Adas comprising type 1 film

Abstract

Provided herein are non-chromosomal dynamically active systems comprising Type 1 pili (T1P) and methods of making and using the same.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of priority to U.S. Provisional Application No. 63 / 354,979, filed on June 23, 2022, which is incorporated herein by reference in its entirety.

[0003] Sequence Listing

[0004] This application contains a sequence listing, which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. The XML copy created on June 20, 2023 is named 51296-056WO2_Sequence_Listing_6_20_23 and is 46,583 bytes in size. Technical Field

[0005] Provided herein are non-chromosomal dynamic activity systems comprising type 1 pili (T1P) and methods of making and using the same. Background Art

[0006] There is a need for delivery vectors that can target mammalian cells and deliver biological agents; compositions containing such delivery vectors; and related methods of delivering the vectors to cells, thereby modulating biological systems including mammalian cells and organisms. In particular, there is a need for delivery vectors that have tropism for target cells. Summary of the invention

[0007] In one aspect, the disclosure features a formulation comprising a plurality of non-chromosomal dynamic active systems (ADAS) derived from a parent bacterial cell genetically engineered to constitutively express type 1 pili (T1P), wherein the plurality of ADAS binds to a target cell via the T1P.

[0008] In one aspect, the disclosure features a plurality of non-chromosomal dynamic activity systems (ADAS) comprising type 1 pili (T1P), wherein the ADAS is derived from a parent bacterial cell that constitutively expresses components of the T1P.

[0009] In some embodiments, the parent cell comprises a modified fimS promoter operably linked to a component of the T1P and directs constitutive expression of the component.

[0010] In some embodiments, the components of T1P are encoded by the fim operon.

[0011] In some embodiments, the parent cell comprises a modified fimS promoter operably linked to the fim operon, wherein the modified fimS promoter comprises a mutation at a recombinase cleavage site that prevents the fimS promoter from recombining into an 'OFF' orientation.

[0012] In some embodiments, the parent cell expresses a component of the T1P at a level at least 1.5-fold higher than the level observed in the unmodified parent cell.

[0013] In some embodiments, said ADAS comprises said T1P at a level at least 1.5-fold higher than that observed in a plurality of ADAS produced by an unmodified parent cell.

[0014] In some embodiments, the proportion of multiple ADAS comprising T1P is increased relative to the multiple ADAS produced by a parent cell that does not constitutively express components of T1P.

[0015] In some embodiments, the parent cell comprises an endogenous fim operon.

[0016] In some embodiments, the parent cell is an Escherichia coli (E. coli) bacterium. In some embodiments, the E. coli bacterium is E. coli CFT073.

[0017] In some embodiments, the parent cell comprises one or more heterologous nucleotide sequences encoding components of the T1P. In some embodiments, the one or more heterologous nucleotide sequences comprise a fim operon. In some embodiments, the fim operon is the fim operon of Escherichia coli CFT073.

[0018] In some embodiments, the one or more heterologous nucleotide sequences comprise a sequence that is at least 90% identical to the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the one or more heterologous nucleotide sequences comprise a sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the one or more heterologous nucleotide sequences comprise a nucleotide sequence of SEQ ID NO: 1.

[0019] In some embodiments, the one or more heterologous nucleotide sequences further comprise a constitutive promoter operably linked to the fim operon.

[0020] In some embodiments, the constitutive promoter is a modified fimS promoter comprising a mutation at the recombinase cleavage site that prevents the fimS promoter from recombining into an 'off' orientation.

[0021] In some embodiments, the one or more nucleotide sequences encoding the components of T1P are carried on a vector. In some embodiments, the parent bacterial cell has been transiently transformed with the vector. In some embodiments, the parent bacterial cell has been stably transformed with the vector.

[0022] In certain embodiments, the parent cell is a gram-negative bacterial cell. In certain embodiments, the gram-negative bacterial cell is an Escherichia coli, Salmonella, Yersinia, Vibrio, Pseudomonas, Shigella or Legionella bacterial cell.

[0023] In some embodiments, the parent cell does not comprise an intact endogenous fim operon.

[0024] In some embodiments, the parental cell has not been exposed to culture conditions that promote expression of the fim operon. In some embodiments, the culture conditions are temperature, pH, osmotic pressure, oscillation, or activation of a stress response or stringent response.

[0025] In some embodiments, the ADAS comprises a payload.

[0026] In some embodiments, the cargo is a nucleic acid, a plasmid, a polypeptide, a protein, an enzyme, an amino acid, a small molecule, a gene editing system, a hormone, an immunomodulator, a carbohydrate, a lipid, an organic particle, an inorganic particle, or a ribonucleoprotein complex (RNP).

[0027] In some embodiments, the payload is encapsulated by the ADAS. In some embodiments, the payload is attached to a surface of the ADAS.

[0028] In some embodiments, the ADAS comprises a heterologous bacterial secretion system. In some embodiments, the heterologous bacterial secretion system is a type 3 secretion system (T3SS).

[0029] In some embodiments, the cargo comprises a moiety that directs export of the bacterial secretion system.

[0030] In another aspect, the disclosure features a composition including a plurality of ADAS of any of the above embodiments.

[0031] In some embodiments, the composition is formulated for delivery to a mammal. In some embodiments, the composition is formulated for oral delivery.

[0032] In another aspect, the disclosure features a method for delivering ADAS to a cell, the method comprising (a) providing a composition comprising a plurality of ADAS of any one of the above embodiments; and (b) contacting the cell with the composition of step (a).

[0033] In some embodiments, delivery of the ADAS to the cell is increased by at least 10% relative to ADAS derived from an unmodified parent cell.

[0034] In some embodiments, an effective amount of said ADAS is delivered to the cell at a dosage that is at least 10% lower than the dosage required for ADAS derived from the unmodified parent cell.

[0035] In another aspect, the disclosure features a method for delivering a cargo to a cell, the method comprising (a) providing a composition comprising a plurality of ADAS of any one of the above embodiments, wherein the ADAS further comprises a cargo; and (b) contacting the cell with the composition of step (a).

[0036] In some embodiments, the ADAS further comprises a heterologous bacterial secretion system. In some embodiments, the heterologous bacterial secretion system is a T3SS.

[0037] In some embodiments, the delivering is to the cytoplasm of a cell.

[0038] In some embodiments, delivery of the cargo to the cell is increased by at least 10% relative to ADAS derived from an unmodified parent cell.

[0039] In some embodiments, an effective amount of the cargo is delivered to the cell at a dose that is at least 10% lower than the dose required for ADAS derived from the unmodified parent cell.

[0040] In another aspect, the disclosure features a method of regulating a cell, the method comprising (a) providing a composition comprising a plurality of ADAS of any one of the above embodiments; and (b) contacting the cell with the composition of step (a), thereby regulating the cell.

[0041] In some embodiments, the cell is a mammalian cell.

[0042] In some embodiments, the mammalian cell is an intestinal cell. In some embodiments, the intestinal cell is a gut-associated lymphoid tissue (GALT) cell, a Peyer's patch cell, an M cell, a lamina propria cell, a small intestinal cell, or a large intestinal cell.

[0043] In some embodiments, the mammalian cell is a bladder cell.

[0044] In some embodiments, the mammalian cell is an immune cell.

[0045] In some embodiments, the mammalian cell is a blood-brain barrier cell.

[0046] In some embodiments, the mammalian cell is a mannosyling cell.

[0047] In another aspect, the disclosure features a method of treating a mammal in need thereof, the method comprising (a) providing a composition comprising a plurality of ADAS of any one of the above embodiments; and (b) contacting the mammal with an effective amount of the composition of step (a), thereby treating the mammal.

[0048] In some embodiments, a therapeutic effect is achieved at a dosage that is at least 10% lower than the dosage required for ADAS derived from the unmodified parent cell.

[0049] In another aspect, the disclosure features an ADAS comprising a T1P derived from a parent bacterial cell, wherein the ADAS is produced by a method comprising the steps of: (a) providing a parent cell modified to constitutively express a component of T1P; and (b) producing ADAS from the parent bacterial cell, wherein the ADAS comprises the T1P.

[0050] In another aspect, the disclosure features an ADAS comprising a T1P derived from a parent bacterial cell, wherein the ADAS is produced by a method comprising the steps of: (a) providing a parent cell modified to express a component of a native T1P at a level at least 1.5-fold higher than that observed in the unmodified parent cell; and (b) producing ADAS from the parent bacterial cell, wherein the ADAS comprises a T1P native to the parent cell.

[0051] In another aspect, the disclosure features an ADAS comprising a T1P derived from a parent bacterial cell, wherein the ADAS is produced by a method comprising the steps of: (a) providing a parent cell modified to express a component of a heterologous T1P; and (b) producing ADAS from the parent bacterial cell, wherein the ADAS comprises a T1P that is heterologous to the parent cell.

[0052] In another aspect, the disclosure features an engineered bacterium that constitutively expresses a component of a T1P, wherein the engineered bacterium comprises the T1P at a level that is at least 1.5-fold higher than the level of T1P comprised by a non-engineered bacterium.

[0053] In some embodiments, the T1P is a native T1P. In other aspects, the T1P is a heterologous T1P.

[0054] In another aspect, the disclosure features an engineered bacterium that constitutively expresses a component of T1P, wherein the bacterium has been modified to produce ADAS.

[0055] In another aspect, the disclosure features a method for producing ADAS, the method comprising the steps of: (a) providing an engineered bacterium that constitutively expresses a component of T1P; and (b) producing ADAS from the bacterium.

[0056] In another aspect, the disclosure features an ADAS produced according to any of the above methods.

[0057] Other features and advantages of the invention will be apparent from the following detailed description, and from the claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0058] Figure 1 Schematic diagram showing two conformations of the fim operon, which contains a gene encoding type 1 pili (T1P). The promoter (fimS) is phase-variable and flanked by inverted repeat (IR) sites (as shown in the box diagram) that can be cut by site-specific recombinases fimB and fimE. Cutting and inversion of the promoter causes the promoter to transition between an 'ON' orientation (promoter facing the operon; expressing the fim operon) and an 'OFF' orientation (promoter facing the operon, not expressing the fim operon). The recombinase cleavage site targeted by λ-RED recombineering to produce a locked (LON) version of the operon is shown in green.

[0059] Figure 2 is a set of electron micrographs showing the non-chromosomal dynamic activity system (ADAS) derived from control K12 E. coli (strain BW25113) and pathogenic E. coli (strain CFT073) parental cells or from parental cells that have been engineered to contain a locked (LON) version (LON T1P) of the fim operon.

[0060] Figure 3 Figure 2 shows the hemagglutination titers of control parent bacterial cells (E. coli strains BW25113 and CFT073), parent bacterial cells that have been engineered to contain the LON version of the fim operon (LON T1P), and ADAS produced therefrom (2 x A set of bar graphs (dilution series). Parental cells or ADAS were serially diluted in PBS and contacted with guinea pig RBCs. PBS containing exogenous mannose was included as a functional control.

[0061] Figure 4 is a bar graph showing the number of ADAS counted per HT-29 cell nucleus as measured in an assay of binding of ADAS produced by BW25113 or BW25113LON T1P parental cells to the human colorectal cancer cell line HT-29. A formulation containing exogenous mannose was provided as a control. DETAILED DESCRIPTION

[0062] I. Definitions

[0063] As used herein, the term "non-chromosomal dynamic system" or "ADAS" refers to a genome-free non-replicating closed membrane system comprising at least one membrane and having an internal volume suitable for accommodating a load (e.g., one or more of the following: nucleic acids, plasmids, polypeptides, proteins, enzymes, amino acids, small molecules, gene editing systems, hormones, immunomodulators, carbohydrates, lipids, organic particles, inorganic particles, or ribonucleoprotein complexes (RNPs)). In some embodiments, ADAS is a miniature cell or a modified miniature cell derived from a parent bacterial cell (e.g., a Gram-negative or Gram-positive bacterial cell). In other aspects, ADAS is derived from a parent cell by modifying the parent cell to remove the genome, and is substantially similar in size to the parent cell. Any suitable method can be used, such as genetic manipulation of the parent cell or exposure to a culture or condition that increases the possibility of bacterial miniature cell formation to derive ADAS from the parent bacterium. An exemplary method for preparing ADAS is a method of destroying the cell division mechanism of the parent cell. In some embodiments, ADAS may include one or more endogenous or heterologous features of the parent cell surface, for example, cell wall, cell wall modification, flagella or pili (e.g., type 1 pili (T1P)), and / or one or more endogenous or heterologous features of the parent cell internal volume, for example, nucleic acids, plasmids, proteins, small molecules, transcription mechanisms or translation mechanisms. In other embodiments, ADAS may lack one or more features of the parent cell. In still other embodiments, ADAS may be loaded with features that the parent cell does not include, or otherwise modified by the features.

[0064] As used herein, the term "T1P-ADAS" refers to ADAS comprising type 1 pili (T1P) at or above a detectable threshold level. T1P can be detected using, for example, a red blood cell (RBC) hemagglutination assay, as described herein.

[0065] As used herein, as used with reference to T1P, the terms "constitutive expression" and "constitutively expressed" refer to a state in which one or more nucleic acid sequences encoding components of T1P are expressed (e.g., transcribed and translated (e.g., expressed by a bacterial cell, ADAS, or other system comprising the one or more nucleic acid sequences)) regardless of environmental conditions, i.e., a state in which the expression of one or more nucleic acid sequences encoding components of T1P cannot be turned off.

[0066] As used herein, the term "endogenous type 1 pili" or "endogenous T1P" refers to a T1P that is present on a cell (e.g., a parent cell) or an ADAS derived therefrom and that is naturally encoded by the cell (e.g., encoded by a wild-type version of the cell). T1P can be expressed by an endogenous gene of the cell (e.g., an endogenous fim operon), and / or can be encoded and expressed by a synthetic construct in the cell. The expression or abundance of endogenous T1P can be increased, for example, by adding a moiety that increases the abundance of T1P (e.g., a transcriptional activator of T1P) or by reducing or removing a negative regulator of T1P expression. In some embodiments, the expression of T1P is increased by modifying or replacing the natural promoter of the endogenous gene encoding T1P, for example, modifying the fimS promoter (e.g., a modification that locks the fimS promoter in an "on" configuration).

[0067] As used herein, the term "heterologous type 1 pilus" or "heterologous T1P" refers to a T1P that is present on a cell (e.g., a parent cell) or an ADAS derived therefrom and is not naturally encoded by the cell (e.g., not encoded by the wild-type version of the cell). The cell may encode another T1P, or may not encode any T1P. In some embodiments, the T1P is expressed by one or more synthetic constructs in the cell.

[0068] As used herein, the term "highly active ADAS" refers to ADAS (e.g., T1P-ADAS) with high work potential, for example, ADAS with the ability to perform a large amount of useful work. Work can be metabolic work, including chemical synthesis (e.g., protein, nucleic acid, lipid, carbohydrate, polymer or small molecule) under suitable conditions, chemical modification or transport (e.g., input, output or secretion, such as secretion by a bacterial secretion system (e.g., T3SS)). In certain embodiments, highly active ADAS starts with a large amount of energy, for example, energy in the form of ATP. In other embodiments, ADAS has the ability to absorb or generate energy / ATP from another source. Highly active ADAS can be identified by the following, for example, ATP concentration increases, the ability to produce ATP increases, the ability to produce protein increases, the rate or amount of protein production increases, and / or the responsiveness to biological signals, for example, the induction of promoters increases.

[0069] As used herein, the term "parent bacterial cell" refers to a cell (e.g., a Gram-negative or Gram-positive bacterial cell) from which ADAS (e.g., T1P-ADAS) is derived. The parent bacterial cell is typically a living bacterial cell. The term "living bacterial cell" refers to a bacterial cell that contains a genome and is capable of cell division. Preferred parent bacterial cells are derived from any strain in Table 1.

[0070] An ADAS composition or formulation that is "substantially free" of parent bacterial cells and / or live bacterial cells is defined herein as a composition having no more than 500, e.g., 400, 300, 200, 150, 100 or less colony forming units (CFU) / mL. An ADAS composition that is substantially free of parent bacterial cells or live bacterial cells may include less than 50, less than 25, less than 10, less than 5, less than 1, less than 0.1, or less than 0.001 CFU / mL. No bacterial cells are included.

[0071] As used herein, the term "endogenous type 3 secretion system" or "endogenous T3SS" refers to a T3SS that is present on a cell (e.g., a parent cell) or an ADAS derived therefrom and that is naturally encoded by the cell (e.g., encoded by a wild-type version of the cell). The T3SS can be expressed by an endogenous gene of the cell, and / or can be encoded and expressed by a synthetic construct in the cell. The expression or abundance of the endogenous T3SS can be increased, for example, by adding a portion that increases the abundance of the T3SS (e.g., a transcriptional activator of the T3SS) or by reducing or removing a negative regulator of T3SS expression.

[0072] As used herein, the term "heterologous type 3 secretion system" or "heterologous T3SS" refers to a T3SS that is present on a cell (e.g., a parent cell) or an ADAS derived therefrom and is not naturally encoded by the cell (e.g., not encoded by the wild-type version of the cell). The cell may encode another T3SS, or may not encode any T3SS. In some embodiments, the T3SS is expressed by a synthetic construct in the cell.

[0073] As used herein, an "endogenous effector" of a secretion system (e.g., a T3SS, T4SS, or T6SS) is a portion (e.g., a protein or polypeptide) that is naturally encoded by the cell from which the secretion system (e.g., T3SS) is derived (e.g., encoded by a wild-type version of the cell) and is capable of being secreted by the secretion system. One or more of the secretion system and its endogenous effectors may be expressed in the cell in which they naturally occur, or may be heterologously expressed, e.g., by a cell that does not naturally encode the endogenous effector or secretion system.

[0074] As used herein, an effector that is heterologous to a secretion system ("heterologous effector") is a moiety (e.g., a protein or polypeptide) that is not naturally encoded by the cell from which the secretion system (e.g., T3SS) is derived (e.g., not encoded by the wild-type version of the cell) and is capable of being secreted by the secretion system of the cell from which the heterologous effector is derived. The effector may be capable of being secreted by a secretion system to which it is heterologous, or may be modified to be secreted by a secretion system to which it is heterologous. In some embodiments, the heterologous effector is an effector of a T4SS or T6SS that is secreted by a T3SS.

[0075] As used herein, the "cargo" of a secretion system (e.g., T3SS) is a part that can be secreted by a secretion system (e.g., delivered to the cytoplasm of a host cell or delivered to the extracellular space). The cargo can be an endogenous effector of a secretion system, a heterologous effector, or a part that is not naturally secreted by any secretion system. The cargo can be, for example, a protein or polypeptide (e.g., an enzyme (e.g., a metabolic enzyme)), a DNA modifier (e.g., a component of a CRISPR system), a chromatin remodeler, a gene editor, a nuclear targeting agent (e.g., a transcription factor), a binding agent (e.g., an antibody or an antibody fragment, such as a VHH molecule), an immunogenic agent (e.g., an immunostimulant or an immunosuppressant), or a toxin. The cargo can be modified to be secreted by a secretion system, for example, by adding a secretion signal (e.g., an N-terminal secretion signal), such as the secretion signal provided in Table 3.

[0076] As used herein, the term "percentage identity" refers to the sequence identity percentage (%) relative to a reference polynucleotide or polypeptide sequence after comparison by standard techniques. The comparison for determining the purpose of nucleic acid or amino acid sequence identity percentage can be realized in various ways within the capabilities of those skilled in the art, for example, using publicly available computer software, such as BLAST, BLAST-2, PSI-BLAST or Megalign software. Those skilled in the art can determine the appropriate parameters for aligning sequences, including any algorithm required for maximum alignment on the full length of the compared sequences. For example, the sequence comparison computer program BLAST can be used to produce sequence identity value percentage. As an illustration, the sequence identity percentage of a given nucleic acid or amino acid sequence A with, compared to or relative to a given nucleic acid or amino acid sequence B (which can be alternatively expressed as the following phrase: with, compared to or relative to a given nucleic acid or amino acid sequence B having a given nucleic acid or amino acid sequence A of a certain sequence identity percentage) is calculated as follows:

[0077] 100×(fraction X / Y)

[0078] wherein X is the number of nucleotides or amino acids scored as identical matches by a sequence alignment program (e.g., BLAST) in an alignment of A and B, and wherein Y is the total number of nucleotides or amino acids in B. In some embodiments, for example, in homologs of MinE or DivIVA proteins, the sequence identity to the native sequence MinE (or minE) or DivIVA (or divIVA) sequence disclosed herein will have at least about 40%, 50%, 60%, 70%, 80%, 85%, 90% or even 95% or greater amino acid or nucleic acid sequence identity, alternatively, at least about 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or greater amino acid or nucleic acid sequence identity.

[0079] As used herein, the phrase "modulating the state of a cell" refers to an observable change in the state of a cell (e.g., a mammalian cell) (e.g., a transcriptome, a proteome, an epigenome, a biological effect, or a healthy or diseased state) as measured using techniques and methods known in the measurement field (e.g., methods of measuring the level or expression of a protein, a transcript, an epigenetic marker, or an increase or decrease in the activity of a biological pathway). Modulating the state of a cell may result in a change of at least 1% relative to before administration (e.g., a change of at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or at least 98% or more relative to before administration; for example, a change of up to 100% relative to before administration). In some embodiments, modulating the state of a cell involves a cell increasing a parameter of the cell (e.g., a level or expression of a protein, a transcript, or the activity of a biological pathway). Increasing the state of a cell may result in a parameter being increased by at least 1% relative to before administration (e.g., an increase of at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or at least 98% or more relative to before administration; e.g., an increase of up to 100% relative to before administration). In other embodiments, modulating a state involves decreasing a parameter of a cell (e.g., the level or expression of a protein, transcript, or the activity of a biological pathway). Reducing the state of the cell may result in a decrease in the parameter by at least 1% relative to before administration (e.g., a decrease of at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or at least 98% or more relative to before administration; e.g., a decrease of up to 100% relative to before administration).

[0080] As used herein, the term "heterologous" refers to a cell or composition that is not naturally present. In some embodiments, "heterologous" refers to a molecule; for example, a T1P, a component thereof, or a nucleic acid or cargo encoding it (e.g., a polypeptide, a nucleic acid such as an RNA or tRNA encoding a protein or a small molecule) or a structure (e.g., a plasmid or a gene editing system) that is not naturally present in ADAS or a parent bacterium that produces ADAS (e.g., a Gram-negative bacterial cell or a Gram-positive bacterial cell).

[0081] II. Composition

[0082] A. ADAS containing type 1 pili

[0083] "ADAS" is a genome-free non-replicating closed membrane system comprising at least one membrane (in some embodiments, two membranes, wherein the two membranes are disjoint) and having an internal volume suitable for accommodating a load (e.g., nucleic acids, plasmids, polypeptides, proteins, enzymes, amino acids, small molecules, gene editing systems, hormones, immunomodulators, carbohydrates, lipids, organic particles, inorganic particles, or ribonucleoprotein complexes (RNPs)). In some embodiments, ADAS is a miniature cell or a modified miniature cell derived from a parent bacterial cell (e.g., a Gram-negative or Gram-positive bacterial cell). Any suitable method can be used, such as genetic manipulation of the parent cell or exposure to a culture or condition that increases the possibility of bacterial miniature cell formation to derive ADAS from the parent bacterium. Exemplary methods for producing ADAS are provided in WO 2020 / 123569.

[0084] The present invention is based, at least in part, on the development by the applicant of ADAS comprising type 1 pili (T1P-ADAS). T1P is a hair-like structure present on the surface of bacteria. They have been shown to promote tropism to intestinal areas (e.g., Peyer's patches) and other body parts and cell types. ADAS comprising T1P on its surface can be derived from a parent bacterium comprising T1P on its surface. However, the expression of genes encoding components of T1P (fim operon) is controlled by phase-variable promoters, and the production of T1P can be turned off in response to growth conditions (Zhang et al., Proc Natl Acad Sci USA [Proceedings of the National Academy of Sciences of the United States], 113 (15): 4182-4187, 2016), making it difficult to consistently produce T1P-ADAS from parent cells. In addition, not all desired parent bacteria have a functional copy of the fim operon. The present invention provides ADAS derived from a parent bacterial cell that constitutively expresses components of T1P and / or comprises one or more heterologous nucleotide sequences encoding components of T1P; methods of producing the same; and methods of delivering such ADAS and / or its cargo to cells.

[0085] In some embodiments, ADAS has a long axis cross section between about 100nm-500μm (e.g., in some embodiments, about: 100-600nm, such as 100-400nm; or between about 0.5-10μm and 10-500μm). In some embodiments, the short axis cross section of ADAS is between about: 0.001%, 0.01%, 0.1%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% to 100% of the long axis. In some embodiments, ADAS has about: 0.001-1μm 3 , 0.3-5μm 3 、5-4000μm 3 or 4000-50x10 7 μm 3 In some embodiments, the size of the ADAS is substantially similar to that of the parent cell, for example, the size (e.g., internal volume, major axis cross-section, and / or minor axis cross-section) is about 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the size of the parent cell, the size is the same as the size of the parent cell, or the size is about 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, or 110% of the size of the parent cell.

[0086] ADAS can be derived from various sources, including a parent bacterial strain engineered or induced to produce a genome-free closed membrane system ("parent strain"); a genome-excised bacterium; an extract of a bacterial cell preparation (e.g., by mechanical or other means); or a fully synthesized product, optionally including a fraction of a bacterial cell preparation.

[0087] i. ADAS derived from parental cells constitutively expressing T1P components

[0088] In some aspects, the disclosure features a plurality of non-chromosomal dynamic active systems (T1P-ADAS) comprising type 1 pili, wherein the ADAS is derived from a parent bacterial cell that constitutively expresses components of T1P. In some embodiments, the components of T1P comprise FimA, FimI, FimC, FimD, FimF, FimG, and FimH genes.

[0089] In some embodiments, the parent cell comprises a modified fimS promoter operably linked to and directing constitutive expression of the components of the T1P. In some embodiments, the components of the T1P are encoded by the fim operon. In some aspects, the fim operon comprises genes encoding FimA, FimI, FimC, FimD, FimF, FimG, and FimH.

[0090] The fimS promoter is flanked by two recombination sites, and the cleavage and recombination at these sites allow the promoter to switch between an "on" and a "off" configuration. In some embodiments, the parent cell comprises a modified fimS promoter operably connected to the fim operon, wherein the modified fimS promoter comprises a mutation preventing the fimS promoter from being recombined into a 'off' orientation at the recombinase cleavage site. In some embodiments, the recombination site comprising the mutation is upstream of the fimS promoter. In other embodiments, the recombination site comprising the mutation is downstream of the fimS promoter. In still other embodiments, both the upstream and downstream recombination sites are mutated. Exemplary mutations in the upstream (left) recombination site are shown in SEQ ID NOs: 4-7. SEQ ID NO: 4 shows the wild-type sequence of the fimS site of the Escherichia coli strain CFT073 in the 'on' orientation; SEQ ID NO: 5 shows a version of this fimS site, which comprises a mutation in the left inverted repeat site that locks the promoter in the 'on' orientation. SEQ ID NO:6 shows the wild-type sequence of the fimS site of E. coli strain MG1655 in the 'open' orientation; SEQ ID NO:7 shows a version of this fimS site containing a mutation in the left inverted repeat site that locks the promoter in the 'open' orientation. In other aspects, the parent cell comprises a constitutive promoter (e.g., J23100, J23101, J23102, J23103, J23104, J23105, J23106, J23107, J23108, J23109, J23110, J23111, J23112, J23113, J23114, J23115, J23116, J23117, J23118, J23119, J23150 or J23151 promoter) operably linked to a component of the T1P (e.g., the fim operon) and directs its constitutive expression. Exemplary promoter sequences are provided, for example, at the iGEM Standard Biological Parts Registry. In some aspects, the endogenous fimS promoter has been replaced by a constitutive promoter.

[0091] In other aspects, the disclosure features a plurality of T1P-ADAS, wherein the ADAS is derived from a parent bacterial cell that can be induced to express a component of T1P. In some aspects, the parent cell comprises an inducible promoter (e.g., pTac, pTrp, Para, RLac, pTet or pRha promoter) that is operably linked to a component of T1P (e.g., fim operon) and directs its inducible expression. In some aspects, the endogenous fimS promoter has been replaced by an inducible promoter.

[0092] In some embodiments, the parent cell is an E. coli bacterium. In some embodiments, the E. coli bacterium is E. coli CFT073.

[0093] In some embodiments, the parent cell expresses a component of T1P at a level that is at least 1.1-fold higher than the level observed in the unmodified parent cell (e.g., at least 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 35-fold, 40-fold, 45-fold, 50-fold, or 100-fold or more than 100-fold higher than the level observed in the unmodified parent cell, such as 1- to 2-fold, 2- to 5-fold, 5- to 10-fold, 10- to 20-fold, 20- to 30-fold, 30- to 40-fold, 40- to 50-fold, 50- to 100-fold, or more than 100-fold higher than the level observed in the unmodified parent cell). In some embodiments, the parent cell expresses a component of the T1P at a level at least 1.5-fold higher than the level observed in the unmodified parent cell.

[0094] In some embodiments, the ADAS comprises T1P at a level that is at least 1.1-fold higher than the level observed in a plurality of ADAS produced by a control (e.g., unmodified) parental cell (e.g., at least 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 3-fold, 4-fold, 5-fold higher than the level observed in a plurality of ADAS produced by a control parental cell). In some embodiments, the ADAS comprises T1P at a level that is at least 1.5-fold higher than the level observed in a plurality of ADAS produced by a control parental cell.

[0095] In some embodiments, the proportion of multiple ADAS comprising T1P is increased relative to the multiple ADAS produced by a parent cell that does not constitutively express a component of T1P, e.g., by at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more than 100% (e.g., by 1%-5%, 5%-10%, 10%-20%, 20%-30%, 30%-40%, 40%-50%, 50%-60%, 60%-70%, 70%-80%, 80%-90%, 90%-100%, or more than 100%).

[0096] In some aspects, the disclosure provides an ADAS comprising a T1P derived from a parent bacterial cell, wherein the ADAS is produced by a method comprising the steps of: (a) providing a parent cell modified to express a component of a native T1P at a level that is at least 1.5 times higher than the level observed in the unmodified parent cell (e.g., at least 1.6 times, 1.7 times, 1.8 times, 1.9 times, 2 times, 2.5 times, 3 times, 4 times, 5 times, 6 times higher than the level observed in the unmodified parent cell); , 7-fold, 8-fold, 9-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 35-fold, 40-fold, 45-fold, 50-fold, or 100-fold or more than 100-fold, such as 1-fold to 2-fold, 2-fold to 5-fold, 5-fold to 10-fold, 10-fold to 20-fold, 20-fold to 30-fold, 30-fold to 40-fold, 40-fold to 50-fold, 50-fold to 100-fold higher than the level observed in the unmodified parental cell); and (b) producing ADAS from the parent bacterial cell, wherein the ADAS comprises T1P that is native to the parental cell. In some embodiments, the comparison between T1P-ADAS and the unmodified parental cell is performed under conditions where the unmodified parental cell does not produce T1P or produces T1P at a low level. In unmodified bacterial cells, the native promoter of type 1 pili (T1P), fimS, is phase variable and can switch between 'on' and 'off' orientations in response to a variety of signals, including temperature, pH, osmotic pressure, and stress and stringent responses. In the laboratory, growing E. coli in LB broth at 37°C with shaking (standard growth conditions for E. coli) promotes the maintenance of the fimS switch in the 'off' orientation. Switching growth to 37°C, static (rather than shaking), promotes the maintenance of the fimS switch in the 'on' orientation.

[0097] Thus, in some aspects, the disclosure provides an ADS comprising a T1P derived from a parent bacterial cell that has not been exposed to culture conditions that promote expression of a fim operon (e.g., not exposed to such conditions prior to producing the ADAS, or not exposed to such conditions during production of the ADAS), wherein the ADAS is produced by a method comprising the steps of: (a) providing a parent cell that has been modified to express a component of a native T1P at a level that is at least 1.5 times higher than the level observed in the unmodified parent cell (e.g., at least 1.6 times higher than the level observed in the unmodified parent cell); fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 35-fold, 40-fold, 45-fold, 50-fold, or 100-fold or more than 100-fold, such as 1- to 2-fold, 2- to 5-fold, 5- to 10-fold, 10- to 20-fold, 20- to 30-fold, 30- to 40-fold, 40- to 50-fold, 50- to 100-fold higher than the level observed in the unmodified parent cell); and (b) producing ADAS from the parent bacterial cell, wherein the ADAS comprises a T1P that is native to the parent cell.

[0098] In some embodiments, the culture conditions are temperature, pH, osmotic pressure, oscillation, or activation of a stress response or stringent response. In some embodiments, the culture conditions that promote expression of the fim operon are growth under static (rather than oscillating) conditions at 37°C. Conditions that affect expression of the fim operon are further described in Zhang et al., Proc Natl Acad Sci USA, 113(15):4182-4187, 2016.

[0099] ii. ADAS derived from parental cells containing heterologous T1P components

[0100] In some aspects, the plurality of ADAS described above are derived from a parent cell comprising one or more heterologous nucleotide sequences encoding components of T1P. In some embodiments, the one or more heterologous nucleotide sequences comprise a fim operon. In some embodiments, the fim operon is the fim operon of Escherichia coli CFT073.

[0101] In some embodiments, the one or more heterologous nucleotide sequences comprise a sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 1 (i.e., the E. coli CFT073 fim operon sequence) (e.g., comprising a sequence having at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more than 99% identity, such as 90%-92%, 92%-94%, 94%-96%, 96%-98%, or 98%-100% identity to the nucleotide sequence of SEQ ID NO: 1). In some embodiments, the one or more heterologous nucleotide sequences comprise a sequence having at least 95% identity to the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the one or more heterologous nucleotide sequences comprise the nucleotide sequence of SEQ ID NO: 1.

[0102] In some embodiments, the one or more heterologous nucleotide sequences comprise a sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 3 (i.e., the E. coli MG1655 fim operon sequence) (e.g., comprising a sequence having at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more than 99% identity, such as 90%-92%, 92%-94%, 94%-96%, 96%-98%, or 98%-100% identity to the nucleotide sequence of SEQ ID NO: 3). In some embodiments, the one or more heterologous nucleotide sequences comprise a sequence having at least 95% identity to the nucleotide sequence of SEQ ID NO: 3. In some embodiments, the one or more heterologous nucleotide sequences comprise the nucleotide sequence of SEQ ID NO: 3.

[0103] In some embodiments, the one or more heterologous nucleotide sequences are operably linked to a constitutive promoter. In some embodiments, the one or more heterologous nucleotide sequences further comprise a constitutive promoter operably linked to the fim operon. In some embodiments, the constitutive promoter is a modified fimS promoter, and the modified fimS promoter comprises a mutation at the recombinase cleavage site that prevents the fimS promoter from being reorganized into a 'closed' orientation (e.g., comprising a mutation at a restriction site upstream of the fimS promoter; comprising a mutation at a restriction site downstream of the fimS promoter; or comprising a mutation at both upstream and downstream recombination sites).

[0104] In some embodiments, one or more nucleotide sequences encoding components of the T1P are carried on a vector. In some embodiments, the parent bacterial cell has been transiently transformed with the vector. In other embodiments, the parent bacterial cell has been stably transformed with the vector.

[0105] In some embodiments, the parent cell comprises a functional endogenous fim operon.

[0106] In some embodiments, wherein the parent cell comprises a functional endogenous fim operon, the parent cell expresses fim at a level that is at least 1.1 times higher than the level observed in the unmodified parent cell (e.g., at least 1.2 times, 1.3 times, 1.4 times, 1.5 times, 1.6 times, 1.7 times, 1.8 times, 1.9 times, 2 times, 2.5 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 11 times, 12 times, 13 times, 14 times, 15 times, 16 times, 17 times, 18 times, 19 times, 20 times, 21 times, 22 times, 23 times, 24 times, 25 times, 26 times, 27 times, 28 times, 29 times, 30 times, 31 times, In some embodiments, the parent cell expresses a component of T1P at a level that is at least 1.5 times higher than the level observed in the unmodified parent cell.

[0107] In some embodiments, wherein the parent cell comprises a functional endogenous fim operon, the ADAS comprises T1P, and the level of T1P is at least 1.1-fold higher than the level observed in a plurality of ADAS produced by a control (e.g., unmodified) parent cell (e.g., at least 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold higher than the level observed in a plurality of ADAS produced by a control parent cell). In some embodiments, the ADAS comprises T1P at a level that is at least 1.5-fold higher than the level observed in a plurality of ADAS produced by a control parental cell.

[0108] In some embodiments, wherein the parent cell comprises a functional endogenous fim operon, the proportion of multiple ADAS comprising T1P is increased relative to the multiple ADAS produced by a parent cell that does not constitutively express components of T1P, such as by at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more than 100% (e.g., by 1%-5%, 5%-10%, 10%-20%, 20%-30%, 30%-40%, 40%-50%, 50%-60%, 60%-70%, 70%-80%, 80%-90%, 90%-100%, or more than 100%).

[0109] In some embodiments, the parent cell does not comprise an intact endogenous fim operon.

[0110] In some aspects, the present disclosure provides an ADAS comprising a T1P derived from a parent bacterial cell, wherein the ADAS is produced by a method comprising the following steps: (a) providing a parent cell modified to constitutively express a component of T1P; and (b) producing ADAS from the parent bacterial cell, wherein the ADAS comprises the T1P.

[0111] In some aspects, the disclosure features an ADAS comprising a T1P derived from a parent bacterial cell, wherein the ADAS is produced by a method comprising the steps of: (a) providing a parent cell modified to express a component of a heterologous T1P; and (b) producing ADAS from the parent bacterial cell, wherein the ADAS comprises a T1P that is heterologous to the parent cell.

[0112] iii. Parental cells

[0113] In some embodiments of T1P-ADAS of section IIA(i) or IIA(ii), the parent cell is a Gram-negative bacterial cell. The parent bacterium includes any suitable bacterial species (e.g., species that can be modified to produce ADAS) that can produce ADAS. Table 1 provides a non-limiting list of suitable Gram-negative genera from which ADAS can be derived.

[0114] Table 1. Bacterial genera used for ADAS production

[0115]

[0116] In some embodiments, the gram-negative bacterial cell is an Escherichia (e.g., E. coli), Salmonella, Yersinia, Vibrio, Pseudomonas, Shigella, or Legionella bacterial cell. In some embodiments, the parent bacterial cell is a probiotic cell. In some embodiments, the parent bacterial cell is a mammalian pathogen or a mammalian commensal bacterium. In some cases, the mammalian commensal bacterium is a Staphylococcus, Bifidobacterium, Micrococcus, Lactobacillus, or Actinomyces species, or the mammalian pathogenic bacterium is Escherichia coli (EHEC), Salmonella typhimurium, Shigella flexneri, Yersinia enterolitica, or Helicobacter pylori.

[0117] In some embodiments, the parent bacterial cell is an auxotrophic parent bacterium, i.e., a parent bacterium that is unable to synthesize an organic compound required for growth. Such bacteria can only grow when an organic compound is provided.

[0118] In some embodiments, the parent cell is an E. coli bacterium. In some embodiments, the E. coli bacterium is E. coli CFT073.

[0119] In some embodiments, the parental cell is not exposed to culture conditions that promote the expression of the fim operon, for example, before ADAS is produced or during the generation of ADAS. In some embodiments, the culture conditions are activation of temperature, pH, osmotic pressure, oscillation, or stress response or stringent response. In some embodiments, the culture conditions that promote the expression of the fim operon are grown under static (rather than oscillating) conditions at 37°C. The conditions affecting the expression of the fim operon are further described in Zhang et al., Proc Natl Acad Sci USA [Proceedings of the National Academy of Sciences of the United States], 113 (15): 4182-4187, 2016.

[0120] In some aspects, the disclosure features an engineered bacterium that constitutively expresses a component of T1P, wherein the engineered bacterium comprises T1P at a level that is at least 1.1-fold higher than the level of T1P comprised in a non-engineered bacterium (e.g., at least 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 3-fold higher than the level observed in the unmodified parental cell). In some embodiments, the engineered bacteria comprises T1P at a level that is at least 1.5 times higher than the level of T1P contained in the non-engineered bacteria. In some embodiments, the T1P is a native T1P, such as a T1P encoded by a fim operon endogenous to the bacteria. In some embodiments, the T1P is a heterologous T1P, such as a T1P encoded by one or more nucleotide sequences that are heterologous to the bacterium (eg, the fim operon). In some embodiments, the bacterium has been modified to produce ADAS.

[0121] In some aspects, the disclosure features an engineered bacterium that constitutively expresses a component of T1P, wherein the bacterium has been modified to produce ADAS.

[0122] In some aspects, the disclosure features an ADAS produced by a method comprising: (a) providing an engineered bacterium that constitutively expresses a component of T1P; and (b) producing ADAS from the bacterium.

[0123] B. ADAS with payload

[0124] In certain embodiments, ADAS (e.g., T1P-ADAS) provided by the present invention includes a load, such as a load contained in the inside of ADAS. The load can be any part arranged inside ADAS (e.g., encapsulated by ADAS) or conjugated to the surface of ADAS. In certain embodiments, the load includes nucleic acid, plasmid, polypeptide, protein, enzyme, amino acid, small molecule, gene editing system, hormone, immunomodulator, carbohydrate, lipid, organic particle, inorganic particle or ribonucleoprotein complex (RNP) or a combination of the foregoing substances. In some aspects, the load is delivered by the secretion system (e.g., T3SS) included in ADAS. In other aspects, the load is not delivered by T3SS.

[0125] In some embodiments, the nucleic acid is DNA, RNA or plasmid. In some embodiments, nucleic acid (e.g., DNA, RNA (e.g., mRNA, ASO, circular RNA (circRNA), siRNA, shRNA, tRNA, dsRNA or a combination thereof) or plasmid) encodes protein. In some embodiments, protein is transcribed and / or translated in ADAS. In some embodiments, nucleic acid inhibits the translation of protein or polypeptide, for example, is siRNA or antisense oligonucleotide (ASO).

[0126] In certain embodiments, the load is an agent that can regulate the microbiome of a target organism (e.g., a human microbiome or a non-human microbiome), such as a polysaccharide, an amino acid, an antimicrobial (e.g., such as an anti-infective or antimicrobial peptide, protein and / or natural product), a short-chain fatty acid, or a combination thereof. In some instances, the agent that can regulate the host microbiome is a probiotic.

[0127] In some embodiments, the load is an enzyme. In some embodiments, the enzyme changes a substrate to produce a target product. In some embodiments, the substrate is present in ADAS, and the target product is produced in ADAS. In other embodiments, the substrate is present in the environment to which the target cell or ADAS is delivered.

[0128] In certain embodiments, the load is modified to improve stability compared to an unmodified version of the load. The "stability" of the load is a unitless ratio of the half-life of the unmodified load to the half-life of the modified load, and the half-life is measured under the same environmental conditions. In certain embodiments, the environment is experimentally controlled, such as simulated body fluids, RNase-free water, cytoplasm, extracellular space, or "ADAS protoplasm" (i.e., the content of the internal volume of ADAS, such as after lysis). In other embodiments, the environment is actual or simulated: mammalian intestine, mammalian skin, mammalian reproductive tract, mammalian respiratory tract, mammalian blood flow, or mammalian extracellular space. In certain embodiments, the ADAS does not significantly degrade the load.

[0129] In certain embodiments, the cargo comprises a protein. In certain embodiments, the stability of the protein in the cytoplasm or other environment is greater than about: 1.01, 1.1, 10, 100, 1000, 10000, 100000, 100000, or 10000000. The protein can be any protein, including growth factors; enzymes; hormones; immunomodulatory proteins; antibiotic proteins, such as antibacterial, antifungal or antiviral proteins, and targeting agents, such as antibodies or nanobodies. In some embodiments, the protein is a hormone, such as a paracrine, endocrine or autocrine hormone.

[0130] In some embodiments, the cargo is an anti-inflammatory agent, such as a cytokine (e.g., a heterologously expressed anti-inflammatory cytokine or a mutein thereof (e.g., IL-10, TGF-β, IL-22, IL-2) or an antibody (e.g., an antibody or antibody fragment targeting tumor necrosis factor (TNF) (e.g., an anti-TNF antibody); an antibody or antibody fragment targeting IL-12 (e.g., an anti-IL-12 antibody); or an antibody or antibody fragment targeting IL-23 (e.g., an anti-IL-23 antibody).

[0131] In certain embodiments, the load is an immunomodulator. Immunomodulators include, for example, immunostimulants; checkpoint inhibitors (e.g., inhibitors of PD-1, PD-L1, or CTLA-4); chemotherapeutics; immunosuppressants; antigens; superantigens; and small molecules (e.g., cyclosporine A, cyclic dinucleotides (CDNs), or STING agonists (e.g., MK-1454)). In some embodiments, an immunomodulator is a part that induces tolerance in a subject, such as an allergen, an autoantigen (e.g., an autoantigen associated with a disease), or a microorganism-specific antigen. In some embodiments, an immunomodulator is a vaccine, such as an antigen from a pathogen (e.g., a virus (e.g., a viral envelope protein) or a bacterium). In some embodiments, the antigen is a cancer neoantigen. In some embodiments, the pathogen is a coronavirus, such as SARS-CoV-2. In some embodiments, the load is an adjuvant, such as an immunomodulatory molecule or a molecule that changes the compartmentalization, presentation, or spectrum of one or more co-stimulatory molecules associated with a vaccine antigen. In some instances, an adjuvant is an activator of an immune path upstream of a desired immune response (e.g., an activator of an innate immune path upstream of an adaptive immune response). In other examples, the adjuvant enhances presentation of the antigen on immune cells or immune moieties (e.g., MHC class 1) in the target organism. In some examples, the adjuvant is Listeriolysin O (LLO). In some embodiments, ADAS comprises an antigen and one or more adjuvants.

[0132] In some embodiments, the cargo is an agent for treating or preventing cancer, e.g., an agent that reduces the likelihood of a patient developing cancer or an agent that treats cancer (e.g., an agent that increases progression-free survival and / or overall survival of an individual with cancer).

[0133] Agents for preventing cancer include, but are not limited to, anti-inflammatory agents and growth inhibitors. Agents for treating cancer (e.g., solid tumor cancer) include, but are not limited to, anti-inflammatory agents, growth inhibitors, chemotherapeutics, immunotherapeutics, anti-cancer antibodies or antibody fragments (e.g., antibodies or antibody fragments targeting cancer antigens) (e.g., cancer neoantigens), cancer vaccines (e.g., vaccines comprising cancer neoantigens), agents that induce autophagy (e.g., activators such as Listeria-hemolysin-o), cytotoxins, inflammasome inhibitors, immune checkpoint inhibitors (e.g., inhibitors of PD-1, PD-L1, or CTLA-4), transcription factor inhibitors, and agents that destroy the cytoskeleton.

[0134] In certain embodiments, the load is an enzyme. The enzyme can be an enzyme that plays catalytic activity in a target cell or an organism (for example, in a human or non-human mammal). In certain embodiments, the catalytic activity is extracellular matrix (ECM) digestion (for example, the enzyme is hyaluronidase and the catalytic activity is ECM digestion) or toxin removal. In certain embodiments, the enzyme is an enzyme replacement therapy, for example, phenylalanine hydroxylase. In certain embodiments, the enzyme is UDP-glucuronyl transferase. In certain embodiments, the enzyme has hepatic enzyme activity (for example, porphobilinogen deaminase (PBGD), for example, human PBGD (hPBGD)). In certain embodiments, the enzyme is a protease, an oxidoreductase or a combination thereof.

[0135] In some embodiments, the enzyme changes the substrate to produce a target product. In some embodiments, the substrate is present in ADAS, and the target product is produced in ADAS. In other embodiments, the substrate is present in the target cell or the environment to which ADAS is delivered. In some embodiments, the enzyme is diadenylate cyclase A, the substrate is ATP, and the target product is cyclic diAMP.

[0136] In some embodiments, the enzyme is chemically conjugated to the ADAS membrane, optionally via a linker to the outer membrane.

[0137] Alternatively, the cargo may be a nucleic acid encoding any of the enzymes described herein.

[0138] In some embodiments, the cargo is an agent that activates or inhibits the autophagic process (eg, an activator such as Listeria-hemolysin-o, or an inhibitor such as IcsB).

[0139] In some embodiments, the cargo is an anti-infective agent, such as an anti-microbial agent, such as an anti-infective or anti-microbial peptide, protein, and / or natural product.

[0140] In some embodiments, the cargo is a protein that regulates host transcriptional responses, such as a transcription factor; a protein that promotes host cell growth, such as a growth factor; or a protein that inhibits protein function, such as a nanobody. In some embodiments, the transcription factor is a human transcription factor.

[0141] For ADAS comprising a load, in some embodiments, the load is RNA, such as circular RNA, mRNA, siRNA, shRNA, ASO, tRNA, dsRNA or a combination thereof. In certain embodiments, the stability of RNA is, for example, greater than about: 1.01, 1.1, 10, 100, 1000, 10000, 100000, 100000 or 10000000 in ADAS protoplasm. In certain embodiments, the RNA load can be stabilized, for example, by an additional stem-loop structure, such as a tRNA scaffold (e.g., non-human tRNALys3 and Escherichia coli tRNAMet (Nat.Methods [Natural Methods], Ponchon 2007)). Both have been fully characterized and recombinantly expressed. However, a variety of other types, such as aptamers, lncRNA, ribozymes, etc., can also be used. When ADAS is obtained from a parent strain that is ineffective (or hypomorphic alleles) for one or more ribonucleases, RNA can also be stabilized.

[0142] In some specific embodiments, the RNA is a protein-encoding mRNA. In more specific embodiments, the protein-encoding mRNA encodes an enzyme (e.g., an enzyme that confers liver enzyme activity, such as human PBGD (hPBGD) mRNA), or an antigen (e.g., an antigen that induces an immune response (such as eliciting effective and lasting neutralizing antibody titers), such as mRNA encoding CMV glycoprotein gB and / or pentamer complex (PC)). In certain specific embodiments, the RNA is a small non-coding RNA, such as shRNA, ASO, tRNA, dsRNA or a combination thereof.

[0143] In certain embodiments, the ADAS provided by the present invention includes a load comprising at least one component of a gene editing system. The components of a "gene editing system" include (or encode) proteins (or nucleic acids encoding the proteins), which can modify a target DNA sequence, such as a genomic DNA sequence, together with suitable related nucleic acids and nucleic acids (e.g., guide RNAs) related to the functions of such proteins, whether, for example, by inserting or deleting a target sequence, or by changing the methylation state of the target sequence. Exemplary gene editing systems include gene editing systems based on Cas systems such as Cas9, Cpf1 or other RNA targeting systems and their accompanying RNAs (e.g., sequence-complementary CRISPR guide RNAs), as well as zinc finger nucleases and TAL effectors conjugated to nucleases.

[0144] Other embodiments of ADAS provided by the present invention include DNA as a load, including plasmids, optionally wherein the DNA comprises a protein coding sequence. In certain embodiments, exemplary DNA loads include plasmids encoding a target RNA sequence (see the above examples), for example, the target RNA sequence can be flanked by a tRNA insertion sequence on each side. The present invention encompasses various DNA loads, including: ADAS production (e.g., driving FTZ overexpression, exonucleases that degrade the genome); longevity plasmids (ATP synthase expression, rhodopsin expression); loads expressing stable non-coding RNA, tRNA, lncRNA; expression of secretion system tag proteins, NleE2 effector domains and positioning tags; secretion system T3 / 4SS, T5SS, T6SS; logic circuits, which conditionally express secretion systems; and combinations thereof. In some embodiments, the logic circuit includes an inducible expression or inhibition box, such as an IPTG-inducible Plac promoter and the hrpR portion of an AND gate, and, for example, a heat-inducible promoter pL (from bacteriophage λ, which is often inhibited by heat-labile proteins) and the hrpS portion of an AND gate. To engineer an OR gate, the system described by Rosado et al., PLoS Genetics, 2018 can be used. In short, a cis-repressor mRNA encoding RFP under a constitutive promoter can be used. The repression can then be removed in the presence of RAJ11 sRNA. A plasmid containing the IPTG-inducible promoter PLAc and the heat-inducible promoter pL can then be used, both of which induce expression of RAJ11 sRNA. The output is then RFP expression, which is observed in response to either input. These systems can be adapted for a variety of sensor-type functions.

[0145] In some embodiments, the ADAS provided by the present invention comprises a transporter in the membrane. In certain embodiments, the transporter is specific for glucose, sodium, potassium, metal ions, anionic solutes, cationic solutes or water.

[0146] In some embodiments, the membrane of ADAS provided by the present invention comprises an enzyme. In a specific embodiment, the enzyme is a protease, an oxidoreductase, or a combination thereof. In some embodiments, the enzyme is chemically conjugated to the ADAS membrane, optionally conjugated to the outer membrane via a linker.

[0147] C. ADAS containing bacterial secretion system

[0148] In certain embodiments, the T1P-ADAS provided by the present invention comprises a bacterial secretion system (e.g., an endogenous bacterial secretion system or a heterologous bacterial secretion system). "Bacterial secretion system" is a protein or protein complex that can export a load from the cytoplasm of a bacterial cell (or, for example, an ADAS derived therefrom) to: the extracellular space of Gram-negative bacteria, the periplasmic space, or the intracellular space of another cell. In certain embodiments, the bacterial secretion system is played by an active (e.g., ATP-dependent or PMF-dependent) process, and in certain embodiments, the bacterial secretion system comprises a tube or spike that spans a host cell (or ADAS) and a target cell. In other embodiments, the bacterial secretion system is a transmembrane channel. Exemplary bacterial secretion systems include T3SS and T4SS (and T3 / T4SS defined below), which are tubular structures, wherein loads pass through the interior of a protein tube and T6SS, and T6SS carries loads at the end of the spike. Other exemplary bacterial secretion systems include T1SS, T2SS, T5SS, T7SS, Sec and Tat, and the bacterial secretion system is a transmembrane bacterial secretion system.

[0149] In some embodiments, the ADAS (e.g., T1P-ADAS) provided by the present invention comprises a heterologous bacterial secretion system. In some embodiments, the heterologous bacterial secretion system is a type 3 secretion system (T3SS). In some embodiments, the cargo comprises a portion that directs the bacterial secretion system to output.

[0150] In some embodiments, the T3SS is from the genus of Table 2.

[0151] In some embodiments, the parent bacterial cell does not comprise an endogenous T3SS.

[0152] Table 2. Effectors and functional categories

[0153]

[0154] In some embodiments, the T3SS is a Salmonella T3SS, a Vibrio T3SS, an Escherichia T3SS, a Yersinia T3SS, a Shigella T3SS, a Pseudomonas T3SS, or a Chlamydia T3SS. In some embodiments, the Salmonella T3SS is a Salmonella enterica T3SS. In some embodiments, the Vibrio T3SS is a Vibrio parahaemolyticus T3SS. In some embodiments, the Escherichia T3SS is an enteropathogenic Escherichia coli (EPEC) T3SS. In some embodiments, the Yersinia T3SS is a Yersinia enterocolitica T3SS. In some embodiments, the Shigella T3SS is a Shigella flexneri T3SS.

[0155] In some embodiments, the parent bacterial cell comprises one or more heterologous nucleotide sequences encoding components of T3SS. In some embodiments, one or more nucleotide sequences encoding components of T3SS are carried on a vector. In some embodiments, the parent bacterial cell has been transiently transformed with a vector. In some embodiments, the parent bacterial cell has been stably transformed with a vector. In some embodiments, the parent bacterial cell further comprises a portion that increases the level of T3SS in ADAS. In some embodiments, the portion is a transcriptional activator of one or more heterologous nucleotide sequences encoding components of T3SS.

[0156] In another aspect, the disclosure features a T1P-ADAS derived from a parent bacterial cell, the ADAS comprising a bacterial type 3 secretion system (T3SS) endogenous to the parent bacterial cell, wherein the parent bacterial cell has been modified to reduce the level of an endogenous protein or polypeptide capable of being secreted by the T3SS.

[0157] In some embodiments, the parental bacterial cell has been modified by deleting a transcriptional activator of an endogenous protein or polypeptide capable of secretion by the T3SS.

[0158] In some embodiments, the parent bacterial cell is a Gram-negative bacterial cell.

[0159] In some embodiments, the parent bacterial cell is from a genus from Table 2.

[0160] In some embodiments, the parent bacterial cell is a Salmonella species, a Vibrio species, an Escherichia species, a Yersinia species, or a Shigella species. In some embodiments, the Salmonella species is Salmonella enterica. In some embodiments, the Vibrio species is Vibrio parahaemolyticus. In some embodiments, the Escherichia species is enteropathogenic Escherichia coli (EPEC). In some embodiments, the Yersinia species is Yersinia enterocolitica. In some embodiments, the Shigella species is Shigella flexneri.

[0161] In some embodiments, the parent bacterial cell further comprises a moiety that increases the level of T3SS in ADAS. In some embodiments, the moiety is a transcriptional activator of a nucleotide sequence encoding a component of the T3SS.

[0162] In some embodiments, the parent bacterial cell has been modified to reduce the level of a negative regulator of a component of the T3SS. In some embodiments, the chromosomal locus encoding the negative regulator has been deleted from the parent bacterial cell.

[0163] In some embodiments, the parent bacterial cell has been modified to reduce the level of one or more of: LPS; metabolically non-essential proteins; toxins not associated with the T3SS; endotoxins; flagella; and pili.

[0164] In some embodiments, the ADAS further comprises at least one cargo, wherein the T3SS is capable of delivering the cargo to a target cell. In some embodiments, the delivery is to the cytoplasm of the target cell.

[0165] In some embodiments, the cargo is a protein or a polypeptide.

[0166] In some embodiments, the cargo is endogenously secreted by the T3SS.

[0167] In some embodiments, ADAS or the parent bacterial cell has been modified to increase the level of cargo in ADAS.

[0168] In some embodiments, the cargo is not endogenously secreted by the T3SS.

[0169] In some embodiments, the cargo is endogenously secreted by a T3SS from a species other than the ADAS T3SS species.

[0170] In some embodiments, the cargo is endogenously secreted by a type 4 secretion system (T4SS) or a type 6 secretion system (T6SS).

[0171] In some embodiments, the cargo has been modified for delivery by a T3SS.

[0172] In some embodiments, the cargo is an enzyme, a DNA modifier, a chromatin remodeler, a gene editor, a nuclear targeting agent, a binder, an immunogenic agent, or a toxin. In some embodiments, the enzyme is a metabolic enzyme. In some embodiments, the gene editor is a component of a CRISPR system. In some embodiments, the nuclear targeting agent is a transcription factor. In some embodiments, the binder is an antibody or antibody fragment. In some embodiments, the binder is a VHH molecule. In some embodiments, the immunogenic agent is an immunostimulatory agent. In some embodiments, the immunogenic agent is an immunosuppressant.

[0173] In some embodiments, the cargo has been modified by adding a secretion signal. In some embodiments, the secretion signal is a sequence of Table 3.

[0174] Table 3. Secretion signals

[0175]

[0176]

[0177] In some embodiments, ADAS comprises a cargo, wherein the cargo comprises a moiety that directs export of a bacterial secretion system. In some embodiments, the moiety is Pho / D, Tat, or a synthetic peptide signal.

[0178] In certain embodiments, the ADAS provided by the present invention is a double membrane ADAS. In more specific embodiments, the double membrane ADAS further comprises a bacterial secretion system. In still more specific embodiments, the bacterial secretion system is selected from T3SS, T4SS, T3 / 4SS or T6SS, optionally, wherein T3SS, T4SS, T3 / 4SS or T6SS has a weakened or non-functional effector that does not affect the adaptability of target cells.

[0179] In some embodiments, the bacterial secretion system is capable of exporting a cargo into a target cell, such as a mammalian cell, across the ADAS outer membrane, such as a T3SS, T4SS, T3 / T4SS, or T6SS.

[0180] In certain embodiments, the bacterial secretion system is T3 / 4SS. "T3 / 4SS" is a secretion system based on T3SS or T4SS, including a mixed system and an unmodified version, wherein the secretion system forms a protein tube between bacteria (or ADAS, such as T1P-ADAS) and target cells, thereby connecting both and delivering one or more effectors. In certain embodiments, the target cell is a mammalian cell. In certain embodiments, T3 / 4SS includes an effector, which may be a modified effector. The example of the T3SS system includes the Salmonella SPI-1 system, the enterohemorrhagic Escherichia coli (EHEC coli) ETT1 system, the citrus / rapeseed yellow mononas (Xanthomonas citri / campestri) T3SS system, and the Pseudomonas syringae (Pseudomonas syringae) T3SS system. The example of the T4SS system includes the Agrobacterium Ti plasmid system and the Helicobacter pylori T4SS. In certain embodiments, the T3 / 4SS has an altered effector function, for example, an effector selected from SopD2, SopE, Bop, Map, Tir, EspB, EspF, NleC, NleH2 or NleE2. In more specific embodiments, the altered effector function is used for intracellular targeting, such as translocation to the nucleus, Golgi apparatus, mitochondria, actin, microvilli, ZO-1, microtubules or cytoplasm. In still more specific embodiments, the altered effector function is based on nuclear targeting of NleE2 derived from Escherichia coli. In other specific embodiments, the altered effector function is used for filopodia formation, tight junction destruction, microvilli elimination or SGLT-1 deactivation.

[0181] In some embodiments, the ADAS provided by the present invention comprising a bacterial secretion system comprises T6SS. In some embodiments, T6SS targets bacteria in its natural host and contains effectors that kill bacteria. In certain specific embodiments, T6SS is derived from Pseudomonas putida (P.putida) K1-T6SS, and optionally, the effector comprises the amino acid sequence of Tke2 (accession number AUZ59427.1), or its functional fragment. In other embodiments, T6SS targets fungi in its natural host and contains effectors that kill fungi, for example, T6SS is derived from Serratia marcescens, and the effector comprises the following amino acid sequence: Tfe1 (Genbank: SMDB11_RS05530) or Tfe2 (Genbank: SMDB11_RS05390).

[0182] In some embodiments of ADAS provided by the present invention containing a bacterial secretion system, the bacterial secretion system is capable of exporting cargo outside the cell. In certain more specific embodiments, the bacterial secretion system is T1SS, T2SS, T5SS, T7SS, Sec or Tat.

[0183] D. ADAS and highly active ADAS derived from parent bacteria deficient in cell division topology specificity factors

[0184] In some aspects, the present invention provides a T1P-ADAS and / or a composition comprising a plurality of T1P-ADAS, wherein the T1P-ADAS and / or the composition is derived from a parent bacterium having reduced levels, activity or expression of a cell division topology-specific factor.

[0185] In some aspects, the invention provides a composition comprising a plurality of T1P-ADAS, wherein the T1P-ADAS does not comprise a cell division topology-specific factor, and wherein the composition is substantially free of living bacterial cells.

[0186] In some aspects, T1P-ADAS is produced by a method comprising: (a) preparing, providing or obtaining a plurality of parent bacteria as described herein that have reduced levels or activity of a cell division topology-specific factor; (b) exposing the parent bacteria to conditions that allow the formation of miniature cells, thereby producing highly active ADAS; and (c) separating the ADAS from the parent bacteria, thereby producing a composition that is substantially free of live bacterial cells.

[0187] In some embodiments of the above aspects, the cell division topology specific factor is a polypeptide having an amino acid sequence at least 20% identical to the E. coli minE polypeptide (SEQ ID NO: 25), such as at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98% or 99% identical to SEQ ID NO: 25. In some embodiments, the cell division topology specific factor comprises the amino acid sequence of SEQ ID NO: 25. In some embodiments, the cell division topology specific factor is a minE polypeptide. Exemplary species having minE polypeptides are provided in Table 1 and Rothfield et al., Nature Reviews Microbiology, 3: 959-968, 2005.

[0188] In some embodiments, the parent bacterium is Escherichia coli, and the minE polypeptide is Escherichia coli minE. In other embodiments, the parent bacterium is Salmonella typhimurium, and the minE polypeptide is Salmonella typhimurium minE. In yet other embodiments, the parent bacterium is a bacterium of Table 1, and the cell division topology specific factor is endogenous minE or DivIVA of the parent bacterium.

[0189] In some embodiments of the above aspects, the cell division topology specific factor is an amino acid sequence having at least 20% identity to the Bacillus subtilis DivIVA polypeptide (SEQ ID NO: 28), such as a polypeptide having at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98% or 99% identity to SEQ ID NO: 28. In some embodiments, the cell division topology specific factor comprises the amino acid sequence of SEQ ID NO: 28. In some embodiments, the cell division topology specific factor is a DivIVA polypeptide. Exemplary species with DivIVA polypeptides are provided in Table 1 and Rothfield et al., Nature Reviews Microbiology, 3: 959-968, 2005. In some embodiments, the parent bacterium is Bacillus subtilis, and the cell division topology specific factor is Bacillus subtilis DivIVA.

[0190] In some embodiments, the cell division topology-specific factor whose level or activity is reduced also has reduced levels of one or more Z-ring inhibitory proteins of ADAS or a parent bacterium.

[0191] In some embodiments, the Z-ring inhibitory protein is a polypeptide having an amino acid sequence at least 20% identical to the E. coli minC polypeptide (SEQ ID NO: 26), such as at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98% or 99% identical to SEQ ID NO: 26. In some embodiments, the Z-ring inhibitory protein comprises the amino acid sequence of SEQ ID NO: 26. In some embodiments, the Z-ring inhibitory protein is a minC polypeptide.

[0192] In some embodiments, the Z-ring inhibitory protein is a polypeptide having an amino acid sequence at least 20% identical to an E. coli minD polypeptide (SEQ ID NO: 27), such as at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98% or 99% identical to SEQ ID NO: 27. In some embodiments, the Z-ring inhibitory protein comprises the amino acid sequence of SEQ ID NO: 27. In some embodiments, the Z-ring inhibitory protein is a minD polypeptide.

[0193] In some embodiments, the level, activity or expression of at least two Z-ring inhibitory proteins of the ADAS or parent bacteria is reduced. In some embodiments, the expression of minC polypeptides and minD polypeptides of the ADAS or parent bacteria is reduced. In some embodiments, the expression of minC polypeptides, minD polypeptides and minE polypeptides of the ADAS or parent bacteria is reduced, for example, the minCDE operon (ΔminCDE) is deleted.

[0194] Any suitable method can be used to achieve a reduction in the level, activity or expression of a cell division topology specific factor or a Z-ring inhibitory protein, such as a reduction in ADAS or a reduction in a parent bacterial cell. For example, in some embodiments, the reduction in the level or activity is caused by a loss-of-function mutation, such as a gene deletion. In some embodiments, the loss-of-function mutation is an inducible loss-of-function mutation, and loss of function is induced by exposing the parent cell to an inducing condition, for example, the inducible loss-of-function mutation is a temperature-sensitive mutation, and wherein the inducing condition is a temperature condition.

[0195] In some embodiments, the parental cell has a minCDE operator (ΔminCDE) or a homologous operator deletion.

[0196] E. ADAS lacking proteases, RNases and / or LPS

[0197] In another aspect, the invention provides a composition comprising a plurality of T1P-ADAS, wherein the protease level or activity of the ADAS is reduced relative to the ADAS produced by the wild-type parent bacterium. In some aspects, the ADAS is produced by a parent bacterium that has been modified to reduce or eliminate the expression of at least one protease.

[0198] In some embodiments, the RNase level or activity of the ADAS is reduced relative to that produced by the wild-type parent bacteria. In some embodiments, the ADAS is produced by a parent bacteria that has been modified to reduce or eliminate the expression of at least one RNase. In some embodiments, the RNase is an endoribonuclease or an exoribonuclease.

[0199] In another aspect, the invention provides a composition comprising a plurality of T1P-ADAS, wherein the ADAS is modified to have reduced lipopolysaccharide (LPS). In some embodiments, the modification is a lipid A biosynthetic myristoyltransferase (msbB) mutation.

[0200] In certain embodiments, the T1P-ADAS provided by the present invention lacks one or more metabolic non-essential proteins. "Metabolism non-essential proteins" include, but are not limited to, pili, flagella, undesirable secretion systems, transposases, effectors, phage elements or their regulatory elements, such as flhC or OmpA. In certain embodiments, the ADAS provided by the present invention lacks one or more of RNase, protease or its combination, and in specific embodiments, lacks one or more endoribonucleases (such as RNase A, RNase h, RNase III, RNase L, RNase PhyM) or exoribonucleases (such as RNase R, RNase PH, RNase D); or serine, cysteine, threonine, aspartic acid, glutamic acid and metalloproteinases; or a combination of any of the foregoing.

[0201] F. ADAS Comprising a Targeting Moiety

[0202] In another embodiment, T1P-ADAS comprises a targeting moiety. In some embodiments, the targeting moiety is a nanobody, a carbohydrate binding protein or a tumor targeting peptide. In some embodiments, the targeting moiety is an endogenous surface ligand of a parent cell (e.g., a surface ligand inherited by ADAS). In other embodiments, the targeting moiety is an exogenous ligand (e.g., an exogenous tissue targeting ligand) added to ADAS using any method described herein for modifying ADAS. The targeting moiety can facilitate targeting ADAS to a tissue type or cell type in a tissue-related manner.

[0203] In certain embodiments, the nanobody is a nanobody against a tumor antigen such as HER2, PSMA or VEGF-R. In other embodiments, the carbohydrate binding protein is a lectin, such as mannose binding lectin (MBL). In still other embodiments, the tumor targeting peptide is an RGD motif or a CendR peptide.

[0204] G. ADAS Comprising Other Animal Parts

[0205] The T1P-ADAS provided by the present invention can include various additional components, including, for example, photovoltaic pumps, one or more retinal production boxes, metabolic enzymes, targeting agents, cargoes, bacterial secretion systems and transporters, including the aforementioned combinations, including certain specific embodiments described below. In certain embodiments, the ADAS lacks other elements, such as metabolic non-essential genes and / or certain nucleases or proteases.

[0206] In certain embodiments, the T1P-ADAS comprises a functional ATP synthase and, in some embodiments, a membrane-embedded proton pump. In some embodiments, the ATP synthase concentration of the highly active ADAS is at least: 1 / 10000 nm 2 , 1 / 5000nm 2 , 1 / 3500nm 2 , 1 / 1000nm 2 . In certain embodiments, the ADAS provided by the present invention comprises an ATP synthase, optionally lacking a regulatory domain, such as lacking an ε domain. Deletion can be achieved in various ways. In certain embodiments, the deletion is performed by inducing a native ε domain deletion. In certain embodiments, the deletion can be achieved by flanking LoxP sites and inducible Cre expression or CRISPR knockout, or can be inducible (e.g., placed on a plasmid in the presence of a tTa tet transactivator in an ATP synthase knockout strain)

[0207] In some embodiments, TIP-ADAS may include a photovoltaic proton pump. In certain embodiments, the photovoltaic proton pump is Proteus rhodopsin. In more specific embodiments, the Proteus rhodopsin comprises an amino acid sequence of Proteus rhodopsin from uncultured marine bacterial branch SAR86 (GenBank accession number: AAS73014.1). In other embodiments, the photovoltaic proton pump is Myxobacterium rhodopsin. In certain embodiments, the photovoltaic proton pump is bacteriorhodopsin, delta rhodopsin or halorhodopsin from Halobium salinarum, Natronomonas pharaonis, Exiguobacterium sibiricum, Haloterrigena turkmenica or Haloarcula marismortui.

[0208] In some embodiments, the T1P-ADAS provided by the present invention further comprises retinal. In certain embodiments, the ADAS provided by the present invention further comprises a retinal synthesis protein (or protein system), or a nucleic acid encoding the same.

[0209] In certain embodiments, T1P-ADAS provided by the present invention further comprises one or more glycolytic pathway proteins. In certain embodiments, glycolytic pathway protein is phosphofructokinase (Pfk-A), for example, phosphofructokinase or its functional fragment comprising the amino acid sequence of UniProt accession number P0A796. In other embodiments, glycolytic pathway protein is triose phosphate isomerase (tpi), for example, triose phosphate isomerase or its functional fragment comprising the amino acid sequence of UniProt accession number P0A858.

[0210] H. Highly active ADAS

[0211] In some embodiments, the present invention provides highly active T1P-ADAS. "Highly active ADAS" is an ADAS with high work potential, for example, an ADAS with the ability to perform a large amount of useful work. Work can be defined as, for example, metabolic work, including chemical synthesis (e.g., synthesis of proteins, nucleic acids, lipids, carbohydrates, polymers or small molecules), chemical modification (e.g., modification of proteins, nucleic acids, lipids, carbohydrates, polymers or small molecules) or transport (e.g., input, output or secretion) under suitable conditions. In some embodiments, highly active ADAS starts with a large amount of energy, for example, energy in the form of adenosine triphosphate (ATP). In other embodiments, ADAS has the ability to absorb or generate energy (e.g., ATP) from another source.

[0212] In some embodiments, the initial ATP concentration of highly active ADAS is at least 1 nM, 1.1.nM, 1.2 nM, 1.3 nM, 1.4 mM, 1.5 mM, 1.6 mM, 2 mM, 2.5 mM, 3 nM, 3.5 nM, 4 mM, 5 mM, 10 mM, 20 mM, 30 mM or 50 mM. ATP concentration can be assessed in various ways, including BacTiter-Glo® for cleaved ADAS in certain embodiments. TM Assay (Promega).

[0213] High activity can be additionally or alternatively assessed by the rate or amount of increase in ATP concentration over time in ADAS. In some embodiments, after incubation under suitable conditions, for example, at 37°C for 12 hours, the ATP concentration of ADAS increases by at least 50%, at least 60%, at least 75%, at least 100%, at least 150%, at least 200% or more than 200%. In certain embodiments, the ATP generation rate of highly active ADAS is greater than about: 0.000001, 0.00001, 0.0001, 0.001, 0.01, 0.05, 0.1, 0.5, 1.0, 2, 3, 5, 10, 15, 20, 30, 40, 50, 75, 100, 200, 300, 500, 1000, 10000 ATP / sec / nm 2 , lasting at least about: 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 12 hours, 1 day, 2 days, 4 days, 1 week or two weeks.

[0214] In other aspects, high activity is assessed by the rate of decrease in ATP concentration over time. In some embodiments, the ATP concentration in highly active ADAS may decrease more slowly than in non-highly active ADAS. In some embodiments, for example, using BacTiter-Glo TM The ATP concentration in the ADAS or ADAS composition 24 hours after preparation decreases by less than about 50% (e.g., less than about: 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5%) compared to the initial ATP concentration (e.g., ATP per cell volume) as measured by an ADAS or ADAS composition assay (Promega).

[0215] High activity can be additionally or alternatively evaluated with the lifespan index of ADAS. Lifespan index is calculated with the ratio of GFP production rate at 24 hours and 30 minutes. In certain embodiments, the lifespan index of highly active ADAS is greater than about: 0.13, 0.14, 0.15, 0.16, 0.18, 0.2, 0.25, 0.3, 0.35, 0.45, 0.5, 0.60, 0.70, 0.80, 0.90, 1.0 or greater. In a more specific embodiment, lifespan index is measured in ADAS containing a functional GFP plasmid with a suitable promoter of species, wherein at 30 minutes and 24 hours, the GFP concentration relative to the quantity of ADAS, the average plasmid quantity of each ADAS and the volume of solution is measured with a plate reader.

[0216] In some aspects, ADAS produces protein, such as heterologous protein. In some aspects, high activity is evaluated by the rate, amount or duration of producing protein or the rate of inducing protein expression (for example, the response of ADAS to signal). For example, the ADAS may include a plasmid, and the plasmid includes an inducible promoter and a nucleotide sequence encoding the heterologous protein, wherein the ADAS is contacted with the inducer of the inducible promoter under appropriate conditions to cause the production of the heterologous protein. In some aspects, in the ADAS contacted with the inducer, for example, in highly active ADAS, relative to the ADAS not yet contacted with the inducer, the production of the heterologous protein increases by at least 1.6 times. For example, in some embodiments, in the ADAS contacted with the inducer, for example, in highly active ADAS, the production of heterologous protein increases by at least 1.5 times, 1.75 times, 2 times, 3 times, 4 times, 5 times, 10 times or more than 10 times. In some embodiments, the heterologous protein production rate of high-activity ADAS is within a specific duration after ADAS contacts an inducer, for example, in 5 minutes, 10 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 3 hours or more than 3 hours to reach a target level. In some embodiments, protein (e.g., heterologous protein) is produced at a rate of at least 0.1 femtogram / hour / high-activity ADAS, for example, at least 0.2, 0.4, 0.6, 0.8, 1, 2, 4, 6, 8, 10, 25, 50, 100, 250, 500, 1000, 2000, 3000 or 3500fg / hour / ADAS. In some embodiments, the high activity of ADAS is evaluated with the duration of protein production. High-activity ADAS can produce protein (e.g., heterologous protein) in at least 2 hours, at least 4 hours, at least 8 hours, at least 12 hours, at least 24 hours, at least 48 hours or more than 48 hours.

[0217] I. ADAS Compositions and Formulations

[0218] The present invention provides compositions or preparations containing T1P-ADAS provided by the present invention, especially ADAS derived from parent cells constitutively expressing T1P components and ADAS derived from parent cells containing heterologous T1P components. In some embodiments, the ADAS preparation is substantially free of living cells. These are collectively referred to as "multiple compositions provided by the present invention" or "the present invention provides a composition", etc., and may contain any ADAS provided by the present invention and any combination of ADAS provided by the present invention.

[0219] In some embodiments, the compositions provided herein comprise a plurality of ADAS, wherein about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% of the ADAS comprise T1P.

[0220] The compositions provided by the invention can be prepared in any suitable formulation. For example, the formulation can be suitable for IP, IV, IM, oral, topical (cream, gel, ointment, transdermal patch), aerosolization or atomization application. In certain embodiments, the formulation is a liquid formulation. In other embodiments, the formulation is a lyophilized formulation.

[0221] In some embodiments, the ADAS compositions described herein comprise less than 100 colony forming units (CFU / mL) of viable bacterial cells, e.g., less than 50 CFU / mL, less than 20 CFL / mL, less than 10 CFU / mL, less than 1 CFU / mL, or less than 0.1 CFU / mL of viable bacterial cells.

[0222] In some embodiments, the present invention provides an ADAS composition, wherein the ADAS is lyophilized and reconstituted, and wherein the T1P level of the reconstituted ADAS (e.g., the amount of T1P on the surface of ADAS or a portion of ADAS comprising T1P) is at least 90% of the T1P level of the unlyophilized ADAS, such as at least 95%, 98% or at least equal to the T1P level of the unlyophilized ADAS.

[0223] In some embodiments, the present invention provides an ADAS composition, wherein the ADAS is stored, for example, stored at 4°C, wherein the T1P level of the ADAS after storage is at least 90% of the T1P level of the unstored ADAS, for example, at least 95%, 98% or at least equal to the T1P level of the unstored ADAS. In some embodiments, the storage lasts for at least one day, at least one week, at least two weeks, at least three weeks, at least one month, at least two months, at least six months or at least one year.

[0224] In some embodiments, the ADAS may be stored or otherwise processed in a "quiescent" state and then quickly activated.

[0225] In some embodiments, the ADAS composition is formulated for delivery to a mammal, e.g., formulated for intraperitoneal, intravenous, intramuscular, oral, topical, aerosolized, or nebulized administration. In some embodiments, the composition is formulated for oral delivery.

[0226] In some embodiments, the composition is formulated as a liquid, solid, aerosol, paste, gel, or gaseous composition.

[0227] III. Methods of Manufacturing ADAS

[0228] A. Preparation of ADAS

[0229] In some aspects, the disclosure features a method for producing ADAS, the method comprising the steps of: (a) providing an engineered bacterium that constitutively expresses a component of T1P; and (b) producing ADAS from the bacterium.

[0230] Parent bacteria include any suitable bacterial species that can produce ADAS (eg, species that can be modified to produce ADAS using the methods described herein). Table 1 provides a non-limiting list of suitable genera from which ADAS can be derived.

[0231] In some aspects, the invention features methods for making any of the ADAS compositions described herein in Section I, such as T1P-ADAS compositions. For example, provided herein are methods for preparing ADAS derived from a parent cell that constitutively expresses a T1P component, methods for preparing ADAS derived from a parent cell that comprises a heterologous T1P component, and methods for preparing any of the ADAS mentioned herein, wherein the ADAS comprises a cargo.

[0232] In some embodiments, the ADAS (e.g., T1P-ADAS) is prepared from a parent strain that is a human bacterium, such as a commensal human bacterium (e.g., Escherichia coli, Staphylococcus spp., Bifidobacterium spp., Micrococcus spp., Lactobacillus spp., or Actinomyces spp.) or a human pathogenic bacterium (e.g., Escherichia coli EHEC, Salmonella typhimurium, Shigella flexneri, Yersinia enterocolitica, or Helicobacter pylori) or an extremophilic microorganism.

[0233] In some embodiments, ADAS and / or the parent strain are functionalized derivatives of any of the foregoing, e.g., comprising functional cassettes, such as cassettes that induce the bacteria to perform one or more of the following: secrete antimicrobial agents, digest plastics, secrete toxins, survive in extreme environments, produce nanoparticles, integrate in other organisms, respond to the environment, and produce reporter signals.

[0234] The parent bacterium may include a functionalized derivative of any of the foregoing, for example including a functional box, such as a functional box that induces the bacterium to do one or more of the following: secrete antimicrobial agents, digest plastics, secrete toxins, survive in extreme environments, make nanoparticles, integrate in other organisms, respond to the environment, and produce a reporter signal.

[0235] In some embodiments, ADAS is derived from a parent strain that is engineered or induced to overexpress ATP synthase. In some more specific embodiments, the ATP synthase is heterologous to the parent strain. In certain specific embodiments, the parent strain is modified to express a functional F o F 1 ATP synthase.

[0236] In certain embodiments, the ADAS provided by the present invention is obtained from a parent strain cultured under conditions selected from the following: an applied voltage (e.g., 37 mV), a non-atmospheric oxygen concentration (e.g., 1%-5% O 2 , 5%-10% O 2 10%-15% O 2 , 25%-30% O 2 ), low pH (approximately: 4.5, 5.0, 5.5, 6.0, 6.5), or a combination thereof.

[0237] Due to the diversity of bacteria, ADAS with modified membranes can be prepared, for example, to improve the biodistribution of ADAS after being applied to target cells. In certain embodiments, the membrane is modified to have less immunogenicity or immunostimulation in mammals. For example, in certain embodiments, ADAS is obtained from a parent strain, wherein the immunostimulatory ability of the parent strain is reduced or eliminated by post-production treatment with detergents, enzymes or PEG functionalization. In certain embodiments, ADAS is prepared by a parent strain, and the membrane is modified by knocking out the LPS synthesis pathway in the parent strain, for example, by knocking out msbB. In other specific embodiments, ADAS is prepared by a parent strain that produces cell wall defective particles by exposure to hypertonic conditions.

[0238] In some embodiments, the method comprises transforming the parent strain with an inducible DNA enzyme system, such as exoI (NCBI GeneID: 946529) & sbcD (NCBI GeneID: 945049) nuclease, or I-CeuI (e.g., Swissprot: P32761.1) nuclease. In more specific embodiments, the method comprises using a single, two, three or four auxotrophic strains and having a complementary gene on a plasmid encoding an inducible nuclease.

[0239] In some embodiments of the methods provided herein, the parent strain is cultured under conditions selected from the group consisting of: an applied voltage (e.g., 37 mV), a non-atmospheric oxygen concentration (e.g., 1%-5% O 2 , 5%-10% O 2 , 10%-15% O 2 , 25%-30% O 2 ), low pH (4.5-6.5), or a combination thereof.

[0240] In certain embodiments of the methods provided herein, the parent strain lacks flagella and an undesired secretion system, optionally wherein the flagella and the undesired secretion system are removed using λred recombineering.

[0241] In some embodiments of the methods provided herein, flagellar control components are excised from the parental strain genome via, for example, insertion of a plasmid containing a CRISPR domain targeting flagellar control genes, such as flhD and flhC.

[0242] In certain embodiments, the method provided by the present invention is used to prepare highly active ADAS, wherein ADAS containing a plasmid containing a rhodopsin encoding gene is cultured in the presence of light. In a more specific embodiment, the rhodopsin is a Proteus rhodopsin or a functional fragment thereof with a GenBank accession number from SAR86 uncultured bacteria: an amino acid sequence of AAS73014.1. In still more specific embodiments, the culture is supplemented with retinal. In other more specific embodiments, the rhodopsin is Proteus rhodopsin, and the plasmid additionally contains a gene for synthesizing retinal (this plasmid is from Kim et al., Microb Cell Fact [microbial cell factory], 2012 pACYC-RDS plasmid).

[0243] In certain specific embodiments, the parent strain contains a nucleic acid sequence encoding a Nanobody, which is then expressed on the membrane of the ADAS.

[0244] In some embodiments of the methods provided herein, the parent strain contains a nucleic acid sequence encoding one or more bacterial secretion system operons. Exemplary plasmids include Salmonella SPI-1 T3SS, Shigella flexneri T3SS, Agrobacterium Ti plasmids, and Pseudomonas putida K1-T6SS systems.

[0245] In certain embodiments, the parent strain comprises a cargo. In some embodiments, the parent strain contains a nucleic acid sequence encoding a set of genes for synthesizing small molecule cargoes.

[0246] IV. Purification of ADAS and ADAS Compositions

[0247] In some embodiments of the methods and compositions provided herein, ADAS is purified from a composition (e.g., culture) comprising live bacteria, such as parent bacteria. A method for making a composition comprising multiple ADAS (the composition is substantially free of live bacterial cells) includes (a) preparing, providing or obtaining a plurality of parent bacteria with reduced levels or activity of cell division topology-specific factors; (b) exposing the parent bacteria to conditions that allow the formation of miniature cells, thereby producing the ADAS; and (c) separating the ADAS from the parent bacteria, thereby producing a composition substantially free of live bacterial cells.

[0248] Purification separates ADAS from live parent bacterial cells, which contain the genome and may be larger. Separation of highly active ADAS from parent bacteria can be performed using a variety of methods as described herein. Exemplary methods for purification as described herein include centrifugation, selective growth, and buffer exchange / concentration methods.

[0249] In some aspects, ADAS compositions and methods for comparing such compositions are provided herein, wherein the compositions are substantially free of parent bacterial cells and / or viable bacterial cells, e.g., having no more than 500, e.g., 400, 300, 200, 150, or 100, or less than 50, less than 25, less than 10, less than 5, less than 1, less than 0.1 colony forming units (CFU) / mL. In some embodiments, an ADAS composition that is substantially free of parent bacterial cells may not include bacterial cells.

[0250] ADAS provided by the present invention can be prepared using auxotrophic parent strains. As described in more detail below, such manufacturing methods can be used for purifying ADAS. For example, after ADAS is generated, the parent bacterial cell can be removed by growing in a culture medium lacking the nutrients (e.g., amino acids) necessary for the survival of the parent bacteria. In certain embodiments, ADAS provided by the present invention is derived from at least 1, 2, 3, 4 or more auxotrophic parent strains in the following: arginine (e.g., argA knockout, such as strain JW2786-1 and NK5992), cysteine ​​(cysE knockout, such as strain JW3582-2 and JM15), glutamine such as glnA knockout (such as strain JW3841-1 and M5004), glycine such as glyA knockout (such as strain JW2535-1 and AT2457), histidine such as hisB knockout (such as strain JW2004-1 and SB3930), isoleucine such as ilvA knockout (such as strain JW37 45-2 and AB1255), leucine such as leuB knockout (such as strains JW5807-2 and CV514), lysine such as lysA knockout (such as strains JW2806-1 and KL334), methionine such as metA knockout (such as strains JW3973-1 and DL41), phenylalanine such as pheA knockout (such as strains JW2580-1 and KA197), proline such as proA knockout (such as strains JW0233-2 and NK5525), serine such as serA knockout (such as strains JW2880-1 and JC158), threonine such as thrC knockout (such as strains JW0003-2 and Gif 41), tryptophan such as trpC knockout (such as strains JW1254-2 and CAG18455), tyrosine such as tyrA knockout (such as strains JW2581-1 and N3087), valine / isoleucine / leucine such as ilvd knockout (such as strains JW5605-1 and CAG18431).

[0251] In certain embodiments, the methods comprise using a single, two, three, or four auxotrophic parent strains, optionally wherein the parent strains further comprise a plasmid expressing ftsZ.

[0252] V. Methods of using ADAS

[0253] A. Methods of delivering ADAS

[0254] In some aspects, the disclosure features a method for delivering ADAS to a cell, the method comprising (a) providing a composition comprising a plurality of ADAS of the invention (e.g., T1P-ADAS); and (b) contacting the cell with the composition of step (a).

[0255] In some embodiments, delivery of the ADAS to a cell is increased by at least 1% relative to ADAS derived from a control (e.g., unmodified) parent cell (e.g., at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more than 100% relative to ADAS derived from a control parent cell (e.g., an increase of 1%-5%, 5%-10%, 10%-20%, 20%-30%, 30%-40%, 40%-50%, 50%-60%, 60%-70%, 70%-80%, 80%-90%, 90%-100%, or more than 100% relative to ADAS derived from a control parent cell) In some aspects, delivery of the ADAS to the cell is increased by at least 10% relative to ADAS derived from a control parental cell.

[0256] In some embodiments, an effective amount of the ADAS is delivered to the cells at a dose that is at least 1% lower than the dose required for ADAS derived from a control parental cell (e.g., at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more than 100% lower than the dose required for ADAS derived from a control parental cell (e.g., an increase of 1%-5%, 5%-10%, 10%-20%, 20%-30%, 30%-40%, 40%-50%, 50%-60%, 60%-70%, 70%-80%, 80%-90%, or 90%-99%)). In some embodiments, an effective amount of said ADAS is delivered to the cell at a dose that is at least 10% lower than the dose required for ADAS derived from a control parental cell.

[0257] In some embodiments, the cell is a mammalian cell (e.g., a human cell or a non-human mammalian cell, including a cell of a farm animal, a domestic animal, or a pest animal). In some embodiments, the mammalian cell is an intestinal cell, such as a gut-associated lymphoid tissue (GALT) cell, a Peyer's patch cell, an M cell, a lamina propria cell, a small intestinal cell, or a large intestinal cell. In other embodiments, the mammalian cell is a bladder cell, an immune cell, or a blood-brain barrier cell. In some embodiments, the mammalian cell is a mannosylated cell.

[0258] B. Methods of delivering cargo

[0259] In some aspects, the disclosure features a method for delivering a cargo to a cell, the method comprising (a) providing a composition comprising a plurality of ADAS of the invention (e.g., T1P-ADAS), wherein the ADAS further comprises a cargo; and (b) contacting the cell with the composition of step (a).

[0260] In some embodiments, the ADAS further comprises a heterologous bacterial secretion system. In some embodiments, the heterologous bacterial secretion system is a T3SS. In some embodiments, the delivery is delivered to the cytoplasm of a cell.

[0261] In some embodiments, delivery of the cargo to the cell is increased by at least 1% relative to ADAS derived from a control (e.g., unmodified) parent cell (e.g., at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more than 100% relative to ADAS derived from a control parent cell (e.g., an increase of 1%-5%, 5%-10%, 10%-20%, 20%-30%, 30%-40%, 40%-50%, 50%-60%, 60%-70%, 70%-80%, 80%-90%, 90%-100%, or more than 100% relative to ADAS derived from a control parent cell)). In some embodiments, delivery of the cargo to the cell is increased by at least 10% relative to ADAS derived from a control parental cell.

[0262] In some embodiments, an effective amount of the cargo is delivered to the cells at a dose that is at least 1% lower than the dose required for ADAS derived from a control (e.g., unmodified) parental cell (e.g., at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more than 100% lower than the dose required for ADAS derived from a control parental cell (e.g., an increase of 1%-5%, 5%-10%, 10%-20%, 20%-30%, 30%-40%, 40%-50%, 50%-60%, 60%-70%, 70%-80%, 80%-90%, or 90%-99%)). In some embodiments, an effective amount of said cargo is delivered to the cells at a dose that is at least 10% lower than the dose required for ADAS derived from a control parental cell.

[0263] In some embodiments, the cell is a mammalian cell (e.g., a human cell or a non-human mammalian cell, including a cell of a farm animal, a domestic animal, or a pest animal). In some embodiments, the mammalian cell is an intestinal cell, such as a gut-associated lymphoid tissue (GALT) cell, a Peyer's patch cell, an M cell, a lamina propria cell, a small intestinal cell, or a large intestinal cell. In other embodiments, the mammalian cell is a bladder cell, an immune cell, or a blood-brain barrier cell. In some embodiments, the mammalian cell is a mannosylated cell.

[0264] C. Methods of regulating cells

[0265] In some aspects, the disclosure features a method of modulating a cell, the method comprising (a) providing a composition comprising a plurality of ADAS (e.g., T1P-ADAS) of the invention; and (b) contacting the cell with the composition of step (a), thereby modulating the cell.

[0266] In some embodiments, the cell is a mammalian cell (e.g., a human cell or a non-human mammalian cell, including a cell of a farm animal, a domestic animal, or a pest animal). In some embodiments, the mammalian cell is an intestinal cell, such as a gut-associated lymphoid tissue (GALT) cell, a Peyer's patch cell, an M cell, a lamina propria cell, a small intestinal cell, or a large intestinal cell. In other embodiments, the mammalian cell is a bladder cell, an immune cell, or a blood-brain barrier cell. In some embodiments, the mammalian cell is a mannosylated cell.

[0267] Modulation can be any observable change in the state of a cell (e.g., a mammalian cell) (e.g., a transcriptome, a proteome, an epigenome, a biological effect, or a healthy or diseased state) as measured using techniques and methods known in the measurement art (e.g., methods that measure the level or expression of a protein, a transcript, an epigenetic marker, or an increase or decrease in the activity of a biological pathway). In some embodiments, modulating the state of a cell involves the cell increasing a parameter of the cell (e.g., the level or expression of a protein, a transcript, or the activity of a biological pathway). In other embodiments, modulating the state involves decreasing a parameter of the cell (e.g., the level or expression of a protein, a transcript, or the activity of a biological pathway).

[0268] Cells can be isolated (e.g., in vitro) or in vivo (e.g., in vivo). The methods provided herein require providing an effective amount of ADAS provided by the present invention or a composition provided by the present invention to approach target cells. Approaching target cells can be direct (e.g., target cells are directly regulated by ADAS, such as by adjacent secretion of an agent adjacent to target cells (e.g., a load of ADAS) or injecting the agent (e.g., a load) into target cells), or indirect. Indirect regulation of target cells can be performed by targeting different cells, for example, by regulating cells adjacent to target cells, the adjacent cells can be symbiotic with the target cells or pathogenic to the target cells. Adjacent cells can be in vitro or in vivo like target cells (e.g., in an organism, they can be symbiotic or pathogenic). These methods are collectively referred to as "methods of use provided by the present invention" and the like. In a related aspect, the present invention provides target uses of ADAS and compositions provided by the present invention, and the target uses are consistent with the methods of use provided by the present invention.

[0269] For example, in some embodiments, the present invention provides a method for regulating the state of mammalian cells by providing an effective amount of ADAS provided by the present invention or a composition provided by the present invention close to mammalian cells. In certain embodiments, the ADAS or composition is provided to approach mammalian cells in vivo, in mammals (e.g., people). In certain embodiments, mammalian cells in healthy mammals are exposed to bacteria. In more specific embodiments, the mammalian cells are lung epithelial cells, immune cells, skin cells, oral epithelial cells, intestinal epithelial cells, reproductive tract epithelial cells or urinary tract cells. In still more specific embodiments, the mammalian cells are intestinal epithelial cells, such as intestinal epithelial cells from human subjects suffering from inflammatory bowel disease, such as Crohn's disease (Crohn's disease) or colitis. In yet more specific embodiments, the mammalian cells are intestinal epithelial cells from subjects suffering from inflammatory bowel disease, and the ADAS comprises a bacterial secretion system and a load comprising an anti-inflammatory agent.

[0270] In other embodiments, mammalian cells in a diseased state are exposed to bacteria. In certain embodiments, the mammalian cells are pathogenic, such as tumors. In other embodiments, mammalian cells in a diseased state, such as wounds, ulcers, tumors, or inflammatory diseases are exposed to bacteria.

[0271] In certain embodiments, the ADAS is derived from a mammalian commensal parent strain. In other embodiments, the ADAS is derived from a mammalian pathogenic parent strain.

[0272] In some embodiments, the state of the mammalian cell is regulated by: providing an effective amount of ADAS provided by the present invention or a composition provided by the present invention to approach bacteria or fungal cells near mammalian cells. That is, these methods need to indirectly regulate the state of mammalian cells. In certain embodiments, the bacteria or fungal cells are pathogenic. In more specific embodiments, the adaptability of the pathogenic bacteria or fungal cells is reduced. In certain other embodiments, the bacteria or fungal cells are symbiotic. In more specific embodiments, the adaptability of the symbiotic bacteria or fungal cells increases. In still more specific embodiments, the adaptability of the symbiotic bacteria or fungal strains is increased by reducing the adaptability of a large number of competing bacteria or fungi that may be neutral, symbiotic or pathogenic.

[0273] D. Methods of treating mammals

[0274] In some aspects, the disclosure features a method of treating a mammal in need thereof (e.g., a human or non-human mammal, such as a farm animal, a domestic animal, or a pest animal), the method comprising (a) providing a composition comprising a plurality of ADAS (e.g., T1P-ADAS) of the invention; and (b) contacting the mammal with an effective amount of the composition of step (a), thereby treating the mammal.

[0275] In some embodiments, the therapeutic effect is achieved at a dose that is at least 1% lower than the dose required for ADAS derived from a control parental cell (e.g., unmodified) (e.g., at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more than 100% lower than the dose required for ADAS derived from a control parental cell (e.g., an increase of 1%-5%, 5%-10%, 10%-20%, 20%-30%, 30%-40%, 40%-50%, 50%-60%, 60%-70%, 70%-80%, 80%-90%, or 90%-99%)). In some embodiments, a therapeutic effect is achieved at a dosage that is at least 10% lower than the dosage required for ADAS derived from a control parental cell.

[0276] The mammal in need of treatment may have a disease, such as cancer. In some embodiments, the ADAS carries a chemotherapeutic cargo or an immunotherapy cargo.

[0277] Other embodiments:

[0278] The invention is further described in the following numbered paragraphs:

[0279] 1. A plurality of non-chromosomal dynamically active systems (ADAS) comprising type 1 pili (T1P), wherein the ADAS is derived from a parent bacterial cell constitutively expressing components of the T1P.

[0280] 2. The plurality of ADAS as described in paragraph 1, wherein the parent cell comprises a modified fimS promoter, which is operably linked to the components of the T1P and directs the constitutive expression of the components.

[0281] 3. The plurality of ADAS as described in paragraph 1 or 2, wherein the components of T1P are encoded by the fim operon.

[0282] 4. A plurality of ADAS as described in paragraph 3, wherein the parent cell comprises a modified fimS promoter operably linked to the fim operon, wherein the modified fimS promoter comprises a mutation at a recombinase cleavage site that prevents the fimS promoter from recombining into an 'off' orientation.

[0283] 5. The plurality of ADAS as described in any of paragraphs 1-4, wherein the parent cell expresses a component of the T1P at a level at least 1.5-fold higher than the level observed in an unmodified parent cell.

[0284] 6. The plurality of ADAS of any one of paragraphs 1-5, wherein the ADAS comprises the T1P at a level at least 1.5-fold higher than that observed in the plurality of ADAS produced by an unmodified parent cell.

[0285] 7. The plurality of ADAS of any of paragraphs 1-6, wherein the proportion of the plurality of ADAS comprising T1P is increased relative to a plurality of ADAS produced by a parent cell that does not constitutively express components of T1P.

[0286] 8. A plurality of ADAS as described in any one of paragraphs 1-7, wherein the parent cell comprises an endogenous fim operon.

[0287] 9. The plurality of ADAS of any one of paragraphs 1-8, wherein the parent cell is an Escherichia coli bacterium.

[0288] 10. The plurality of ADAS of paragraph 9, wherein the E. coli bacteria is E. coli CFT073.

[0289] 11. The plurality of ADAS of any of paragraphs 1-10, wherein the parent cell comprises one or more heterologous nucleotide sequences encoding components of the T1P.

[0290] 12. The plurality of ADAS as described in paragraph 11, wherein the one or more heterologous nucleotide sequences comprise a fim operon.

[0291] 13. The plurality of ADAS as described in paragraph 12, wherein the fim operon is the fim operon of Escherichia coli CFT073.

[0292] 14. The plurality of ADAS as described in paragraph 13, wherein the one or more heterologous nucleotide sequences comprise a sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 1.

[0293] 15. The plurality of ADAS as described in paragraph 14, wherein the one or more heterologous nucleotide sequences comprise a sequence having at least 95% identity to the nucleotide sequence of SEQ ID NO: 1.

[0294] 16. A plurality of ADAS as described in paragraph 15, wherein the one or more heterologous nucleotide sequences comprise the nucleotide sequence of SEQ ID NO: 1.

[0295] 17. The ADAS of any one of paragraphs 12-16, wherein the one or more heterologous nucleotide sequences further comprises a constitutive promoter operably linked to the fim operon.

[0296] 18. The plurality of ADAS of paragraph 17, wherein the constitutive promoter is a modified fimS promoter comprising a mutation at a recombinase cleavage site that prevents the fimS promoter from recombining into an 'off' orientation.

[0297] 19. The plurality of ADAS of any of paragraphs 11-18, wherein the one or more nucleotide sequences encoding the components of T1P are carried on a vector.

[0298] 20. The plurality of ADAS of paragraph 19, wherein the parent bacterial cell has been transiently transformed with the vector.

[0299] 21. The plurality of ADAS as described in paragraph 19, wherein the parent bacterial cell has been stably transformed with the vector.

[0300] 22. The plurality of ADAS of any one of paragraphs 10-21, wherein the parent cell is a Gram-negative bacterial cell.

[0301] 23. The plurality of ADAS of paragraph 22, wherein the Gram-negative bacterial cells are Escherichia coli, Salmonella, Yersinia, Vibrio, Pseudomonas, Shigella, or Legionella bacterial cells.

[0302] 24. A plurality of ADAS as described in any one of paragraphs 11-23, wherein the parent cell does not contain a complete endogenous fim operon.

[0303] 25. A plurality of ADAS as described in any one of paragraphs 3, 4, and 12-24, wherein the parent cell has not been exposed to culture conditions that promote expression of the fim operon.

[0304] 26. The plurality of ADAS of paragraph 25, wherein the culture condition is temperature, pH, osmotic pressure, oscillation, or activation of a stress response or a stringent response.

[0305] 27. A plurality of ADAS as described in any of paragraphs 1-26, wherein the ADAS comprises a payload.

[0306] 28. A plurality of ADAS as described in paragraph 27, wherein the cargo is a nucleic acid, a plasmid, a polypeptide, a protein, an enzyme, an amino acid, a small molecule, a gene editing system, a hormone, an immunomodulator, a carbohydrate, a lipid, an organic particle, an inorganic particle or a ribonucleoprotein complex (RNP).

[0307] 29. A plurality of ADAS as described in paragraphs 27 or 28, wherein the payload is encapsulated by the ADAS.

[0308] 30. A plurality of ADAS as described in paragraphs 27 or 28, wherein the payload is attached to a surface of the ADAS.

[0309] 31. The plurality of ADAS of any one of paragraphs 1-30, wherein the ADAS comprises a heterologous bacterial secretion system.

[0310] 32. The plurality of ADAS of paragraph 31, wherein the heterologous bacterial secretion system is a type 3 secretion system (T3SS).

[0311] 33. The plurality of ADAS of paragraphs 31 or 32, wherein the cargo comprises a moiety that directs export of the bacterial secretion system.

[0312] 34. A composition comprising a plurality of ADAS as described in any of paragraphs 1-33.

[0313] 35. The composition of paragraph 34, wherein the composition is formulated for delivery to a mammal.

[0314] 36. The composition of paragraph 35, wherein the composition is formulated for oral delivery.

[0315] 37. A method for delivering ADAS to a cell, the method comprising:

[0316] (a) providing a composition comprising a plurality of ADAS as described in any one of paragraphs 1-36; and

[0317] (b) contacting the cell with the composition of step (a).

[0318] 38. The method of paragraph 37, wherein delivery of the ADAS to the cell is increased by at least 10% relative to ADAS derived from an unmodified parent cell.

[0319] 39. The method of paragraph 37 or 38, wherein the effective amount of the ADAS is delivered to the cell at a dose that is at least 10% lower than the dose required for ADAS derived from an unmodified parent cell.

[0320] 40. A method for delivering a cargo to a cell, the method comprising:

[0321] (a) providing a composition comprising a plurality of ADAS as described in any one of paragraphs 1-36, wherein the ADAS further comprises a cargo; and

[0322] (b) contacting the cell with the composition of step (a).

[0323] 41. The method of any one of paragraphs 37-40, wherein the ADAS further comprises a heterologous bacterial secretion system.

[0324] 42. The method of paragraph 41, wherein the heterologous bacterial secretion system is a T3SS.

[0325] 43. The method of any of paragraphs 37-42, wherein the delivery is to the cytoplasm of the cell.

[0326] 44. The method of any of paragraphs 40-43, wherein delivery of the cargo to the cell is increased by at least 10% relative to ADAS derived from an unmodified parent cell.

[0327] 45. The method of any of paragraphs 40-43, wherein an effective amount of the cargo is delivered to the cell at a dose that is at least 10% lower than the dose required for ADAS derived from an unmodified parent cell.

[0328] 46. ​​A method of regulating a cell, the method comprising:

[0329] (a) providing a composition comprising a plurality of ADAS as described in any one of paragraphs 1-36; and

[0330] (b) contacting the cell with the composition of step (a), thereby modulating the cell.

[0331] 47. The method of any of paragraphs 37-46, wherein the cell is a mammalian cell.

[0332] 48. The method of paragraph 47, wherein the mammalian cell is an intestinal cell.

[0333] 49. The method of paragraph 48, wherein the intestinal cell is a gut-associated lymphoid tissue (GALT) cell, a Peyer's patch cell, an M cell, a lamina propria cell, a small intestinal cell, or a large intestinal cell.

[0334] 50. The method of paragraph 47, wherein the mammalian cell is a bladder cell.

[0335] 51. The method of paragraph 47, wherein the mammalian cell is an immune cell.

[0336] 52. The method of paragraph 47, wherein the mammalian cell is a blood-brain barrier cell.

[0337] 53. The method of any of paragraphs 47-52, wherein the mammalian cell is a mannosylated cell.

[0338] 54. A method of treating a mammal in need thereof, the method comprising:

[0339] (a) providing a composition comprising a plurality of ADAS as described in any one of paragraphs 1-36; and

[0340] (b) contacting the mammal with an effective amount of the composition of step (a), thereby treating the mammal.

[0341] 55. The method of paragraph 54, wherein the therapeutic effect is achieved at a dosage that is at least 10% lower than the dosage required for ADAS derived from an unmodified parent cell.

[0342] 56. An ADAS comprising a T1P derived from a parent bacterial cell, wherein the ADAS is produced by a method comprising the steps of:

[0343] (a) providing a parent cell modified to constitutively express a component of T1P; and

[0344] (b) producing ADAS from the parent bacterial cell, wherein the ADAS comprises the T1P.

[0345] 57. An ADAS comprising a T1P derived from a parent bacterial cell, wherein the ADAS is produced by a method comprising the steps of:

[0346] (a) providing a parent cell modified to express a component of native T1P at a level at least 1.5 times higher than that observed in an unmodified parent cell; and

[0347] (b) producing ADAS from the parent bacterial cell, wherein the ADAS comprises a T1P that is native to the parent cell.

[0348] 58. An ADAS comprising a T1P derived from a parent bacterial cell, wherein the ADAS is produced by a method comprising the steps of:

[0349] (a) providing a parent cell modified to express a component of a heterologous T1P; and

[0350] (b) producing ADAS from the parent bacterial cell, wherein the ADAS comprises a T1P that is heterologous to the parent cell.

[0351] 59. An engineered bacterium that constitutively expresses a component of a T1P, wherein the engineered bacterium comprises the T1P at a level that is at least 1.5 times higher than the level of T1P comprised by a non-engineered bacterium.

[0352] 60. The bacterium of paragraph 59, wherein the T1P is a native T1P.

[0353] 61. The bacterium of paragraph 59, wherein the T1P is a heterologous T1P.

[0354] 62. An engineered bacterium that constitutively expresses components of T1P, wherein the bacterium has been modified to produce ADAS.

[0355] 63. A method for producing an ADAS, the method comprising the steps of:

[0356] (a) providing an engineered bacterium that constitutively expresses components of T1P; and

[0357] (b) producing ADAS by the bacteria.

[0358] 64. An ADAS produced according to the method of paragraph 63.

[0359] The invention is further described in the following numbered paragraphs:

[0360] 1. A preparation comprising a plurality of non-chromosomal dynamic active systems (ADAS), the plurality of non-chromosomal dynamic active systems being derived from a parent bacterial cell genetically engineered to constitutively express type 1 pili (T1P), wherein the plurality of ADAS bind to a target cell via the T1P.

[0361] 2. The formulation of paragraph 1, wherein the parent bacterial cell comprises a modified fimS promoter operably linked to a component of the T1P and directs constitutive expression of the component.

[0362] 3. The preparation of paragraph 1 or 2, wherein the components of T1P are encoded by the fim operon.

[0363] 4. The preparation of paragraph 3, wherein the parent bacterial cell comprises a modified fimS promoter operably linked to the fim operon, wherein the modified fimS promoter comprises a mutation at a recombinase cleavage site that prevents the fimS promoter from recombining into an 'off' orientation.

[0364] 5. The preparation of any of paragraphs 1-4, wherein the parent bacterial cell expresses a component of the T1P at a level at least 1.5-fold higher than the level observed in an unmodified parent bacterial cell.

[0365] 6. The formulation of any of paragraphs 1-5, wherein the plurality of ADAS comprises the T1P at a level that is at least 1.5-fold higher than the level observed in the plurality of ADAS produced by an unmodified parent bacterial cell.

[0366] 7. The preparation of any of paragraphs 1-6, wherein the proportion of the plurality of ADAS comprising T1P is increased relative to the plurality of ADAS produced by a parent bacterial cell that does not constitutively express components of T1P.

[0367] 8. The preparation of any of paragraphs 1-7, wherein the parent bacterial cell comprises an endogenous fim operon.

[0368] 9. The preparation of any of paragraphs 1-8, wherein the parent bacterial cell is an Escherichia coli bacterium.

[0369] 10. The formulation of paragraph 9, wherein the E. coli bacterium is E. coli CFT073.

[0370] 11. The preparation of any of paragraphs 1-10, wherein the parent bacterial cell comprises one or more heterologous nucleotide sequences encoding components of the T1P.

[0371] 12. The preparation of paragraph 11, wherein the one or more heterologous nucleotide sequences comprise the fim operon.

[0372] 13. The preparation of paragraph 12, wherein the fim operon is the fim operon of Escherichia coli CFT073.

[0373] 14. The formulation of paragraph 13, wherein the one or more heterologous nucleotide sequences comprise a sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 1.

[0374] 15. The formulation of paragraph 14, wherein the one or more heterologous nucleotide sequences comprise a sequence having at least 95% identity to the nucleotide sequence of SEQ ID NO: 1.

[0375] 16. The formulation of paragraph 15, wherein the one or more heterologous nucleotide sequences comprise the nucleotide sequence of SEQ ID NO: 1.

[0376] 17. The formulation of any of paragraphs 12-16, wherein the one or more heterologous nucleotide sequences further comprises a constitutive promoter operably linked to the fim operon.

[0377] 18. The formulation of paragraph 17, wherein the constitutive promoter is a modified fimS promoter comprising a mutation at the recombinase cleavage site that prevents the fimS promoter from recombining into an 'off' orientation.

[0378] 19. The formulation of any of paragraphs 11-18, wherein the one or more nucleotide sequences encoding the components of T1P are carried on a vector.

[0379] 20. The preparation of paragraph 19, wherein the parent bacterial cell has been transiently transformed with the vector.

[0380] 21. The preparation of paragraph 19, wherein the parent bacterial cell has been stably transformed with the vector.

[0381] 22. The preparation of any of paragraphs 10-21, wherein the parent bacterial cell is a Gram-negative bacterial cell.

[0382] 23. The formulation of paragraph 22, wherein the Gram-negative bacterial cell is an Escherichia coli, Salmonella, Yersinia, Vibrio, Pseudomonas, Shigella, or Legionella bacterial cell.

[0383] 24. The preparation of any of paragraphs 11-23, wherein the parent bacterial cell does not contain an intact endogenous fim operon.

[0384] 25. The preparation of any of paragraphs 3, 4, and 12-24, wherein the parent bacterial cell has not been exposed to culture conditions that promote expression of the fim operon.

[0385] 26. The formulation of paragraph 25, wherein the culture condition is temperature, pH, osmotic pressure, oscillation, or activation of a stress response or a stringent response.

[0386] 27. The formulation of any of paragraphs 1-26, wherein the ADAS comprises a cargo.

[0387] 28. The formulation of paragraph 27, wherein the cargo is a nucleic acid, a plasmid, a polypeptide, a protein, an enzyme, an amino acid, a small molecule, a gene editing system, a hormone, an immunomodulator, a carbohydrate, a lipid, an organic particle, an inorganic particle, or a ribonucleoprotein complex (RNP).

[0388] 29. The formulation of paragraph 27 or 28, wherein the cargo is encapsulated by the ADAS.

[0389] 30. The formulation of paragraph 27 or 28, wherein the cargo is attached to the surface of the ADAS.

[0390] 31. The formulation of any of paragraphs 1-30, wherein the ADAS comprises a heterologous bacterial secretion system.

[0391] 32. The formulation of paragraph 31, wherein the heterologous bacterial secretion system is a type 3 secretion system (T3SS) or a type 6 secretion system (T6SS).

[0392] 33. The formulation of paragraph 31 or 32, wherein the cargo comprises a moiety that directs export of the bacterial secretion system.

[0393] 34. A composition comprising a preparation of a plurality of ADAS as described in any of paragraphs 1-33.

[0394] 35. The composition of paragraph 34, wherein the composition is formulated for delivery to a mammal.

[0395] 36. The composition of paragraph 35, wherein the composition is formulated for oral delivery.

[0396] 37. A method for delivering ADAS to a cell, the method comprising contacting the cell with a composition comprising a preparation of a plurality of ADAS as described in any of paragraphs 1-36.

[0397] 38. The method of paragraph 37, wherein delivery of the ADAS to the cell is increased by at least 10% relative to ADAS derived from an unmodified parent bacterial cell.

[0398] 39. The method of paragraph 37 or 38, wherein an effective amount of the ADAS is delivered to the cell at a dose that is at least 10% lower than the dose required for ADAS derived from an unmodified parent bacterial cell.

[0399] 40. A method for delivering a cargo to a cell, the method comprising contacting the cell with a composition comprising a preparation of a plurality of ADAS as described in any one of paragraphs 1-36, wherein the ADAS further comprises a cargo.

[0400] 41. The method of any one of paragraphs 37-40, wherein the ADAS further comprises a heterologous bacterial secretion system.

[0401] 42. The method of paragraph 41, wherein the heterologous bacterial secretion system is a T3SS or a T6SS.

[0402] 43. The method of any of paragraphs 37-42, wherein the delivery is to the cytoplasm of the cell.

[0403] 44. The method of any of paragraphs 40-43, wherein delivery of the cargo to the cell is increased by at least 10% relative to ADAS derived from an unmodified parent bacterial cell.

[0404] 45. The method of any of paragraphs 40-43, wherein an effective amount of the cargo is delivered to the cell at a dose that is at least 10% lower than the dose required for ADAS derived from an unmodified parent bacterial cell.

[0405] 46. ​​A method for modulating a cell, the method comprising contacting the cell with a composition comprising a preparation of a plurality of ADAS as described in any of paragraphs 1-36, thereby modulating the cell.

[0406] 47. The method of any of paragraphs 37-46, wherein the cell is a mammalian cell.

[0407] 48. The method of paragraph 47, wherein the mammalian cell is an intestinal cell.

[0408] 49. The method of paragraph 48, wherein the intestinal cell is a gut-associated lymphoid tissue (GALT) cell, a Peyer's patch cell, an M cell, a lamina propria cell, a small intestinal cell, or a large intestinal cell.

[0409] 50. The method of paragraph 47, wherein the mammalian cell is a bladder cell.

[0410] 51. The method of paragraph 47, wherein the mammalian cell is an immune cell.

[0411] 52. The method of paragraph 47, wherein the mammalian cell is a blood-brain barrier cell.

[0412] 53. The method of any of paragraphs 47-52, wherein the mammalian cell is a mannosylated cell.

[0413] 54. An ADAS derived from a parent bacterial cell genetically engineered to constitutively express T1P, wherein the ADAS is produced by a method comprising the steps of:

[0414] (a) providing a parent bacterial cell modified to constitutively express components of T1P; and

[0415] (b) producing ADAS from the parent bacterial cell, wherein the ADAS comprises the T1P.

[0416] 55. An ADAS derived from a parent bacterial cell genetically engineered to constitutively express T1P, wherein the ADAS is produced by a method comprising the steps of:

[0417] (a) providing a parent bacterial cell modified to express a component of native T1P at a level at least 1.5 times higher than that observed in an unmodified parent bacterial cell; and

[0418] (b) producing ADAS from the parent bacterial cell, wherein the ADAS comprises a T1P native to the parent bacterial cell.

[0419] 56. An ADAS derived from a parent bacterial cell genetically engineered to constitutively express T1P, wherein the ADAS is produced by a method comprising the steps of:

[0420] (a) providing a parent bacterial cell modified to express components of a heterologous T1P; and

[0421] (b) producing ADAS from the parent bacterial cell, wherein the ADAS comprises a T1P that is heterologous to the parent bacterial cell.

[0422] 57. A genetically engineered bacterium that constitutively expresses a component of a T1P, wherein the engineered bacterium comprises the T1P at a level that is at least 1.5 times higher than the level of T1P comprised by a non-engineered bacterium.

[0423] 58. The bacterium of paragraph 57, wherein the T1P is a native T1P.

[0424] 59. The bacterium of paragraph 57, wherein the T1P is a heterologous T1P.

[0425] 60. A genetically engineered bacterium that constitutively expresses components of T1P, wherein the bacterium has been modified to produce ADAS.

[0426] 61. A method for producing ADAS, the method comprising producing ADAS from bacteria genetically engineered to constitutively express components of T1P.

[0427] 62. An ADAS produced according to the method of paragraph 61.

[0428] Examples

[0429] Example 1: Methods for making ADAS expressing endogenous or heterologous type 1 pili (T1P-ADAS) A. ADAS expressing endogenous T1P

[0430] The natural promoter of type 1 pili (T1P), fimS, is phase variable. A phase variable promoter is a DNA fragment that can be inverted after being cleaved by a site-specific recombinase. The recombinases fimB and fimE are expressed at the inverted repeat sites (IR sites; in Figure 1 ) binds and cleaves, and can switch the promoter to an 'on' orientation (promoter faces the operator; the fim operator is expressed) or a 'off' orientation (promoter faces away from the operator; the fim operator is not expressed) ( Figure 1 ). The fimS expression state is heritable, but also reversible, and inversions are affected by a variety of signals, including temperature, pH, osmotic pressure, and stress and stringent responses. In the laboratory, growing E. coli in LB broth at 37°C with shaking (standard growth conditions for E. coli) promotes the maintenance of the fimS switch in the 'off' orientation. Switching growth to 37°C, static (rather than shaking) promotes the maintenance of the fimS switch in the 'on' orientation.

[0431] Use λ-RED recombineering to make the recombinase cleavage site upstream of the promoter ( Figure 1The green box in the figure (green box) mutation locked it in the open orientation ("locked" ("LON") operon), thereby generating bacteria that constitutively express the fim operon (i.e., constitutively express T1P). This was performed in two strains of E. coli: a laboratory-adapted strain (BW25113) and a pathogenic strain (CFT073). The bacteria were further engineered to produce ADAS by deleting the minCDE locus using λ-RED recombineering as described in WO 2020 / 123569.

[0432] The wild-type sequence (5'->3') of the fimS site in E. coli strains CFT073 and MG1655 with the fimS promoter in the 'open' orientation is shown in SEQ ID NO:4 and SEQ ID NO:6, respectively. The left inverted repeat site is underlined and italicized. SEQ ID NO:5 and SEQ ID NO:7 shown below show mutations made to the left inverted repeat site. Mutations are indicated in uppercase letters. Although very similar, the fimS operons from CFT073 and MG1655 have some variations in the promoter sequence. The inverted repeat site sequence and the mutations made to lock the promoter to 'open' are identical.

[0433] CFT073 fimS native 'open' orientation (SEQ ID NO:4)

[0434] ttggggcca ttttgactcatagaggaaagcatcgcgcacaaactttttcagtttatttgttggcttaatgttctatagttatctttatttgcagttttttatattgcatgaggtggttttggagagaagaatgaggaagttgcgtcgagctacagaaacg ttagctttacatatagcggaggtgatgtgaaattaatttacaagagaaataatttacatatcaaacagttagatgctttttgtcgttttttaatatttttatgcttgagaaaaaatacgtaacttatttatgatatagacagtttggccccaa

[0435] CFT073 fimS 'locked' sequence. (SEQ ID NO:5) Mutations from the native sequence are in bold and capital letters.

[0436] Tcttttgactcatagaggaaagcatcgcgcacaaactttttcagtttatttgttggcttaatgttctatagttatctttatttgcagttttttatattgcatgaggtggtttttggagagaagaatgaggaagttgcgtcgagctacagaaacgttagctttacatatagcggaggtgatgtgaaattaatttacaagagaaataatttacatatcaaacagttagatgctttttgtcgttttttaatatttttatgcttgagaaaaaatacgtaacttatttatgatatagacagtttggccccaa

[0437] MG1655 fimS natural 'open' orientation (SEQ ID NO:6)

[0438] ttggggcca ttttgactcatagaggaaagcatcgcggacaaactttttcagtttatttgttggcttaatattctattgttatctttatttatagatgtttatattgcatgaggtggtttttggagagaagaatgaggaagatgcgtcgagccacagaaacgttagctttacatatagcggaggtgatgtgaaattaatttacaatagaaataatttacatatcaaacagttagatgctttttgtcgttttttaatatttttatgcttgagaaaaaatacgtaacttatttatgatatggacagtttggccccaa

[0439] MG1655 fimS 'locked' orientation (SEQ ID NO:7)

[0440] Tcttttgactcatagaggaaagcatcgcggacaaactttttcagtttatttgttggcttaatattctattgttatctttatttatagatgtttatattgcatgaggtggtttttggagagaagaatgaggaagatgcgtcgagccacagaaacg ttagctttacatatagcggaggtgatgtgaaattaatttacaatagaaataatttacatatcaaacagttagatgctttttgtcgttttttaatatttttatgcttgagaaaaaatacgtaacttatttatgatatggacagtttggccccaa

[0441] Bacterial strains containing the LON operon express T1P when grown with shaking at 37° C. Unmodified strains (eg, wild-type bacteria without mutated fimS) grown under these growth conditions will not produce T1P.

[0442] like Figure 2 As shown, the presence of T1P on the surface of ADAS produced by engineered BW25113 and CFT073 E. coli strains containing the locked operon was confirmed using transmission electron microscopy.

[0443] B. ADAS expressing heterologous T1P

[0444] Heterologous expression of T1P was achieved by cloning the CFT073 fim operon (ATCC 700928; SEQ ID NO: 1), containing the genes FimA, FimI, FimC, FimD, FimF, FimG, and FimH, into a plasmid containing a constitutive promoter (thereby generating pT1P) and expressing the plasmid in bacteria. The operon was obtained from the pathogenic E. coli strain CFT073 and expressed in K12 E. coli BW25113. The CFT073 version of the fim operon was chosen because previous studies showed that the type 1 pili of this strain are superior in ligand binding. The promoter is J23117 (SEQ ID NO: 2). The bacteria were further engineered to produce ADAS by deleting the minCDE locus using λ-RED recombineering, as described in WO 2020 / 123569.

[0445] Example 2: Endogenous and allogeneic T1P-ADAS agglutinate erythrocytes

[0446] To determine whether the engineered bacteria of Example 1 and the ADAS produced therefrom contained detectable levels of T1P, the bacteria and ADAS were evaluated using a red blood cell (RBC) hemagglutination assay.

[0447] The RBC hemagglutination assay is a standard assay in the art for demonstrating expression of functional T1P. T1P binds to mannosylated residues, and guinea pig RBCs (gpRBCs) are highly mannosylated. x The assay is performed by incubating a test article (e.g., the engineered bacteria of Example 1 or ADAS produced therefrom) with a fixed number of gpRBCs in PBS or PBS+mannose and determining the dilution at which the test article no longer agglutinates RBCs (read as HA titer). PBS+mannose is included as a functional control because T1P agglutination is mannose sensitive.

[0448] ADAS expressing T1P from both endogenous (LON T1P; Example 1A) and heterologous (pT1P; Example 1B) sources were found to agglutinate RBCs ( Figure 3 This binding was mannose-inhibitable, a hallmark of T1P-dependent aggregation. Furthermore, functional expression was demonstrated in T1P-ADAS derived from two different E. coli strains ( Figure 3 ). Example 3: Endogenous T1P-ADAS shows enhanced binding to intestinal cells

[0449] Previous studies have shown that T1P promotes tropism to intestinal areas (e.g., Peyer's patches) and other body sites and cell types (Martinez et al., The EMBO Journal, 19:2803-2812, 2000; Carvalho et al., J Exp Med., 206(10):2179-2189, 2009; Hase et al., Nature, 462(7270):226-230, 2009; Avalos et al., Sci Rep., 6:18109, 2016; Sheikh et al., PLoS Negl Trop. Dis. [PLoS Neglected Tropical Diseases], 11(5):e00055862017, 2017; Spaulding et al., Nature [Nature], 546(7659):528-532, 2017; LeGuennec et al., Cellular Microbiology [Cellular Microbiology], 22:e13132, 2019).

[0450] This example demonstrates that ADAS produced according to Example 1A (T1P-ADAS) exhibits enhanced binding to the human colorectal cancer cell line HT-29 over non-T1P-ADAS (i.e., ADAS produced by bacteria that are not engineered according to Example 1A to contain the locked fim operon). The assay was performed by incubating ADAS with HT-29 cells for one hour, removing unbound ADAS, fixing the remaining bound ADAS, and staining with a fluorescent antibody against LPS. Fluorescence microscopy was performed to count the number of ADAS per HT-29 cell nucleus ( Figure 4 ). It was also demonstrated that the enhanced binding of T1P-ADAS was mannose sensitive.

[0451] Although the foregoing invention has been described in detail by way of illustration and example for the purpose of clear understanding, the description and examples should not be construed as limiting the scope of the invention. The disclosures of all patents and scientific literature cited herein are expressly incorporated by reference in their entirety. Other embodiments are within the claims.

Claims

1. A preparation comprising a plurality of non-chromosomal dynamic active systems (ADAS), the plurality of non-chromosomal dynamic active systems being derived from a parent bacterial cell genetically engineered to constitutively express type 1 pili (T1P), wherein the plurality of ADAS bind to a target cell via the T1P.

2. The preparation of claim 1, wherein the parent bacterial cell comprises a modified fimS promoter operably linked to a component of the T1P and directs constitutive expression of the component.

3. The preparation of claim 1 or 2, wherein the components of T1P are encoded by the fim operon.

4. The preparation of claim 3, wherein the parent bacterial cell comprises a modified fimS promoter operably linked to the fim operon, wherein the modified fimS promoter comprises a mutation at a recombinase cleavage site that prevents the fimS promoter from recombining into an 'off' orientation.

5. The preparation of any one of claims 1-4, wherein the parent bacterial cell expresses a component of the T1P at a level at least 1.5-fold higher than the level observed in an unmodified parent bacterial cell.

6. The preparation of any one of claims 1-5, wherein the plurality of ADAS comprises the T1P at a level that is at least 1.5-fold higher than the level observed in the plurality of ADAS produced by an unmodified parent bacterial cell.

7. The preparation of any one of claims 1-6, wherein the proportion of the plurality of ADAS comprising T1P is increased relative to the plurality of ADAS produced by a parent bacterial cell that does not constitutively express components of T1P.

8. The preparation of any one of claims 1-7, wherein the parent bacterial cell comprises an endogenous fim operon.

9. The preparation of any one of claims 1-8, wherein the parent bacterial cell is an Escherichia coli bacterium.

10. The formulation of claim 9, wherein the E. coli bacteria is E. coli CFT073.

11. The preparation of any one of claims 1-10, wherein the parent bacterial cell comprises one or more heterologous nucleotide sequences encoding components of the T1P.

12. The formulation of claim 11, wherein the one or more heterologous nucleotide sequences comprise the fim operon.

13. The preparation of claim 12, wherein the fim operon is the fim operon of Escherichia coli CFT073.

14. The formulation of claim 13, wherein the one or more heterologous nucleotide sequences comprise a sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO:

1.

15. The formulation of claim 14, wherein the one or more heterologous nucleotide sequences comprise a sequence having at least 95% identity to the nucleotide sequence of SEQ ID NO:

1.

16. The formulation of claim 15, wherein the one or more heterologous nucleotide sequences comprise the nucleotide sequence of SEQ ID NO:

1.

17. The formulation of any one of claims 12-16, wherein the one or more heterologous nucleotide sequences further comprises a constitutive promoter operably linked to the fim operon.

18. The formulation of claim 17, wherein the constitutive promoter is a modified fimS promoter comprising a mutation at the recombinase cleavage site that prevents the fimS promoter from recombining into an 'off' orientation.

19. The formulation of any one of claims 11 to 18, wherein the one or more nucleotide sequences encoding the components of T1P are carried on a vector.

20. The preparation of claim 19, wherein the parent bacterial cell has been transiently transformed with the vector.

21. The preparation of claim 19, wherein the parent bacterial cell has been stably transformed with the vector.

22. The preparation of any one of claims 10-21, wherein the parent bacterial cell is a Gram-negative bacterial cell.

23. The formulation of claim 22, wherein the Gram-negative bacterial cell is an Escherichia coli, Salmonella, Yersinia, Vibrio, Pseudomonas, Shigella, or Legionella bacterial cell.

24. The preparation of any one of claims 11-23, wherein the parent bacterial cell does not comprise an intact endogenous fim operon.

25. The preparation of any one of claims 3, 4, and 12-24, wherein the parent bacterial cell has not been exposed to culture conditions that promote expression of the fim operon.

26. The formulation of claim 25, wherein the culture condition is temperature, pH, osmotic pressure, shaking, or activation of a stress response or a stringent response.

27. The formulation of any one of claims 1-26, wherein the ADAS comprises a cargo.

28. The formulation of claim 27, wherein the cargo is a nucleic acid, a plasmid, a polypeptide, a protein, an enzyme, an amino acid, a small molecule, a gene editing system, a hormone, an immunomodulator, a carbohydrate, a lipid, an organic particle, an inorganic particle, or a ribonucleoprotein complex (RNP).

29. The formulation of claim 27 or 28, wherein the cargo is encapsulated by the ADAS.

30. The formulation of claim 27 or 28, wherein the cargo is attached to the surface of the ADAS.

31. The formulation of any one of claims 1-30, wherein the ADAS comprises a heterologous bacterial secretion system.

32. The formulation of claim 31, wherein the heterologous bacterial secretion system is a type 3 secretion system (T3SS) or a type 6 secretion system (T6SS).

33. The formulation of claim 31 or 32, wherein the cargo comprises a moiety that directs export of the bacterial secretion system.

34. A composition comprising a preparation of a plurality of ADAS as described in any one of claims 1-33.

35. The composition of claim 34, wherein the composition is formulated for delivery to a mammal.

36. The composition of claim 35, wherein the composition is formulated for oral delivery.

37. A method for delivering ADAS to a cell, the method comprising contacting the cell with a composition comprising a preparation of a plurality of ADAS as described in any one of claims 1-36.

38. The method of claim 37, wherein delivery of the ADAS to the cell is increased by at least 10% relative to ADAS derived from an unmodified parent bacterial cell.

39. The method of claim 37 or 38, wherein an effective amount of the ADAS is delivered to the cell at a dose that is at least 10% lower than the dose required for ADAS derived from an unmodified parent bacterial cell.

40. A method for delivering a cargo to a cell, the method comprising contacting the cell with a composition comprising a preparation of a plurality of ADAS as described in any one of claims 1-36, wherein the ADAS further comprises a cargo.

41. The method of any one of claims 37-40, wherein the ADAS further comprises a heterologous bacterial secretion system.

42. The method of claim 41, wherein the heterologous bacterial secretion system is a T3SS or a T6SS.

43. The method of any one of claims 37-42, wherein the delivery is to the cytoplasm of the cell.

44. The method of any one of claims 40-43, wherein delivery of the cargo to the cell is increased by at least 10% relative to ADAS derived from an unmodified parent bacterial cell.

45. The method of any one of claims 40-43, wherein an effective amount of the cargo is delivered to the cell at a dose that is at least 10% lower than the dose required for ADAS derived from an unmodified parent bacterial cell.

46. ​​A method for modulating a cell, the method comprising contacting the cell with a composition comprising a preparation of a plurality of ADAS as described in any one of claims 1-36, thereby modulating the cell.

47. The method of any one of claims 37-46, wherein the cell is a mammalian cell.

48. The method of claim 47, wherein the mammalian cell is an intestinal cell.

49. The method of claim 48, wherein the intestinal cell is a gut-associated lymphoid tissue (GALT) cell, a Peyer's patch cell, an M cell, a lamina propria cell, a small intestinal cell, or a large intestinal cell.

50. The method of claim 47, wherein the mammalian cell is a bladder cell.

51. The method of claim 47, wherein the mammalian cell is an immune cell.

52. The method of claim 47, wherein the mammalian cell is a blood-brain barrier cell.

53. The method of any one of claims 47-52, wherein the mammalian cell is a mannosylated cell.

54. An ADAS derived from a parent bacterial cell genetically engineered to constitutively express T1P, wherein the ADAS is produced by a method comprising the steps of: (a) providing a parent bacterial cell modified to constitutively express components of T1P; and (b) producing ADAS from the parent bacterial cell, wherein the ADAS comprises the T1P.

55. An ADAS derived from a parent bacterial cell genetically engineered to constitutively express T1P, wherein the ADAS is produced by a method comprising the steps of: (a) providing a parent bacterial cell modified to express a component of native T1P at a level at least 1.5 times higher than that observed in an unmodified parent bacterial cell; and (b) producing ADAS from the parent bacterial cell, wherein the ADAS comprises a T1P native to the parent bacterial cell.

56. An ADAS derived from a parent bacterial cell genetically engineered to constitutively express T1P, wherein the ADAS is produced by a method comprising the steps of: (a) providing a parent bacterial cell modified to express components of a heterologous T1P; and (b) producing ADAS from the parent bacterial cell, wherein the ADAS comprises a T1P that is heterologous to the parent bacterial cell.

57. A genetically engineered bacterium that constitutively expresses a component of a T1P, wherein the engineered bacterium comprises the T1P at a level that is at least 1.5 times higher than the level of T1P comprised by a non-engineered bacterium.

58. The bacterium of claim 57, wherein the T1P is a native T1P.

59. The bacterium of claim 57, wherein the T1P is a heterologous T1P.

60. A genetically engineered bacterium that constitutively expresses components of T1P, wherein the bacterium has been modified to produce ADAS.

61. A method for producing ADAS, the method comprising producing ADAS from bacteria genetically engineered to constitutively express components of T1P.

62. An ADAS produced according to the method of claim 61.

Images