One-tube gene editing nucleic acid detection method compatible with amplification and Argonaute enzyme digestion and application of one-tube gene editing nucleic acid detection method

Abstract

The invention discloses an amplification and Argonaute enzyme compatible one-tube gene editing nucleic acid detection method and application. The method comprises preparation of immobilized nuclease, an amplification-enzyme digestion compatible system component formula, an amplification-enzyme digestion one-tube reaction program and application of the method in single or multiple nucleic acid detection. According to the invention, a method of combining Argonaute cascade shearing and enzyme immobilized embedding is adopted, the high-temperature tolerance characteristic of Argonaute is combined, and nuclease activity is released through temperature control, so that a one-tube detection process of nuclease interference-free amplification and enzyme digestion hot start activity release is realized, the problems of nucleic acid pollution, complicated operation and the like commonly existing in the existing gene editing nucleic acid detection technology are avoided, and the detection accuracy is improved. And the kit is easy to store and transport, and has important application potential in on-site timely detection and home nucleic acid self-detection.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a one-tube gene editing nucleic acid detection method and application that is compatible with amplification and Argonaute enzyme cutting. Technical Background

[0002] In recent years, the emergence of gene editing tool enzymes has spawned a new generation of nucleic acid detection technology, represented by the CRISPR-based gene editing detection technology of Nobel Prize winner Jennifer and Chinese scientist Zhang Feng. It solves the false positive problem caused by non-specific products of isothermal amplification of LAMP and recombinase polymerase amplification, and further amplifies the detection signal. However, CRISPR-Cas gene editing enzymes can competitively bind and cleave templates. Currently, CRISPR nucleic acid detection generally performs amplification-enzyme cleavage reactions in steps, which is cumbersome to operate, and the uncapping reaction is prone to contamination. Although there have been reports of combining component optimization, light-controlled nucleic acid sealing, microfluidic equipment and other methods to achieve one-tube detection, there are still problems of low sensitivity and the need for special equipment.

[0003] Similar to the CRISPR gene editing enzyme, Argonaute (Ago) protein is a programmable nuclease that can precisely cut complementary paired nucleic acids under the mediation of guide DNA. It has attracted increasing attention in the industry due to its lack of recognition sequence restrictions and orthogonal multiple enzyme cleavage activity. However, due to Ago's strong template binding ability, the current nucleic acid detection technology based on Ago protein still requires two steps of amplification and enzyme cleavage for reaction, and there are also problems such as cumbersome operation and contamination from opening the lid.

[0004] LAMP and recombinase polymerase amplification have the advantages of being rapid, simple, specific, sensitive, and reproducible. Compared with other detection methods, they have obvious advantages in practical applications, but they are prone to false positives caused by nonspecific amplification and are difficult to achieve multiple detection. Summary of the invention

[0005] In view of the false positive problem caused by non-specific products of existing isothermal amplification, the present invention provides a one-tube gene editing nucleic acid detection method and application that is compatible with Argonaute enzyme amplification.

[0006] The first aspect of the present invention provides a one-tube nucleic acid detection reaction system, which contains an amplification system and an enzyme cleavage system containing immobilized Argonaute nuclease.

[0007] In another preferred example, the amplification includes LAMP amplification.

[0008] In another preferred embodiment, the amplification includes recombinase polymerase amplification.

[0009] In another preferred example, the recombinase polymerase amplification includes RPA, RAA, MIRA, ERA, or a combination thereof.

[0010] In another preferred embodiment, the reaction system includes a LAMP amplification-enzyme cleavage system, or a recombinase polymerase amplification-enzyme cleavage system.

[0011] In another preferred embodiment, the total volume of the LAMP amplification-enzyme digestion system is 25-100 μL.

[0012] In another preferred embodiment, the LAMP amplification-enzyme digestion system comprises:

[0013] (1) Enzymes: 4-50 U Bst DNA polymerase, 0.5-2 U reverse transcriptase, 0.5-4 U thermostable inorganic pyrophosphatase, 2-8 mg immobilized Argonaute nuclease;

[0014] (2) Buffer: 0.5-2x Bst Buffer, 1-10 mM MgSO4, 1.0-3.0 mM dNTP;

[0015] (3) Primers and guide DNA: 0.5-5 μM upstream gDNA, 0.5-5 μM downstream gDNA, 0.5-2x primers, where 1x primer components are: 1.6 μM FIP / BIP inner primer, 0.2 μM F3 / B3 outer primer, 0.4 μM LF / LB loop primer; and

[0016] (4) Nucleic acid reporter molecule and nucleic acid template: 0.1-2 μM nucleic acid reporter molecule, 5-40 μL nucleic acid template to be tested.

[0017] In another preferred embodiment, the Bst DNA polymerase and Bst buffer are common commercially available reagents.

[0018] In another preferred embodiment, the 1x primer is a LAMP amplification primer.

[0019] In another preferred embodiment, the reverse transcriptase is ThermoStable V RTase reverse transcriptase that can withstand temperatures between 55°C and 65°C or other commercially available reverse transcriptase that can withstand temperatures between 55°C and 65°C.

[0020] In another preferred embodiment, the nucleic acid reporter molecule is a probe molecule of 25-35 bases.

[0021] In another preferred embodiment, the gDNA is a 5' phosphorylated and 3' phosphorylated single-stranded DNA molecule.

[0022] In another preferred embodiment, the gDNA can only use downstream gDNA, and the detection efficiency is not significantly affected.

[0023] In another preferred embodiment, the length of the gDNA is 15-20 bases.

[0024] In another preferred embodiment, the LAMP amplification-enzyme digestion system can detect two target gene fragments, and it comprises:

[0025] (1) Enzyme reagents: 0.2-1 U / μL Bst DNA polymerase, 0.5-1 U / μL reverse transcriptase, 0.02-0.05 U / μL thermostable inorganic pyrophosphatase, 2-5 mg / μL immobilized nuclease;

[0026] (2) Buffer: 1x Bst buffer, 6-8 mM MgSO4, 1.0-3.0 mM dNTP;

[0027] (3) Primers and guide DNA: 0.5-2 μM target 1 upstream gDNA, 0.5-2 μM target 1 downstream gDNA, 0.5-1x target 1 primer, 0.5-2 μM target 2 upstream gDNA, 0.5-2 μM target 2 downstream gDNA, 0.5-1x target 2 primer.

[0028] (4) Nucleic acid reporter molecules and nucleic acid templates: 0.5-1 μM target nucleic acid reporter molecules, 0.5-1 μM target 2 nucleic acid reporter molecules, and 5-40 μL of nucleic acid template to be tested.

[0029] In another preferred embodiment, the 0.5-1x primer components are 0.8-1.6 μM FIP / BIP inner primer, 0.1-0.2 μM F3 / B3 outer primer and 0.2-0.4 μM LF / LB loop primer.

[0030] In another preferred embodiment, the LAMP amplification-enzyme digestion compatible system procedure is: 1) Amplification phase: control the temperature at 62-65°C for 30-45 minutes. 2) Enzyme digestion phase: control the temperature at 92-97°C for 20-30 minutes. During this period, the corresponding nucleic acid reporter molecule fluorescent labeling signal or the end point fluorescent signal is collected every 15-60 seconds.

[0031] In another preferred embodiment, the total volume of the recombinase polymerase amplification-enzyme digestion system is 20-100 μL.

[0032] In another preferred embodiment, the recombinase polymerase amplification-enzyme digestion system contains 120-125ng DNA recombinase, 300-900ng single-stranded binding protein or mutant protein with similar function, 25-50ng / μL recombinant regulatory protein, 5-30mM magnesium acetate, 0.5-2U reverse transcriptase, 20-90mM Tris (pH 7.9-8.4), 80-100mM potassium acetate, 1-10mM dithiothreitol, 200μM dNTP, 1-8mM ATP, 20-50mM creatine phosphate, 20-120ng creatine kinase, 10-40ng Bacillus subtilis DNA polymerase large fragment Bsu, 0.01-0.05U thermostable inorganic pyrophosphatase, 0.1-10mg immobilized Argonaute nuclease, 0.5-5μM upstream gDNA, 0.5-5μM downstream gDNA, 0.1-2μM nucleic acid reporter molecule, 0.2-1.0μM upstream primer, 0.2-1.0μM downstream primer, 5-40μL nucleic acid template

[0033] In another preferred embodiment, the DNA recombinase includes UvsX DNA recombinase or its analogs.

[0034] In another preferred example, the single-chain binding protein includes single-chain binding protein gp32 or a variant thereof.

[0035] In another preferred example, the recombinant regulatory protein includes UvsY recombinant regulatory protein or a variant thereof.

[0036] In another preferred embodiment, the recombinase polymerase amplification-enzyme digestion system comprises:

[0037] (1) Enzymes: 120-125 ng / μL recombinant enzyme, 600-900 ng / μL single-stranded binding protein, 25-30 ng / μL recombinant regulatory protein, 0.5-1 U / μL reverse transcriptase, 15-45 ng / μL Bacillus subtilis DNA polymerase large fragment Bsu, 0.01-0.05 U / μL thermostable inorganic pyrophosphatase, 2-5 mg / μL immobilized nuclease;

[0038] (2) Buffer and metal ions: 5-30 mM magnesium acetate, 50 mM Tris (Ph7.9-8.4), 80-100 mM potassium acetate, 1-5 mM dithiothreitol, 5%-5.5% high molecular weight polyethylene glycol, 100-300 μM dNTPs, 1-8 mM adenosine triphosphate ATP, 20-50 mM phosphocreatine, 50-120 ng / μL creatine kinease;

[0039] (3) Primers, gDNA: 0.2-1.0 μM upstream primer, 0.2-1.0 μM downstream primer, 0.5-5 μM upstream gDNA, 0.5-5 μM downstream gDNA;

[0040] (4) Detection nucleic acid template and nucleic acid reporter molecule: 5-15 μL of the detection nucleic acid template and 0.1-2 μM of the nucleic acid reporter molecule.

[0041] In another preferred embodiment, the enzyme of the recombinase polymerase-enzyme digestion system can be a common commercially available RAA reagent component.

[0042] In another preferred embodiment, the upstream primer and the downstream primer are single-stranded DNA molecules of 40-45 bases.

[0043] In another preferred embodiment, the nucleic acid reporter molecule is a single-stranded DNA molecular probe of 25-35 bases.

[0044] In another preferred embodiment, the upstream gDNA and the downstream gDNA are 5' phosphorylated and 3' phosphorylated single-stranded DNA molecules.

[0045] In another preferred embodiment, the length of the gDNA is 15-25 bases.

[0046] In another preferred embodiment, if the recombinase polymerase amplification reagent is a common commercially available lyophilized reagent, the buffer, the primer, the gDNA, the nucleic acid reporter molecule, the immobilized Argonaute nuclease, and the nucleic acid template can be directly added.

[0047] Preferably, the recombinase polymerase amplification-enzyme digestion system procedure is:

[0048] 1) Amplification stage: control the temperature at 37-42°C for 30-50 minutes;

[0049] 2) Enzyme digestion stage: control the temperature at 90-99°C for 20-40 minutes;

[0050] During this period, the corresponding nucleic acid reporter molecule fluorescent labeling signal or the endpoint fluorescent signal is collected every 15-60 seconds.

[0051] In another preferred embodiment, the Argonaute nuclease includes thermostable Argonaute nuclease.

[0052] In another preferred example, the thermostable Argonaute nuclease includes PfAgo, MfAgo, TtAgo, MpAgo, ThAgo, TpsAgo, or a combination thereof.

[0053] In another preferred embodiment, the immobilized Argonaute nuclease comprises a lyophilized formulation of the Argonaute nuclease.

[0054] In another preferred embodiment, the immobilized Argonaute nuclease comprises a lyophilized formulation of the immobilized Argonaute nuclease.

[0055] In another preferred embodiment, the immobilized Argonaute nuclease comprises a lyophilized formulation of the thermostable Argonaute nuclease.

[0056] In another preferred embodiment, the immobilized Argonaute nuclease includes a lyophilized formulation of PfAgo, MfAgo, TtAgo, MpAgo, ThAgo, TpsAgo, or a combination thereof.

[0057] In another preferred embodiment, the lyophilized formulation of the Argonaute nuclease is uniformly embedded in a thermotropic phase and transparent and colorless inert material after melting.

[0058] In another preferred embodiment, the lyophilized formulation of the immobilized Argonaute nuclease is uniformly embedded in a thermotropic phase and transparent and colorless inert material after melting.

[0059] In another preferred embodiment, the lyophilized formulation of the thermostable Argonaute nuclease is uniformly embedded in a thermostable phase and transparent and colorless inert material after melting.

[0060] In another preferred embodiment, the lyophilized dosage form of PfAgo, MfAgo, TtAgo, MpAgo, ThAgo, TpsAgo, or a combination thereof is uniformly embedded in a thermotropic phase and a transparent and colorless inert material after melting.

[0061] In another preferred embodiment, the outer layer of inert material further comprises a layer of outer layer inert material which has a temperature-dependent phase and is transparent and colorless after melting.

[0062] In another preferred embodiment, the Argonaute nuclease is expressed by a host.

[0063] In another preferred embodiment, the host includes a microorganism.

[0064] In another preferred embodiment, the microorganism includes Saccharomyces cerevisiae, Pichia pastoris, Saccharomyces monacensis, Saccharomyces bayanus, Saccharomyces pastorianus, Saccharomyces carlsbergensis, Saccharomyces pombe, Kluyveromyces marxiamus, Kluyveromyces lactis, Kluyveromyces fragilis, Pichia stipites, Candida shehatae, Candida tropicalis, Escherichia coli, or a combination thereof.

[0065] In another preferred embodiment, the microorganism includes Saccharomyces cerevisiae, Pichia pastoris, Myceliophthora thermophila, or a combination thereof.

[0066] In another preferred embodiment, the inert material and / or the outer layer inert material includes paraffin, polyethylene wax (PE wax), polypropylene wax (PP wax), vinyl acetate copolymer wax (EVA wax), ozokerite, gelatin, agarose, epoxy resin, or a combination thereof.

[0067] In another preferred embodiment, the inert material and / or the outer layer inert material comprises epoxy resin.

[0068] In another preferred embodiment, the reaction system can be stored and / or transported at room temperature of 30-60 degrees Celsius due to freeze-drying.

[0069] In another preferred embodiment, the lyophilization comprises a protective agent.

[0070] In another preferred embodiment, the protective agent includes: mannitol 2-3% (m / v), trehalose 2-10% (m / v), polyethylene glycol-8000 1-3% (m / v), glycine 2-3% (m / v), or a combination thereof.

[0071] In another preferred embodiment, the freeze-drying procedure includes: (1) maintaining at -60°C to -50°C for 10-15 hours; (2) maintaining at -50°C to -40°C for 3-5 hours, evacuating and maintaining until the end of the procedure; (3) maintaining at -40°C to -30°C for 1-5 hours; (4) maintaining at -35°C to -25°C for 2-5 hours; (5) maintaining at -25°C to -20°C for 2-5 hours; (6) maintaining at -20°C to -10°C for 1-3 hours; (7) maintaining at -10°C to 0°C for 1-3 hours; (8) maintaining at 0°C to 10°C for 2-5 hours; (9) maintaining at 10°C to 20°C for 3-4 hours; (10) maintaining at 20°C to 30°C for 99 hours.

[0072] In another preferred embodiment, the reaction system further comprises a detection device or system.

[0073] In another preferred embodiment, the detection device or system includes a fluorescence quantitative PCR instrument, a constant temperature fluorescence detector, a portable fluorescence detector, or a combination thereof.

[0074] In another preferred embodiment, when the amplification is LAMP, the reaction procedure of the detection device or system includes:

[0075] Stage 1: 60-65°C, 20-50 minutes, no fluorescence signal collection;

[0076] The second stage: 87-99°C, 10-40 minutes, one cycle every 15-60 seconds, collecting the corresponding nucleic acid reporter molecule fluorescence labeling signal once in each cycle, or collecting the fluorescence signal at the end point.

[0077] In another preferred embodiment, when the amplification is recombinase polymerase amplification, the reaction procedure of the detection device or system includes:

[0078] Stage 1: 35-45°C, maintained for 20-50 minutes, without collecting fluorescence signals;

[0079] The second stage: 87-99°C, maintained for 10-40 minutes, with one cycle every 15-60 seconds, and the corresponding nucleic acid reporter molecule fluorescent labeling signal or endpoint fluorescent signal is collected once in each cycle.

[0080] In another preferred embodiment, the reaction system is used for nucleic acid detection.

[0081] In another preferred example, the nucleic acid detection includes single and multiple nucleic acid detection.

[0082] In another preferred embodiment, the nucleic acid includes a nucleic acid sequence.

[0083] In another preferred embodiment, the nucleic acid sequence is from the following species:

[0084] Novel coronavirus SARS-CoV-2, influenza A virus (IAV), influenza B virus (IBV), African swine fever virus (AFSV), porcine respiratory and reproductive syndrome virus (PRRSV), porcine circovirus type 2 (PCV2), feline herpesvirus (FHV), or a combination thereof.

[0085] The second aspect of the present invention provides a kit for nucleic acid target detection, which contains the detection system as described in the first aspect of the present invention or reagents for preparing the detection system, instructions for use describing the method of using the detection system to detect target nucleic acid, or a combination thereof.

[0086] A third aspect of the present invention provides a method for detecting whether a target nucleic acid molecule is present in a sample, comprising the following steps:

[0087] (a) providing the detection system according to the first aspect of the present invention; and

[0088] (b) reacting the detection system with a sample to be detected at a certain temperature to form a first reaction solution;

[0089] (c) performing fluorescence detection on the first reaction solution to obtain a fluorescence signal value;

[0090] Wherein, if a fluorescence signal value is detected in the first reaction solution, it indicates that the target nucleic acid molecule exists in the sample; and if no fluorescence signal value is detected in the first reaction solution, it indicates that the target nucleic acid molecule does not exist in the sample.

[0091] In another preferred embodiment, the sample to be detected includes a non-amplified sample and an amplified (or nucleic acid amplified) sample.

[0092] In another preferred embodiment, the sample to be detected is a sample obtained by amplification.

[0093] In another preferred embodiment, the method of nucleic acid amplification is selected from the following group: PCR amplification, LAMP amplification, RPA amplification, ligase chain reaction, branched DNA amplification, NASBA, SDA, transcription-mediated amplification, MIRA, ERA, and rolling circle amplification.

[0094] In another preferred embodiment, the PCR includes high temperature PCR, normal temperature PCR, and low temperature PCR.

[0095] In another preferred embodiment, the method is used to detect whether the nucleic acid at the target site has a SNP, a point mutation, a deletion, and / or an insertion.

[0096] In another preferred embodiment, the fluorescence detection in step (b) is performed using an enzyme reader or a fluorescence spectrophotometer.

[0097] In another preferred embodiment, the method is an in vitro method.

[0098] In another preferred embodiment, the method is non-diagnostic and non-therapeutic.

[0099] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0100] Figure 1 The image shows the appearance of a tube of lyophilized reagent for LAMP amplification-Argonaute immobilized nuclease cleavage and the appearance after the reaction is completed.

[0101] Figure 2 The sensitivity test results of the pre-packaged LAMP amplification-Argonaute immobilized nuclease shearing one-tube lyophilized reagent are shown using the N gene of the new coronavirus SARS-CoV-2 as an example.

[0102] Figure 3 The results of the one-tube detection of the novel coronavirus SARS-CoV-2 pseudovirus extraction-free N gene LAMP amplification-Argonaute nuclease shearing are shown.

[0103] Figure 4 Shown are the results of a LAMP amplification-Argonaute nuclease cleavage-tube assay for African swine fever virus (ASFV).

[0104] Figure 5 The results of the LAMP amplification-Argonaute nuclease cleavage-tube assay for porcine circovirus type 2 (PCV2) are shown.

[0105] Figure 6 The results of LAMP amplification-Argonaute nuclease shearing-tube detection of porcine blue ear virus PRRSV are shown.

[0106] Figure 7 The results of a LAMP amplification-Argonaute nuclease cleavage-tube assay for feline herpesvirus (FHV) are shown.

[0107] Figure 8 The results of dual-target LAMP amplification-Argonaute nuclease cleavage detection of the N gene of the new coronavirus SARS-CoV-2 and the M gene of influenza A virus are shown.

[0108] Fig. 9The results of LAMP amplification-Argonaute nuclease shearing one-tube detection of the N gene of the new coronavirus SARS-CoV-2 and the human RNase P20 gene are shown.

[0109] Fig.10 The results of the RAA amplification-Argonaute immobilized nuclease cleavage-tube detection of the N gene of the new coronavirus SARS-CoV-2 are shown.

[0110] Fig.11 A comparison of the results of a one-tube assay using both upstream gDNA and downstream gDNA (dual gDNA) and using only downstream gDNA is shown. DETAILED DESCRIPTION

[0111] After extensive and in-depth research, the inventors first used a method combining Ago cascade shearing with LAMP and recombinase polymerase amplification, and took advantage of the high temperature tolerance of Ago, used immobilized and embedded freeze-dried Ago enzyme, and released nuclease activity through temperature control, realizing a one-tube amplification-shearing detection process without nuclease interference in amplification and hot-start release of enzyme activity, avoiding the common problems of nucleic acid contamination and cumbersome operation in existing gene editing nucleic acid detection technologies, while realizing room temperature storage and transportation, and having important application potential in on-site timely detection and home nucleic acid self-testing. The present invention was completed on this basis.

[0112] the term

[0113] In order to better understand the present invention, the following terms are defined.

[0114] Unless otherwise specified, all singular terms also include plural, active and past tenses of the terms. Thus, for example, reference to "a protein" includes more than one protein, and reference to "a compound" refers to more than one compound.

[0115] Unless the context clearly dictates otherwise, the term "about" includes values ​​within a standard deviation of the stated value.

[0116] Where a numerical range is provided, it is to be understood that each intermediate integer of the value and each tenth of each intermediate integer of the value (unless the context clearly indicates otherwise), between the upper and lower limits of the range and any other specified or intermediate values ​​in the specified range are included in the present invention, unless the context clearly indicates otherwise. The upper and lower limits of these smaller ranges may be independently included in the smaller ranges and are also encompassed in the present invention, subject to any explicitly excluded limitations within the specified ranges. When the specified range includes one or two of these limits, the range excluding (i) any one or (ii) two of those included limits is also included in the present invention. For example, "1 to 50" includes "2 to 25", "5 to 20", "25 to 50", "1 to 10", etc.

[0117] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0118] As used herein, the term "comprising" or "including (comprising)" may be open, semi-closed and closed. In other words, the term also includes "consisting essentially of" or "consisting of".

[0119] As used herein, the term "nucleic acid" means single-stranded and double-stranded polymers of nucleotide monomers, including 2'-deoxyribonucleotides (DNA) and ribonucleotides (RNA) linked by internucleotide phosphodiester bonds or internucleotide analogs, and associated counterions, such as H + NH4 + , trialkylammonium, tetraalkylammonium, Mg 2+ 、Na + Etc. Nucleic acid can be a polynucleotide or an oligonucleotide. Nucleic acid can be composed entirely of deoxyribonucleotides, entirely of ribonucleotides, or can be a chimeric mixture thereof. Nucleotide monomer units can include any nucleotide described herein, including but not limited to naturally occurring nucleotides and nucleotide analogs. The size range of nucleic acids is typically from several monomer units such as 5-40 to several thousand monomer nucleotide units. Nucleic acids include but are not limited to genomic DNA, cDNA, hnRNA, mRNA, rRNA, tRNA, fragmented nucleic acids, nucleic acids obtained from subcellular organelles such as mitochondria or chloroplasts, and nucleic acids obtained from microorganisms or DNA or RNA viruses that may be present on or in biological samples.

[0120] As used herein, the term "target nucleic acid" is intended to mean a nucleic acid that is a target of analysis or action. Analysis or action includes subjecting the nucleic acid to copying, amplification, sequencing and / or other procedures for nucleic acid interrogation. The target nucleic acid may include a nucleotide sequence other than the target sequence to be analyzed. For example, the target nucleic acid may include one or more adapters, including adapters that function as primer binding sites on the flanks of the target nucleic acid sequence to be analyzed. The target nucleic acid hybridized with a capture oligonucleotide or a capture primer may include nucleotides that extend beyond the 5' or 3' ends of the capture oligonucleotide, in such a way that not all target nucleic acids are suitable for extension.

[0121] As used herein, when referring to guide RNA or DNA, crRNA or its derivatives, 5' phosphorylated single-stranded nucleic acid or other nucleotides, the term "target specificity" is intended to mean such a polynucleotide, which includes a nucleotide sequence specific to the target polynucleotide sequence, i.e., a nucleotide sequence that can selectively anneal to the recognition region of the target polynucleotide (e.g., target DNA). The target-specific nucleotide can have a single type of oligonucleotide, or the target-specific nucleotide can include two or more types of oligonucleotides with different sequences. Therefore, the target-specific nucleotide can be two or more sequences, including 3, 4, 5, 6, 7, 8, 9 or 10 or more different sequences. In one embodiment, crRNA or its derivatives include a target-specific nucleotide region complementary to a region of the target DNA sequence. In one embodiment, crRNA or its derivatives may include other nucleotide sequences except the target-specific nucleotide region. In one embodiment, other nucleotide sequences may be from tracrRNA sequences. In one embodiment, 5' phosphorylated single-stranded nucleic acid or its derivatives include a target-specific nucleotide region complementary to a region of the target DNA sequence. In one embodiment, the 5'-phosphorylated single-stranded nucleic acid or its derivative may contain other nucleotide sequences in addition to the target-specific nucleotide region.

[0122] As used herein, when referring to polynucleotide use, the term "complementary" is intended to mean a polynucleotide comprising a nucleotide sequence that can selectively anneal to the identification region of a target polynucleotide under certain conditions. As used herein, the term "substantially complementary" and grammatical equivalents are intended to mean a polynucleotide comprising a nucleotide sequence that can specifically anneal to the identification region of a target polynucleotide under certain conditions. Annealing refers to the nucleotide base pairing interaction of a nucleic acid and another nucleic acid, which interaction results in the formation of a duplex, triplex or other higher-order structures. By Watson-Crick (Watson-Crick) and Hoogsteen type hydrogen bonding, the main interaction is typically nucleotide base specific, for example, A:T, A:U and G:C. In certain embodiments, base stacking and hydrophobic interactions can also contribute to duplex stability. Conditions for annealing a polynucleotide to a complementary or substantially complementary region of a target nucleic acid are well known in the art, for example, as described in Nucleic Acid Hybridization, A Practical Approach, Hames and Higgins, eds., IRL Press, Washington, DC (1985) and Wetmur and Davidson, Mol. Biol. 31:349 (1968). Annealing conditions will depend on the specific application and can be routinely determined by one skilled in the art without undue experimentation.

[0123] As used herein, the term "polymerase chain reaction" or "PCR" refers to a procedure in which a small amount of nucleic acid, e.g., RNA and / or DNA, is amplified, as described, for example, in U.S. Pat. No. 4,683,195 to Mullis. Typically, sequence information from the ends of or beyond the region of interest needs to be available so that oligonucleotide primers can be designed; these primers will be identical or similar in sequence to the opposite strands of the template to be amplified. The 5' terminal nucleotides of the two primers can be consistent with the ends of the amplified material. PCR can be used to amplify specific RNA sequences, specific DNA sequences from total genomic DNA, and cDNA, phage or plasmid sequences transcribed from total cellular RNA, and the like. See generally Mullis et al., Cold Spring Harbor Symp. Quant. Biol., 51: 263 (1987); Erlich, ed., PCR Technology, (Stockton Press, NY, 1989).

[0124] As used herein, the term "Argonaute system" refers to an enzyme system comprising a guide nucleic acid and an Argonaute family protein or a variant thereof, wherein the guide nucleic acid comprises a nucleotide sequence that is complementary or substantially complementary to a region of a target polynucleotide, such as a guide DNA. The Argonaute system includes an engineered and / or programmed nuclease system derived from a naturally occurring Argonaute system. The Argonaute system may comprise an engineered and / or mutated Argonaute protein. The Argonaute system may comprise an engineered and / or programmed guide DNA.

[0125] As used herein, the terms "guide RNA", "gDNA", and "guide DNA" are used interchangeably to refer to a gDNA comprising a sequence that is complementary or substantially complementary to a region of a target DNA sequence. The gDNA may comprise a nucleotide sequence other than a region that is complementary or substantially complementary to a region of a target DNA sequence.

[0126] As used herein, the term "guide DNA" refers to a DNA comprising a sequence that is complementary or substantially complementary to a region of a target DNA sequence. The guide DNA may comprise a nucleotide sequence other than a region that is complementary or substantially complementary to a region of a target DNA sequence.

[0127] As used herein, the term "nuclease" refers to an enzyme that is capable of cleaving phosphodiester bonds between nucleotide subunits of a nucleic acid.

[0128] As used herein, the term "detecting" a nucleic acid molecule or a fragment thereof refers to determining the presence of a nucleic acid molecule, typically when the nucleic acid molecule or a fragment thereof has been completely or partially separated from other components of a sample or composition, and may also include determining the charge-to-mass ratio, mass, amount, absorbance, fluorescence or other properties of a nucleic acid molecule or a fragment thereof.

[0129] As used herein, the term "primer" refers to a natural or synthetic oligonucleotide primer that can serve as the starting point of nucleic acid synthesis when placed in a primer extension (not limited to the number of extended bases) that is initiated. Primer can be a single-stranded oligodeoxyribonucleotide. The length of primer can be in the range of from about 10 to about 50 nucleotides, such as 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or about 50 nucleotides. The primer need not reflect the exact sequence of the template, but must be sufficiently complementary to hybridize with the template for primer extension to occur. If desired, the primer can be labeled by incorporating a detectable marker, for example, by spectroscopy, photochemistry, biochemistry, immunochemistry, or chemical means. Exemplary markers include, but are not limited to, biotin, amines, radioactive labels (e.g., 32P), fluorescent dyes, electron-dense reagents, enzymes (commonly used in ELISA), or biotin.

[0130] As used herein, the term "linear amplification" refers to an amplification process that uses multiple cycles of primer extension reactions to amplify target nucleic acids. With linear amplification, the abundance of transcripts increases proportionally with the number of cycles and is linearly amplified. Examples of linear amplification programs are LCR, the aRNA method of Phillips and Eberwine above, and the linear amplification method described herein. Unlike exponential amplification, the amount of amplified product does not increase exponentially. For example, in an ideal 4-hour linear amplification reaction with a copy rate of 2000 copies / minute, 2000 copies of template DNA will produce 960,000,000 copies.

[0131] As used herein, the term "exponential amplification" refers to an amplification procedure in which the product (i.e., amplicon) doubles with each reaction cycle. "Exponential amplification" is a nonlinear amplification that results in an exponential increase in the number of nucleic acid copies present. For example, exponential amplification can occur when primer extensions are initiated at both ends of an amplicon in an amplification cycle. For example, PCR is an exponential amplification procedure. For example, in an ideal PCR reaction with 30 cycles, 2 copies of template DNA will produce 2^30 or 1,073,741,824 copies.

[0132] As used herein, the terms "enrich," "enriching," or "enrichment" in the context of enriching a target polynucleotide refer to a process that produces a higher percentage of a target polynucleotide in a polynucleotide population. In one embodiment, the percentage is increased by about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In one embodiment, the percentage is increased by about 2-fold, 5-fold, 10-fold, 50-fold, or 100-fold. In one embodiment, the target polynucleotide is substantially isolated from the polynucleotide population.

[0133] As used herein, the term "polymerase" refers to a protein that can catalyze the specific incorporation of nucleotides to extend the 3' hydroxyl terminus of a primer molecule (such as, for example, a template oligonucleotide) for a nucleic acid target sequence. The polymerase can be, for example, thermophilic, such that it is active at elevated reaction temperatures. For example, it can also have strand displacement capability.

[0134] As used herein, the term "single nucleotide polymorphism (SNP)" refers to a DNA sequence variation that occurs when a single nucleotide - A, T, C or G - in a genome (or other consensus sequence) differs between members of a species (or between paired chromosomes in an individual).

[0135] As used herein, the term "single nucleotide variant (SNV)" refers to a genotype or polynucleotide that includes a single nucleotide polymorphism (SNP) or a point mutation site.

[0136] As used herein, the terms "subject" and "patient" are used interchangeably. As used herein, the subject is preferably a mammal, such as a non-primate (e.g., a cow, pig, horse, cat, dog, rat, etc.) or a primate (e.g., a monkey and a human). In a specific embodiment, the subject is a human. In one embodiment, the subject is a mammal (e.g., a human) having cancer.

[0137] Ago enzyme

[0138] In the present invention and detection method, a core component is a gene editing enzyme, such as Ago enzyme.

[0139] In some embodiments, the Ago is derived from the Argonaute system. The Argonaute protein family was first discovered genetically and identified for the first time in plants. Members are defined by the presence of PAZ (Piwi-Argonaute-Zwille) and PIWI domains. Argonaute proteins are highly conserved between species, and many organisms encode multiple members of the family. The number of Argonaute genes ranges from 1 in the fission yeast Schizosaccharomyces pombe to 27 in the nematode worm Caenorhabditis elegans. In mammals, there are eight Argonaute genes. The Argonaute protein family can be divided into the Ago subfamily and the Piwi subfamily. In most organisms investigated so far, including fruit flies, zebrafish and mice, the expression of Piwi proteins is limited to the germline, in which Piwi proteins bind to Piwi interacting proteins (piRNAs). In contrast, Ago proteins are ubiquitously expressed in many organisms. The human Ago1, Ago3, and Ago4 genes are clustered on chromosome 1, while the Ago2 gene is located on chromosome 8. The human Piwi subfamily includes HIWI1, HIWI2, HIWI3, and HILI; they are encoded by genes on chromosomes 12, 11, 22, and 8, respectively. Members of the Argonaute protein family have been shown to be key players in gene silencing pathways directed by small RNAs. Small RNAs, such as short interfering RNAs (siRNAs), microRNAs (miRNAs), or Piwi interacting RNAs (piRNAs), are anchored in specific binding pockets and direct Argonaute proteins to target mRNA molecules for silencing or destruction. See, e.g., Hock and Meister, Genome Biol, .2008, 9(2):210. Recently, it has also been shown that certain Argonaute proteins are directed by small DNAs for DNA cleavage. See, e.g., Gao et al., nature biotechnology, 2016, doi:10.1038 / nbt.3547. Thus, the Argonaute system provides a mechanism for targeting specific sequences and certain enzymatic activities to that sequence.

[0140] Thus, in some embodiments, the Ago is an Ago subfamily system or a derivative thereof. In other embodiments, the system is a Piwi subfamily system or a derivative thereof. In some specific embodiments, the Argonaute protein is Ng Argonaute or a variant thereof.

[0141] Key elements of the Argonaute system include guide nucleic acids, such as 5' phosphorylated single-stranded nucleic acids. 5' phosphorylated single-stranded nucleic acids or derivatives thereof include target-specific nucleotide regions that are complementary or substantially complementary to a region of the target nucleic acid. In some embodiments, 5' phosphorylated single-stranded nucleic acids or derivatives thereof include user-selectable DNA sequences that allow enzyme-specific targeting of complementary double-stranded DNA. In some embodiments, the user-selectable DNA sequence includes 20-50 nucleotides that are complementary or substantially complementary to a region of the target DNA sequence. In some embodiments, 5' phosphorylated single-stranded nucleic acids are user-selectable single-stranded DNA sequences of less than 100 nucleotides. In some embodiments, 5' phosphorylated single-stranded nucleic acids are single-stranded DNAs of less than 50 nucleotides. In some embodiments, 5' phosphorylated single-stranded nucleic acids are single-stranded DNAs of less than 25 nucleotides. Exemplary lengths of single-stranded DNA include 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50 nucleotides. In some embodiments, the user-selectable DNA sequence comprises less than 20 nucleotides that are complementary or substantially complementary to a region of the target DNA sequence. Exemplary user-selectable DNA sequences comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides that are complementary or substantially complementary to a region of a target DNA sequence.

[0142] In some embodiments, the target-specific nucleotide region of the 5' phosphorylated single-stranded nucleic acid has a 100% base pair match with a region of the target nucleic acid. In some embodiments, the target-specific nucleotide region of the 5' phosphorylated single-stranded nucleic acid has a 90%-100%, 80%-100%, or 70%-100% base pair match with a region of the target nucleic acid. In some embodiments, there is a base pair mismatch between the target-specific nucleotide region of the crRNA and a region of the target nucleic acid. In some embodiments, there are two base pair mismatches between the target-specific nucleotide region of the 5' phosphorylated single-stranded nucleic acid and a region of the target nucleic acid. In some embodiments, there are three base pair mismatches between the target-specific nucleotide region of the 5' phosphorylated single-stranded nucleic acid and a region of the target nucleic acid. In some embodiments, there are four base pair mismatches between the target-specific nucleotide region of the 5' phosphorylated single-stranded nucleic acid and a region of the target nucleic acid. In some embodiments, there are five base pair mismatches between the target-specific nucleotide region of the 5' phosphorylated single-stranded nucleic acid and a region of the target nucleic acid.

[0143] Argonaute used in the present application includes engineered and / or programmed nuclease systems derived from naturally occurring Argonaute systems. The Argonaute system may comprise engineered and / or mutated Argonaute proteins. The Argonaute system may also comprise engineered and / or programmed guide nucleic acids. In some embodiments, the Argonaute protein or its variant is engineered to remove endonuclease activity so that the Argonaute system does not produce double-stranded DNA breaks or single-stranded DNA breaks. In other embodiments, the Argonaute protein or its variant is engineered to be able to produce single-stranded DNA breaks.

[0144] It will be appreciated that any Argonaute system capable of binding nucleic acid or disrupting double stranded nucleic acid and creating a loop structure by directing nucleic acid may be used in the present methods.

[0145] In some embodiments, the primer used in the application is a single-stranded oligodeoxyribonucleotide. In some embodiments, the primer length is from about 10 to about 50 nucleotides. The exemplary length of the primer provided herein is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.

[0146] In some embodiments, the primer used in the present application has a 100% base pair match with a region of the target nucleic acid. In some embodiments, the primer used in the present application has a 90%-100%, 80%-100% or 70%-100% base pair match with a region of the target nucleic acid. In some embodiments, there is a base pair mismatch between a region of the primer and the target nucleic acid. In some embodiments, there are two base pair mismatches between a region of the primer and the target nucleic acid. In some embodiments, there are three base pair mismatches between a region of the primer and the target nucleic acid. In some embodiments, there are four base pair mismatches between a region of the primer and the target nucleic acid. In some embodiments, there are five base pair mismatches between a region of the primer and the target nucleic acid.

[0147] In some embodiments, the primer used in the present application is labeled, for example, for enrichment or detection of amplified products. In some embodiments, the primer used in the present application is labeled for detection by spectroscopy, photochemistry, biochemistry, immunochemistry or chemical means. In some embodiments, primers are labeled with biotin, amine, radioactive markers (for example, 32P), fluorescent dyes, electron-dense reagents, enzymes (generally used in ELISA) or biotin.

[0148] In the present invention, the preferred Ago enzyme is PfAgo enzyme, which is derived from the archaeon Pyrococcus furiosus, has a gene length of 2313 bp, and an amino acid sequence consisting of 770 amino acids.

[0149] The enzymatic cleavage characteristics of PfAgo enzyme are as follows: the enzyme can use 5' phosphorylated oligonucleotide as guide ssDNA to guide the enzyme to accurately cleave the target nucleic acid sequence; the cleavage site is located at the phosphodiester bond between the target nucleic acid (ssDNA) corresponding to the 10th and 11th nucleotides of the guide ssDNA.

[0150] Generally, the preferred working temperature of PfAgo enzyme is 95±2 degrees.

[0151] Primers, guide ssDNA pairs, and reporter nucleic acid molecules

[0152] In the detection system and detection method of the present invention, a core component is the guide ssDNA pair.

[0153] In the present invention, the preferred guide ssDNAs are oligonucleotides with a length of 14-24 nt (such as 16 nt), and the first 5' nucleotide is a phosphorylated thymine (T).

[0154] The term "primer" used herein has the meaning commonly understood by those skilled in the art, that is, a short single-stranded DNA or RNA fragment used to detect a nucleic acid sequence complementary thereto.

[0155] In view of the teachings of the present invention and the common knowledge in the art, it should be understood by those skilled in the art that, knowing the primer pair, those skilled in the art can independently design the probe according to the template sequence between the forward primer and the reverse primer binding site, and detect the technical effect of the probe and the primer pair. In a specific embodiment, a person of ordinary skill in the art can specifically design the probe as needed, and the probe can be in a liquid phase or fixed on a solid phase; it can be combined before amplification or after amplification. Therefore, the probe of the present invention is not limited to the probe specifically disclosed in the embodiment. The primer pair of the present invention is also not limited to the use of paired with the probe specifically disclosed in the embodiment.

[0156] In the detection system and detection method of the present invention, a core component is a reporter nucleic acid carrying a reporter molecule.

[0157] As used herein, "probe," "reporter molecule," and "reporter nucleic acid molecule" are used interchangeably.

[0158] In some embodiments, the preferred reporter molecule of the present invention is a fluorescent molecule or a fluorescent group. A preferred reporter nucleic acid molecule is a nucleic acid molecule carrying a fluorescent group and a quencher group, respectively. For example, a fluorescent group (F) is labeled at the 5' end, and a quencher group (Q) is labeled at the 3' end.

[0159] Detection systems, methods, and kits

[0160] The present invention provides a one-tube detection system for detecting target nucleic acid molecules, which comprises: an amplification system and an enzyme cutting system comprising an immobilized Argonaute nuclease, such as a guide ssDNA pair, a gene editing enzyme Pyrococcusfuriosus Argonaute (PfAgo), and a fluorescent reporter nucleic acid, wherein the fluorescent reporter nucleic acid carries a fluorescent group and a quenching group; wherein the target nucleic acid molecule is a target DNA.

[0161] The present invention also provides a nucleic acid detection method based on immobilized Argonaute nuclease.

[0162] For ease of understanding, the inventor provides the principle of the detection method of the present invention. It should be understood that the protection scope of the present invention is not limited by the principle.

[0163] In the method of the present invention, based on the cleavage activity of the immobilized Argonaute nuclease, a series of guide ssDNAs can be designed according to different target nucleic acid sequences, and these guide ssDNAs target the nucleic acid to be detected and mediate the immobilized Argonaute nuclease to cleave the target fragment. In some embodiments, after the cleavage, new secondary guide ssDNA is also formed; the secondary guide ssDNA continues to guide the immobilized Argonaute nuclease to cleave the fluorescent reporter nucleic acid complementary to the secondary guide ssDNAs under the action of the immobilized Argonaute nuclease, thereby achieving the detection of the target nucleic acid.

[0164] In the present invention, according to the design requirements of the guide ssDNAs, the immobilized Argonaute nuclease can be specially designed to selectively shear nucleic acid sequences with differences in some sites, thereby achieving typing detection.

[0165] In a preferred embodiment, the present invention provides preferred primers, guide ssDNAs and fluorescent reporter nucleic acids for nucleic acid detection.

[0166] In the present invention, multiple target nucleic acids and guide ssDNAs can be added simultaneously to the cleavage system of immobilized Argonaute nuclease, combined with reporter nucleic acids with different fluorescent groups, to achieve multiple detection of target nucleic acids.

[0167] The method of the present invention is very suitable for detecting trace nucleic acids. By combining PCR and a guide ssDNA pair with a specific sequence, the present invention can detect target nucleic acids as low as fM concentration.

[0168] In a preferred embodiment, the detection method of the present invention comprises the following steps:

[0169] Step 1: Design amplification primers, specific oligonucleotide guide ssDNAs and fluorescent reporter nucleic acids for different target nucleic acid sequences;

[0170] Step 2: Collect the sample to be tested and extract the nucleic acid complex containing the target sequence;

[0171] Step 3: Add the obtained sample to be tested as a template into the one-tube nucleic acid detection reaction system of the present invention to perform an amplification reaction;

[0172] Step 4: performing specific shearing in the one-tube nucleic acid detection reaction system of the present invention under the condition of continuous insulation at 90-99 degrees Celsius;

[0173] Step 5: Performing fluorescence quantitative analysis on the system in step 4;

[0174] Step 6: After analyzing the image, adjust the Start value, End value and threshold line of the Baseline to determine the result.

[0175] In the present invention, the amplification primers used in the amplification reaction usually have a Tm value of about 60±3 degrees, and the amplified fragment size is about 90-120 bp. Preferably, the amplification primers should be designed to avoid the region to be detected.

[0176] The present invention also provides a kit for use in the detection method of the present invention.

[0177] Typically, the kit includes: reagents for preparing the detection system of the present invention and instructions for use describing the method of using the detection system to detect the target nucleic acid.

[0178] application

[0179] The present invention utilizes the high temperature resistance of Argonaute nuclease, has simplified operation, is particularly suitable for detecting trace target nucleic acid molecules and multiple detection, and has wide applicability.

[0180] In the present invention, the target nucleic acid molecule can be DNA or RNA. When the target nucleic acid molecule is RNA, it can be converted into DNA by reverse transcription and then detected.

[0181] In another preferred embodiment, the target nucleic acid molecule includes a target nucleic acid molecule derived from a group consisting of: plants, animals, microorganisms, viruses, or a combination thereof.

[0182] In another preferred embodiment, the target DNA is artificially synthesized or naturally occurring DNA.

[0183] In another preferred embodiment, the target DNA includes wild-type or mutant DNA.

[0184] The detection reaction system of the present invention is suitable for detecting a variety of pathogens, such as viruses. In some embodiments, the virus can be selected from, but not limited to: positive single-stranded RNA virus ((+)-ss-envRNAV), negative single-stranded RNA virus ((-)-ss-envRNAV), double-stranded DNA virus (ds-DNAV) or positive RNA derived from DNA virus. In some embodiments, the viral infection is caused by any of the following viral families: Arenavirus, Arterviridae, Bunyavirus, Filoviridae, Flaviviridae, Orthomyxoviridae, Paramyxoviridae, Rhabdoviridae, Retroviridae (particularly the genus Deltaretroviridae), Coronaviridae, Togaviridae, Herpesviridae, Poxviridae, or Hepadnaviridae.

[0185] In some embodiments, (+)-ss-envRNAV can be selected from, but not limited to, Coronaviridae, Flaviviridae, Togaviridae, and Arteriviridae. In some embodiments, (+)-ss-envRNAV is a coronavirus pathogenic to humans. In some embodiments, the coronavirus is selected from the group consisting of SARS-CoV, MERS-CoV, COVID-19 (SARS-CoV-2), CoV 229E, CoV NL63, CoV OC43, CoV HKU1, and CoV HKU20.

[0186] In some embodiments, the (+)-ss-envRNAV can be selected from, but not limited to, Flavivirus, Yellow Fever Virus, Dengue Virus, Japanese Encephalitis Virus, West Nile Virus, Zika Virus, Tick-borne Encephalitis Virus, Kyasanur Forest Disease Virus, Alkhurma Disease Virus, Omsk Hemorrhagic Fever Virus, and Powassan Virus.

[0187] In some embodiments, the Togaviridae virus of (+)-ss-envRNAV can be selected from, but not limited to, arborvirus, eastern equine encephalitis virus (EEEV), western equine encephalitis virus (WEEV), Venezuelan equine encephalitis virus (VEEV), chikungunya virus (CHIKV), Oneang-Nyang virus (ONNV), Pogosta disease virus, Sindbis virus, Ross River fever virus (RRV) and Semliki Forest virus.

[0188] The present invention includes embodiments in which the virus is a coronavirus (CoV) pathogenic to humans, for example, selected from but not limited to: SARS-CoV, MERS-CoV, COVID-19 (SARS-CoV-2), CoV 229E, CoV NL63, CoV OC43, CoV HKU1, and CoV HKU20.

[0189] In some embodiments, the (-)-(ss)-envRNAV can be selected from, but not limited to, Arenaviridae, Bunyaviridae (Bunyaviridae), Filoviridae, Orthomyxoviridae, Paramyxoviridae, or Rhabdoviridae.

[0190] In some embodiments, the Arenaviridae virus can be selected from, but not limited to, Lassa virus, aseptic mengitis virus, Guanarito virus, Junin virus, Lujo virus, Machupo virus, Sabia virus, and Whitewater Arroyo virus.

[0191] In some embodiments, the Bunyaviridae virus can be selected from, but not limited to, Hantavirus and Crimean-Congo hemorrhagic fever orthonairovirus.

[0192] In some embodiments, the Paramyxoviridae virus can be selected from, but not limited to, Mumps virus, Nipah virus, Hendra virus, Respiratory syncytial virus (RSV), human parainfluenza virus (HPIV), and NDV.

[0193] In some embodiments, the Orthomyxoviridae virus can be selected from, but not limited to, influenza virus (type A (A) to type C (C)), Isavirus, Thogotovirus, Quaranjavirus, H1N1 virus, H2N2 virus, H3N2 virus, H1N2 virus, Spanish flu virus, Asian flu virus, and Russian flu virus.

[0194] In some embodiments, the Rhabdoviridae virus can be selected from, but not limited to, rabies virus, vesiculovirus, Lyssavirus, and Cytorhabdovirus, among others.

[0195] In terms of disease monitoring, the present invention can achieve active management such as prediction and prevention of diseases, and achieve early detection and early treatment, or early prediction and early prevention. Since the detection sensitivity of the present invention is very high, it is suitable for early diagnosis and symptomatic treatment, saving patient treatment time and improving the success rate of treatment. The present invention reduces the waste of high medical costs and strives for the golden opportunity for treatment.

[0196] In terms of environmental monitoring, the present invention can conveniently and quickly accurately identify nucleic acid molecules in environmental pollutants and provide effective environmental detection data.

[0197] One of the preferred embodiments of the present invention is as follows.

[0198] Item 1. A one-tube gene editing nucleic acid detection method compatible with amplification and Argonaute digestion, comprising the following:

[0199] (1) Components of an amplification-enzyme cleavage compatible one-tube gene editing nucleic acid detection system.

[0200] (2) Amplification-enzyme digestion-tube detection operation steps.

[0201] Item 2. The one-tube gene editing nucleic acid detection freeze-dried system components compatible with amplification and enzyme cleavage as described in Item 1 contain two systems, namely, the LAMP amplification-enzyme cleavage system and the recombinase polymerase amplification-enzyme cleavage system.

[0202] Item 3. The LAMP amplification-enzyme digestion system according to Item 2, wherein the total volume of the system is 25-100 μL, and the components include (1) enzyme: 4-40 U Bst DNA polymerase, 0.5-2 U thermostable reverse transcriptase, 0.5-4 U thermostable inorganic pyrophosphatase, 2-8 mg immobilized Argonaute nuclease; (2) buffer: 0.5-2x Bst Buffer, 1-10 mM MgCl2, 1.0-3.0 mM dNTP; (3) primers and guide DNA (gDNA for short): 0.5-5 μM upstream gDNA, 0.5-5 μM downstream gDNA, 0.5-2x primers, wherein 1x primer components are: 1.6 μM inner primers FIP and BIP, 0.2 μM outer primers F3 and B3, 0.4 μM loop primers LF and LB; (4) Nucleic acid reporter molecules and nucleic acid templates: 0.1-2 μM nucleic acid reporter molecules, 5-40 μL nucleic acid templates.

[0203] Item 4. The recombinase polymerase amplification-enzyme digestion system according to Item 2, which includes but is not limited to four recombinase polymerase amplification methods based on DNA recombinases with similar functions, namely RPA, RAA, MIRA and ERA. The total volume of the system is 20-100 μL, and the components include 120-250 ng UvsX DNA recombinase or a recombinase with similar functions, 300-900 ng single-stranded binding protein gp32 or a mutant protein with similar functions, 25-50 ng UvsY recombinant regulatory protein or a mutant protein with corresponding functions, 5-30 mM magnesium acetate, 0.5-2 U reverse transcriptase, 20-90 mM Tris (pH 7.9-8.4), 80-100 mM potassium acetate, 1-10 mM dithiothreitol, 200 μM dNTP, 1-8 mM ATP, 20-50mM creatine phosphate, 20-120ng creatine kinase, 10-40ng Bacillus subtilis DNA polymerase large fragment Bsu, 0.01-0.05U thermostable inorganic pyrophosphatase, 0.5-10mg immobilized Argonaute nuclease, 0.5-5μM upstream gDNA, 0.5-5μM downstream gDNA, 0.1-2μM nucleic acid reporter molecule, 0.2-1.0μM upstream primer, 0.2-1.0μM downstream primer, 5-40μL nucleic acid template.

[0204] Item 5. The immobilized Argonaute nuclease according to Items 3 and 4, wherein firstly, the Argonaute nuclease is a freeze-dried high temperature resistant Argonaute enzyme such as PfAgo, MfAgo, TtAgo, MpAgo, ThAgo, TpsAgo, etc.; secondly, the freeze-dried Argonaute nuclease powder is uniformly embedded in an inert material which is in a temperature variable phase and transparent and colorless after melting; finally, the outer layer of the inert material in which the freeze-dried Argonaute nuclease powder is embedded is further wrapped with a layer of inert material which is in a temperature variable phase and transparent and colorless after melting.

[0205] The PfAgo is a thermostable Argonaute enzyme expressed from Escherichia coli.

[0206] Item 6. The inert material according to Item 5 which has a temperature-dependent phase and is transparent and colorless after melting, comprises paraffin wax, polyethylene wax (PE wax), polypropylene wax (PP wax), vinyl acetate copolymer wax (EVA wax), ozokerite, gelatin, agarose, epoxy resin, etc. After release, a film is formed to prevent liquid evaporation and aerosol contamination.

[0207] Item 7. The LAMP amplification-enzyme cleavage system and the recombinase polymerase amplification-enzyme cleavage system described in Item 2 can be freeze-dried and stored and transported at room temperature of 10-30 degrees.

[0208] Item 8. The freeze-drying method of the LAMP amplification-enzyme digestion system and the recombinase polymerase amplification-enzyme digestion system according to Item 7, wherein the freeze-drying protective agent is: 2-3% (m / v) mannitol, 2-10% (m / v) trehalose, 1-3% (m / v) polyethylene glycol-8000, 2-3% (m / v) glycine, and the freeze-drying procedure is: (1) -60°C to -50°C for 10-15h; (2) -50°C to -40°C for 3-5h h, evacuate and maintain until the end of the program; (3) -40℃~-30℃, maintain for 1-5h; (4) -35~-25℃, maintain for 2-5h; (5) -25~-20℃, maintain for 2-5h; (6) -20℃~-10℃, maintain for 1-3h; (7) -10℃~0℃, maintain for 1-3h; (8) 0℃~10℃, maintain for 2-5h; (9) 10℃~20℃, maintain for 3-4h; (10) 20℃~30℃, maintain for 99h.

[0209] Item 9. The operating steps of the amplification-enzyme digestion-tube detection method according to Item 1, comprising placing the LAMP amplification-enzyme digestion compatible system into an adaptive device such as a fluorescence quantitative PCR instrument, a constant temperature fluorescence detector, a portable fluorescence detector, etc., and setting the reaction program as follows:

[0210] Stage 1: 60-70°C, 20-50 minutes, no fluorescence signal collection;

[0211] The second stage: 87-99°C, 10-40 minutes, one cycle every 15-60 seconds, collecting the corresponding nucleic acid reporter molecule fluorescence labeling signal once in each cycle, or collecting the fluorescence signal at the end point.

[0212] Item 10. The amplification-enzyme digestion system-tube detection reaction according to Item 1, comprising placing the recombinase polymerase amplification-cutting compatible system into an adaptive device such as a fluorescence quantitative PCR instrument, a constant temperature fluorescence detector, a portable fluorescence detector, etc., and setting the reaction program as follows:

[0213] Stage 1: 35-45°C, maintained for 20-50 minutes, without collecting fluorescence signals;

[0214] The second stage: 87-99°C, maintained for 10-40 minutes, with one cycle every 15-60 seconds, and the corresponding nucleic acid reporter molecule fluorescent labeling signal or endpoint fluorescent signal is collected once in each cycle.

[0215] Item 11. Application of a one-tube gene editing nucleic acid detection method compatible with Argonaute enzyme, including but not limited to single or multiple nucleic acid detection applications of the following types of targets or targets of the same type and related nucleic acid sequences:

[0216] Pathogens: Novel coronavirus SARS-CoV-2, influenza A virus (IAV), influenza B virus (IBV), African swine fever virus (ASFV), porcine respiratory and reproductive syndrome virus (PRRSV), porcine circovirus type 2 (PCV2), porcine epidemic diarrhea virus (PEDV), feline herpesvirus (FHV);

[0217] Human genome: for example RNase P20.

[0218] On the one hand, the present invention provides a one-tube gene editing nucleic acid detection system component for amplifying multiple targets compatible with immobilized Argonaute nuclease.

[0219] Preferably, the immobilized Argonaute nuclease is a lyophilized enzyme preparation embedded in an inert material.

[0220] Preferably, the inert material is paraffin, polyethylene wax (PE wax), polypropylene wax (PP wax), vinyl acetate copolymer wax (EVA wax), ozokerite, gelatin, agarose, epoxy resin, etc.

[0221] More preferably, the inert material is epoxy resin.

[0222] Preferably, the Argonaute nuclease is a lyophilized thermostable Argonaute enzyme such as PfAgo, MfAgo, TtAgo, MpAgo, ThAgo, TpsAgo, etc.

[0223] More preferably, the Argonaute nuclease is PfAgo enzyme.

[0224] Preferably, the components of the single-target LAMP amplification-enzyme cleavage compatible system reagent are:

[0225] (1) Enzyme reagents: 4-40 U Bst DNA polymerase, 0.5-2 U reverse transcriptase, 0.5-4 U thermostable inorganic pyrophosphatase, 2-8 mg immobilized Argonaute nuclease;

[0226] (2) Buffer: 1x Bst buffer, 6-8 mM MgCl2, 1-3 mM dNTP;

[0227] (3) Primers and guide DNA: 0.5-2 μM upstream gDNA, 0.5-2 μM downstream gDNA, 1x-1.5x primers; the 1x primer components are: 1.6 μM inner primers FIP and BIP, 0.2 μM outer primers F3 and B3, 0.4 μM loop primers LF and LB.

[0228] (4) Nucleic acid reporter molecule and nucleic acid template: 0.5-1 μM nucleic acid reporter molecule, 5-40 μL nucleic acid template.

[0229] Preferably, the LAMP amplification-enzyme cleavage compatible system is compatible with the detection of DNA or RNA nucleic acid molecules.

[0230] Preferably, the 1x primer is a LAMP amplification primer.

[0231] More preferably, the 1x primer composition is 1.6 μM inner primers FIP and BIP, 0.2 μM outer primers F3 and B3, and 0.4 μM loop primers LF and LB.

[0232] Preferably, the reverse transcriptase is a ThermoStable V RTase reverse transcriptase that tolerates 55-65°C.

[0233] Preferably, the nucleic acid reporter molecule is a probe molecule of 25-35 bases.

[0234] Preferably, the upstream gDNA and the downstream are 5' phosphorylation-modified and 3' phosphorylation-modified single-stranded DNA molecules.

[0235] More preferably, the upstream gDNA and the downstream gDNA may only use the downstream gDNA, and the detection efficiency is not significantly affected.

[0236] Preferably, the gDNA is 15-20 bases in length.

[0237] More preferably, the LAMP amplification and immobilized nuclease compatible system reagents compatible with two target gene fragments are composed of:

[0238] (1) Enzyme reagents: 8-40 U Bst DNA polymerase, 0.5-2 U reverse transcriptase, 0.5-4 U thermostable inorganic pyrophosphatase, 2-8 mg immobilized nuclease;

[0239] (2) Buffer: 1x Bst buffer, 6-8 mM MgCl2, 1.0-3.0 mM dNTP;

[0240] (3) Primers and guide DNA: 0.5-2 μM target 1 upstream gDNA, 0.5-2 μM target 1 downstream gDNA, 0.5-1x target 1 primer, 0.5-2 μM target 2 upstream gDNA, 0.5-2 μM target 2 downstream gDNA, 0.5x-1x target 2 primer.

[0241] (4) Nucleic acid reporter molecules and nucleic acid templates: 0.5-1 μM target 1 nucleic acid reporter molecule, 0.5-1 μM target 2 nucleic acid reporter molecule, and 5-40 μL of the nucleic acid template to be tested.

[0242] Preferably, the 0.5-1x primer components are 0.8-1.6 μM inner primers FIP and BIP, 0.1-0.2 μM outer primers F3 and B3, and 0.2-0.4 μM loop primers LF and LB.

[0243] Preferably, the LAMP amplification-enzyme cleavage compatible system procedure is: (1) amplification stage: control the temperature at 62-65°C, maintain for 30-45 minutes, and do not collect fluorescence signals; (2) enzyme cleavage stage: control the temperature at 92-97°C, maintain for 20-40 minutes, during which the corresponding nucleic acid reporter molecule fluorescence labeling signal or the endpoint fluorescence signal is collected every 15-60 seconds.

[0244] This formula is optimized through a large number of experiments and is a screened formula suitable for LAMP reaction amplification and compatible with immobilized nuclease.

[0245] Preferably, the composition of the recombinase polymerase amplification-Argonaute enzyme digestion compatible system reagent is:

[0246] (1) Enzymes: 120-125 ng UvsX or a recombinant enzyme with similar functions, 300-900 ng single-stranded binding protein gp32 or a mutant protein with similar functions, 25-50 ng UvsY recombinant regulatory protein or a mutant protein with corresponding functions, 0.5-2 U reverse transcriptase, 15-40 ng Bacillus subtilis DNA polymerase large fragment Bsu, 0.01-0.05 U thermostable inorganic pyrophosphatase, and 2-8 mg immobilized nuclease.

[0247] (2) Buffer and metal ions: 5-30 mM magnesium acetate, 50 mM Tris (pH 7.9-8.4), 80-100 mM potassium acetate, 1-5 mM dithiothreitol, 5%-5.5% high molecular weight polyethylene glycol, 100-300 μM dNTPs, 1-8 mM adenine nucleoside triphosphate, 20-50 mM creatine phosphate, 50-120 ng creatine kinase.

[0248] (3) Primers, gDNA, nucleic acid template and nucleic acid reporter molecules: 0.2-1.0 μM upstream primer, 0.2-1.0 μM downstream primer, 0.5-5 μM upstream gDNA, 0.5-5 μM downstream gDNA, 5-40 μL nucleic acid template, 0.1-2 μM nucleic acid reporter molecules.

[0249] Preferably, the upstream primer and the downstream primer are single-stranded DNA molecules of 40-45 bases.

[0250] Preferably, the nucleic acid reporter molecule is a single-stranded DNA molecular probe of 25-35 bases.

[0251] Preferably, the upstream gDNA and the downstream gDNA are 5' phosphorylation-modified and 3' phosphorylation-modified single-stranded DNA molecules.

[0252] Preferably, the length of the gDNA is 10-25 bases.

[0253] Preferably, the procedure of the recombinase polymerase amplification-enzyme cleavage compatible system is as follows: (1) amplification stage: control the temperature at 37-42°C, maintain for 30-50 minutes, and do not collect fluorescence signals; (2) enzyme cleavage stage: control the temperature at 90-99°C, maintain for 20-40 minutes, during which one cycle is performed every 15-60 seconds, and collect the corresponding nucleic acid reporter molecule fluorescence labeling signal or the endpoint fluorescence signal in each cycle.

[0254] The above component system and detection steps are optimized through a large number of experiments and are screened to be compatible with recombinase polymerase reaction amplification and immobilized Argonaute nuclease.

[0255] The present invention also provides a freeze-dried protective agent for a one-tube gene editing nucleic acid detection system that is compatible with amplification and immobilized Argonaute nuclease.

[0256] Preferably, the final concentration of the freeze-dried protective agent component formula is: 2.5% (m / v) mannitol, 2% (m / v) trehalose, 2% (m / v) polyethylene glycol-8000, and 2.5% (m / v) glycine.

[0257] Preferably, the freeze-drying procedure of the tube form is: (1) -50°C for 12 hours; (2) -40°C for 3 hours, during which the vacuum is applied until the end; (3) -30°C for 3 hours; (4) -25°C for 4 hours; (5) -20°C for 2 hours; (6) -10°C for 1 hour; (7) 0°C for 2 hours; (8) 10°C for 4 hours; (9) 20°C for 4 hours; (10) 25°C for 99 hours.

[0258] Preferably, the freeze-dried components can be added to centrifuge tubes, vials or directly dispensed into PCR tubes for freeze-drying.

[0259] Preferably, the freeze-dried product after the freeze-dried component and the LAMP amplification-enzyme cleavage compatible system are freeze-dried simultaneously has a good morphology and can be stored at 25° C. for 180 days.

[0260] The beneficial effects of the present invention compared to the prior art include:

[0261] 1. The detection method described in the present invention realizes one-tube gene editing detection, and the sensitivity and detection speed are basically consistent with the two-step method of opening the cover midway, which solves the problems of gene editing detection pollution caused by opening the cover, cumbersome operation, fluorescence curve fluctuation caused by liquid evaporation, and instability of the component system.

[0262] 2. The detection reagent of the present invention can be stored at 25°C for half a year, 37°C for 4 weeks, or 2-8°C for 1 year or even longer, and can be transported at room temperature.

[0263] 3. The single or multiple gene editing detection system described in the present invention can meet the single or multiple detection of various pathogenic microorganisms or human and animal genomes.

[0264] 4. The multiplex system of this technology relies on fluorescent molecules of different wavelengths added to different probe molecules, and its specificity is greatly improved compared with conventional isothermal amplification.

[0265] 5. The gDNA used in this technology can be added with only one downstream gDNA, the effect can meet the detection needs, the design is simpler and the cost is lower.

[0266] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are weight percentages and weight parts.

[0267] Sequence Listing:

[0268] 1. Novel coronavirus SARS-CoV-2 (COVID-19)

[0269] SEQ ID NO.1N-F3: 5'-AACACAAGCTTTCGGCAG-3'

[0270] SEQ ID NO.2N-B3: 5'-GAAATTTGGATCTTTGTCATCC-3'

[0271] SEQ ID NO.3N-FIP: 5'-TGCGGCCAATGTTTGTAATCAGCCAAGGAAATTTTGGGGAC-3'

[0272] SEQ ID NO.4N-BIP: 5'-CGCATTGGCATGGAAGTCACTTTGATGGCACCTGTGTAG-3'

[0273] SEQ ID NO.5N-LF: 5'-TTCCTTGTCTGATTAGTTC-3'

[0274] SEQ ID NO.6N-LB: 5'-ACCTTCGGGAACGTGGTT-3'

[0275] SEQ ID NO.7N-gDNA1: 5'-Phosphate-TCCAGCGCTTCAGCGT-3'-Phosphate

[0276] SEQ ID NO.8N-gDNA2: 5'-Phosphate-TCTTCGGAATGTCGCG-3'-Phosphate

[0277] SEQ ID NO.9N-reporter: 5'-ROX-TCTTCAGCGTTCTTCGGAATGTCGCGCA-3'-BHQ2

[0278] 2.International Vehicle(IAV)

[0279] SEQ ID NO.10IAV-F3:5′-TTTCTATCATCCCRTCAGGC-3′

[0280] SEQ ID NO.11IAV-B3:5'-TCGGGTCCCCATTCCCATT-3'

[0281] SEQ ID NO.12IAV-FIP:5'-TTAGCCATTCCATGAGAGCCTCRAGCCCCTCAAAGCCGAGATC-3'

[0282] SEQ ID NO.13IAV-BIP:5'-TTGTGTTCACGCTCACCGTGCTTTTGGACAAAGCGYCTACG-3'

[0283] SEQ ID NO.14IAV-LF1:5′-CTGTGTTCTTTCCTGCAAARACA-3′

[0284] SEQ ID NO.15IAV-LB1:5′-CAGTGAGCGAGGACTGCA-3′

[0285] SEQ ID NO.16IAV-gDNA1:5'-phosphate-TAGACAAGACCAATCT-3'-phosphate

[0286] SEQ ID NO.17IAV-gDNA2:5'-phosphate-TGTCACCTCTGACTAA-3'-phosphate

[0287] SEQ ID NO.18IAV-Reporter:5'-FAM-TACCAGTCAATCTTGTCACCTCTTACCAGT-3'-BHQ2

[0288] 3.International Vehicle(IBV)

[0289] SEQ ID NO.19IBV-F3:5'-CAAATCAAACAGAAGACGGA-3'

[0290] SEQ ID NO.20IBV-B3:5'-GCTTTTGTTTAATCCACCGT-3'

[0291] SEQ ID NO.21 IBV-FIP: 5'-ACCTCTTTGATAGRYAATTGTTCCAAAGTGGCAGAATTGTTGTTGA-3'

[0292] SEQ ID NO.22 IBV-BIP: 5'-CAAGTGGCAGGAGCAARGTAATTTTTCATGGAGGCAATC-3'

[0293] SEQ ID NO.23 IBV-LF: 5'-GTTTTTCCAGATTTYTGCACCATG-3'

[0294] SEQ ID NO.24 IBV-LB: 5'-GGATCCTTGCCCTTAATTGGWGAAG-3'

[0295] SEQ ID NO.25 IBV-gDNA1: 5'-phosphate-TATTTTATTGCCTCAA-3'-phosphate

[0296] SEQ ID NO.26 IBV-gDNA2: 5'-phosphate-TAGGTGTGGTGCGCAA-3'-phosphate

[0297] SEQ ID NO.27 IBV-Reporter: 5'-VIC-TTTATTGCCTCAAAAGGTGTGGTGCGCA-3'-BHQ2

[0298] 5. African swine fever virus (ASFV)

[0299] SEQ ID NO.28 ASFV-F3: 5'-TTCCAGGTAGGTTTTAATCCT-3'

[0300] SEQ ID NO.29 ASFV-B3: 5'-GTAGACGCAATATACGCTTTA-3'

[0301] SEQ ID NO.30 ASFV-FIP: 5'-GGTGACCCACACCAACAATAACTGGGCCATTTAAGAGCAG-3'

[0302] SEQ ID NO.31 ASFV-BIP: 5'-CAAAAAGGTTGTGTATTTCAGGGGTGGTTTATCCCAGGAGTCATT-3'

[0303] SEQ ID NO.32ASFV-LF:5′-CACCACGATGAAAAACTAATGT-3′

[0304] SEQ ID NO.33ASFV-LB:5'-TTCATTATTCGTGAGCGAGAT-3'

[0305] SEQ ID NO.34ASFV-gDNA1:5'-phosphate-TGCGTTTTATGGACAC-3'-phosphate

[0306] SEQ ID NO.35ASFV-gDNA2:5'-phosphate-TTATCAGGGAAAATCG-3'-phosphate

[0307] SEQ ID NO.36ASFV Reporter:5′-FAM-TTATGGACACGTATCAGGGAAAATCGAACG-3′-BHQ1

[0308] 6.Recombinant Protozoan P20(RNase P20)

[0309] SEQ ID NO.37RNaseP20-FIP:5'-GTGTGACCCTGAAGACTCGGTTTTAGCCACTGACTCGGATC-3'

[0310] SEQ ID NO.38RNaseP20-BIP:5'-CCTCCGTGATATGGCTCTTCGTTTTTTTCTTACATGGCTCTGGTC-3'

[0311] SEQ ID NO.39RNaseP20-LF:5′-ATGTGGATGGCTGAGTTGTT-3′

[0312] SEQ ID NO.40RNaseP20-LB:5′-CATGCTGAGTACTGGACCTC-3′

[0313] SEQ ID NO.41RNaseP20-F3:5'-TTGATGAGCTGGAGCCA-3'

[0314] SEQ ID NO.42RNaseP20-B3:5′-CACCCTCAATGCAGAGTC-3′

[0315] SEQ ID NO.43 RNaseP20 - gDNA1: 5'-phosphate - TATCACGGAGGGGATA - 3'-phosphate

[0316] SEQ ID NO.44 RNaseP20 - gDNA2: 5'-phosphate - TGTGGAGGAGTGTCTT - 3'-phosphate

[0317] SEQ ID NO.45 RNaseP20 - Reporter: 5'-VIC - TCACGGAGGGGATAAGTGGAGGAGTGTCTT - 3'-BHQ2

[0318] 8. Porcine circovirus type 2 (PCV2)

[0319] SEQ ID NO.46 PCV2 - FIP: 5'-GTTACAGGGTGCTGCTCTGCGACCTGTCTACTGCTGTG - 3'

[0320] SEQ ID NO.47 PCV2 - BIP: 5'-CGTGATTGGAAGACGAATGTACACCCAGTATGTGGTTTCCGG - 3'

[0321] SEQ ID NO.48 PCV2 - LF: 5'-CCGCTCTCCAACAAGGTACT - 3'

[0322] SEQ ID NO.49 PCV2 - LB: 5'-ATTGTGGGGCCACCTGG - 3'

[0323] SEQ ID NO.50 PCV2 - F3: 5'-GATCTCAAGGACAACGGA - 3'

[0324] SEQ ID NO.51 PCV2 - B3: 5'-CCACTTGTTTCTAGGTGGTT - 3'

[0325] SEQ ID NO.52 PCV2 - gDNA1: 5'-phosphate - TCTGAACTTTTGAAAG - 3'

[0326] SEQ ID NO.53 PC2 - gDNA2: 5'-phosphate - TGAGCGGGAAAATGCA - 3'

[0327] SEQ ID NO.54PCV2-Reporter:5'-FAM-CTGAACTTTTGAAAGTGAGCGGGAAAATGC-3-BHQ1'

[0328] 9.Feature-Holding Vehicle(FHV)

[0329] SEQ ID NO.55FHV-FIP:5'-AGCCTATTCCGTTCATAGTGGGAAAAAAATACTAGTTGGCGTGAT-3'

[0330] SEQ ID NO.56FHV-BIP:5'-TTCAGTGTTTTCAAAGCCCGG-CCCATGCATGCATGTCAA-3';

[0331] SEQ ID NO.57FHV-LF:5'-GTTAAAAATTTCTTAGTA-3'

[0332] SEQ ID NO.58FHV-LB:5'-GAGCTCTCCGACCAAAATGG-3'

[0333] SEQ ID NO.59FHV-F3:5'-GCAATGTATATATGATGTTGGTACA-3'

[0334] SEQ ID NO.60FHV-B3:5'-TCCATAAGTCCATCGAGGA-3'

[0335] SEQ ID NO.61FHV-gDNA1:5'-phosphate-TACAATAGTTTCCGAT-3'

[0336] SEQ ID NO.62FHV-gDNA2:5'-phosphate-TCGACGGAGTCAGATT-3'

[0337] SEQ ID NO.63FHV Reporter:5'-FAM-ACAATAGTTTCCGATTCGACGGAGTCAGAT-3'-BHQ1

[0338] 10.Frequent snowflakes

[0339] SEQ ID NO.64PRRSV-FIP:5'-GTGCAGAAGCCCTAGCAGTCGTTTTCTATTACCTACACGCC-3'

[0340] SEQ ID NO.65PRRSV-BIP:5'-TTCAGAGTACAAATAAGGTCGCGCGGTTTCTATGGCTGAGTACAC-3'

[0341] SEQ ID NO.66PRRSV-LF:5'-CGACTCACCTTTAGGGCATATATC-3'

[0342] SEQ ID NO.67PRRSV-LB:5′-CACTATGGGAGCAGTAGTTGC-3′

[0343] SEQ ID NO.68PRRSV-F3:5'-ACAAAAGGTGCTTTTGGC-3'

[0344] SEQ ID NO.69PRRSV-B3:5′-TCTGGAGGTGATGAATTTCC-3′

[0345] SEQ ID NO.70PRRSV-gDNA1:5′-phosphate-TCTGCACCTTTTGATC-3′

[0346] SEQ ID NO.71PRRSV-gDNA2:5'-phosphate-TTCCTGAATTGTGCTT-3'

[0347] SEQ ID NO.72PRRSV-Reporter:5'-FAM-CTGCACCTTTTGATCTTCCTGAATTGTGCT-3'-BHQ1

[0348] 11.Specifying snowflakes

[0349] SEQ ID NO.73PEDV-FIP:5'-TGGGTCCGAAGCAAGCTGAGACATCCCAGAGTGGAGG-3'

[0350] SEQ ID NO.74PEDV-BIP:5'-TTGGAGATGCGGAATTTGTCGAACTGGCGATCTGAGCATAG-3'

[0351] SEQ ID NO.75PEDV-LF:5′-GCTATTTTCGCCCTTGGGA-3′

[0352] SEQ ID NO.76PEDV-LB:5′-AGGTGTTGATGCCTCAGG-3′

[0353] SEQ ID NO.77PEDV-F3:5'-CTTCGAAGGAACGTGACCT-3'

[0354] SEQ ID NO.78PEDV-B3:5'-CAATGCTGCAACATTTGGT-3'

[0355] SEQ ID NO.79PEDV-gDNA1: 5'-phosphate-GACCCAGGGGAGGCTT-phosphate-3'

[0356] SEQ ID NO.80PEDV-gDNA2: 5'-phosphate-CAAAAATTTTGGAGAT-phosphate-3'

[0357] SEQ ID NO.81PEDV-Reporter;5'-FAM-CCAGGGGAGGCTTCAAAAATTTTGGAGA-3'-BHQ1

[0358] 12. Recombinase polymerase amplification-cleavage reaction of novel coronavirus

[0359] SEQ ID NO.82RAA-N-F1: 5'-CTCTTCTCGTTCCTCATCACGTAGTCGCAAC-3

[0360] SEQ ID NO.83RAA-N-R1: 5'-ACATTTTGCTCTCAAGCTGGTTCAATCTGTCA-3

[0361] SEQ ID NO.84RAA-N-gDNA1: 5'-phosphate-TTCAAGAAATTCAACT-3'-phosphate-

[0362] SEQ ID NO.85RAA-N-gDNA2: 5'-phosphate-TCAGGCAGCAGTAGGG-3'-phosphate-

[0363] SEQ ID NO.86RAA-N-Reporter: 5'-FAM-CAAGAAATTCAACTCCAGGCAGCAGTAGGG-3'-BHQ1

[0364] Example

[0365] The present invention is further described in detail below with reference to embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0366] Example 1 Preparation of LAMP Amplification-Argonaute Immobilized Nuclease Shearing-Tube Lyophilized Reagent

[0367] Taking the N gene of the novel coronavirus SARS-CoV-2 as an example, the configuration steps of the freeze-dried pre-packed LAMP amplification-Argonaute nuclease shearing one-tube test are as follows:

[0368] The specific components of the reaction system for a single reaction are as follows:

[0369]

[0370]

[0371] All components except the immobilized Argonaute nuclease in the above table were prepared according to the reaction quantity, divided into 8 tube strips, and lyophilized.

[0372] The program was set as (1) -50°C for 12 h; (2) -40°C for 3 h, during which the vacuum was applied until the end; (3) -30°C for 3 h; (4) -25°C for 4 h; (5) -20°C for 2 h; (6) -10°C for 1 h; (7) 0°C for 2 h; (8) 10°C for 4 h; (9) 20°C for 4 h; (10) 25°C for 99 h.

[0373] After treatment, add 1 high-activity immobilized Argonaute nuclease particle, such as Figure 1 As shown. Each reaction well of the 8-tube strip contains lyophilized reaction components and 1 immobilized Argonaute nuclease particle. The number of particles is determined according to the enzyme activity and particle size to ensure that the final concentration of the enzyme is 2-5 mg / μL. This lyophilized reagent can be stored at room temperature for 30 days and is transported at room temperature or with ice packs. When in use, add 20 μL of enzyme-free water to the lyophilized components for reconstitution, and then add the nucleic acid molecule to be tested, or 5 μL of negative control. The program selects 65 degrees Celsius for 40 minutes; then 95°C for 40 minutes, and the fluorescence signal of the ROX channel is collected every 1 minute. The gradient of plasmid concentration settings is 3000 copies per microliter, 300 copies per microliter, 30 copies per microliter, 3 copies per microliter, and 0.3 copies per microliter. The results are as shown Figure 2 As shown, the sensitivity of the pre-aliquoted LAMP amplification-Argonaute immobilized nuclease shearing lyophilized tube reagent is 3 copies per microliter.

[0374] Example 2 Single-target LAMP amplification-Argonaute nuclease cleavage-tube detection results

[0375] 1. Extraction-free N gene LAMP amplification-Argonaute nuclease shearing one-tube detection of the new coronavirus SARS-CoV-2 pseudovirus

[0376] The novel coronavirus SARS-CoV-2 pseudovirus contains the N gene and ORF1ab gene fragments.

[0377] The components of the test reagent are shown in the following table:

[0378]

[0379]

[0380] After the components in the above table are configured, add the template and place it on the fluorescence quantitative instrument for amplification-enzyme digestion reaction. The program is set to 65℃ for 40 minutes; 95℃ for 40 minutes, during which the fluorescence signal of the ROX channel is collected every 30 seconds. The template is the negative control and the pseudovirus sample to be tested, where the copy number of the pseudovirus is 600 copies per microliter, 60 copies per microliter, 6 copies per microliter, and 0.6 copies per microliter.

[0381] The results are as follows Figure 3 As shown, the sensitivity of the one-tube detection of the novel coronavirus SARS-CoV-2 pseudovirus extraction-free N gene LAMP amplification-Argonaute nuclease shearing is 6 copies per microliter.

[0382] 2. LAMP amplification-Argonaute nuclease shearing-tube detection of African swine fever virus (ASFV)

[0383] The components of the one-tube test kit for African swine fever are shown in the following table:

[0384] Components Dosage Bst enzyme (8U / μL) 0.8μL 20U / μL thermostable reverse transcriptase 0.2μL dNTPs(10mM) 3.5μL <![CDATA[MgCl2(100mM)]]> 1.5μL 10x BST buffer 2.5μL 2U / μL heat-stable inorganic pyrophosphatase 0.5μL Immobilized Argonaute nuclease 1 capsule 20x ASFV Primers 1.25μL ASFV-gDNA1 (100 μM) 0.5μL ASFV-gDNA2 (100 μM) 0.5μL ASFV-Reporter (10μM) 2μL Enzyme-free water 0.25μL

[0385] After the components in the above table are configured, add the template and place it on the fluorescence quantitative instrument for amplification-enzyme digestion reaction. The program is set to 65℃ for 40 minutes; 95℃ for 40 minutes, during which the fluorescence signal of the FAM channel is collected every 60 seconds. The template is a negative control and a plasmid containing the P72 gene of African swine fever.

[0386] The ASFV plasmid concentration gradient was set as 3000 copies per microliter, 300 copies per microliter, 30 copies per microliter, 3 copies per microliter, and 0.3 copies per microliter. Figure 4 As shown, the sensitivity of the one-tube assay for LAMP amplification of African swine fever virus and shearing with Argonaute immobilized nuclease is 3 copies per microliter.

[0387] 3. LAMP amplification-Argonaute nuclease shearing-tube detection of porcine circovirus type 2 PCV2

[0388] The components of the one-tube test kit for porcine circovirus type 2 are shown in the following table:

[0389]

[0390]

[0391] After the components in the above table are configured, add the template and place it on the fluorescence quantitative instrument for amplification-enzyme digestion reaction. The program is set to 65℃ for 40 minutes and 95℃ for 20 minutes, during which the fluorescence signal of the FAM channel is collected every 60 seconds. The template is a negative control plasmid containing porcine circovirus sequence.

[0392] The concentration gradient of porcine circovirus plasmid was set as 3000 copies per microliter, 300 copies per microliter, 30 copies per microliter, 3 copies per microliter, and 0.3 copies per microliter. Figure 5 As shown, the sensitivity of the PCV2 LAMP amplification-Argonaute immobilized nuclease shearing one-tube assay was 0.3 copies per microliter.

[0393] 4. LAMP amplification-Argonaute nuclease shearing-tube detection of porcine blue ear virus (PRRSV)

[0394] The components of the one-tube test kit for porcine reproductive and respiratory syndrome virus are shown in the following table:

[0395] Components Dosage 8U / μL Bst enzyme 0.8μL 20U / μL thermostable reverse transcriptase 0.2μL dNTPs(10mM) 3.5μL <![CDATA[MgCl2(100mM)]]> 1.5μL 10x BST buffer 2.5μL 2U / μL heat-stable inorganic pyrophosphatase 0.5μL Immobilized Argonaute nuclease 1 capsule 20xPRRSV Primer 1.25μL PRRSV-gDNA1 (100 μM) 0.5μL PRRSV-gDNA2 (100 μM) 0.5μL PRRSV-Reporter (10μM) 2μL Enzyme-free water 0.25μL

[0396] After the components in the table above are configured, add the template and place it on the fluorescence quantitative instrument for amplification-enzyme digestion reaction. The program is set to 65℃ for 30 minutes and 95℃ for 40 minutes, during which the fluorescence signal of the ROX channel is collected every 60 seconds. The template is a negative control and a plasmid containing porcine blue ear virus.

[0397] The concentration gradient of porcine blue ear virus plasmid was set as 3000 copies per microliter, 300 copies per microliter, 30 copies per microliter, 3 copies per microliter, and 0.3 copies per microliter. Figure 6 As shown, the sensitivity of the one-tube assay for LAMP amplification of PRRSV-Argonaute immobilized nuclease shearing was 0.3 copies per microliter.

[0398] 5. LAMP amplification-Argonaute nuclease cleavage-tube detection of feline herpes virus (FHV)

[0399] The components of the one-tube test kit for feline herpes virus are shown in the following table:

[0400]

[0401] After the components in the above table are configured, add the template and place it on the fluorescence quantitative instrument for amplification-enzyme digestion reaction. The program is set to 65℃ for 30 minutes and 95℃ for 20 minutes, during which the fluorescence signal of the FAM channel is collected every 60 seconds. The template is a negative control and a plasmid containing feline herpes virus.

[0402] The concentration gradient of the plasmid of the feline herpes virus fragment was set as 3000 copies per microliter, 300 copies per microliter, 30 copies per microliter, 3 copies per microliter, and 0.3 copies per microliter. Figure 7 As shown, the sensitivity of the FHV LAMP-Argonaute immobilized nuclease shearing one-tube assay was 0.3 copies per microliter.

[0403] Example 3 One-tube detection reaction of LAMP amplification-enzyme cleavage dual targets

[0404] 1. The reaction components of the LAMP amplification-enzyme digestion one-tube test for the dual targets of 2019-nCoV and influenza A are shown in the following table:

[0405]

[0406]

[0407] After the components in the above table are configured, add 5 μL of the template to be tested, place it on the fluorescence quantitative instrument for amplification-enzyme digestion reaction, and collect the fluorescence signals of FAM and ROX dual channels in real time during the enzyme digestion step. The templates are negative control, plasmid containing the new coronavirus N gene, and plasmid containing influenza A virus.

[0408] The concentration gradient of the plasmids of the novel coronavirus N gene and influenza A virus was set as 3000 copies per microliter, 300 copies per microliter, 30 copies per microliter, 3 copies per microliter, and 0.3 copies per microliter. Figure 8 As shown, the sensitivity of the LAMP amplification-Argonaute immobilized nuclease shearing one-tube detection of the dual targets of the new coronavirus and influenza A virus is 30 copies per microliter of the N gene plasmid of the new coronavirus and 30 copies per microliter of the influenza A plasmid.

[0409] 2. The reaction components of the LAMP amplification-enzyme digestion one-tube test for the dual targets of the SARS-CoV-2 N gene and the human RNase P20 gene are shown in the following table:

[0410]

[0411]

[0412] After the components in the above table are configured, add 5 μL of the template to be tested, place it on the fluorescence quantitative instrument for amplification-enzyme digestion reaction, and collect the fluorescence signals of FAM and ROX dual channels in real time during the enzyme digestion step. The templates are negative control, plasmid containing the new coronavirus, and plasmid containing the human internal reference gene.

[0413] The concentration gradient of the plasmids of the novel coronavirus N gene and human RNase P20 gene was set as 3000 copies per microliter, 300 copies per microliter, 30 copies per microliter, 3 copies per microliter, and 0.3 copies per microliter. Fig. 9 As shown, under the LAMP amplification-Argonaute immobilized nuclease shearing one-tube detection conditions of the dual targets of the new coronavirus N gene and the human RNase P20 gene, the sensitivity of the new coronavirus N gene plasmid was 30 copies per microliter, and the sensitivity of the human RNase P20 gene was 30 copies per microliter.

[0414] Example 4 Preparation of RAA Amplification-Enzyme Digestion Tube Detection Reagent

[0415] The reaction components of the recombinase polymerase amplification-enzyme digestion-tube test are shown in the following table:

[0416]

[0417]

[0418] After the components in the table above are configured, add 10 μL of the template to be tested and place it on the fluorescence quantitative instrument for amplification-enzyme digestion reaction. The program is set to 37°C for 30 minutes; 95°C for 30 seconds, 40 cycles, and collect the fluorescence signal of the FAM channel once in this step. The template is a negative control and a plasmid containing a new coronavirus.

[0419] The concentration gradient of the plasmid of the novel coronavirus N gene fragment was set as 3000 copies per microliter, 300 copies per microliter, 30 copies per microliter, 3 copies per microliter, and 0.3 copies per microliter. Fig.10 As shown, the sensitivity of the one-tube assay for RAA amplification of N gene plasmid and shearing with Argonaute immobilized nuclease was 0.3 copies per microliter.

[0420] Example 5 African swine fever double gDNA and downstream gDNA detection

[0421] Comparison of the results of African swine fever double gDNA and single gDNA one-tube detection, configuration of reaction system:

[0422] (1) Dual gDNA system

[0423]

[0424] (2) Single gDNA system

[0425]

[0426] After the configuration is complete, add 5 μL of template and perform LAMP amplification-enzyme digestion reaction. The program is set to 65℃ for 40 minutes and 95℃ for 30 minutes, and collect the signal of FAM fluorescence channel every 60 seconds. The results are as follows: Fig.11 shown.

[0427] The template is a plasmid molecule containing African swine fever, and the copy numbers are 3000 copies per microliter, 300 copies per microliter, 30 copies per microliter, 3 copies per microliter, and 0.3 copies per microliter. The results are as follows Fig.11 As shown, the sensitivity of LAMP amplification-Argonaute immobilized nuclease shearing-tube detection of double gDNA and downstream gDNA African swine fever plasmid was 3 copies per microliter, and the curves were relatively consistent.

[0428] The results showed that under this reaction condition, the sensitivity of double gDNA was consistent with that of single gDNA.

[0429] The above embodiment is only for illustrating the technical concept and features of the present invention, and is a preferred embodiment, and its purpose is to enable technicians in the professional field to understand the content of the present invention and implement it accordingly, and it cannot be used to limit the protection scope of the present invention. Any equivalent transformation or modification made according to the principle of the present invention should be included in the protection scope of the present invention.

[0430] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A one-tube nucleic acid detection reaction system, characterized in that: The reaction system contains an amplification system and an enzyme cleavage system containing immobilized Argonaute nuclease.

2. The reaction system according to claim 1, characterized in that The amplification includes LAMP amplification and recombinase polymerase amplification.

3. The reaction system according to claim 2, characterized in that The recombinase polymerase amplification includes RPA, RAA, MIRA, ERA, or a combination thereof.

4. The reaction system according to claim 1, characterized in that The Argonaute nuclease includes a thermostable Argonaute nuclease.

5. The reaction system according to claim 4, characterized in that The thermostable Argonaute nuclease includes PfAgo, MfAgo, TtAgo, MpAgo, ThAgo, TpsAgo, or a combination thereof.

6. The reaction system according to claim 4, characterized in that The immobilized Argonaute nuclease includes a lyophilized formulation of the thermostable Argonaute nuclease.

7. The reaction system according to claim 1, characterized in that The nucleic acid detection includes single and multiple nucleic acid detection.

8. The reaction system according to claim 1, characterized in that The nucleic acids are derived from the following species: Novel coronavirus (SARS-CoV-2), influenza A virus (IAV), influenza B virus (IBV), African swine fever virus (AFSV), porcine respiratory and reproductive syndrome virus (PRRSV), porcine circovirus type 2 (PCV2), feline herpesvirus (FHV), or a combination thereof.

9. A kit for nucleic acid target detection, characterized in that: The kit contains the detection system as claimed in claim 1 or reagents for preparing the detection system, instructions for use describing a method for detecting a target nucleic acid using the detection system, or a combination thereof.

10. A method for detecting the presence of a target nucleic acid molecule in a sample, comprising the following steps: (a) providing the detection system as claimed in claim 1; and (b) reacting the detection system with a sample to be detected at a certain temperature to form a first reaction solution; (c) performing fluorescence detection on the first reaction solution to obtain a fluorescence signal value; Wherein, if a fluorescence signal value is detected in the first reaction solution, it indicates that the target nucleic acid molecule exists in the sample; and if no fluorescence signal value is detected in the first reaction solution, it indicates that the target nucleic acid molecule does not exist in the sample.

Images