Functional marker for identifying gummy stem blight resistance of muskmelon and application of functional marker

Abstract

The invention discloses a functional marker for identifying muskmelon gummy stem blight resistance, the functional marker is an InDel molecular marker, the sequence of the functional marker is a nucleotide sequence fragment as shown in SEQ ID NO: 1, and the marker is located in a muskmelon gummy stem blight resistance gene CDS region and is co-separated from the muskmelon gummy stem blight resistance gene; the invention also discloses a method for identifying the resistance of muskmelon gummy stem blight by using the InDel molecular marker. The method can be used for identifying muskmelon gummy stem blight resistant germplasm materials, and has important application value in muskmelon gummy stem blight resistant breeding and functional marker-assisted selection.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular marker-assisted breeding, and particularly relates to an InDel molecular marker for identifying resistance to melon vine blight and an application thereof. Background Art

[0002] melon( Cucumismelo L.) belongs to the Cucurbitaceae family (Cucurbitaceae) Cucumis ) is an annual climbing herb in the horticultural industry and is widely planted around the world. According to the United Nations Food and Agriculture Organization database (FAOSTAT), from 2016 to 2022, my country's melon planting area accounted for 36.87% of the global melon planting area. In 2022, my country's melon production reached 14.253 million tons, accounting for 49.9% of the global total production.

[0003] Gummy stem blight (GSB) is one of the major fungal diseases that harm melons. Didymella bryoniae ), which occurs widely in both open-field and facility melon cultivation, and becomes increasingly serious with the expansion of facility cultivation areas. Vine blight can harm all organs of the aboveground part of the melon. In the early stage of leaf infection, yellow-brown "V"-shaped spots with unclear rings appear on the leaf margins, and the entire leaf dies in the later stage. When the disease first occurs at the base of the stems and vines, oval sunken spots appear. In the later stage, the diseased part gradually dries up and shrinks, the epidermis becomes grayish white, and the diseased part is easy to crack. In severe cases, the entire plant loses water, wilts, and dies. Vine blight seriously affects the yield and quality of melons, significantly reduces the planting benefits of melons, and restricts the development of the melon industry.

[0004] The application of chemical agents is currently the main method for preventing and controlling melon vine blight, but it is costly and causes great environmental pollution. The use of large amounts of fungicides not only causes huge pollution to the ecological environment, but also accelerates the mutation of pathogenic bacteria, leading to drug resistance in pathogens. Analyzing the resistance mechanism of melon vine blight, exploring resistance genes, and using these genes to breed vine blight-resistant varieties are the safest, most economical, and most environmentally friendly measures to prevent and control melon vine blight.

[0005] With the continuous development of molecular biology and sequencing technology, the development of molecular marker technology is very rapid. The efficiency of transferring disease-resistant traits using traditional breeding methods is low, and the disease-resistant breeding cycle is long. The use of functional marker-assisted selection breeding technology can overcome the limitations of traditional breeding methods, significantly improve breeding efficiency, achieve accurate selection of disease-resistant genes, and greatly reduce breeding costs. As a genetic marker, InDel markers can detect inserted or deleted bases through methods such as PCR amplification and sequencing. The technology is mature and the operation is relatively simple. In contrast, SSR markers are prone to replication slippage during PCR amplification, making it more likely to fail in amplification or produce non-specific products. At the same time, the physical distance between SSR linkage markers and disease-resistant genes is far, and the linkage relationship is easily interrupted, resulting in uncertainty in assisted selection. Summary of the invention

[0006] In view of the problems that phenotypic identification in melon vine blight resistance breeding is easily affected by the environment, and the selection of disease-resistant materials is time-consuming and labor-intensive, the present invention provides a molecular marker and method for phenotypic identification of melon vine blight resistance.

[0007] The disease-resistant material 'MG016' carries a dominant gene for resistance to vine blight ， However, the gene has not been cloned and no molecular markers have been developed to co-segregate with it. Based on this, the applicant used high-throughput sequencing technology and bioinformatics analysis, combined with BSA and fine positioning, to clone the melon vine blight resistance candidate gene for the first time, and the applicant named it CmGSBWY Gene. The gene fragment is about 3kb in size and contains a complete open reading frame (ORF). In the disease-resistant material 'MG016', when the gene was silenced using the virus-induced gene silencing (VIGS) technology, the disease-resistant material showed susceptible to the disease, further proving that the gene is a resistance gene to melon vine blight. At present, the sequence of the gene has not been made public, and the applicant is conducting stable overexpression experiments and further functional verification analysis on it.

[0008] One of the purposes of the present invention is to provide a gene for resistance to melon vine blight CmGSBWY The functional marker in the coding region sequence is an InDel molecular marker, and its nucleotide sequence is shown in SEQ ID NO.1, a total of 102 bp. In the marker sequence, the susceptible parent has a 6 bp base insertion mutation relative to the resistant parent. Specifically, the InDel molecular marker is a melon vine blight resistance gene CmGSBWY The marker in the sequence is co-segregated with the gene. The molecular marker can be used to effectively distinguish the resistance of strains to vine blight in the segregating population, thus providing an efficient genetic tool for molecular breeding of disease-resistant melons.

[0009] The second object of the present invention is to provide a primer for amplifying the InDel molecular marker, which includes an upstream primer and a downstream primer, and its nucleotide sequence is shown as SEQ ID NO.2 and SEQ ID NO.3. The primer can be used to identify the resistance of melon germplasm to vine blight.

[0010] The third object of the present invention is to provide the application of the InDel molecular marker or its primer in the identification of melon vine blight resistance phenotype and variety breeding.

[0011] A fourth object of the present invention is to provide a kit for identifying the phenotype of melon vine blight resistance and breeding varieties, wherein the kit comprises the primers.

[0012] A fifth object of the present invention is to provide a method for identifying the phenotype of melon vine blight resistance and breeding the varieties, the method comprising the following steps: (1) Extracting genomic DNA from melon; (2) using the genomic DNA extracted in step (1) as a template and performing PCR amplification using the primers described above; (3) The amplified product of step (2) is subjected to gel electrophoresis to identify the resistance to melon vine blight based on the size of the bands.

[0013] The PCR amplification system is 1µL, upstream and downstream primers (10µmol / L), 1µL DNA template (50-150ng / µL), 4µL 2 × TaqMasterMix (DyePlus), and ddH2O is added to 10µL.

[0014] The PCR reaction procedure is as follows: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 45 s, a total of 34 cycles, extension at 72°C for 10 min, and storage at 4°C.

[0015] Specifically, the banding pattern of the PCR amplification product was recorded, and the resistance to melon vine blight was determined based on the fragment size. The judgment principle was as follows: (1) The band sizes amplified by the molecular marker primers in the resistant parent and the susceptible parent were significantly different; (2) When the molecular marker primer is used to amplify melon germplasm, if a specific band of the same size as that of the disease-resistant parent appears, that is, a fragment of 102 bp is amplified, then the strain is disease-resistant; (3) When the molecular marker primers are used to amplify melon germplasm, if only a specific band of the same size as that of the susceptible parent appears, that is, only a fragment of 108 bp is amplified, then the strain is susceptible.

[0016] The beneficial effects of the present invention are: The present invention uses the BSA method combined with the fine positioning method to locate and clone the vine blight resistance gene CmGSBWY ,according to CmGSBWY Based on the sequence differences of genes between resistant and susceptible parents, a new molecular marker for melon vine blight resistance gene was developed. This marker can effectively distinguish the resistance phenotype of melon vine blight. At the same time, this marker is the first one from a vine blight resistance gene in China and abroad. CmGSBWY Functional markers in the coding region can be used to directly select disease-resistant genes, thereby achieving accurate selection of disease-resistant phenotypes.

[0017] The identification result of the invention is accurate and reliable, and can be used for the early screening of melon vine blight-resistant germplasm, shortening the breeding period, and improving breeding efficiency. It also has the advantages of convenient and rapid detection and is not affected by environmental factors. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 It is the result of PCR amplification of molecular marker primers in F2 population; Marker, melon vine blight resistant parent 'MG016', melon vine blight susceptible parent 'S28', F1 generation individual plant, and F2 population individual plant with determined phenotype are marked respectively. The band with phenotype of disease resistance is consistent with the disease-resistant parent or F1 generation individual plant; the band with phenotype of disease sensitivity is consistent with the disease-susceptible parent. Among them, R represents individual plant with phenotype of disease resistance, and S represents individual plant with phenotype of disease sensitivity.

[0019] Figure 2 This is a partial phenotype diagram of the disease-resistant and susceptible F2 plants. R represents a plant with a disease-resistant phenotype, and S represents a plant with a disease-susceptible phenotype. DETAILED DESCRIPTION

[0020] The present invention is further described in detail below in conjunction with specific examples. The following examples are only illustrative of the present invention, but not limiting. The various experimental operations involved in the examples are routine operations in the art that are not described in detail. For the parts not specifically described in the text, ordinary technicians in the art can refer to various commonly used reference books, scientific and technological literature or related instructions, manuals, etc. to implement them. In this study, the disease-resistant parent 'MG016' is a germplasm resource introduced from abroad, and the disease-susceptible parent 'S28' is a domestic local variety, which is currently stored in the College of Horticulture and Forestry of Huazhong Agricultural University and can be provided to the outside.

[0021] Example 1 Based on the melon vine blight resistance gene CmGSBWY Development of InDel molecular markers based on sequence differences in susceptible materials This example provides an InDel molecular marker co-segregated with a melon vine blight resistance gene. The primer sequences of the InDel molecular marker are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0022] Forward primer: 5'-GGGAACAGAGACGTAGAAGA-3' (SEQ ID NO. 2) Reverse primer: 5'-ATCCCTACCTCTGTCTCTGT-3' (SEQ ID NO. 3) The design method of the primers is as follows: CmGSBWY The sequence difference of the gene in the resistant and susceptible materials was selected. The InDel site was checked using the tview command of the Samtools software to see whether there was a significant sequence difference between the two parents (the resistant parent was the wild species of melon 'MG016', and the susceptible parent was 'S28') and at the site. The faidx command in the Samtools software was used to intercept the base sequence of 200 bp before and after the InDel site from the reference genome. Primers were designed using the Primer3 online website (https: / / primer3.ut.ee / ), with a primer length of 20-24 bp, a PCR product size of 100-200 bp, and a Tm value of 52-57℃.

[0023] In this study, a 6bp base insertion mutation occurred in the susceptible parent relative to the resistant parent at the InDel site.

[0024] InDel marker sequence of disease-resistant parent: >MG016 GGGAACAGAGACGTAGAAGATGATCGATATAGGGACAGGGCAGGGGACAGAGGAAGAGACAGAGATAGAGACAGAGACAGAGACAGAGACAGAGGTAGGGAT InDel marker sequence of susceptible parent: >S28 GGGAACAGAGACGTAGAAGATGATCGATATAGGGACAGGGCAGGGGACAGAGGAAGAGACAGAGATAGAGA TAGAGA CAGAGACAGAGACAGAGACAGAGGTAGGGAT Example 2 Using CmGSBWY Screening of melon germplasm resources resistant to vine blight using InDel molecular markers in coding regions The molecular markers in Example 1 were used to screen for melon germplasm resources with resistance to vine blight. The specific implementation method is as follows: 1. PCR amplification and electrophoresis detection (1) Extract genomic DNA of the sample to be tested using the CTAB method; (2) Using the genomic DNA obtained in step (1) as a template, PCR amplification was performed using the molecular marker primers in Example 1. PCR amplification system: 1 µL upstream and downstream primers (10 µmol / L), 1 µL DNA template (50-150 ng / µL), 4 µL 2 × TaqMasterMix (DyePlus), and ddH2O to make up to 10 µL. The PCR reaction program was: 94°C pre-denaturation for 3 min, 94°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 45 s, a total of 34 cycles, 72°C extension for 10 min, and storage at 4°C. The obtained amplified product was detected by electrophoresis using 8% polyacrylamide gel, with a voltage of 200 V, a current of 200 mA, a power of 36 W, and an electrophoresis time of 80 min. Finally, the product was silver stained with 2% AgNO3 solution for color development. Among them, the preparation method of 8% polyacrylamide gel is: 24mL30% Acr-Bis (acrylamide-methylene bisacrylamide), 16 mL 5×TBE, 800µL10% APS (ammonium persulfate), 64 µL coagulant TEMED, and dilute to 80 mL with ultrapure water.

[0025] 2. F2 population construction The susceptible material 'S28' was selected, which is a local specialty variety in my country. It has strong growth, large fruits and good quality, but it is susceptible to vine blight. The wild melon species 'MG016', which is resistant to vine blight, has small fruits, sour flavor and low edible value, but is resistant to vine blight. CmGSBWY In the early stage of the experiment, 'S28' was used as the female parent and 'MG016' as the male parent to obtain F1, and the F1 was self-pollinated to obtain multiple F2 populations.

[0026] 3. Identification of resistance to vine blight in individual F2 populations based on phenotypes In order to verify the accuracy of the developed InDel molecular marker in identifying the melon vine blight resistance phenotype, the marker was verified by population analysis using the constructed F2 population. Figure 1 It shows that in this population, all strains phenotypically identified as resistant have the same genotype as the resistant parent or F1 generation plant, that is, a fragment of 102bp appears, and all strains phenotypically identified as susceptible have the same genotype as the susceptible parent, that is, only a fragment of 108bp appears. This population is an F2 population, and this result shows that the functional marker is a co-dominant marker that can distinguish between resistant and susceptible materials, and is specific to the melon vine blight resistance gene. CmGSBWYThe functional markers screened by the present invention can be used to assist in the screening of resistant and susceptible melon seedlings, which will overcome the shortcomings of conventional disease-resistant breeding, simplify the phenotypic identification method, and provide a genetic tool for functional marker-assisted breeding of vine blight resistance, which will further accelerate the process of breeding vine blight-resistant varieties.

Claims

1. A functional marker for identifying resistance to vine blight in melon, the marker being located in the CDS region of a vine blight resistance gene in melon and belonging to an InDel molecular marker, characterized in that: The InDel molecular marker is a nucleotide sequence fragment shown in SEQ ID NO: 1, which is 102 bp in total; the nucleotide sequence fragment shown in SEQ ID NO: 1 is co-segregated with a melon vine blight resistance gene.

2. A primer for amplifying the InDel molecular marker according to claim 1, characterized in that: The primers consist of an upstream primer and a downstream primer, and the nucleotide sequences thereof are shown in SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

3. Use of the InDel molecular marker according to claim 1 or the primer according to claim 2 in identification of resistance to melon vine blight.

4. A kit for identifying resistance to melon vine blight, comprising the primers according to claim 2.

5. A method for identifying resistance to melon vine blight, characterized in that The following steps are involved: (1) Extracting genomic DNA from the sample to be tested; (2) using the genomic DNA extracted in step (1) as a template, and performing PCR amplification using the primers described in claim 2; (3) Performing electrophoresis on the amplified product of step (2) and identifying the resistance to melon vine blight based on the size of the bands.

6. The method for identifying resistance to melon vine blight according to claim 5, characterized in that: The PCR amplification system is: 1 µL of 10 µmol / L upstream and downstream primers, 1 µL of 50-150 ng / µL DNA template, 4 µL of 2×TaqMasterMix, and ddH2O is added to 10 µL.

7. The method for identifying resistance to melon vine blight according to claim 5, characterized in that: The PCR reaction program was as follows: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 45 s, a total of 34 cycles, extension at 72°C for 10 min, and storage at 4°C.

8. The method for identifying resistance to melon vine blight according to claim 5, characterized in that: In step (3), if a specific band of the same size as that of the disease-resistant parent appears, that is, a fragment of 102 bp is amplified, the phenotype of the melon plant is disease-resistant; if only a specific band of the same size as that of the susceptible parent appears, that is, only a fragment of 108 bp is amplified, the phenotype of the melon plant is susceptible.

Images