander, particularly for emergency treatment after blood loss. Dextran with a molecular weight range of 40,000 to 100,000 Da is effective in increasing blood volume. Common grades include dextran 70 (molecular weight 70,000 Da) and dextran 40 (molecular weight 40,000 Da). These dextran types, with a high α(1,6) bond ratio of 95%, exhibit high water solubility, low viscosity, and good water retention, making them ideal plasma expanders. In comparison, dextran with a molecular weight between 10,000 and 20,000 Da is suitable for improving microcirculation and further promoting blood supply to local tissues, while dextran with a molecular weight between 1,000 and 7,000 Da can be used as a pharmaceutical precursor for hematinic agents or anticoagulants. Therefore, the preparation of dextran with a specific molecular weight is crucial in practical applications, and the precise control and optimization of its molecular weight has become a research focus.

[0003] Traditional dextran production methods typically rely on acid hydrolysis of high-molecular-weight dextran, followed by chemical degradation to obtain a product of the desired molecular weight. However, this approach has significant limitations, including a wide and uneven molecular weight distribution of the product and the need for multiple purification steps before obtaining the desired molecular weight. This process is complex, time-consuming, and potentially environmentally polluting. Therefore, the development of more environmentally friendly, efficient, and precisely regulated dextran production methods has become a hot topic of research. Notably, the dextran produced by Leuconostoc mesenteroides 0326 exhibits a high proportion of α(1,6) glycosidic bonds (approximately 95%) while reducing antigenicity. Its water solubility is excellent, particularly when compared to α(1,3)- and β-linked structures, where it exhibits significant solubility advantages. Biotechnological or enzymatic methods can precisely control the molecular weight of the produced dextran, avoiding the uneven molecular weight distribution associated with traditional acid hydrolysis. At the same time, this method is environmentally friendly, has green and sustainable potential, and also shows good application prospects in the optimization of modern dextran production processes.

[0004] The bioenzymatic method offers significant advantages in the preparation of dextran due to its mild reaction conditions and high catalytic efficiency. Compared to traditional chemical methods, enzymatic reactions can be carried out at lower temperatures and under neutral or slightly acidic or slightly alkaline conditions, significantly reducing environmental pollution. The molecular weight of the target product can be precisely controlled by regulating the enzyme type, concentration, and reaction conditions. Furthermore, the catalytic activity and specificity of enzymes make the production process more efficient, the product purity higher, and the subsequent separation and purification steps reduced. Consequently, the bioenzymatic method is gaining increasing attention in industrial applications.

[0005] In the dextran production process, dextransucrase (Dextransucrase, EC 2.4.1.5), a member of the glycoside hydrolase family 70, serves as the core catalytic enzyme, catalyzing the conversion of sucrose to dextran. Site-directed mutagenesis of dextransucrase allows precise manipulation of the structure of its active center pocket, thereby altering the molecular weight distribution of dextran during catalytic dextran synthesis. Studies have shown that by adjusting key sites in the sucrase, the polymerization length of glucan can be influenced, resulting in the production of dextran with varying molecular weights. This targeted mutagenesis technique significantly expands the flexibility of enzymatic methods for molecular weight control and provides an effective approach for preparing dextran with specific molecular weights.

[0006] The dextransucrase used in this invention is derived from Leuconostoc mesenteroides 0326, a strain widely used in the industrial production of dextran. This enzyme consists of 1,250 to 1,600 amino acids and is approximately 170 kDa in size. Its unique structure holds great promise for broad application in polysaccharide synthesis, particularly in the synthesis of polysaccharide drugs, the development of pharmaceutical excipients, the preparation of health foods, and biodegradable biomaterials.

[0007] Dextranase (α-1,6-D-glucan-6-glucanohydrolase; EC 3.2.1.11) is a hydrolase that specifically degrades α-1,6-glycosidic bonds in dextran molecules. Based on their dextran hydrolysis mechanisms, dextranases are generally classified as endo- and exo-type dextranases. Endodextranases randomly hydrolyze α-(1,6) bonds within the dextran chain, generating a series of low- and medium-molecular-weight polysaccharides. Exodextranases primarily degrade α-(1,6) bonds at the non-reducing ends of the dextran chain, releasing glucose. The dextranase used in this study is derived from Penicillium pastoris and is an endo-type dextranase with a protein size of approximately 65 kDa.

[0008] In addition, previous studies have explored the synergistic catalysis of dextransucrase and dextranase to further reduce the molecular weight of the product. Dextranase hydrolyzes the α(1,6) glycosidic bond in dextran and, through synergistic action with dextransucrase, produces low-molecular-weight dextrans. Our group previously successfully conducted synergistic catalysis experiments with dextransucrase and dextranase, obtaining low-molecular-weight dextrans ranging from 5 kDa to 20 kDa. (See Gan W, Zhang H, Zhang Y, et al. Biosynthesis of oligodextrans with different Mw by synergistic catalysis of dextransucrase and dextranase [J]. Carbohydrate polymers, 2014, 112: 387-395.) This study shows that the molecular weight of dextran can be controlled through dual enzyme synergy, but the catalytic efficiency of the dual enzyme system is still limited when the enzyme molecules are in the free state, and it is difficult to obtain a large amount of dextran with uniform molecular weight, especially below 5000Da, through dual enzyme synergy.

[0009] In recent years, gene fusion technology has also been applied to the preparation of dextran. Publication No. CN113564092A reports a method for a fusion enzyme for the directed synthesis of dextran. The fusion enzyme can not only simultaneously synthesize and degrade dextran, but also produce a low-molecular-weight product, which is another method for preparing low-molecular-weight dextran. However, this enzyme engineering technology still faces problems such as enzyme stability and expression efficiency in practical applications and needs further optimization.

[0010] While the aforementioned strategies have made some progress in regulating the molecular weight of dextran, there are currently no reports of constructing self-assembling enzymes through in vitro self-assembly to produce uniform and concentrated dextran. Self-assembling enzyme systems are an emerging enzyme engineering technology that can spontaneously assemble enzyme molecules with different functions into multi-enzyme complexes through covalent interactions. This complex structure can increase the local concentration of enzymes, enhance enzyme synergy, and optimize catalytic efficiency through spatial proximity effects. Self-assembling enzyme systems are expected to provide a new and efficient approach for the production of dextran, especially with significant potential in achieving uniform molecular weight distribution. Summary of the Invention

[0011] The present invention aims to provide a method for constructing a self-assembling enzyme for the directed synthesis of low-molecular-weight dextran below 5000 Da and its application. Compared with natural enzymes (single enzyme or a mixture of multiple enzymes such as dual enzyme synergistic catalysis), the construction of a self-assembling enzyme can bring numerous functional and application advantages. In order to obtain products with concentrated molecular weights, reduce costs, be suitable for industrial production, and expand practical application value, the two enzymes involved in the sequential catalytic reaction are efficiently expressed in their respective expression systems through protein engineering, and self-assembled by in vitro incubation. Through this self-assembling enzyme, low-molecular-weight, uniform, and concentrated dextran can be directly obtained in one step of catalysis.

[0012] To achieve the above object, the present invention provides the following technical solutions:

[0013] First, the present invention provides a self-assembling enzyme for the directed synthesis of uniform low-molecular-weight dextran, named YG-SpyTag-SpyCatcher-padex. YG represents the dextransucrase gene (GenBank No. DQ345760), padex represents the dextranase gene (GenBank No. KF999646.1), SpyTag and SpyCatcher represent two specific short peptides, and the aspartic acid in SpyTag spontaneously forms an isopeptide bond with the lysine in SpyCatcher. The present invention utilizes a SpyTag-SpyCatcher protein covalent coupling system to combine dextransucrase derived from the genetically engineered Escherichia coli BL21(DE3)-YG-SpyTag with dextranase derived from the genetically engineered Pichia pastoris X33-SpyCatcher-padex. The resulting self-assembling enzyme can catalyze the direct conversion of the substrate sucrose into dextran with a molecular weight of 3,000-4,000 Da.

[0014] Secondly, the present invention provides a method for constructing the above-mentioned self-assembling enzyme, comprising the following steps:

[0015] (1) The recombinant expression plasmid pET-28a(+)-YG-SpyTag was transformed into Escherichia coli competent cells BL21(DE3). After kanamycin resistance screening, enzyme digestion, bacterial liquid PCR and DNA sequencing verification, the Escherichia coli genetically engineered bacteria BL21(DE3)-YG-SpyTag were obtained;

[0016] (2) The recombinant expression plasmid pPICZαA-SpyCatcher-padex was first linearized by enzyme digestion and then transformed into the genome of Pichia pastoris competent cells X33. After bleomycin resistance screening, bacterial liquid PCR and DNA sequencing verification, the Pichia pastoris genetically engineered bacteria X33-SpyCatcher-padex were obtained.

[0017] (3) Dextran sucrase was expressed by fermenting Escherichia coli BL21(DE3)-YG-SpyTag, and dextranase was expressed by fermenting Pichia pastoris X33-SpyCatcher-padex. The two enzymes were purified separately and then incubated together in 10mM phosphate buffer solution, pH=5-8, at 4-37°C for 10-15h to obtain a self-assembling enzyme capable of directing the synthesis of uniform low-molecular-weight dextran. Among them, incubation in 10mM phosphate buffer solution (pH=6) at 10-20°C for 10-12h was more optimal, while incubation in 10mM phosphate buffer solution (pH=6) at 15°C for 12h was the most optimal.

[0018] The construction method uses the dextransucrase gene YG (Genbank No. DQ345760) and the dextransucrase gene padex (GenBank No. KF999646.1) from Penicillium aculeatus as templates. The dextransucrase gene YG is transformed into competent Escherichia coli BL21 (DE3) cells via homologous recombination. The dextransucrase gene padex from Penicillium aculeatus is linearized into a plasmid and transformed into the genome of Pichia pastoris X33 via homologous recombination. Each is then fermented and expressed. By incubating at 15°C for 12 hours, the self-assembling enzyme YG-SpyTag-SpyCatcher-padex is obtained. YG represents dextransucrase, padex represents dextranase, and SpyTag and SpyCatcher are two specific short peptides. The aspartic acid in SpyTag spontaneously forms an isopeptide bond with the lysine in SpyCatcher.

[0019] In the above-mentioned construction method, specifically, SpyTag and SpyCatcher protein short peptides are used as connecting bridges to carry out primer design, recombinant plasmid construction and host bacteria transformation. The design of SpyTag and SpyCatcher protein short peptides refers to ChenX, Chen X, Zhu L, et al. Efficient production of inulo-oligosaccharides frominulin by exo-and endo-inulinase co-immobilized onto a self-assemblingprotein scaffold[J]. International Journal of Biological Macromolecules,2022, 210: 588-599. SpyTag and SpyCatcher are used as connecting fragments. The schematic diagram of the SpyTag and SpyCatcher structure is shown in FIG. Figure 2 As shown, SpyCatcher is a 113-residue peptide containing Lys31. SpyTag is a 13-residue peptide containing Asp117. These two moieties recognize each other with high affinity, forming an isopeptide bond between SpyCatcher and SpyTag, creating a covalently bound complex. This isopeptide bond is extremely stable and can withstand extreme conditions such as heat, denaturants, and mechanical forces.

[0020] Step (1) The recombinant expression plasmid pET-28a(+)-YG-SpyTag was obtained by designing primers based on the dextran sucrase gene YG and amplifying the DNA by PCR and digesting the original template with DMT enzyme (Quanshijin Co., Ltd.). The details are as follows:

[0021] Dextransucrase YG plasmid was extracted using a plasmid miniprep kit (purchased from Beijing Quanshijin Biotechnology Co., Ltd.). PCR was then performed using the following primers: pre-denaturation at 94°C for 3 minutes, followed by 35 cycles of denaturation at 94°C for 5 seconds, annealing at 60°C for 15 seconds, and extension at 72°C for 2 minutes, followed by extension at 72°C for 5 minutes. After completion of the PCR reaction, the reaction was verified by agarose gel electrophoresis. After positive results were confirmed by agarose gel electrophoresis, the reaction was digested with DMTase (Beijing Quanshijin Biotechnology Co., Ltd.) to remove the methylated template.

[0022] Upstream primer:

[0023] 5'----GGTGGCGGTGGCAGTGCGCACATCGTTATGGTCGATGCATATAAACCCACCAAATAACTCGAGCACCACCACCACCA----3'

[0024] Downstream primer:

[0025] 5'-----CGATGTGCGCACTGCCACCGCCACCGCTACCGCCACCGCCTGCTGACACAGCATTTCCATTATTATCAAATTGGTAAA----3'.

[0026] Step (2) The recombinant expression plasmid pPICZαA-SpyCatcher-padex was obtained by designing primers using the dextranase gene padex and the SpyCatcher gene (PDB ID: 4MLI) from Penicillium aculeatus as templates, and amplifying the plasmid by PCR, digesting the original template with DMT enzyme, and then purifying the original template and then homologous recombination. The details are as follows:

[0027] The SpyCatcher gene was amplified by PCR using the following primers.

[0028] Upstream primer:

[0029] 5'-----TCGAGAAAAGAGAGGCTGAAGCTGAATTCTTCGAAACGATGGCGATGGTGGATACCCTGAGC-----3'

[0030] Downstream primer:

[0031] 5'------GAGCCAAAGTCAACAACTTCAACATAGTAGCGCCGCTGCCGCCCGCTGCCAATATGCGCATCG -----3'.

[0032] Then, the dextranase padex gene was linearized by PCR using the following primers.

[0033] Upstream primer:

[0034] 5'-----GAATTCAGCTTCAGCCTCTTTTCTCGA -----3'

[0035] Downstream primer:

[0036] 5'-----GCTACTATGTTGAAGTTGTTGACTTTGGCTCT-----3'

[0037] The gene fragment SpyCatcher and the linearized padex were then digested and purified with DMT enzyme, ligated using homologous recombination technology, transformed into DH5α competent cells, and single colonies were picked and sequenced for verification.

[0038] Furthermore, on the one hand, by transforming the recombinant expression plasmid pET-28a(+)-YG-SpyTag into Escherichia coli competent cells BL21(DE3), after kanamycin resistance screening, enzyme digestion, bacterial liquid PCR and DNA sequencing verification, a self-assembly enzyme Escherichia coli BL21(DE3)-YG-SpyTag genetically engineered bacterium capable of directing the synthesis of dextran can be obtained. On the other hand, by first linearizing the recombinant expression plasmid pPICZαA-SpyCatcher-padex through enzyme digestion and then transforming it into the genome of Pichia pastoris competent cells X33, after bleomycin resistance screening, bacterial liquid PCR and DNA sequencing verification, a self-assembly enzyme Pichia pastoris X33-SpyCatcher-padex genetically engineered bacterium capable of directing the synthesis of dextran can be obtained.

[0039] In the above-mentioned construction method, preferably, in step (3), the genetically engineered Escherichia coli BL21 (DE3) -YG-SpyTag is fermented to express dextran sucrase, and the method comprises the following steps: the genetically engineered bacteria BL21 (DE3) -YG-SpyTag is inoculated at a volume fraction of 0.5% into LB culture medium containing 40-60 μg / mL kanamycin, the rotation speed is 250 r / min, and the culture is cultured at 37°C for 16 hours; 2 mL of the culture solution is drawn from the above-mentioned culture solution and added to 200 mL of A culture medium, and the culture is placed in a shaking table at 37°C for culture. When the enriched culture solution is diluted 10 times with distilled water, the OD value is600 At 0.20-0.24, 500 μL IPTG (inducer, isopropyl-β-D-thiogalactoside) can be added to start inducing enzyme production, and the fermentation is maintained at 25°C for 3.5-4 hours. The bacterial suspension after induced fermentation is centrifuged at 8000 r / min for 15 minutes at 0°C. One centrifuge tube corresponds to one bottle of bacterial suspension, and then distilled water is added for shaking and washing, and centrifuged again; 15-20 mL of acetic acid-calcium acetate buffer with a pH value of 5.4 is added to each centrifuge tube and shaken to evenly mix, an ice water bath is added, ultrasonically disrupted for 15 minutes, and centrifuged. The supernatant is dextran sucrase with an enzyme activity of 50-80 U / mL. Among them, preferably, each liter of the A culture medium contains 5g glycerol, 5g glucose, 10g peptone, 10g potassium nitrate, 17.105g Na2HPO4·12H2O, 3g KH2PO4, 1g NH4Cl, and 0.1mMMgSO4·7H2O.

[0040] In addition, for the above-mentioned construction method, step (3) is preferably to ferment the genetically engineered Pichia pastoris X33-SpyCatcher-padex to express dextranase, using the following method steps: the genetically engineered bacteria X33-SpyCatcher-padex is inoculated into liquid YPD culture medium at a rate of 0.5%, and cultured at 30°C and 250 r / min for 24 hours. Then, it is inoculated into BMGY culture medium at a rate of 1%, and cultured under the same conditions for 12-24 hours. The bacteria are collected by centrifugation, the culture supernatant is discarded, and the bacteria are resuspended in BMMY culture medium, and finally cultured on a shaker at 25°C and 250 r / min for 5 days. 1% methanol is added every 24 hours for induction. The bacterial suspension after induced fermentation is centrifuged at 0°C and 10,000 r / min for 15 minutes, and the supernatant is collected as dextranase with an enzyme activity of 150-200 U / mL.

[0041] Preferably, each liter of the BMGY medium contains: 1% yeast extract powder, 2% peptone, 100 mM sodium phosphate pH 6.0, 1.34% YNB, 4x10 -5 Preparation: Weigh 20 g of peptone and 10 g of yeast extract powder, dissolve in water, add 100 mL of 1 M sodium phosphate pH 6.0 buffer, and dilute to 800 mL with water. Autoclave at 121°C for 20 min. Add 100 mL of 10% glycerol, 100 mL of 10xYNB, and 2 mL of 500xB. Once prepared, aliquot.

[0042] Preferably, each liter of the BMMY medium contains the following medium formula: 1% yeast extract, 2% peptone, 100 mM sodium phosphate pH 6.0, 1.34% YNB, 4x10-5 Preparation: Weigh 20 g of peptone and 10 g of yeast extract powder, dissolve in water, add 100 mL of 1 M sodium phosphate pH 6.0 buffer, and dilute to 800 mL with water. Autoclave at 121°C for 20 min. Add 100 mL of 10% methanol, 100 mL of 10xYNB, and 2 mL of 500xB. Once prepared, aliquot.

[0043] Preferably, 100 mg / mL Zeocin (bleomycin) is prepared by weighing 100 mg of bleomycin and adding 1 mL of sterile water, filtering through a 0.22 μm microporous filter to sterilize, and storing at -20°C after aliquoting.

[0044] Preferably, 1M sodium phosphate, pH 6.0. Solution A: Weigh 138 g of NaH2PO4 and dissolve it in an appropriate amount of water. After complete dissolution, dilute to 1 L to obtain 1 mol / L NaH2PO4. Solution B: Weigh 142 g of Na2HPO4 and dissolve it in an appropriate amount of water. After complete dissolution, dilute to 1 L to obtain 1 mol / L Na2HPO4. Mix 877 mL of Solution A with 133 mL of Solution B to obtain a 1M sodium phosphate buffer solution, pH 6.0.

[0045] Preferably, 10xYNB: weigh 134 g YNB (yeast nitrogen base) and dissolve it in 1000 mL water, filter and sterilize it with a 0.22 μm sterile filter, and store it at 4° C. The shelf life is 1 year.

[0046] Preferably, 500xB: Weigh 20 mg of biotin and dissolve it in 100 mL of water. Sterilize it by filtration using a 0.22 μm sterile filter. The product can be stored at 4° C. for one year.

[0047] Preferably, 10% glycerol: 10 mL glycerol is mixed with 90 mL water, filtered and sterilized or autoclaved, and stored at room temperature. The shelf life is more than one year.

[0048] Preferably, 10% methanol: 10 mL of anhydrous methanol is mixed with 90 mL of water, filtered through a sterile 0.22 μm microporous filter, and can be stored at 4°C for about two months.

[0049] The present invention provides a genetically engineered bacterium capable of directing the synthesis of low-molecular-weight dextran. Through fermentation expression, a self-assembly enzyme is obtained through in vitro self-assembly, enabling its application in the preparation of uniform low-molecular-weight dextran. The method involves fermenting the engineered Escherichia coli strain BL21(DE3)-YG-SpyTag to express dextransucrase, and simultaneously fermenting the engineered yeast strain X33-SpyCatcher-padex to express dextranase. Both enzymes are then purified separately and incubated in 10 mM phosphate buffer (pH 6) at 15°C for 12 hours to obtain the self-assembly enzyme that produces uniform low-molecular-weight dextran. Sucrose is then used as a substrate for direct synthesis of low-molecular-weight dextran through the bifunctional catalysis of the self-assembly enzyme. Preferably, dextran with a weight-average molecular weight of 3000-4000 Da can be obtained.

[0050] Compared with the prior art, the present invention has the following beneficial effects:

[0051] (1) The dextran synthesized by the self-assembled enzyme obtained by in vitro self-assembly of the enzyme solution obtained by induced expression of the genetically engineered bacteria constructed by the present invention has a concentrated molecular weight and a high conversion rate, and is simple to separate and purify. Under the same conditions, the yield calculation found that the dextran constructed by the present invention directly converts most of the sucrose into dextran with a molecular weight of 3000-4000Da.

[0052] (2) Under the same conditions and reaction time, the self-assembled enzyme obtained by self-assembly after expression by the engineered bacteria has a more concentrated molecular weight than the synergistic catalytic product of the dual-enzyme free enzyme (the synergistic catalytic product system of the dual-enzyme free enzyme contains heterogeneous sugar anhydrides with molecular weights of 30,000 Da, 20,000 Da and 10,000 Da).

[0053] (3) The present invention can specifically produce dextran 3000-4000Da, simplifying the separation and purification steps, reducing production costs, and providing a certain basis for better application in production. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] Figure 1 is a diagram of the construction of dextransucrase and dextranase plasmids of the present invention; (a) YG-SpyTag (b) SpyCatcher-padex;

[0055] Figure 2 Schematic diagram of the structure of SpyCatcher and SpyTag of the present invention; (a) SpyCatcher (b) SpyTag;

[0056] Figure 3 This is an SDS-PAGE image of the purified self-assemblyase protein of the present invention;

[0057] Figure 4 is a diagram of the catalytic mechanism of the present invention; (a) schematic diagram of self-assembly catalysis (b) schematic diagram of dual-enzyme catalysis;

[0058] Figure 5 This is an HPLC chart of the molecular weight of the dextran product of the present invention; in the figure, the ordinate represents the peak height, that is, the content, and the abscissa represents the peak time, which also represents the molecular weight;

[0059] Figure 6 This is a one-dimensional hydrogen spectrum of the product dextran of the present invention;

[0060] Figure 7 This is a two-dimensional spectrum of the product dextran of the present invention;

[0061] Figure 8 This is the Fourier transform infrared spectrum of the product dextran of the present invention. DETAILED DESCRIPTION

[0062] The following embodiments are further descriptions of the present invention to illustrate the technical content of the present invention, but the essential content of the present invention is not limited to the following embodiments. Ordinary technicians in this field can and should know that any simple changes or replacements based on the essential spirit of the present invention should fall within the scope of protection required by the present invention.

[0063] Example 1

[0064] Construction of a self-assembly enzyme genetically engineered bacteria BL21(DE3)-YG-SpyTag and X33-SpyCatcher-padex for the directional synthesis of uniform low molecular weight dextran.

[0065] Using the dextransucrase gene YG as a template, PCR, digestion, and transformation into BL21(DE3) Escherichia coli were used to generate the self-assembling enzyme E. coli BL21(DE3)-YG-SpyTag, capable of directing the synthesis of uniform low-molecular-weight dextran. The Pichia pastoris X33-SpyCatcher-padex engineered strain was generated by PCR, digestion, purification, homologous recombination, and plasmid linearization using the SpyCatcher and dextranase gene padex as templates, respectively. Primers were designed using SnapGene software based on the dextransucrase gene YG, SpyCatcher, and dextranase gene padex sequences.

[0066] For dextransucrase:

[0067] The dextran sucrase YG plasmid was extracted using a plasmid mini-extraction kit (purchased from Beijing Quanshijin Biotechnology Co., Ltd.), and then PCR was performed using the following primers. The PCR conditions were: 94°C pre-denaturation for 3 minutes; 94°C denaturation for 5 seconds, 60°C annealing for 15 seconds, and 72°C extension for 2 minutes, 35 cycles; and 72°C extension for 5 minutes. After the PCR reaction was completed, it was detected by agarose gel electrophoresis. After the agarose nucleic acid electrophoresis detection was correct, DMT enzyme (Beijing Quanshijin Biotechnology Co., Ltd.) was used for digestion to remove the methylated template. Plasmid construction is as follows Figure 1a shown.

[0068] Upstream primer:

[0069] 5'--GGTGGCGGTGGCAGTGCGCACATCGTTATGGTCGATGCATATAAACCCACCAAATAACTCGAGCACCACCACCACCA--3'

[0070] Downstream primer:

[0071] 5'--CGATGTGCGCACTGCCACCGCCACCGCTACCGCCACCGCCTGCTGACACAGCATTTCCATTATTATCAAATTGGTAAA--3'.

[0072] For dextranase:

[0073] The SpyCatcher gene (PDB ID: 4MLI) was amplified by PCR using the following primers. PCR conditions were: 94°C denaturation for 3 min, 35 cycles of 94°C denaturation for 5 s, 60°C annealing for 15 s, and 72°C extension for 2 min, followed by 72°C extension for 5 min.

[0074] Upstream primer:

[0075] 5'-TCGAGAAAAGAGAGGCTGAAGCTGAATTCTTCGAAACGATGGCGATGGTGGATACCCTGAGC -3'

[0076] Downstream primer:

[0077] 5'--GAGCCAAAGTCAACAACTTCAACATAGTAGCGCCGCTGCCGCCCGCTGCCAATATGCGCATCG --3'.

[0078] The dextranase padex gene was then linearized by PCR using the following primers. PCR conditions were: 94°C denaturation for 3 min, 35 cycles of 94°C denaturation for 5 s, 60°C annealing for 15 s, and 72°C extension for 2 min, followed by 72°C extension for 5 min.

[0079] Upstream primer:

[0080] 5'-GAATTCAGCTTCAGCCTTCTTTCTCGA-3'

[0081] Downstream primer:

[0082] 5'-GCTACTATGTTGAAGTTGTTGACTTTGGCTCT-3'

[0083] The gene fragment SpyCatcher and the linearized padex were then digested and purified with DMT enzyme, and then connected by homologous recombination technology, transformed into E. coli DH5α competent cells, and single colonies were picked and sequenced for verification. Figure 1b As shown. The reaction system used for ligation is a homologous recombination system. Preferably: 2 μL of purified first PCR product; 1 μL of purified second PCR product; 5 μL of 2× Basic Assembly Premix Mix. The reaction system is made up to 10 μL with ultrapure water. Ligation procedure: Gently mix the above reaction system, incubate at 50°C for 30 minutes, and then place on ice to obtain the ligation product. Transform the ligation product into E. coli DH5α competent cells, add 500 μL of LLB liquid medium, and incubate at 37°C, 220 rpm for 1 hour. Spread 50 μL of the bacterial solution onto a solid LLB plate containing 100 μg / mL bleomycin antibiotic and incubate overnight at 37°C. Pick positive colonies for PCR identification and send the positive bacterial solution to a universal biosequencing company for sequencing.

[0084] Host strain I transformation involves transforming the recombinant expression plasmid pET-28a(+)-YG-SpyTag into competent E. coli cells BL21(DE3). After kanamycin resistance screening, enzyme digestion, bacterial solution PCR, and DNA sequencing verification, a self-assembling enzyme-producing E. coli engineered bacteria BL21(DE3)-YG-SpyTag suitable for the directed synthesis of uniform low-molecular-weight dextran is obtained. Specifically, host strain I transformation includes the following steps:

[0085] (1) Take 100 μL of Escherichia coli BL21 (DE3) competent cell suspension (purchased from Beijing Quanshijin Biotechnology Co., Ltd.) from a -80°C freezer and thaw on ice;

[0086] (2) Add the prepared recombinant expression plasmid, adding approximately 5 μL of pET-28a(+)-YG-SpyTag plasmid per 50 μL of competent cells, gently shake, and place on ice for 30 minutes;

[0087] (3) Heat shock in a 42°C water bath for 45 seconds, followed by rapid cooling on ice for 2 minutes;

[0088] (4) Add 500 μL of sterilized LB liquid medium (without antibiotics) to the tube, mix well, and incubate at 37°C for 1 hour to allow the bacteria to return to normal growth;

[0089] (5) After the bacterial solution is shaken, 100 μL is spread on a screening plate containing kanamycin (100 μg / mL) and placed with the front side facing up for half an hour. When the bacterial solution is completely absorbed by the culture medium, the culture medium is inverted and cultured at 37°C for 16 to 18 hours; positive colonies are selected and verified by PCR of the bacterial solution to obtain the self-assembling enzyme Escherichia coli engineered bacteria BL21(DE3)-YG-SpyTag that can synthesize uniform low-molecular-weight dextran in a directed manner.

[0090] Host strain II transformation involves transforming the recombinant expression plasmid pPICZαA-SpyCatcher-padex into Pichia pastoris X33 competent cells. The recombinant plasmid is first linearized with SacⅠ endonuclease, followed by bleomycin resistance screening and DNA sequencing verification to obtain the genetically engineered Pichia pastoris X33-SpyCatcher-padex strain, which produces a self-assembling enzyme suitable for the directed synthesis of uniform low-molecular-weight dextran. Specifically, Host strain II transformation includes the following steps:

[0091] (1) Thaw the cryopreserved X33 competent cells on ice and let them stand for 5-6 minutes until they are completely thawed. Immediately add 10 μL of the linearized recombinant plasmid pPICZαA-SpyCatcher-padex and let it stand on ice for about 2 minutes.

[0092] (2) Preheat the electroporation instrument for 30 min, add the competent cells into the electroporation cup, and perform electroporation: voltage 2500 V, time 4.5 ms;

[0093] (3) Remove the cuvette and immediately add 1 mL of ice-cold 1 M sorbitol solution to rinse the yeast cells in the cuvette. Transfer the cells to a centrifuge tube and incubate at 30°C and 250 rpm for 1 h.

[0094] (4) Centrifuge the cultured cells at 4000 × g for 2 min, remove 900 μL of supernatant with a pipette, and resuspend the cells in the remaining culture medium;

[0095] (5) All the bacteria were spread on a YPD plate containing 100 μg / mL bleomycin resistance, cultured in an inverted manner at 30°C for 3-5 days, and the growth of the bacteria on the culture medium was observed.

[0096] Example 2

[0097] Expression of the self-assembling enzyme Escherichia coli genetically engineered bacteria BL21 (DE3)-YG-SpyTag that can direct the synthesis of uniform low molecular weight dextran.

[0098] The genetically engineered bacteria BL21 (DE3) -YG -SpyTag obtained in Example 1 was inoculated into LB medium containing 40-60 μg / mL kanamycin at a rate of 0.5%, and cultured at 37 ° C for 16 hours at a speed of 250 r / min; 2 mL of the culture solution was taken out and added to 200 mL of medium A, and cultured on a shaking table at 37 ° C. When the enriched culture solution was diluted 10 times with distilled water, the OD 600 At 0.20-0.24°C, 500 μL IPTG can be added to initiate enzyme induction. After induction fermentation at 25°C for 3.5-4 hours, crushing and centrifugation are performed. Maintain induction fermentation at 25°C for 3.5-4 hours. The bacterial suspension obtained after induction fermentation is centrifuged at 8000 rpm for 15 minutes at 4°C. One centrifuge tube corresponds to one bottle of bacterial suspension. Then, distilled water is added and shaken to wash, and centrifuged again. 15-20 mL of acetic acid-calcium acetate buffer with a pH of 5.4 is added to each centrifuge tube and shaken to mix. Add an ice-water bath, ultrasonically crush for 15 minutes, and centrifuge to separate. The supernatant is dextran sucrase with an enzyme activity of 50-80 U / mL. Each liter of the culture medium A contains 5 g glycerol, 5 g glucose, 10 g peptone, 10 g potassium nitrate, 17.105 g Na2HPO4·12H2O, 3 g KH2PO4, 1 g NH4Cl, and 0.1 mM MgSO4·7H2O.

[0099] Example 3

[0100] Expression of the self-assembling enzyme Pichia pastoris X33-SpyCatcher-padex, which can direct the synthesis of uniform low molecular weight dextran.

[0101] The genetically engineered bacteria X33-SpyCatcher-padex obtained in Example 1 was inoculated into YPD medium containing 100 μg / mL bleomycin at a 0.5% inoculum size and cultured at 30°C and 250 r / min for 24 hours. Subsequently, it was inoculated into BMGY medium at a ratio of 1% and cultured under the same conditions for 12-24 hours. The bacteria were collected by centrifugation, the culture supernatant was discarded, and the bacteria were resuspended in BMMY medium and finally cultured on a shaker at 25°C and 250 r / min for 5 days. 1% methanol was added every 24 hours for induction. The bacterial suspension after induced fermentation was centrifuged at 0°C and 10,000 r / min for 15 minutes, and the supernatant was collected as dextranase with an enzyme activity of 150-200 U / mL.

[0102] Each liter of the BMGY medium contains: 1% yeast extract powder, 2% peptone, 100 mM sodium phosphate pH 6.0, 1.34% YNB, 4x10 -5 Preparation: Weigh 20 g of peptone and 10 g of yeast extract powder, dissolve in water, add 100 mL of 1 M sodium phosphate pH 6.0 buffer, and dilute to 800 mL with water. Autoclave at 121°C for 20 min. Add 100 mL of 10% glycerol, 100 mL of 10xYNB, and 2 mL of 500xB. Once prepared, aliquot.

[0103] Each liter of the BMMY medium contains the following culture medium formula: 1% yeast extract, 2% peptone, 100 mM sodium phosphate pH 6.0, 1.34% YNB, 4x10 -5 Preparation: Weigh 20 g of peptone and 10 g of yeast extract powder, dissolve in water, add 100 mL of 1 M sodium phosphate pH 6.0 buffer, and dilute to 800 mL with water. Autoclave at 121°C for 20 min. Add 100 mL of 10% methanol, 100 mL of 10xYNB, and 2 mL of 500xB. Once prepared, aliquot.

[0104] Example 4

[0105] The applications of the self-assembling enzyme that can direct the synthesis of uniform dextran 3000-4000Da are as follows:

[0106] The dextran sucrase and dextranase obtained by the methods of Example 2 and Example 3 were purified and incubated at a molar ratio of 1:1 in 10 mM phosphate buffer solution (pH = 6) at 15 ° C for 12 h. After incubation, a self-assembling enzyme was obtained, which was verified by SDS-PAGE. Figure 3 As shown, Figure 3 In the figure, lanes 1-4 are all purified self-assembly enzymes with a protein size of 250 KDa.

[0107] The catalytic reaction was carried out with sucrose as the substrate. The enzyme reaction system was prepared as follows: 300mM sucrose, acetic acid-calcium acetate buffer (pH=5.4), and a reaction system of a self-assembling enzyme with an enzyme activity of 5U / mL. The catalytic schematic diagram is shown in Figure 4. The reaction was carried out on a shaker at 30°C and 150-180r / min for 6-8 hours. The reaction liquid was taken out and boiled at high temperature to inactivate the self-assembling enzyme in the system, terminate the reaction, and collect the supernatant by centrifugation. The fructose and residual sucrose in the reaction liquid were then dialyzed out using a 500Da dialysis bag, and the product was dried. The dried product was detected by differential liquid chromatography. The detection conditions were: GPC column, differential detector, pure water as the mobile phase, flow rate of 0.6mL / min, and high performance liquid chromatography detection as follows. Figure 5 , the GPC column standard curve fitting showed that the self-assembly enzyme catalysis product was dextran with a weight average molecular weight of 3500Da. One-dimensional hydrogen spectrum analysis and characterization of the product dextran, such as Figure 6 shown. 1 The proton peak at around 4.98 ppm in the H NMR spectrum confirms the presence of α-1,6 glycosidic bonds on the dextran backbone, while the proton peak at 5.25 ppm indicates that the branched glycosidic bonds of dextran are α-1,3 glycosidic bonds. Reference: Li MQ, Zhang HB, Li Y, Hu XQ, Yang JW: The thermoduric effects of site-directed mutagenesis of proline and lysine ondextransucrase from Leuconostoc mesenteroides0326[J]. International Journal of Biological Macromolecules 2018, 107(Pt B): 1641-1649. The 1H-1H COSY NMR spectrum reveals the order of proton connections in the molecule, and the two-dimensional NMR spectrum is shown in Figure 2. Figure 7 shown.

[0108] After infrared characterization of the sugar anhydride product, the results are as follows Figure 8 As shown in Figure 2, the sharp peak at 1005 cm⁻¹ indicates the presence of an α-1,6 glycosidic bond in the sample; the stretching vibration peaks at 917 cm⁻¹ and 763 cm⁻¹ indicate a pyranose ring configuration in the product's sugar ring; and the absorption peak at 843 cm⁻¹ indicates an α-type anomeric carbon configuration in the dextran product. Compared to commercial dextran, the obtained product possesses the same functional groups and anhydroglucose bond type.

[0109] It should be noted that the technical contents of the present invention described above are only for the purpose of explaining and illustrating the technical essence of the present invention to enable those skilled in the art to understand the technical essence of the present invention. Therefore, the technical contents described above are not intended to limit the substantial protection scope of the present invention. The substantial protection scope of the present invention shall be based on the claims. Those skilled in the art should be aware that any modifications, equivalent substitutions, and improvements based on the substantial spirit of the present invention shall fall within the substantial protection scope of the present invention.

Claims

1. A self-assembling enzyme for the directed synthesis of uniform low-molecular-weight dextran, named YG-SpyTag-SpyCatcher-padex, is obtained by combining dextran sucrase expressed by fermentation of Escherichia coli genetically engineered bacteria BL21(DE3)-YG-SpyTag with dextranase expressed by fermentation of Pichia pastoris genetically engineered bacteria X33-SpyCatcher-padex via a SpyTag-SpyCatcher protein covalent coupling system; wherein: YG is the dextran sucrase gene of Genbank No. DQ345760, padex is the dextranase gene of GenBank No. KF999646.1, SpyTag and SpyCatcher are two specific short peptides, and the aspartic acid in SpyTag spontaneously forms an isopeptide bond with the lysine in SpyCatcher. The Escherichia coli genetically engineered bacteria BL21 (DE3)-YG-SpyTag is obtained by transforming the recombinant expression plasmid pET-28a (+) -YG-SpyTag into Escherichia coli competent cells BL21 (DE3) and screening for kanamycin resistance. The Pichia pastoris genetically engineered bacteria X33-SpyCatcher-padex is obtained by first linearizing the recombinant expression plasmid pPICZαA-SpyCatcher-padex with enzymes, then transforming it into Pichia pastoris competent cells X33, and screening for bleomycin resistance.

2. The method for constructing the self-assembling enzyme according to claim 1, comprising the following steps: (1) The recombinant expression plasmid pET-28a(+)-YG-SpyTag was transformed into Escherichia coli competent cells BL21(DE3). After kanamycin resistance screening, enzyme digestion, bacterial liquid PCR and DNA sequencing verification, the Escherichia coli genetically engineered bacteria BL21(DE3)-YG-SpyTag were obtained; (2) The recombinant expression plasmid pPICZαA-SpyCatcher-padex was first linearized by enzyme digestion and then transformed into the genome of Pichia pastoris competent cells X33. After bleomycin resistance screening, bacterial liquid PCR and DNA sequencing verification, the Pichia pastoris genetically engineered bacteria X33-SpyCatcher-padex were obtained; (3) The genetically engineered Escherichia coli BL21(DE3)-YG-SpyTag was fermented to express dextran sucrase, and the genetically engineered Pichia pastoris X33-SpyCatcher-padex was fermented to express dextran. The two enzymes were purified separately and then incubated together in 10 mM, pH 5-8 phosphate buffer solution at 4-37°C for 10-15 h to obtain a self-assembling enzyme that can synthesize uniform low molecular weight dextran.

3. The construction method according to claim 2, wherein: Step (1) The recombinant expression plasmid pET-28a(+)-YG-SpyTag is obtained by designing primers based on the dextran sucrase gene YG and digesting the original template with DMT enzyme through PCR amplification technology.

4. The construction method according to claim 2, wherein: Step (2) The recombinant expression plasmid pPICZαA-SpyCatcher-padex is obtained by designing primers using the dextranase gene padex and SpyCatcher gene from Penicillium aculeatus as templates, and amplifying the plasmid by PCR, digesting the original template with DMT enzyme, and then purifying the original template and obtaining the plasmid by homologous recombination.

5. The construction method according to claim 2, wherein: Step (3) fermenting the genetically engineered Escherichia coli BL21 (DE3)-YG-SpyTag to express dextran sucrase, using the following method steps: The genetically engineered bacteria BL21 (DE3)-YG-SpyTag was inoculated into LB medium containing 40-60 μg / mL kanamycin at a volume fraction of 0.5%, and cultured at 37°C for 16 hours at a speed of 250 r / min. 2 mL of the culture solution was taken out and added to 200 mL of medium A, and the culture was placed in a shaking incubator at 37°C. When the enriched culture solution was diluted 10 times with distilled water, the OD 600 At 0.20-0.24, 500 μL IPTG can be added to start inducing enzyme production, and the fermentation temperature is maintained at 25°C for 3.5-4 hours. The bacterial suspension after induced fermentation is centrifuged at 8000 rpm for 15 minutes at 0°C. One centrifuge tube corresponds to one bottle of bacterial suspension. Then, distilled water is added for washing by shaking and centrifugation again. 15-20 mL of acetic acid-calcium acetate buffer with a pH value of 5.4 is added to each centrifuge tube and shaken to mix well. An ice-water bath is added, ultrasonically disrupted for 15 minutes, and centrifuged. The supernatant is dextran sucrase with an enzyme activity of 50-80 U / mL. Each liter of the A medium contains 5 g glycerol, 5 g glucose, 10 g peptone, 10 g potassium nitrate, 17.105 g Na2HPO4·12H2O, 3 g KH2PO4, 1 g NH4Cl, and 0.1 mM MgSO4·7H2O.

6. The construction method according to claim 2, wherein: Step (3) fermenting the genetically engineered Pichia pastoris X33-SpyCatcher-padex to express dextranase, using the following method steps: The genetically engineered bacteria X33-SpyCatcher-padex was inoculated into YPD medium containing bleomycin at a 0.5% inoculum size and cultured at 30°C and 250 r / min for 24 hours; then, it was inoculated into BMGY medium at a 1% ratio and cultured under the same conditions for 12-24 hours; the bacteria were collected by centrifugation, the culture supernatant was discarded, and the bacteria were resuspended in BMMY medium and finally cultured on a shaker at 25°C and 250 r / min for 5 days; 1% methanol was added every 24 hours for induction; the induced fermentation bacterial suspension was centrifuged at 0°C and 10,000 r / min for 15 minutes, and the supernatant was collected as dextranase with an enzyme activity of 150-200 U / mL.

7. Use of the self-assembling enzyme according to claim 1 or obtained by the construction method according to any one of claims 2 to 6 in catalyzing the conversion of sucrose to low molecular weight dextran.

8. The use according to claim 7, characterized in that The low molecular weight dextran has a molecular weight of 3000-4000 Da.

Images