Spatial transcriptomic library preparation materials and methods

Abstract

The present disclosure relates generally to methods for improving the preparation of spatial transcriptomic RNA libraries, such as mRNA libraries, by improving in situ capture of RNA transcript information from tissue samples. The spatial transcriptomic library from a tissue sample can be used to determine genetic maps and help diagnose persons having or at risk of having diseases, such as cancer, genetic diseases, autoimmune diseases, and other indications, and improve treatment of subjects.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the priority benefit of U.S. Provisional Patent Application No. 63 / 477,726 filed on December 29, 2022 and U.S. Provisional Patent Application No. 63 / 612,819 filed on December 20, 2023, the entire text of which is incorporated herein by reference.

[0003] Sequence Disclosure Incorporated by Reference

[0004] The sequence listing as part of this disclosure is submitted simultaneously with the specification as a computer-readable file. The file name containing the sequence listing is "IP-2535-PC_SeqListing.xml", which was created on December 21, 2023 and is 20,735 bytes in size. The subject matter of the sequence listing is incorporated herein by reference in its entirety. Technical Field

[0005] The present disclosure generally relates to methods for generating spatial transcriptomics mRNA libraries by improving methods for capturing mRNA transcripts from in situ samples, and mRNA libraries prepared by these methods. Background Art

[0006] Spatial transcriptomics enables high-resolution in situ gene expression profiling, in which cellular relationships are captured within complex tissue architectures. Formalin-fixed paraffin-embedded (FFPE) tissues represent a valuable resource for cancer research, as they are the most widely available material with known patient outcomes (recent estimates suggest that there are >1 billion FFPE samples worldwide). However, formalin fixation and subsequent de-crosslinking are known to cause degradation and chemical modification of RNA during tissue processing, making poly A capture of mRNA more challenging than in fresh frozen tissue. Summary of the invention

[0007] The present disclosure provides an improved method for generating mRNA transcript libraries from in situ samples (e.g., fresh frozen or formalin-fixed paraffin-embedded tissue samples) by increasing the efficiency of capturing mRNA transcripts from tissue samples, thereby generating a more complete transcriptomic library. The method can be used to isolate genomic information from samples (such as tumor biopsies or other tissues) in patients with a disease and associate the genetic information with having a disease or being at risk of having a disease or developing a disease.

[0008] In one aspect, the present disclosure provides a method for preparing an mRNA transcript expression library from a tissue sample, the method comprising: a) mounting the tissue sample on a substrate comprising a plurality of capture oligonucleotides, wherein the capture oligonucleotides comprise a first clustering sequence (e.g., P7), a spatial barcode sequence (SBC), and a first universal adapter sequence (e.g., Rd2 adapter); b) contacting the tissue sample with the following substances under conditions such that one or more 5' gene-specific probes and one or more 3' gene-specific probes hybridize to one or more mRNA transcripts in the tissue sample: i) a plurality of 5' gene-specific probes, the plurality of 5' gene-specific probes comprising a sequence complementary to the first universal adapter sequence and a 5' gene-specific primer; ii) a plurality of 3' gene-specific probes, The multiple 3' gene-specific probes comprise a 3' gene-specific primer, a unique molecular index and a second universal adapter sequence (e.g., Rd1 adapter); c) contacting the tissue sample in (b) with a ligation reagent so that the 5' gene-specific probe and the 3' gene-specific probe that hybridize to the mRNA transcript adjacent to each other are ligated together to form one or more ligated gene-specific probe pairs; d) removing the mRNA transcripts that hybridize to the ligated gene-specific probe pairs and leaving the ligated gene-specific probe pair oligonucleotide sequences; e) capturing the ligated gene-specific probe pair oligonucleotides of (d) on a substrate by combining a sequence complementary to the first universal adapter sequence in the 5' gene-specific probe with the first universal adapter sequence (e.g., Rd2 adapter) of the capture oligonucleotide.

[0009] Also contemplated are methods for determining expression of mRNA transcripts in a tissue sample, the method comprising a) mounting the tissue sample on a substrate comprising a plurality of capture oligonucleotides, wherein the capture oligonucleotides comprise a first clustering sequence (e.g., P7), a spatial barcode sequence (SBC), and a first universal adapter sequence (e.g., Rd2 adapter); b) contacting the tissue sample with: i) a plurality of 5' gene-specific probes comprising a sequence complementary to the first universal adapter sequence and a 5' gene-specific primer; and ii) a plurality of 3' gene-specific probes comprising a sequence complementary to the first universal adapter sequence and a 5' gene-specific primer, under conditions such that one or more 5' gene-specific probes and one or more 3' gene-specific probes hybridize to one or more mRNA transcripts in the tissue sample; The gene-specific probe comprises a 3' gene-specific primer, a unique molecular index and a second universal adapter sequence (e.g., Rd1 adapter); c) contacting the tissue sample in (b) with a ligation reagent so that the 5' gene-specific probe and the 3' gene-specific probe that hybridize to the mRNA transcript adjacent to each other are ligated together to form one or more ligated gene-specific probe pairs; d) removing the mRNA transcripts that hybridize to the ligated gene-specific probe pair and leaving the ligated gene-specific probe pair oligonucleotide sequences; e) capturing the ligated gene-specific probe pair oligonucleotides of (d) on a substrate by combining a sequence complementary to the first universal adapter sequence in the 5' gene-specific probe with the first universal adapter sequence (e.g., Rd2 adapter) of the capture oligonucleotide.

[0010] In another aspect, the present disclosure provides a method for preparing an mRNA transcript expression library from a tissue sample and / or a method for determining mRNA transcript expression from a tissue sample, the method comprising: a) mounting the tissue sample on a substrate comprising a plurality of capture oligonucleotides, wherein the capture oligonucleotides comprise a first clustering sequence (e.g., P7), a spatial barcode sequence (SBC), and a first universal adapter sequence (e.g., Rd2 adapter); b) contacting the tissue sample with the following substances under conditions such that one or more 5' gene-specific probes and one or more 3' gene-specific probes hybridize to one or more mRNA transcripts in the tissue sample: i) a plurality of 5' gene-specific probes, the 5' gene-specific probes comprising a sequence complementary to the first universal adapter sequence, a unique molecular index, and a 5' gene-specific primer; and ii) multiple 3' gene-specific probes, the multiple 3' gene-specific probes comprising a 3' gene-specific primer and a second universal adapter sequence (e.g., Rd1 adapter); c) contacting the tissue sample in (b) with a ligation reagent so that the 5' gene-specific probe and the 3' gene-specific probe that hybridize to the mRNA transcript adjacent to each other are ligated together to form one or more ligated gene-specific probe pairs; d) removing the mRNA transcripts that hybridize to the ligated gene-specific probe pairs and leaving the ligated gene-specific probe pair oligonucleotide sequences; e) capturing the ligated gene-specific probe pair oligonucleotides of (d) on a substrate by combining a sequence complementary to the first universal adapter sequence in the 5' gene-specific probe with the first universal adapter sequence (e.g., Rd2 adapter) of the capture oligonucleotide.

[0011] In various embodiments, the present disclosure provides a method for preparing an mRNA transcript expression library from a tissue sample, the method comprising: a) mounting the tissue sample on a substrate comprising a plurality of capture oligonucleotides, wherein the capture oligonucleotides comprise a first clustering sequence (e.g., P7), a spatial barcode sequence (SBC), and a first universal adapter sequence (e.g., Rd2 adapter); b) contacting the tissue sample with the following substances under conditions such that one or more 5' gene-specific probes and one or more 3' gene-specific probes hybridize to one or more mRNA transcripts in the tissue sample: i) a plurality of 5' gene-specific probes, the plurality of 5' gene-specific probes comprising a sequence complementary to the first universal adapter sequence and a 5' gene-specific primer; and ii) a plurality of 3' gene-specific probes, the plurality of 3' gene-specific probes comprising a 3' gene-specific primer, a unique molecular index, and a second universal adapter sequence (e.g., Rd1 adapter); The invention relates to a method of preparing an oligonucleotide sequence of the present invention and a method for preparing an oligonucleotide sequence of the present invention. The method comprises: step (a) of preparing an oligonucleotide sequence of the present invention and a method for preparing the oligonucleotide sequence of the present invention. The method comprises: step (b) contacting the tissue sample with a nucleotide base and a ligation reagent, wherein hybridization of the 5' gene-specific probe and the 3' gene-specific probe on the mRNA transcript results in a nucleotide gap between the hybridized molecules; c) contacting the tissue sample in (b) with a nucleotide base and a ligation reagent, so that the gap between the 5' gene-specific probe and the 3' gene-specific probe hybridized to the mRNA transcript is filled with a nucleotide base complementary to the mRNA transcript, and the 5' gene-specific probe and the 3' gene-specific probe are ligated together to form one or more ligated gene-specific probe pairs; d) removing the mRNA transcript hybridized to the ligated gene-specific probe pair and leaving the ligated gene-specific probe pair oligonucleotide sequence; and e) capturing the ligated gene-specific probe pair oligonucleotide sequence of (d) on a substrate by combining a sequence complementary to the first universal adapter sequence in the 5' gene-specific probe with the first universal adapter sequence (e.g., Rd2 adapter) of the capture oligonucleotide.

[0012] The present disclosure also contemplates a method for determining expression of mRNA transcripts in a tissue sample, the method comprising a) mounting the tissue sample on a substrate comprising a plurality of capture oligonucleotides, wherein the capture oligonucleotides comprise a first clustering sequence (e.g., P7), a spatial barcode sequence (SBC), and a first universal adapter sequence (e.g., Rd2 adapter); b) contacting the tissue sample with the following substances under conditions such that one or more 5' gene-specific probes and one or more 3' gene-specific probes hybridize to one or more mRNA transcripts in the tissue sample: i) a plurality of 5' gene-specific probes, the plurality of 5' gene-specific probes comprising a sequence complementary to the first universal adapter sequence and a 5' gene-specific primer; and ii) a plurality of 3' gene-specific probes, the plurality of 3' gene-specific probes comprising a 3' gene-specific primer, a unique molecular index, and a second universal adapter sequence (e.g., Rd1 adapter), wherein the one or more 5' gene-specific probes and the one or more 3' gene-specific probes hybridize to one or more mRNA transcripts in the tissue sample. Hybridization of the 5' gene-specific probe and the one or more 3' gene-specific probes on the mRNA transcript results in a nucleotide gap between the hybrid molecules; c) contacting the tissue sample in (b) with a nucleotide base and a ligation reagent so that the nucleotide gap between the 5' gene-specific probe and the 3' gene-specific probe hybridized to the mRNA transcript is filled with a nucleotide base complementary to the mRNA transcript, and the 5' gene-specific probe and the 3' gene-specific probe are ligated together to form one or more ligated gene-specific probe pairs; d) removing the mRNA transcript hybridized to the ligated gene-specific probe pair and leaving the ligated gene-specific probe pair oligonucleotide sequence; and e) capturing the ligated gene-specific probe pair oligonucleotide sequence of (d) on a substrate by combining a sequence complementary to the first universal adapter sequence in the 5' gene-specific probe with the first universal adapter sequence (e.g., Rd2 adapter) of the capture oligonucleotide.

[0013] In various embodiments, the present disclosure provides a method for preparing an mRNA transcript expression library from a tissue sample and / or a method for determining mRNA transcript expression from a tissue sample, the method comprising a) mounting the tissue sample on a substrate comprising a plurality of capture oligonucleotides, wherein the capture oligonucleotides comprise a first clustering sequence (e.g., P7), a spatial barcode sequence (SBC), and a first universal adapter sequence (e.g., Rd2 adapter); b) contacting the tissue sample with the following substances under conditions such that one or more 5' gene-specific probes and one or more 3' gene-specific probes hybridize to one or more mRNA transcripts in the tissue sample: i) a plurality of 5' gene-specific probes, the 5' gene-specific probes comprising a sequence complementary to the first universal adapter sequence, a unique molecular index, and a 5' gene-specific primer; and ii) a plurality of 3' gene-specific probes, the plurality of 3' gene-specific probes comprising a 3' gene-specific primer and a second universal adapter sequence. (e.g., Rd1 adapter), wherein hybridization of the 5' gene-specific probe and the 3' gene-specific probe on the mRNA transcript results in a nucleotide gap between the hybridized molecules; c) contacting the tissue sample in (b) with a nucleotide base and a ligation reagent, so that the gap between the 5' gene-specific probe and the 3' gene-specific probe hybridized to the mRNA transcript is filled with a nucleotide base complementary to the mRNA transcript, and the 5' gene-specific probe and the 3' gene-specific probe are ligated together to form one or more ligated gene-specific probe pairs; d) removing the mRNA transcript hybridized to the ligated gene-specific probe pair and leaving the ligated gene-specific probe pair oligonucleotide sequence; and e) capturing the ligated gene-specific probe pair oligonucleotide sequence of (d) on a substrate by combining a sequence complementary to the first universal adapter sequence in the 5' gene-specific probe with the first universal adapter sequence (e.g., Rd2 adapter) of the capture oligonucleotide.

[0014] In various embodiments, the nucleotide gap is 1 to 50 or more nucleotides, including 50 or more nucleotides, 1 to 50 nucleotides, 1 to 40 nucleotides, 1 to 30 nucleotides, 1 to 20 nucleotides, or 1 to 10 nucleotides.

[0015] In various embodiments, the tissue sample is a fresh tissue sample, a frozen tissue sample, or a formalin-fixed paraffin-embedded (FFPE) tissue sample.

[0016] It is contemplated that the method further comprises indexing and sequencing the ligated gene-specific probe pairs, comprising f) performing an extension reaction and PCR on the oligonucleotide of (e) to generate a PCR template representing one or more mRNA transcripts in the tissue sample; g) eluting the PCR template; and h) performing index PCR to generate a double-stranded PCR product comprising a first-strand PCR product and a second-strand complementary to the first-strand PCR product. In various embodiments, the method further comprises sequencing the PCR product of (h), and determining the location of the mRNA transcript in the tissue based on the location of the spatial barcode (SBC) sequence.

[0017] The present disclosure provides improved methods for generating RNA libraries (e.g., mRNA libraries) from tissue samples (e.g., fresh frozen or formalin-fixed paraffin-embedded tissue samples) by increasing the efficiency of capturing mRNA transcripts from tissue samples, thereby generating more complete transcriptomic libraries.

[0018] Existing targeted ex situ spatial methods generally involve connecting probe pairs for RNA targets within tissues. Unless gap filling is performed and then connection is performed, sequence information from RNA cannot be obtained, but rather the connected probes are counted via sequencing. For example, if mutations (SNVs or altered splicing junctions, etc.) are present in RNA, they will not be detected.

[0019] Various methods have been proposed to capture RNA with targeting probes, which can then be hybridized with substrate-attached probes containing spatially barcoded sequences for RNA library preparation.

[0020] In one aspect, the present disclosure provides a method for preparing a spatially barcoded RNA library from a tissue sample, the method comprising: (a) contacting the tissue sample with a plurality of RNA capture probes that hybridize with RNA in the tissue sample, wherein each of the RNA capture probes comprises an RNA capture oligonucleotide sequence complementary to the RNA in the sample and a first substrate capture oligonucleotide complementary to the first domain of a plurality of splint oligonucleotides; (b) hybridizing the RNA capture oligonucleotides of the RNA capture probes with the RNA in the tissue sample to form an RNA-RNA capture probe hybrid; (c) extending the RNA capture oligonucleotides of the RNA-RNA capture probe hybrid using a reverse transcriptase to form a (d) capturing the first-strand cDNA molecules on a substrate, wherein the substrate comprises a plurality of substrate capture probes, each substrate capture probe comprising a spatial barcode and a second substrate capture oligonucleotide complementary to the second domain of the splint oligonucleotide, and wherein the capture comprises hybridizing the splint oligonucleotide with the first substrate capture oligonucleotide of the first-strand cDNA molecule and the second substrate capture oligonucleotide of the substrate capture probe; and (e) connecting the captured first-strand cDNA molecules to the substrate capture probes to form spatially barcoded first-strand cDNA molecules.

[0021] In various embodiments, the substrate capture probe further comprises a substrate anchoring moiety.

[0022] In various embodiments, the surface oligonucleotides further comprise a P7 adaptor and an RNA capture probe primer for reading the spatial barcode sequence.

[0023] Also contemplated is a method for preparing a spatially barcoded RNA library from a tissue sample, the method comprising: (a) contacting the tissue sample with a plurality of RNA capture probes that hybridize with RNA in the tissue sample, wherein the RNA capture probes comprise RNA capture oligonucleotides that are complementary to the RNA in the sample and a handle sequence; (b) hybridizing the RNA capture oligonucleotides of the RNA capture probes with the RNA in the tissue sample to form an RNA-RNA capture probe hybrid; and (c) extending the RNA capture oligonucleotides of the RNA-RNA capture probe hybrid using a reverse transcriptase to form a plurality of first-strand cDNA molecules, wherein each first-strand cDNA molecule The cDNA molecules comprise an RNA capture oligonucleotide and a handle sequence; (d) adding a 3' end oligonucleotide to the 3' end of each first-chain cDNA molecule, wherein the 3' end oligonucleotide comprises a substrate capture oligonucleotide complementary to the first domain of a plurality of substrate capture probes on a substrate, wherein each of the plurality of substrate capture probes comprises a substrate anchor sequence, a spatial barcode, and a first domain in a 5' to 3' orientation; (e) hybridizing the substrate capture oligonucleotide of the first-chain cDNA molecule to the first domain of the substrate capture probe; and (f) extending the first domain of the hybridized substrate capture probe to form a plurality of spatially barcoded first-chain cDNA molecules.

[0024] In various embodiments, the handle sequence is a PCR handle sequence, a molecular identifier, a UMI, or any combination thereof. In various embodiments, the handle sequence is a P5 adapter sequence.

[0025] In various embodiments, the 3' end oligonucleotide is added by tagging. In various embodiments, the 3' end oligonucleotide is added by click chemistry or oNTP-guided adapterization. In various embodiments, the 3' OH is added by terminating the extension reaction with a click-labeled nucleotide. In various embodiments, the click-labeled nucleotide is an azide or alkyne-labeled oligonucleotide. In various embodiments, the extension reaction adds a poly A sequence to the 3' extended sequence.

[0026] In various embodiments, the first strand cDNA is captured on a surface capture oligonucleotide using a poly-T sequence.

[0027] Also provided is a method for preparing a spatially barcoded RNA library from a tissue sample, the method comprising: (a) contacting the tissue sample with a plurality of RNA capture probes that hybridize with RNA in the tissue sample, wherein the RNA capture probes comprise an RNA capture oligonucleotide that is complementary to the RNA in the sample and a handle sequence; (b) hybridizing the RNA capture oligonucleotide of the RNA capture probe with the RNA in the tissue sample to form an RNA-RNA capture probe hybrid; (c) extending the RNA capture oligonucleotide of the RNA-RNA capture probe hybrid using a reverse transcriptase to form a plurality of first-chain cDNA molecules, wherein each of the first-chain cDNA molecules comprises an RNA capture oligonucleotide and a handle sequence; and (d) adding a 3' end oligonucleotide to the 3' end of each first-chain cDNA molecule via template switching, comprising hybridizing the first-chain cDNA molecule Contacting with a reverse transcriptase (RT) and a template switching oligonucleotide (TSO), wherein the RT incorporates an untemplated cytosine nucleotide at the 3' end of a first cDNA and the TSO comprises a sequence capable of hybridizing to the untemplated cytosine nucleotide, wherein the 3' end oligonucleotide is appended to the 3' end of the first cDNA and the RT is extended to produce the complement of the TSO; wherein the 3' end oligonucleotide comprises a substrate capture oligonucleotide complementary to the first domain of a plurality of substrate capture probes on a substrate, wherein each of the plurality of substrate capture probes comprises a substrate anchor sequence, a spatial barcode and a first domain in a 5' to 3' orientation; (e) hybridizing the substrate capture oligonucleotide of the first strand cDNA molecule to the first domain of the substrate capture probe; and (f) extending the first domain of the hybridized substrate capture probe to form a plurality of spatially barcoded first strand cDNA molecules.

[0028] In various embodiments, the substrate capture probe is released from the substrate prior to hybridizing the substrate capture oligonucleotide to the first domain of the substrate capture probe.

[0029] In various embodiments, the first domain is a poly T sequence.

[0030] In another aspect, the present disclosure provides a method for preparing a spatially barcoded RNA library from a tissue sample, the method comprising (a) contacting the tissue sample with a plurality of RNA capture probes that hybridize with RNA in the tissue sample, wherein the RNA capture probes comprise an RNA capture oligonucleotide that is complementary to the RNA in the sample and a handle sequence; (b) hybridizing the RNA capture oligonucleotide of the RNA capture probe with the RNA in the tissue sample to form an RNA-RNA capture probe hybrid; (c) extending the RNA capture oligonucleotide of the RNA-RNA capture probe hybrid using a reverse transcriptase to form a plurality of first-chain cDNA molecules, wherein each of the first-chain cDNA molecules comprises an RNA capture oligonucleotide and a handle sequence; and (d) adding a 3' end oligonucleotide to the 3' end of each first-chain cDNA molecule via template switching, comprising contacting the first-chain cDNA molecule with a reverse transcriptase (RT) and a template switching oligonucleotide (TSO), wherein the RT incorporates an untemplated cytosine at the 3' end of the first cDNA. nucleotides, and the TSO comprises a sequence capable of hybridizing to an untemplated cytosine nucleotide, wherein a 3' end oligonucleotide is attached to the 3' end of the first cDNA, and RT is extended to produce a TSO complement; wherein the 3' end oligonucleotide comprises a substrate capture oligonucleotide complementary to a first domain of a plurality of substrate capture probes on a substrate, wherein each of the plurality of substrate capture probes comprises a substrate anchor sequence, a second handle, a spatial barcode, and a first domain in a 5' to 3' orientation; (e) releasing the substrate capture probe from the substrate; (f) hybridizing the substrate capture oligonucleotide of the first chain cDNA molecule with the first domain of the substrate capture probe; and (g) contacting the first chain with a second chain synthesis mixture comprising a TSO primer, and extending the TSO primer using the first chain as a template to produce a second chain complementary to the first chain, the second chain comprising the TSO, a second cDNA complementary to the first cDNA, and a second chain barcode information comprising a spatial barcode sequence complement (SBC') complementary to the spatial barcode sequence (SBC).

[0031] In various embodiments, the first domain is a poly-G sequence that hybridizes to a poly-C sequence on TSO. In various embodiments, the handle is a P5 sequence and the second handle is a P7 sequence.

[0032] In another aspect, the present disclosure provides a method for preparing a spatially barcoded RNA library from a tissue sample, the method comprising: (a) contacting the tissue sample with a plurality of RNA capture probes that bind to RNA in the tissue sample, wherein each RNA capture probe comprises an RNA capture oligonucleotide complementary to the RNA in the sample and a substrate capture oligonucleotide complementary to a first domain of a plurality of substrate capture probes on a substrate, wherein the RNA capture oligonucleotide complementary to the RNA is blocked at the 3' end; wherein each of the substrate capture probes comprises the first domain and a first substrate anchor sequence in a 5' to 3' orientation and is adjacent to one or more barcoded substrate probes on the substrate, and wherein each of the barcoded substrate probes The barcoded substrate probe comprises a second substrate anchor sequence, a spatial barcode and a random priming sequence in a 5' to 3' orientation; (b) hybridizing the RNA capture oligonucleotide of the RNA capture probe with RNA in a tissue sample to form an RNA-RNA capture probe hybrid having a 5' single-stranded RNA region; (c) hybridizing the substrate capture oligonucleotide of the RNA-RNA capture probe hybrid with the first domain of the substrate capture probe; (d) hybridizing the 5' single-stranded RNA region of the RNA-RNA capture probe hybrid with the random priming sequence of the barcoded substrate probe; and (e) extending the random priming sequence hybridized to the 5' single-stranded RNA region using a reverse transcriptase to form a plurality of spatially barcoded first-strand cDNA molecules.

[0033] In various embodiments, the nucleotide sequence complementary to the RNA in the sample is a poly-T oligonucleotide, a random oligonucleotide (randomer), a semi-random oligonucleotide or a target-specific sequence. In various embodiments, the nucleotide sequence complementary to the RNA in the sample is a poly-T oligonucleotide.

[0034] In various embodiments, the method further comprises the step of removing RNA from the sample. In various embodiments, RNA is removed from the sample after extension to form the first strand cDNA. In various embodiments, RNA is removed by enzymatic or thermal methods.

[0035] Also provided is a method for preparing a spatially barcoded RNA library from a tissue sample, the method comprising (a) contacting the tissue sample with a plurality of RNA capture probes hybridized to RNA in the tissue sample, wherein each of the RNA capture probes comprises an RNA capture oligonucleotide complementary to RNA in the sample and a substrate capture oligonucleotide complementary to a first domain of a plurality of substrate capture probes on a substrate, wherein each of the substrate capture probes comprises a substrate anchor sequence, a first domain, a linker, a spatial barcode, and a random priming sequence in a 5' to 3' orientation; (b) hybridizing the RNA capture probes to RNA in the tissue sample to form an RNA-RNA capture probe hybrid having a 5' single-stranded RNA region; (c) hybridizing the substrate capture oligonucleotide of the RNA-RNA capture probe hybrid to the first domain of the substrate capture probe; (d) hybridizing the 5' single-stranded RNA region of the RNA-RNA capture probe hybrid to the random priming sequence of the substrate capture probe; and (e) extending the random priming sequence hybridized to the 5' single-stranded RNA region using a reverse transcriptase to form a plurality of spatially barcoded first-strand cDNA molecules.

[0036] In various embodiments, the linker is one that is not read through by a polymerase.

[0037] In another aspect, the present disclosure contemplates a method for preparing a spatially barcoded RNA library from a tissue sample, the method comprising (a) contacting the tissue sample with a plurality of RNA capture probes that bind to RNA in the tissue sample, wherein each of the RNA capture probes comprises an RNA capture oligonucleotide complementary to the RNA in the sample and a substrate capture oligonucleotide complementary to a first domain of a plurality of substrate capture probes on a substrate; wherein each of the substrate capture probes comprises the first domain and a first substrate anchor sequence in a 5' to 3' orientation and is adjacent to at least one barcoded substrate probe of the plurality of barcoded substrate probes on the substrate, and wherein each of the barcoded substrate probes comprises in a 5' to 3' orientation a first domain and a first substrate anchor sequence; containing a spatial barcode and a second substrate anchor sequence; (b) hybridizing the RNA capture oligonucleotide of the RNA capture probe with the RNA in the tissue sample to form an RNA-RNA capture probe hybrid; (c) capturing the RNA-RNA capture probe hybrid on the substrate by hybridizing the substrate capture oligonucleotide of the RNA-RNA capture probe hybrid with the first domain of the substrate capture probe; (d) extending the RNA capture oligonucleotide of the captured RNA-RNA capture probe hybrid using a reverse transcriptase to form multiple first-chain cDNA molecules; and (e) connecting each first-chain cDNA molecule in the first-chain cDNA molecules to the proximal barcoded substrate probe to form a spatially barcoded first-chain cDNA molecule.

[0038] Also contemplated are methods for preparing a spatially barcoded RNA library from a tissue sample, the method comprising: (a) contacting the tissue sample with a plurality of RNA capture probes that bind to RNA in the tissue sample, wherein each of the RNA capture probes comprises an RNA capture oligonucleotide complementary to the RNA in the sample and a substrate capture oligonucleotide complementary to a first domain of a plurality of substrate capture probes on a substrate, wherein the RNA capture oligonucleotide complementary to the RNA is blocked at the 3' end; wherein each of the substrate capture probes comprises the first domain and a first substrate anchor sequence in a 5' to 3' orientation and is adjacent to at least one barcoded substrate probe of the plurality of barcoded substrate probes on the substrate; , and wherein each barcoded substrate probe comprises a poly-T sequence, a spatial barcode, and a second substrate anchor sequence in a 5' to 3' orientation; (b) hybridizing the RNA capture oligonucleotide of the RNA capture probe with RNA in a tissue sample to form an RNA-RNA capture probe hybrid; (c) capturing the RNA-RNA capture probe hybrid on a substrate by hybridizing the substrate capture oligonucleotide of the RNA-RNA capture probe hybrid with the first domain of the substrate capture probe; (d) polyadenylation of RNA in the sample at the 3' end; and (e) extending the RNA capture oligonucleotide of the captured RNA-RNA capture probe hybrid using a reverse transcriptase to form a plurality of first-strand cDNA molecules.

[0039] In various embodiments, polyadenylation is performed using a poly A polymerase.

[0040] Also provided is a method for preparing a spatially barcoded RNA library from a tissue sample, the method comprising: (a) contacting the tissue sample with a plurality of RNA capture probes that hybridize with RNA in the tissue sample, wherein each of the RNA capture probes has a hairpin structure and comprises a DNA capture oligonucleotide complementary to the RNA in the sample and a substrate capture oligonucleotide complementary to the first domain of a plurality of substrate capture probes on a substrate, wherein the DNA capture oligonucleotide of the RNA capture probe comprises a single-stranded region, and wherein each of the substrate capture probes comprises a substrate anchor sequence, a spatial barcode, a first domain, and a second domain in a 5' to 3' orientation, wherein the second domain comprises at least one RNA nucleotide or nucleoside; (b) hybridizing the RNA capture probes with RNA in the tissue sample to form RNA-RNA capture probes. (c) capturing the base capture oligonucleotide of the RNA-RNA capture probe hybrid on a substrate by hybridizing the base capture oligonucleotide of the RNA-RNA capture probe hybrid with the first domain of the base capture probe; (d) phosphorylating the 5' single-stranded RNA terminal region of the captured RNA-RNA capture probe hybrid and contacting the captured RNA-RNA capture probe hybrid with a 5' to 3' exoribonuclease to digest the phosphorylated 5' single-stranded RNA terminal region; and (e) connecting the digested 5' RNA terminal region of the captured RNA-RNA capture probe hybrid to the second domain of the base capture probe to form multiple DNA-RNA chimeras on the substrate.

[0041] In various embodiments, ligation is performed using T4 ligase.

[0042] In various embodiments, the RNA of the captured RNA-RNA capture probe hybrid is 5' phosphorylated prior to ligation.

[0043] In various embodiments, the method further comprises generating a first strand cDNA from the plurality of DNA-RNA chimeras on the substrate. In various embodiments, the first strand cDNA can be hybridized from the surface and processed for sequencing.

[0044] In various embodiments, reverse transcription is performed using DNA random primers optionally comprising a P5 adaptor.

[0045] In various embodiments, the cDNA extension template can be dehybridized from the RNA in the tissue by chemical, enzymatic or thermal dehybridization. In various embodiments, the cDNA extension template can be dehybridized from the RNA on the substrate by chemical, enzymatic or thermal dehybridization. In various embodiments, the dehybridization step occurs before or after the capture step.

[0046] In various embodiments, the RNA capture probe is selected from the group consisting of a poly-T sequence, a poly-U sequence, a random oligonucleotide, a semi-random sequence, or a target-specific probe. In various embodiments, the RNA capture probe is a poly-T sequence.

[0047] In various embodiments, the RNA capture probe comprises at least 10 deoxythymidine residues. In various embodiments, the RNA capture probe comprises a plurality of different target-specific RNA capture probe sequences. In various embodiments, the RNA capture probe comprises at least 10 nucleotides complementary to the nucleotide sequence of the target RNA. In various embodiments, the RNA capture probe or surface capture probe is 8 to 80 nucleotides. In various embodiments, the RNA capture probe is between 8 to 80 nucleotides or between 10 to 50 nucleotides.

[0048] In various embodiments, the tissue sample is permeabilized prior to contacting the tissue sample with the plurality of capture oligonucleotides. In various embodiments, the tissue sample is treated with one or more blocking agents prior to contacting the tissue sample with the plurality of RNA capture probes. In various embodiments, the tissue sample is permeabilized and treated with one or more blocking agents prior to contacting the tissue sample with the plurality of RNA capture probes.

[0049] In various embodiments, the substrate is a bead, a bead array, a spotted array, a substrate comprising a plurality of wells, a flow cell, aggregated particles arranged on a chip surface, a membrane or a plate. In various embodiments, the substrate comprises a plurality of nanopores or micropores.

[0050] In various embodiments, the tissue sample is a fresh tissue sample, a frozen tissue sample, or a formalin-fixed paraffin-embedded (FFPE) tissue sample. In various embodiments, when the sample is a FFPE sample, the method may further include de-crosslinking the FFPE sample, optionally wherein the de-crosslinking is performed using a TE buffer at pH 9.

[0051] In various embodiments, the method also includes determining the spatial position of one or more of the spatially barcoded first-strand cDNA molecules or their copies by associating the spatial barcode sequence of the spatially barcoded first-strand cDNA molecules or their copies with the spatial position of surface oligonucleotide molecules on the substrate containing the corresponding spatial barcode sequence.

[0052] In various embodiments, the method further comprises recovering the spatially barcoded first strand cDNA molecules and amplifying them to generate a cDNA library.

[0053] In various embodiments, the spatially barcoded first-strand cDNA molecules are recovered by contacting the spatially barcoded first-strand cDNA on a substrate with a DNA polymerase and one or more primers to produce a spatially barcoded second-strand cDNA that is complementary to the spatially barcoded first-strand cDNA and removing the spatially barcoded second-strand cDNA from the substrate.

[0054] In various embodiments, the one or more primers each comprise a random priming sequence. In various embodiments, the random priming sequence comprises nine random nucleotides.

[0055] In various embodiments, the spatially barcoded second strand cDNAs each comprise a unique molecular identifier (UMI), wherein the UMI comprises an intrinsic sequence and an extrinsic sequence, wherein the extrinsic sequence is a sequence complementary to a random priming sequence used to generate the second strand cDNA, and wherein the intrinsic sequence is a sequence complementary to a first strand cDNA template sequence used to generate the second strand cDNA.

[0056] In various embodiments, the one or more primers each comprise a molecular identifier barcode. In various embodiments, the one or more primers each comprise a UMI barcode.

[0057] In various embodiments, the spatially barcoded second strand cDNA is removed from the substrate by chemical or physical dehybridization.

[0058] In various embodiments, the anchor sequence comprises a cleavage site, and the hybrid of the spatially barcoded first strand cDNA and the spatially barcoded second strand cDNA is removed from the substrate by enzymatic cleavage at the cleavage site. In various embodiments, the cleavage site is a binding site for a restriction endonuclease. In various embodiments, the anchor sequence comprises a cleavage site, and wherein the spatially barcoded first strand cDNA molecule is recovered by enzymatic cleavage at the cleavage site. In various embodiments, the cleavage site is a binding site for a restriction endonuclease.

[0059] In various embodiments, the method further comprises sequencing at least a portion of the cDNA library to determine the spatial barcode sequence of each molecule.

[0060] In various embodiments, the method further comprises determining the spatial position of the one or more cDNA molecules by correlating the spatial barcode sequences of the one or more cDNA molecules with the spatial positions of surface oligonucleotide molecules on the substrate containing the corresponding spatial barcode sequences.

[0061] In various embodiments, the method further includes indexing and sequencing the spatially barcoded first-strand cDNA, the method comprising performing an extension reaction and PCR on the spatially barcoded first-strand cDNA to produce a PCR template, the PCR template comprising a first-strand PCR product representing one or more RNA transcripts in the tissue sample; and eluting the PCR template; performing index PCR to produce a double-stranded PCR product comprising the first-strand PCR product and a second strand complementary to the first-strand PCR product.

[0062] In various embodiments, the method further comprises sequencing the PCR products and determining the location of the RNA transcripts in the tissue based on the spatial barcode of the first strand cDNA.

[0063] In various embodiments, the double-stranded PCR product comprises a second clustering sequence on a second strand that is complementary to the first-strand PCR product, and optionally comprises an index sequence.

[0064] In various embodiments, the PCR product is further processed by labeling to produce a spatial transcriptomics library. In various embodiments, labeling includes labeling on a substrate. In some embodiments, labeling includes labeling on a bead, wherein the bead includes a transposome (BLT) connected to a plurality of beads. In some embodiments, BLT includes i) a plurality of oligonucleotides comprising a first clustering sequence (P7), a first index sequence, and a Read 1 sequencing primer (Rd1 SP) and ii) a plurality of oligonucleotides comprising a second clustering sequence (P5), a second index sequence, and a Read 2 sequencing primer (Rd2 SP).

[0065] In various embodiments, the RNA library is an mRNA library.

[0066] In various embodiments, the method determines RNA expression in a single cell using a tissue sample. In various embodiments, the method determines RNA expression in one or more subcellular components in a single cell. In various embodiments, the subcellular component is a nucleus, cytoplasm, or mitochondria.

[0067] In various embodiments, the substrate or the surface of the substrate comprises a material selected from glass, silicon, poly-L-lysine coated material, nitrocellulose, polystyrene, cyclic olefin copolymer (COC), cyclic olefin polymer (COP), polyacrylamide, polypropylene, polyethylene or polycarbonate.

[0068] Also provided is a method for identifying genetic variations in a subject having a disease or at risk of having a disease, the method comprising generating a sample RNA library (e.g., an mRNA library) from a tissue sample from a subject according to the methods described herein, comparing the genetic information from the sample RNA library (e.g., an mRNA library) with a control RNA library (e.g., an mRNA library) or with a subject sample before the disease, and identifying genetic variations associated with the disease in the sample RNA library (e.g., an mRNA library). Optionally, the method comprises treating the subject with a therapy specific to the disease.

[0069] In various embodiments, the disease is a genetic defect, cancer, an autoimmune disease, a metabolic disorder, or other diseases described herein. Additional diseases or conditions are described in more detail in the detailed description.

[0070] It should be understood that each feature or embodiment or combination described herein is a non-limiting, illustrative example of any aspect of the present invention, and is therefore meant to be combined with any other feature or embodiment or combination described herein. For example, where features are described using language such as "one embodiment," "various embodiments," "some embodiments," "certain embodiments," "additional embodiments," "particular exemplary embodiments," and / or "another embodiment," each of these types of embodiments is a non-limiting example of a feature that is intended to be combined with any other feature or combination of features described herein, without necessarily listing every possible combination.

[0071] These features or combinations of features are applicable to any aspect of the present invention. When examples of values ​​falling within a range are disclosed, any of these examples are considered possible endpoints of the range, any and all numerical values ​​between such endpoints are considered, and any and all combinations of upper and lower limits are considered possible. BRIEF DESCRIPTION OF THE DRAWINGS

[0072] Figure 1 is a schematic diagram of a method for in situ capture of mRNA transcripts from tissue samples using capture probes.

[0073] Figure 2 is a schematic diagram of a method for in situ capture of mRNA transcripts from a tissue sample using capture probes, wherein the capture probes hybridizing to the transcripts result in nucleotide gaps between the hybridized sequences.

[0074] Figure 3 . Schematic diagram of an exemplary RNA library preparation workflow as described herein.

[0075] 4A to 4D . Schematic diagram of an alternative RNA library preparation workflow as described herein. Figure 4AThe general workflow is shown, and methods for adding 3' oligonucleotides are by oNTP-directed bridging or click chemistry ( Figure 4B )、Template conversion( Figure 4C ) or wherein the template switching primer is released from the substrate and is switched by the spatially barcoded template ( Figure 4D ) to add.

[0076] FIG. 5A to FIG. 5B . Schematic diagram of an alternative RNA library preparation workflow as described herein using 3' blocked oligonucleotides on target probes.

[0077] FIG. 6A to FIG. 6B . Schematic diagram of an alternative RNA library preparation workflow as described herein.

[0078] Figure 7 . Schematic diagram of an alternative RNA library preparation workflow as described herein using hairpin probes.

[0079] Figure 8 Shown based on Figure 3 The workflow of the scheme in .

[0080] Fig. 9 Shown based on Figure 4A and Figure 4B The workflow of the scheme in .

[0081] Fig.10 Shown based on Figure 4C The workflow of the scheme in .

[0082] Fig.11 Shown based on Figure 4D The workflow of the scheme in .

[0083] Fig.12 Shown based on Figure 5A The workflow of the scheme in .

[0084] Fig.13 Shown based on Figure 5B The workflow of the scheme in .

[0085] Fig.14 Shown based on Fig. 6A The workflow of the scheme in .

[0086] Fig.15 Shown based on Figure 6B The workflow of the scheme in .

[0087] Fig.16 Shown based on Figure 7 The workflow of the scheme in . DETAILED DESCRIPTION

[0088] To overcome the technical limitations of isolating mRNA transcripts from fresh-frozen or FFPE tissue samples, here we describe an in situ method for mRNA capture and generation of spatially barcoded libraries from such damaged tissues.

[0089] Various methods and compositions are described herein, which allow the genetic map in the characterization tissue to be retained while retaining the spatial information related to the source of the target gene or polynucleotide in the tissue. In various embodiments, the method includes a substrate, on which a plurality of capture probes are fixed so that each capture probe occupies different positions on the array. In other sequences and / or molecules, each capture probe includes a unique positioning nucleic acid tag (that is, a spatial address or index sequence). Each spatial address corresponds to the position of the capture probe on the array. The position of the capture probe on the array can be associated with the position in the tissue sample.

[0090] Examples of genes or polynucleotides in tissue samples include genomic DNA, methylated DNA, specific methylated DNA sequences, messenger RNA (mRNA), poly A mRNA, fragmented mRNA, fragmented DNA, mitochondrial DNA, ribosomal RNA (rRNA), viral RNA, microRNA, in situ synthesized PCR products, and RNA / DNA hybrids. Non-coding RNA (ncRNA), small nucleolar RNA (snoRNA), and / or small nuclear RNA (snRNA) are also contemplated.

[0091] The nucleic acid tag encoding position (i.e., spatial address or index sequence) can be coupled to a nucleic acid capture region or any other molecule that binds to a target gene or polynucleotide. Examples of other molecules that can be coupled to nucleic acid tags include antibodies, antigen binding domains, proteins, peptides, receptors, haptens, etc.

[0092] Various methods and compositions are described herein, which allow characterization of transcriptome and / or genomic variation in tissues while retaining spatial information associated with the source of target nucleic acids in tissues. For example, the methods disclosed herein can identify the location of cells or cell clusters in tissue biopsies carrying abnormal mutations. Therefore, the methods provided herein can be used for diagnostic purposes, such as for the diagnosis of cancer, and may contribute to the selection of targeted therapies.

[0093] The present disclosure is based in part on the recognition that in the process of preparing nucleic acids for sequencing, information related to the spatial origin of nucleic acids in tissue samples can be encoded in nucleic acids. For example, nucleic acids from tissue samples can be labeled by probes including position-specific sequence information ("spatial addresses"). Spatially addressed nucleic acid molecules from tissue samples can then be sequenced in large quantities. Nucleic acid molecules with the same sequence originating from different regions in a tissue sample can be distinguished based on their spatial addresses and can be mapped to their source regions in the tissue sample. In addition, spatial addressing of nucleic acids can increase the detection sensitivity of single nucleotide variations (SNVs) or single nucleotide polymorphisms (SNPs) in tissue samples.

[0094] In some methods described herein, probes for spatial tagging include, for example, a combination of a spatial address region and a gene-specific capture region. Spatially addressable and gene-specific probes can be contacted with a tissue sample as immobilized probes on a capture array.

[0095] The present disclosure recognizes that spatial addressing of nucleic acids from tissue samples can involve two-dimensional spatial addressing, for example, to associate the position of nucleic acids on a two-dimensional capture array with the position of nucleic acids in a two-dimensional tissue section. Spatial addressing can also be performed in additional dimensions. For example, a spatial address sequence can be added to a nucleic acid to describe the relative spatial position of a nucleic acid in a third or fourth dimension, for example, by describing the position of a tissue section in a tissue biopsy, or the position of a tissue biopsy in an organ of a subject. A temporal address sequence can be added to a nucleic acid from a tissue sample to represent a time point in a time course experiment, for example, to interrogate changes in gene expression in a cell in response to a physical or chemical stimulus (such as a drug treatment during a clinical trial).

[0096] definition

[0097] Unless otherwise stated, the following terms used in this Application, including the specification and claims, have the definitions given below.

[0098] As used in this specification and the appended claims, the singular forms "a", "an", and "the" include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to "a capture probe" includes a mixture of two or more capture probes, etc.

[0099] The term "about" when particularly referring to a given amount is meant to include a deviation of ±5%.

[0100] As used herein, the terms "comprises," "comprising," and any variations thereof are intended to cover a non-exclusive inclusion such that a process, method, product defined by a method, or composition of matter that comprises, contains, or contains an element or list of elements includes not only those elements, but may include other elements not expressly listed or inherent to such process, method, product defined by a method, or composition of matter.

[0101] As used herein, "anchor" refers to a moiety that attaches a nanoscaffold to a substrate. Anchors include chemical moieties, peptides, or oligonucleotides. Polynucleotide anchors can be 4 to 20 nucleotides.

[0102] As used herein, "splint oligonucleotide" refers to an oligonucleotide comprising a sequence complementary to a region on a surface probe on a nanostructure and another sequence complementary to a surface oligonucleotide (e.g., attached to a substrate). In various embodiments, the splint oligonucleotide is between 10 and 25 nucleotides or between 15 and 25 nucleotides. In various embodiments, the splint oligonucleotide is 20 nucleotides. In different embodiments, the splint oligonucleotide is 15, 16, 17, 18, 9, 20, 21, 22, 23, 24, or 25 nucleotides.

[0103] As used herein, "surface oligonucleotide" refers to an oligonucleotide comprising an anchor sequence, a spatial barcode sequence, and a sequence hybridized with a splint oligonucleotide for attaching the oligonucleotide to a substrate surface. In various embodiments, the surface oligonucleotide is between 15 and 25 nucleotides. In various embodiments, the surface nucleotide is greater than 20 nucleotides. In various embodiments, the surface oligonucleotide is 15, 16, 17, 18, 9, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides or more.

[0104] As used herein, the term "address," "tag," or "index," when used to refer to a nucleotide sequence, is intended to mean a unique nucleotide sequence that is distinguishable from other indexes and from other nucleotide sequences within a polynucleotide contained within a sample. A nucleotide "address," "tag," or "index" may be a random or specifically designed nucleotide sequence. An "address," "tag," or "index" may have any desired sequence length, as long as it has a length sufficient to make it a unique nucleotide sequence within multiple indexes in a population and / or within a plurality of polynucleotides being analyzed or probed. The nucleotide "address," "tag," or "index" of the present disclosure may be used, for example, to attach to a target polynucleotide to tag or mark a particular species to identify all members of the tagged species within a population. Thus, an index may be used as a barcode, wherein different members of the same molecular species may contain the same index, and wherein different species within a population of different polynucleotides may have different indexes.

[0105] As used herein, the terms "address," "tag," "index," or "barcode," when used to refer to a nucleotide sequence, are intended to refer to a unique nucleotide sequence that is distinguishable from other indices and from other nucleotide sequences within a polynucleotide contained within a sample. A nucleotide "address," "tag," "index," or "barcode" may be a random or specifically designed nucleotide sequence. An "address," "tag," "index," or "barcode" may have any desired sequence length, as long as it has a length sufficient to make it a unique nucleotide sequence within multiple indices in a population and / or within a plurality of polynucleotides being analyzed or probed. The nucleotide "address," "tag," "index," or "barcode" of the present disclosure may be used, for example, to attach to a target polynucleotide to tag or mark a particular species to identify all members of the tagged species within a population. Thus, an index may be used as a barcode, wherein different members of the same molecular species may contain the same index, and wherein different species within a population of different polynucleotides may have different indexes.

[0106] The label / index / barcode sequence may be unique to a single nucleic acid species in a population, or may be shared by several different nucleic acid species in a population. For example, each nucleic acid probe in a population may include a label / index / barcode sequence that is different from all other nucleic acid probes in the population. Alternatively, each nucleic acid probe in a population may include a label / index / barcode sequence that is different from some or most other nucleic acid probes in the population. For example, each probe in a population may have a label / index / barcode that exists for several different probes in the population, even if the probes with a common label / index / barcode differ from each other at other sequence regions along their length. In a specific embodiment, one or more label / index / barcode sequences for a biological sample are not present in the genome, transcriptome, or other nucleic acid of the biological sample. For example, the label / index / barcode sequence may have a sequence identity of less than 80%, 70%, 60%, 50%, or 40% with a nucleic acid sequence in a specific biological sample.

[0107] As used herein, "spatial address," "spatial tag," "spatial barcode," "barcode sequence," or "spatial index," when used in reference to a nucleotide sequence, means an address, tag, barcode, or index that encodes spatial information associated with the region or location of origin of an addressed, tagged, barcoded, or indexed nucleic acid in a tissue sample. The sequence may be a naturally occurring sequence or a sequence that does not naturally occur in the organism from which the barcoded nucleic acid was obtained.

[0108] As used herein, the term "substrate" is intended to represent a solid carrier or support structure. The term includes any material that can be used as a solid or semi-solid basis for forming features, such as a hole for depositing a biopolymer (including nucleic acids, polypeptides and / or other polymers). Non-limiting examples of substrates include bead arrays, spot arrays, aggregated particles arranged on the surface of a chip, membranes, porous plates and flow cells. For example, substrates as provided herein are modified, or can be modified to adapt to the attachment of biopolymers by a variety of methods well known to those skilled in the art. Exemplary types of substrate materials include glass, modified glass, functionalized glass, inorganic glass, microspheres (including inert and / or magnetic particles), plastics, polysaccharides, nylon, nitrocellulose, ceramics, resins, silica, silica-based materials, carbon, metals, optical fibers or fiber bundles, various polymers other than those illustrated above, and porous microtiter plates. Exemplary plastics of specific types include acrylic resins, polystyrene, copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethane and TEFLON TM Specific types of exemplary silica-based materials include silicon and various forms of modified silicon.

[0109] Those skilled in the art will know or understand that the composition and geometry of substrates as provided herein may vary according to the intended use and the preferred requirements of the user. Thus, although planar substrates such as slides, chips, wafers or beads may be used for microarrays, given the teachings and guidance provided herein, those skilled in the art will understand that various other substrates illustrated herein or well known in the art may also be used in the methods and / or compositions herein.

[0110] In some embodiments, the solid support comprises one or more surfaces capable of contacting a reagent, bead, or analyte. The surface may be substantially flat or planar. Alternatively, the surface may be rounded or contoured. Exemplary contours that may be included on the surface are holes (e.g., micropores or nanopores), depressions, columns, ridges, channels, and the like. Exemplary materials that may be used as surfaces include: glass, such as modified or functionalized glass; plastics, such as acrylic acid, polystyrene or a copolymer of styrene and another material, polypropylene, polyethylene, polybutylene, polyurethane, or TEFLON. TM ; polysaccharides or cross-linked polysaccharides, such as agarose or agarose gel; nylon; nitrocellulose; resin; silica or silica-based materials, including silicon and modified silicon, carbon fiber; metal; inorganic glass; fiber bundles, or a variety of other polymers. A single material or a mixture of several different materials can form a surface that can be used for certain examples. In some examples, the surface includes holes (e.g., micropores or nanopores). In some aspects, the surface includes glass, silicon, plastic or other suitable solid supports with patterned covalently attached gels such as poly (N-(5-azidoacetamidopentyl) acrylamide-co-acrylamide) (PAZAM, see, e.g., U.S. Patent Application Publication No. 2014 / 0079923A1, which is incorporated herein by reference). In some examples, the support structure may include one or more layers.

[0111] Non-limiting examples of surfaces include bead arrays, spotted arrays, aggregated particles arranged on a chip surface, membranes, multiwell plates, and flow cells.

[0112] In some embodiments, the solid carrier includes one or more surfaces of a flow cell. As used herein, the term "flow cell" refers to a chamber including a solid surface, through which one or more fluid reagents can flow. The flow cell can be an ordered flow cell or a random flow cell. Examples of flow cells and related fluid systems and detection platforms that can be easily used in the methods of the present disclosure are described in, for example, Bentley et al., Nature 456:53-59 (2008); WO04 / 018497; US 7,057,026; WO 91 / 06678; WO 07 / 123744; US 7,329,492; US 7,211,414; US 7,315,019; US 7,405,281 and US 2008 / 0108082, each of which is incorporated herein by reference.

[0113] In some embodiments, the solid support includes a patterned surface. "Patterned surface" refers to the arrangement of different regions in or on the exposed layer of the solid support. For example, one or more regions in these regions can be features in which one or more amplification primers are present. Features can be separated by gap regions in which there is no amplification primer. In some embodiments, pattern can be an xy format of features in the form of rows and columns. In some embodiments, pattern can be a repeated arrangement of features and / or gap regions. In some embodiments, pattern can be a random arrangement of features and / or gap regions. Exemplary patterned surfaces that can be used in the methods and compositions set forth herein are described in U.S. Serial No. 13 / 661,524 and U.S. Patent Application Publication No. 2012 / 0316086 and International Patent Publication WO 2017 / 019456, wherein each of these patent documents is incorporated herein by reference.

[0114] As used herein, when used to refer to nucleic acid, the term "fixed" is intended to represent being directly or indirectly attached to a solid support via a covalent bond or a non-covalent bond.Fixed also refers to the state in which two objects are joined, fastened, adhered, attached, connected or combined to each other.For example, an analyte (such as a nucleic acid) can be fixed on a material (such as a bead, a gel or a surface) by a covalent bond or a non-covalent bond.In certain embodiments, covalent attachment can be used, but all that is required is that the nucleic acid remains fixed or attached to the support under conditions intended to use the support (for example, in applications requiring nucleic acid amplification and / or sequencing).The oligonucleotide to be used as a capture primer or an amplification primer can be fixed so that the 3'-end can be used for enzymatic extension, and at least a portion of the sequence can hybridize with a complementary sequence.

[0115] Immobilization may occur by hybridization to a surface-attached oligonucleotide, in which case the immobilized oligonucleotide or polynucleotide may be in a 3' to 5' orientation. Alternatively, immobilization may occur by means other than base pairing hybridization, such as covalent attachment as described above.

[0116] Exemplary covalent linkages include, for example, those produced using click chemistry techniques. Exemplary non-covalent linkages include, but are not limited to, nonspecific interactions (e.g., hydrogen bonding, ionic bonding, van der Waals interactions, etc.) or specific interactions (e.g., affinity interactions, receptor-ligand interactions, antibody epitope interactions, avidin-biotin interactions, streptavidin-biotin interactions, lectin carbohydrate interactions, etc.). Exemplary linkages are described in U.S. Patent Nos. 6,737,236, 7,259,258, 7,375,234, and 7,427,678; and U.S. Patent Publication No. 2011 / 0059865A1, each of which is incorporated herein by reference.

[0117] As used herein, the term "array" refers to a group of sites that can be distinguished from each other according to relative positions. Different molecules located at different sites of the array can be distinguished from each other according to the position of the site in the array. A single site of an array may contain one or more specific types of molecules. For example, a site may contain a single target nucleic acid molecule with a specific sequence, or a site may contain several nucleic acid molecules with the same sequence (and / or its complementary sequence). The sites of an array may be different features located on the same substrate. Exemplary features include, but are not limited to, holes in a substrate, beads (or other particles) in or on a substrate, projections of a substrate, ridges on a substrate, or channels in a substrate. The sites of an array may be separate substrates each with different molecules. Different molecules attached to a separate substrate may be identified according to the position of the substrate on a surface associated with the substrate, or according to the position of the substrate in a liquid or gel. Exemplary arrays in which separate substrates are located on the surface include, but are not limited to, those arrays with beads in holes.

[0118] As used herein, the term "single molecule identifier" or "SMI" refers to a random, non-random, or semi-random molecular tag that can be attached to a nucleic acid. In various embodiments, the SMI is a unique molecular identifier (UMI). When incorporated into a nucleic acid, the SMI can be used to correct for subsequent amplification bias by directly counting the single molecule identifier (SMI) sequenced after amplification. The SMI (e.g., UMI) can be attached to similar nucleic acids (e.g., adapters) so that each nucleic acid is unique. The SMI (e.g., UMI) can also be used to uniquely label a single molecule (e.g., a single mRNA molecule) in a sample (e.g., a single mRNA molecule in a tissue sample, a cell sample, or a sample library).

[0119] As used herein, "unique molecular index," "unique molecular identifier," or "UMI" when used in reference to a capture probe or other nucleic acid is intended to refer to a portion of a probe that can be used as a molecular barcode to uniquely tag each molecule in a sample library. A UMI can be represented in a nucleic acid string as "NNNN..." to designate that portion of an oligonucleotide as a UMI. A UMI can be 6 to 20 nucleotides in length or longer. In some aspects, a UMI comprises a spatial barcode.

[0120] As used herein, the term "universal sequence" refers to a series of nucleotides common to two or more nucleic acid molecules, even if these molecules also have sequence regions that are different from each other. Universal sequences present in different members of a molecular set can allow a population of universal capture nucleic acids complementary to the universal sequence to capture a variety of different nucleic acids. Similarly, universal sequences present in different members of a molecular set can allow a population of universal primers complementary to the universal sequence to replicate or amplify a variety of different nucleic acids. Therefore, universal capture nucleic acids or universal primers contain sequences that can specifically hybridize with universal sequences. Target nucleic acid molecules can be modified to attach universal adapters, for example, at one or both ends of different target sequences. Universal capture oligonucleotides are suitable for probing a variety of different oligonucleotides without having to distinguish different species, while target-specific capture sequences are suitable for distinguishing different species. A non-limiting example of a universal sequence is a polyT nucleotide sequence.

[0121] As used herein, a "semi-random" nucleotide sequence comprises or consists of a partially predetermined nucleotide sequence combined with a random nucleotide sequence.

[0122] As used herein, the term "adapter" generally refers to any linear nucleic acid molecule that can be added (e.g., by synthesis or connection) to the oligonucleotide of the present disclosure. In some embodiments, the adaptor is copied to the library molecule using templated polymerase synthesis (e.g., second strand cDNA synthesis as described herein). In some embodiments, the adaptor is connected to the first complementary strand of the present disclosure. In some embodiments, the oligonucleotide of the present disclosure comprises an adaptor ("adapter oligonucleotide"). In some embodiments, the adaptor oligonucleotide comprises 5' to 3', the third sequencing primer sequence (e.g., SBS3), a sequence complementary to a unique index sequence (e.g., i5') and a second clustering primer sequence (e.g., P5). In some embodiments, the adaptor comprises a sequence complementary to a primer. In other embodiments, the adaptor comprises a sequence complementary to a P5 primer or a P5' primer. In some embodiments, the adaptor comprises a sequence complementary to a P7 primer or a P7' primer. In some embodiments, the adaptor comprises a sequence complementary to a B15 primer or a B15' primer.

[0123] When referring to examples of oligonucleotide sequences of primers (e.g., cluster primers) and / or oligonucleotide sequences that are complementary to primers, the terms "P5," "P7," "B15," "P5'" (P5 prime), "P7'" (P7 prime), "B15'" (B15 prime), "P15," and "P17" may be used. The terms "P5'" (P5 prime), "P7'" (P7 prime), and "B15'" (B15 prime) refer to the complement of P5, P7, and B15, respectively. It should be understood that any suitable primer can be used in the methods presented herein, and the use of P5, P5', P7, P7', P15, P17, B15, and B15' is merely an exemplary embodiment. The use of primers (such as P5, P5', P7, P7', P15, P17, B15 and B15' or their complements) on a circulation cell is known in the art, as exemplified by the disclosures of WO2019 / 222264, WO 2007 / 010251, WO 2006 / 064199, WO 2005 / 065814, WO 2015 / 106941, WO1998 / 044151 and WO 2000 / 018957, each of which is incorporated herein by reference in its entirety. For example, any suitable forward amplification primer, whether immobilized or in solution, can be used in the methods presented herein for hybridization with complementary sequences and amplification of sequences. Similarly, any suitable reverse amplification primer, whether immobilized or in solution, can be used in the methods presented herein for hybridization with complementary sequences and amplification of sequences. Those skilled in the art will understand how to design and use primer sequences suitable for capturing and / or amplifying the nucleic acids presented herein. In some embodiments, the "first cluster primer" as described herein is a P5 primer. In some embodiments, the "first cluster primer" as described herein is a P7 primer. In some embodiments, the "first cluster primer" as described herein is a P5' primer. In some embodiments, the "first cluster primer" as described herein is a P7' primer. In some embodiments, the "second cluster primer" as described herein is a P5 primer. In some embodiments, the "second cluster primer" as described herein is a P7 primer. In some embodiments, the "second cluster primer" as described herein is a P5' primer. In some embodiments, the "second cluster primer" as described herein is a P7' primer. In some embodiments, P5 comprises a polynucleotide sequence 5'AAT GAT ACG GCG ACC ACC GA 3' (SEQ ID NO: 1) or a variant thereof or consists of it. In some embodiments, P5 comprises or consists of the polynucleotide sequence 5' AAT GAT ACG GCG ACCACC GAG ATC TAC AC 3' (SEQ ID NO: 2) or a variant thereof.In some embodiments, P7 comprises the polynucleotide sequence 5'CAA GCA GAA GAC GGC ATA CG 3' (SEQ ID NO.3) or a variant thereof or consists thereof. In some embodiments, P7 comprises the polynucleotide sequence 5'CAA GCA GAA GAC GGC ATA CGA GAT 3' (SEQ ID NO.4) or a variant thereof or consists thereof. In some embodiments, P5' comprises the polynucleotide sequence 5'TCG GTG GTC GCCGTA TCA TT 3' (SEQ ID NO:5) or a variant thereof or consists thereof. In some embodiments, P5' comprises the polynucleotide sequence 5'GTG TAG ATC TCG GTG GTC GCC GTA TCA TT 3' (SEQ ID NO:6) or a variant thereof or consists thereof. In some embodiments, P7' comprises the polynucleotide sequence 5'CGT ATG CCG TCT TCT GCT TG 3' (SEQ ID NO.7) or a variant thereof or consists thereof. In some embodiments, P7' comprises the polynucleotide sequence 5'ATC TCG TAT GCCGTC TTC TGC TTG 3' (SEQ ID NO.8) or a variant thereof or consists thereof. In some embodiments, B15 comprises the polynucleotide sequence 5'GTCTCGTGGGCTCGG 3' (SEQ ID NO:9) or a variant thereof or consists thereof. In some embodiments, B15' comprises the polynucleotide sequence 5'CCGAGCCCACGAGAC 3' (SEQ ID NO:10) or a variant thereof or consists thereof. In some embodiments, P15 comprises the polynucleotide sequence 5'TTTTTTAATG ATACGGCGAC CACCGAGANC TACAC3' (SEQ ID NO:11) or a variant thereof or consists thereof. In some embodiments, P17 comprises the polynucleotide sequence 5'TTTTTTNNNC AAGCAGAAGA CGGCATACGA GAT 3' (SEQ ID NO:12) or a variant thereof or consists thereof. When referring to any sequence described herein, the term "variant" as used herein refers to a variant nucleic acid that is substantially identical to, for example, a non-variant sequence (i.e., only has some nucleotide sequence variations). In some embodiments, the variant has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% overall nucleotide sequence identity with the non-variant nucleic acid sequence. It should be understood that P5 and P7 mentioned herein can refer to different primer sequences. The disclosure encompasses any suitable primer sequence combination.

[0124] As used herein, the term "plurality" is intended to represent a population of two or more different members. The plurality of numbers can range in size from small, medium, large to extremely large. The size of a small plurality of numbers can range from, for example, a few members to tens of members. A medium-sized plurality of numbers can range from, for example, tens of members to about 100 members or hundreds of members. A large plurality of numbers can range from, for example, about hundreds of members to about 1000 members, to thousands of members, and up to tens of thousands of members. An extremely large plurality of numbers can range from, for example, tens of thousands of members to about hundreds of thousands, one million, several million, tens of millions, and up to or exceeding hundreds of millions of members. Therefore, a plurality of sizes measured in terms of the number of members can range from two to well over 100 million members, as well as all sizes between and exceeding the above exemplary ranges. Exemplary features of numbers within a microarray include 1.28 cm 2 A plurality of about 500,000 or more discrete features within a nucleic acid. Exemplary nucleic acid plurality numbers include, for example, about 1×10 5 pcs, 5×10 5 and 1×10 6 The term "polynucleotide" refers to a population of one or more different nucleic acid species. Thus, the definition of the term is intended to include all integer values ​​greater than two. The upper limit of the plurality of numbers can be set, for example, by the theoretical diversity of the oligonucleotide sequences in the nucleic acid sample.

[0125] As used herein, the term "nucleic acid" is intended to be consistent with its use in the art, and includes naturally occurring nucleic acids or functional analogs thereof. Particularly useful functional analogs can hybridize with nucleic acids in a sequence-specific manner or can be used as a template for replicating a specific nucleotide sequence. Naturally occurring nucleic acids generally have a backbone comprising a phosphodiester bond. Similar structures may have alternative backbone bonds, including any of a variety of backbone bonds known in the art. Naturally occurring nucleic acids generally have deoxyribose (e.g., present in deoxyribonucleic acid (DNA)) or ribose (e.g., present in ribonucleic acid (RNA)). Nucleic acids may include any of a variety of analogs of these sugar moieties known in the art. Nucleic acids may include natural or non-natural bases. In this regard, natural deoxyribonucleic acids may have one or more bases selected from the group consisting of adenine, thymine, cytosine or guanine, and ribonucleic acids may have one or more bases selected from the group consisting of uracil, adenine, cytosine or guanine. Useful non-natural bases that may be included in nucleic acids are known in the art. Unless otherwise expressly stated, the term "target" when used in reference to a nucleic acid is intended as a semantic identifier of the nucleic acid in the context of the methods or compositions described herein and does not necessarily limit the structure or function of the nucleic acid. Specific forms of nucleic acids can include all types of nucleic acids found in organisms as well as synthetic nucleic acids, such as polynucleotides produced by chemical synthesis.

[0126] Specific examples of nucleic acids suitable for analysis by incorporation into microarrays produced by the methods provided herein include genomic DNA (gDNA), expressed sequence tags (ESTs), messenger RNA (cDNA) of DNA copies, messenger RNA (cRNA) of RNA copies, mitochondrial DNA or genomic RNA, messenger RNA (mRNA), ribosomal RNA (rRNA) and / or other RNA populations. Additional RNAs contemplated include microRNAs, transfer RNAs, non-coding RNAs (ncRNAs), small nucleolar RNAs (snoRNAs) and / or small nuclear RNAs (snRNAs), and fragments and / or portions of these exemplary nucleic acids are also included within the meaning of the terms as used herein.

[0127] As used herein, the term "double-stranded" when used to refer to a nucleic acid molecule means that substantially all of the nucleotides in the nucleic acid molecule are hydrogen-bonded to complementary nucleotides. A partially double-stranded nucleic acid may account for at least 10%, 25%, 50%, 60%, 70%, 80%, 90%, or 95% of the nucleotides that are hydrogen-bonded to complementary nucleotides.

[0128] As used herein, the term "single-stranded" when used in reference to a nucleic acid molecule means that substantially no nucleotides in the nucleic acid molecule are hydrogen bonded to complementary nucleotides.

[0129] As used herein, the term "capture primer" or "capture probe" is intended to mean an oligonucleotide having a nucleotide sequence that can specifically anneal to a single-stranded polynucleotide sequence to be analyzed or a single-stranded polynucleotide sequence subjected to nucleic acid probing under conditions encountered in, for example, a primer annealing step of an amplification or sequencing reaction. The terms "nucleic acid molecule," "polynucleotide," and "oligonucleotide" are used interchangeably herein. Unless specifically indicated otherwise, the different terms are not intended to represent any specific differences in size, sequence, or other properties. For clarity of description, when describing a specific method or composition comprising several nucleic acid species, the terms may be used to distinguish one nucleic acid species from another.

[0130] As used herein, when used to refer to capture probes or other nucleic acids, the terms "gene-specific" or "target-specific" are intended to refer to capture probes or other nucleic acids that contain a nucleotide sequence that is specific to a target nucleic acid (e.g., a nucleic acid from a tissue sample), i.e., a sequence of nucleotides that can selectively anneal to an identification region of the target nucleic acid. A gene-specific capture probe may have an oligonucleotide of a single species, or may contain two or more substances with different sequences. Therefore, a gene-specific capture probe may be two or more sequences, including 3, 4, 5, 6, 7, 8, 9 or 10 or more different sequences. A gene-specific capture probe may contain a gene-specific capture primer sequence and a universal capture probe sequence. Other sequences (such as sequencing primer sequences, etc.) may also be contained in a gene-specific capture primer.

[0131] As used herein, "unique molecular index," "unique molecular identifier," or "UMI" when used in reference to a capture probe or other nucleic acid is intended to refer to a portion of a probe that can be used as a molecular barcode to uniquely tag each molecule in a sample library. A UMI can be represented in a nucleic acid string as "NNNN..." to designate that portion of an oligonucleotide as a UMI. A UMI can be 6 to 20 nucleotides in length or longer. In some aspects, a UMI comprises a spatial barcode.

[0132] In contrast, when used to refer to capture probes or other nucleic acids, the term "universal" means a capture probe or nucleic acid that has a common nucleotide sequence in a plurality of capture probes. The common sequence can be, for example, a sequence complementary to the same adapter sequence. Universal capture probes are suitable for probing a variety of different polynucleotides without having to distinguish between different species, whereas gene-specific capture primers are suitable for distinguishing between different species.

[0133] In various embodiments, the capture elements (e.g., capture primers or capture probes or other nucleic acid sequences) can be spaced to A) spatially resolve nucleic acids within the geometry of a single cell, i.e., multiple capture sites per cell; B) spatially resolve nucleic acids at about the single cell level, i.e., about 1 capture site per cell. In addition, the capture elements can be spaced as in A or B above, and can be: I) spaced to sample nucleic acids from a sample at regular intervals, for example, spaced in a grid or pattern so that about every other or every 5 or every 10 cells are sampled, or about every other or every 5 or every 10 groups of 2, 3, 4, 5, 6, 7, 8, 9, 10 or more cells are sampled; II) spaced to capture samples from substantially all available cells in one or more regions of a sample, or III) spaced to capture samples from substantially all available cells in a sample.

[0134] As used herein, the term "amplicon" when used to refer to nucleic acid, means a product of replicating the nucleic acid, wherein the product has a nucleotide sequence identical or complementary to at least a portion of the nucleotide sequence of the nucleic acid. Amplicon can be produced by any of a variety of amplification methods using nucleic acid or its amplicon as a template, including, for example, polymerase extension, polymerase chain reaction (PCR), rolling circle amplification (RCA), connection extension or ligase chain reaction. Amplicon can be a nucleic acid molecule with a single copy (e.g., PCR product) of a specific nucleotide sequence or multiple copies (e.g., tandem products of RCA) of the nucleotide sequence. The first amplicon of a target nucleic acid can be a complementary copy. Subsequent amplicon is a copy formed by the target nucleic acid or by the first amplicon after generating the first amplicon. Subsequent amplicon can have a sequence that is substantially complementary to the target nucleic acid or substantially identical to the target nucleic acid.

[0135] The number of template copies or amplicons that can be generated can be adjusted by appropriately modifying the amplification reaction, including, for example, changing the number of amplification cycles run, using polymerases with different processivities in the amplification reaction, and / or changing the length of time the amplification reaction is run, as well as modifying other conditions known in the art that affect amplification yield. The number of copies of the nucleic acid template can be at least 1, 10, 100, 200, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, and 10,000 copies, and can vary depending on the specific application.

[0136] As used herein, when used in conjunction with polynucleotides, the term "complementary" is intended to mean a polynucleotide comprising a nucleotide sequence that can selectively anneal to an identification region of a target polynucleotide under certain conditions. As used herein, the term "substantially complementary" and grammatical equivalents are intended to mean a polynucleotide comprising a nucleotide sequence that includes an identification region that can specifically anneal to a target polynucleotide under certain conditions. Annealing refers to the nucleotide base pairing interaction of one nucleic acid with another nucleic acid, which results in the formation of a duplex, triplex or other higher ordered structures. The primary interaction is typically with nucleotide base specificity through Watson-Crick and Hoogsteen type hydrogen bonds, for example, A:T, A:U and G:C. In certain embodiments, base stacking and hydrophobic interactions may also contribute to duplex stability. Conditions for annealing polynucleotides to complementary or substantially complementary regions of target nucleic acids are well known in the art, for example, as described in Nucleic Acid Hybridization, A Practical Approach, edited by Hames and Higgins, IRL Press, Washington, DC (1985), and Wetmur and Davidson, Mol. Biol. 31:349 (1968). Annealing conditions will depend on the specific application and can be routinely determined by those skilled in the art without undue experimentation.

[0137] As used herein, the term "hybridization" refers to a process in which two single-stranded polynucleotides are non-covalently bound to form a stable double-stranded polynucleotide. The resulting double-stranded polynucleotide is a "hybrid" or "duplex". Hybridization conditions will typically include a salt concentration of less than about 1M, more typically less than about 500mM and may be less than about 200mM. Hybridization buffers include buffered saline solutions, such as 5% SSPE, or other such buffers known in the art. The hybridization temperature may be as low as 5°C, but is typically greater than 22°C, and more typically greater than about 30°C, and typically exceeds 37°C. Hybridization is typically performed under stringent conditions, i.e., conditions under which the probe will hybridize to its target subsequence but will not hybridize to other non-complementary sequences. Stringent conditions are sequence-dependent and are different in different situations, and can be routinely determined by those skilled in the art.

[0138] As used herein, the term "dNTP" refers to deoxynucleoside triphosphates. NTP refers to ribonucleotide triphosphates. Purine bases (Pu) include adenine (A), guanine (G) and their derivatives and analogs. Pyrimidine bases (Py) include cytosine (C), thymine (T), uracil (U) and their derivatives and analogs. By way of illustration and not limitation, examples of such derivatives or analogs are those modified with reporter groups, biotinylation, amine modification, radiolabeling, alkylation, etc., and also include thiophosphates, phosphites, ring atom-modified derivatives, etc. The reporter group can be a fluorescent group (such as fluorescein), a chemiluminescent group (such as luminol), a terbium chelator (such as N-(hydroxyethyl)ethylenediaminetriacetic acid that can be detected by delayed fluorescence), etc.

[0139] As used herein, the terms "connection", "connected" and their grammatical equivalents are intended to mean the formation of a covalent bond or connection between the ends of two or more nucleic acids (e.g., oligonucleotides and / or polynucleotides), typically in a template-driven reaction. The nature of the bond or connection can vary widely, and the connection can be performed enzymatically or chemically. As used herein, the connection is typically performed enzymatically to form a phosphodiester bond between the 5' carbon-terminal nucleotide of one oligonucleotide and the 3' carbon of another nucleotide. Template-driven connection reactions are described in the following references: U.S. Patent Nos. 4,883,750; 5,476,930; 5,593,826 and 5,871,921, which are incorporated herein by reference in their entirety. The term "connection" also encompasses the non-enzymatic formation of phosphodiester bonds, as well as the formation of non-phosphodiester covalent bonds (such as phosphorothioate bonds, disulfide bonds, etc.) between the ends of oligonucleotides.

[0140] As used herein, the term "each," when used in reference to a collection of items, is intended to identify a single item in the collection, but does not necessarily refer to every item in the collection unless the context clearly indicates otherwise.

[0141] As used herein, when used to refer to nucleic acids, the term "extension" is intended to mean the addition of at least one nucleotide or oligonucleotide to a nucleic acid. In a specific embodiment, one or more nucleotides can be added to the 3' end of a nucleic acid, for example, by polymerase catalysis (e.g., DNA polymerase, RNA polymerase, or reverse transcriptase). Chemical or enzymatic methods can be used to add one or more nucleotides to the 3' or 5' end of a nucleic acid. One or more oligonucleotides can be added to the 3' or 5' end of a nucleic acid, for example, by chemical or enzymatic (e.g., ligase catalysis) methods. Nucleic acids can be extended in a template-guided manner, whereby the extension product is complementary to the template nucleic acid, and the template nucleic acid hybridizes with the extended nucleic acid.

[0142] Provided herein are arrays and methods for spatial detection and analysis of nucleic acids in tissue samples (e.g., mutation analysis or single nucleotide variation (SNV) detection and insertion and deletion detection). The arrays described herein may include a substrate on which a plurality of capture probes are fixed so that each capture probe occupies a different position on the array. Some or all of the capture probes in the plurality of capture probes may contain a unique position label (i.e., a spatial address or index sequence). The spatial address may describe the position of the capture probe on the array. The position of the capture probe on the array may be associated with the position in the tissue sample.

[0143] As used herein, the term "poly-T" or "poly-A" when used in reference to a nucleic acid sequence is intended to mean a series of two or more thiamine (T) or adenine (A) bases, respectively. The poly-T or poly-A may include at least about 2, 5, 8, 10, 12, 15, 18, 20 or more T or A bases, respectively. Alternatively or in addition, the poly-T or poly-A may include up to about 30, 20, 18, 15, 12, 10, 8, 5 or 2 T or A bases, respectively.

[0144] As used herein, the terms "poly-T", "poly-A" or "poly-U" when used in reference to a nucleic acid sequence (e.g., a capture nucleotide sequence) are intended to refer to a series of two or more thiamine (T), adenine (A) or uridine (U) bases, respectively. Poly-T, poly-A or poly-U may include at least about 2, 5, 8, 10, 12, 15, 18, 20, 22, 25, 28, 30, 32, 35, 38, 40 or more T or A bases, respectively. Alternatively or in addition, poly-T or poly-A or poly-U may include up to about 40, 38, 35, 32, 30, 28, 25, 22, 20, 18, 15, 12, 10, 8, 5 or 2 T or A bases, respectively. In some embodiments, the present disclosure contemplates the use of a "TVN" sequence, wherein "T" is a capture nucleotide sequence, "V" is adenine (A), cytosine (C) or guanine (G), and "N" is adenine (A), cytosine (C), guanine (G) or thymine (T). In some embodiments, the TVN sequence is used to bias reverse transcription toward the bases of the poly A tail on the mRNA molecule.

[0145] As used herein, the term "tagmentation", "tagment" or "tagmenting" refers to the conversion of nucleic acids (e.g., DNA) into adaptor-modified templates in solution ready for cluster formation and sequencing by using transposase-mediated fragmentation and tagging. The method generally involves the modification of nucleic acids by a transposome complex comprising a transposase complexed with an adaptor comprising a transposon end sequence. Tagging results in simultaneous fragmentation of the nucleic acid and ligation of the adaptor to the 5' ends of both strands of the duplex fragments. Following a purification step to remove the transposase, additional sequences are added to the ends of the adapted fragments by PCR.

[0146] "Transposase" refers to an enzyme that can form a functional complex with a composition (e.g., a transposon, a transposon end, a transposon end composition) comprising a transposon end, and, for example, in an in vitro transposition reaction, catalyzes the insertion or transposition of a composition containing a transposon end into a double-stranded target nucleic acid incubated therewith. Transposases as shown herein may also include integrases from retrotransposons and retroviruses. Transposases, transpososomes, and transposome complexes are generally known to those skilled in the art, as shown in the disclosure of U.S. Patent Publication No. 2010 / 0120098, the contents of which are incorporated herein by reference in their entirety. Although many of the embodiments described herein relate to Tn5 transposases and / or highly active Tn5 transposases, it should be understood that any transposition system capable of inserting a transposon end into a 5'-tag and fragmenting a target nucleic acid for its intended purpose with sufficient efficiency can be used in the present invention. In a specific embodiment, a preferred transposition system is capable of inserting a transposon end into a 5'-tag and fragmenting a target nucleic acid in a random or nearly random manner.

[0147] As used herein, the term "transposition reaction" refers to a reaction in which one or more transposons are inserted into a target nucleic acid, for example, at random sites or nearly random sites. The essential components in a transposition reaction are a transposase and a DNA oligonucleotide that exhibits the nucleotide sequence of the transposon, including the transposon sequence transferred and its complementary sequence (non-transferred transposon end sequence) and other components required to form a functional transposition or transposome complex. The DNA oligonucleotide may also contain additional sequences (e.g., adapter or primer sequences) as needed or desired. In some embodiments, the methods provided herein are exemplified by the following: using a transposition complex formed by a hyperactive Tn5 transposase and a Tn5-type transposon end (Goryshin and Reznikoff, 1998, J. Biol. Chem., 273: 7367) or by a MuA transposase and a Mu transposon end comprising R1 and R2 terminal sequences (Mizuuchi, 1983, Cell, 35: 785; Savilahti et al., 1995, EMBO J., 14: 4893). However, any transposition system capable of inserting transposon ends into 5'-tags in a random or nearly random manner with sufficient efficiency and fragmenting target DNA for its intended purpose can be used in the present invention.Examples of transposition systems known in the art that can be used in the methods of the present invention include, but are not limited to, Staphylococcus aureus Tn552 (Colegio et al., 2001, J Bacterid., 183:2384-2388; Kirby et al., 2002, Mol Microbiol, 43:173-186), TyI (Devine and Boeke, 1994, Nucleic Acids Res., 22:3765-3772 and International Patent Application No. WO 95 / 23875), transposon Tn7 (Craig, 1996, Science. 271:1512; Craig, 1996, Review in: Curr Top Microbiol Immunol, 204:27-48), Tn10 and IS10 (Kleckner et al., 1996, Curr Top Microbiol Immunol, 205:27-48), Microbiol Immunol, 204: 49-82), Mariner transposase (Lampe et al., 1996, EMBO J., 15: 5470-5479), Tci (Plasterk, 1996, Curr Top Microbiol Immunol, 204: 125-43), P factor (Gloor, 2004, Methods Mol Biol, 260: 97-114), TnJ (Ichikawa and Ohtsubo, 1990, J Biol Chem. 265: 18829-18832), bacterial insertion sequence (Ohtsubo and Sekine, 1996, Curr. Top. Microbiol. Immunol. 204: 1-26), retrovirus (Brown et al., 1989, Proc Natl Acad Sci USA, 86: 2525-2529), and yeast retrotransposons (Boeke and Corces, 1989, Annu Rev Microbiol. 43: 403-34). The method for inserting the transposon end into the target sequence can be performed in vitro using any suitable transposon system, for which a suitable in vitro transposition system is available or can be developed based on knowledge in the art. Generally speaking, the in vitro transposition system suitable for the methods provided herein requires at least a transposase and a transposon end of sufficient purity, sufficient concentration and sufficient in vitro transposition activity, and the transposase forms a functional complex with the transposon end, and the functional complex has a corresponding transposase that can catalyze the transposition reaction. Suitable transposase transposon end sequences that can be used in the present invention include, but are not limited to, wild-type, derivative or mutant transposon end sequences that form a complex with a transposase selected from a wild-type, derivative or mutant transposase.As used herein, the term "transposome complex" refers to a transposase that is non-covalently bound to a double-stranded nucleic acid. For example, the complex can be a transposase pre-incubated with a double-stranded transposon DNA under conditions that support the formation of a non-covalent complex. The double-stranded transposon DNA can include, but is not limited to, Tn5 DNA, a portion of Tn5 DNA, a transposon end composition, a mixture of transposon end compositions, or other double-stranded DNAs that can interact with a transposase (such as a hyperactive Tn5 transposase).

[0148] As used herein, the term "random" can be used to refer to the spatial arrangement or composition of positions on a surface. For example, there are at least two types of order for the arrays described herein, the first involving the spacing and relative positions of features (also referred to as "sites"), and the second involving the identity or predetermined knowledge of molecules of a specific species present in a specific feature. Therefore, the features of the array can be randomly spaced so that the nearest adjacent features have a variable spacing between each other. Alternatively, the spacing between features can be ordered, for example, forming a regular pattern, such as a rectilinear grid or a hexagonal grid. In another aspect, the features of the array can be random in terms of the identity or predetermined knowledge of the gene of interest (e.g., a nucleic acid of a specific sequence) occupying each feature, regardless of whether the spacing produces a random pattern or an ordered pattern. The arrays described herein can be ordered in one aspect and random in another aspect. For example, in some embodiments described herein, a surface is contacted with a nucleic acid population under such conditions: wherein the nucleic acids are attached at sites that are "randomly positioned" with respect to their relative positions but with respect to the knowledge of the sequence of the nucleic acid species present in any specific site. By "randomly distributing" nucleic acids at locations on a surface it is intended that it is not known or predetermined as to which nucleic acid will be captured at which location (whether or not the locations are arranged in an ordered pattern).

[0149] As used herein, "biological sample" may include one or more biological or chemical substances, such as nucleic acids, oligonucleotides, proteins, cells, tissues, organisms and / or bioactive chemical compounds, such as analogs or analogs of the above-mentioned classes. As used herein, the term "tissue" is intended to represent an aggregate of cells and optional intercellular substances. Typically, cells in tissues are not free to float in a solution, but are attached to each other to form a multicellular structure. Exemplary tissue types include muscle, nerve, epidermis and connective tissue. In some cases, biological samples may include whole blood, lymph, serum, plasma, sweat, tears, saliva, sputum, cerebrospinal fluid, amniotic fluid, semen, vaginal secretions, serous fluid, synovial fluid, pericardial fluid, peritoneal fluid, pleural effusion, transudate, exudate, gallbladder fluid, bile, urine, gastric juice, intestinal fluid, stool samples, liquid containing single or multiple cells, liquid containing organelles, fluidized tissue, fluidized organisms, viruses (including viral pathogens), liquid containing multicellular organisms, biological swabs and biological washes. In other examples, the sample can be derived from an organ, including, for example, an organ of the musculoskeletal system, such as a muscle, bone, tendon, or ligament; an organ of the digestive system, such as a salivary gland, pharynx, esophagus, stomach, small intestine, large intestine, liver, gall bladder, or pancreas; an organ of the respiratory system, such as the larynx, trachea, bronchi, lungs, or diaphragm; an organ of the urinary system, such as the kidney, ureter, bladder, or urethra; a reproductive organ, such as an ovary, fallopian tube, uterus, vagina, placenta, testis, epididymis, vas deferens, seminal vesicle, prostate, penis, or scrotum; an organ of the endocrine system, such as the pituitary gland, pineal gland, thyroid gland, parathyroid gland, or adrenal gland; an organ of the circulatory system, such as the heart, arteries, veins, or capillaries; an organ of the lymphatic system, such as a lymphatic vessel, lymph node, bone marrow, thymus, or spleen; an organ of the central nervous system, such as the brain, brainstem, cerebellum, spinal cord, cranial nerves, or spinal nerves; a sensory organ, such as an eye, ear, nose, or tongue; or an integumentary organ, such as the skin, subcutaneous tissue, or breast. In various embodiments, tissue can be derived from a multicellular organism. In some embodiments, tissue sections can be in contact with a surface, for example, by placing the tissue on the surface. Tissue can be freshly excised from an organism, or it can be pre-preserved, for example, by freezing (for example, fresh frozen tissue), embedding in a material such as paraffin (for example, formalin-fixed paraffin-embedded (FFPE) samples), formalin fixation, infiltration, dehydration, etc. Optionally, tissue sections can be attached to a surface, for example, using the technology and compositions described in, for example, U.S. Patent No. 11,390,912, which is incorporated herein by reference in its entirety. In some embodiments, when the tissue is in contact with the surface, the tissue can be permeabilized and the cells of the tissue can be lysed. Any of a variety of treatments can be used, such as those described above for lysed cells. Target proteins and / or nucleic acids released from permeabilized tissues can be captured by capture oligonucleotides on the surface.Therefore, in various embodiments, the biological sample is a tissue sample. The thickness of the tissue sample or other biological sample in contact with the surface in the methods described herein can be any suitable thickness required. In representative embodiments, the thickness will be at least 0.1 μm, 0.25 μm, 0.5 μm, 0.75 μm, 1 μm, 5 μm, 10 μm, 50 μm, 100 μm or thicker. Alternatively or in addition, the thickness of the biological sample in contact with the surface is no more than 100 μm, 50 μm, 10 μm, 5 μm, 1 μm, 0.5 μm, 0.25 μm, 0.1 μm or thinner.

[0150] As used herein, the term "tissue sample" refers to a piece of tissue that has been obtained from a subject, fixed, sliced, and mounted on a planar surface (e.g., a microscope slide). The tissue sample can be a formalin-fixed paraffin-embedded (FFPE) tissue sample or a fresh tissue sample or a frozen tissue sample, etc. The method disclosed herein can be performed before or after staining the tissue sample. For example, after hematoxylin and eosin staining, the tissue sample can be spatially analyzed according to the method provided herein. The method can include (e.g., using hematoxylin and eosin staining) analyzing the histological characteristics of the sample, and then spatially analyzing the tissue.

[0151] As used herein, the term "formalin-fixed paraffin-embedded (FFPE) tissue section" refers to a piece of tissue, e.g., a biopsy tissue, that has been obtained from a subject, fixed in formaldehyde (e.g., 3% to 5% formaldehyde in phosphate-buffered saline) or Bouin's solution, embedded in wax, cut into thin sections, and then mounted on a planar surface (e.g., a microscope slide).

[0152] As used herein, the term "subject" encompasses mammals and non-mammals. Examples of mammals include, but are not limited to, any member of the class of mammals: humans, non-human primates such as chimpanzees and other apes and monkey species, cows, horses, sheep, goats, pigs, rabbits, dogs, cats, rodents, rats, mice, guinea pigs, etc. Examples of non-mammals include, but are not limited to, birds, fish, etc. The term does not denote a particular age or sex.

[0153] In some embodiments, the nucleic acid in the tissue sample is transferred and captured on the array. For example, the tissue section is placed in contact with the array, and the nucleic acid is captured on the array and labeled with a spatial address. For example, by high-throughput next-generation sequencing (NGS), such as sequencing while synthesis (SBS), the DNA molecules of spatial labeling are released from the array and analyzed. In some embodiments, the nucleic acid in the tissue section (for example, paraffin-embedded (FFPE) tissue section fixed in formalin) is transferred to the array and captured on the array by hybridization with a capture probe. In some embodiments, the capture probe can be a universal capture probe hybridized with the poly-A tail of the adapter region or mRNA in the nucleic acid sequencing library, for example. Alternatively, for example, by high-throughput next-generation sequencing (NGS), such as sequencing while synthesis (SBS), the RNA or DNA molecules of spatial labeling are released from the array and analyzed. In some embodiments, the nucleic acid in the tissue section (for example, paraffin-embedded (FFPE) tissue section fixed in formalin) is transferred to the array and captured on the array by hybridization with a capture probe. In some embodiments, the capture probe can be a gene-specific capture probe that hybridizes to, for example, a specifically targeted mRNA or cDNA in a sample, such as TruSeq TM Custom Amplicon (TSCA) Oligonucleotide Probes (Illumina, Inc.) The capture probe can be a plurality of capture probes, for example, a plurality of the same or different capture probes.

[0154] In some embodiments, a combined indexing (addressing) system is used to provide spatial information for analyzing nucleic acids in a tissue sample. The combined indexing system may involve the use of two or more spatial address sequences (e.g., two, three, four, five or more spatial address sequences).

[0155] In some embodiments, two spatial address sequences are incorporated into the nucleic acid during the preparation of the sequencing library. The first spatial address can be used to define a certain position in the X dimension on the capture array (i.e., capture site), and the second spatial address sequence can be used to define a position in the Y dimension on the capture array (i.e., capture site). During library sequencing, the X and Y spatial address sequences can be determined, and the sequence information can be analyzed to define a specific position on the capture array.

[0156] In some embodiments, three spatial address sequences are incorporated into the nucleic acid during the preparation of the sequencing library. The first spatial address can be used to define a certain position in the X dimension on the capture array (i.e., a capture site), the second spatial address sequence can be used to define a position in the Y dimension on the capture array (i.e., a capture site), and the third spatial address sequence can be used to define the position of a two-dimensional sample slice in a sample (e.g., a tissue biopsy) (e.g., the position of a slice of a tissue sample) to provide positional spatial information in the third dimension (Z dimension) of the sample. During library sequencing, the X, Y, and Z spatial address sequences can be determined, and the sequence information can be analyzed to define a specific position on the capture array.

[0157] In some embodiments, the time address sequence (T) is optionally incorporated into the nucleic acid during the preparation of the sequencing library. In some embodiments, the time address sequence can be combined with two or three spatial address sequences. The time address sequence can be used to determine the time-dependent changes in gene expression in a tissue sample, for example, in the context of a time course experiment. The time-dependent changes in gene expression can occur in a tissue sample, for example, in response to chemical, biological or physical stimulation (e.g., toxins, drugs or heat). The nucleic acid samples obtained from comparable tissue samples (e.g., the proximal section of a tissue sample) at different time points can be merged and sequenced in large quantities. The optional first spatial address can be used to define a certain position (i.e., capture site) in the X dimension on the capture array, the second optional spatial address sequence can be used to define the position (i.e., capture site) in the Y dimension on the capture array, and the third optional spatial address sequence can be used to define the position of the two-dimensional sample slice in the sample (e.g., tissue biopsy) (e.g., the position of the slice of the tissue sample), to provide the positional spatial information in the three-dimensional (Z dimension) of the sample. During library sequencing, the T, X, Y, and Z address sequences are determined and the sequence information is analyzed to determine the specific X, Y (and optionally Z) position on the capture array for each time point (T).

[0158] The address sequences X, Y, and optionally Z and / or T can be contiguous nucleic acid sequences, or the address sequences can be separated by one or more nucleic acids (e.g., 2 or more, 3 or more, 10 or more, 30 or more, 100 or more, 300 or more, or 1,000 or more). In some embodiments, the X, Y, and optionally Z and / or T address sequences can each individually and independently be a combined nucleic acid sequence.

[0159] In some embodiments, the length of the address sequence (e.g., X, Y, Z, or T) can each individually and independently be 100 nucleic acids or less, 90 nucleic acids or less, 80 nucleic acids or less, 70 nucleic acids or less, 60 nucleic acids or less, 50 nucleic acids or less, 40 nucleic acids or less, 30 nucleic acids or less, 20 nucleic acids or less, 15 nucleic acids or less, 10 nucleic acids or less, 8 nucleic acids or less, 6 nucleic acids or less, or 4 nucleic acids or less. The lengths of two or more address sequences in a nucleic acid can be the same or different. For example, if the length of address sequence X is 10 nucleic acids, the length of address sequence Y can be, for example, 8 nucleic acids, 10 nucleic acids, or 12 nucleic acids.

[0160] The address sequence (eg, a spatial address sequence such as X or Y) may be a partially or fully degenerate sequence.

[0161] In some embodiments, the spatially addressed capture probes on the array can be released from the array onto a tissue section for generating a spatially addressed sequencing library. In some embodiments, the capture probes comprise random primer sequences for in situ synthesis of spatially tagged cDNA from RNA in the tissue section. In some embodiments, the capture probes are TruSeq for capturing and spatially tagging genomic DNA in tissue sections. TM Custom Amplicon (TSCA) Oligonucleotide Probes (Illumina, Inc.) Spatially tagged nucleic acid molecules (eg, cDNA or genomic DNA) are recovered from tissue sections and processed in a single tube reaction to generate a spatially tagged amplicon library.

[0162] In another embodiment, the present disclosure provides a substrate comprising a spatially addressable probe disclosed herein, such as a flow cell, a nanoparticle or a bead. In a specific embodiment, the bead comprises a spatially addressable probe disclosed herein. In another embodiment, the substrate comprises streptavidin on the surface of the bead. In yet another embodiment, the bead comprises a plurality of oligonucleotides bound to the bead via a bond or a reversible bond. Examples of reversible bonds include biotin molecules, such as ddBio molecules. The oligonucleotides bound to the substrate generally include an adapter sequence, such as a P5 sequence or a P7 sequence. As used herein, the P5 sequence includes a sequence comprising AAT GAT ACG GCG ACC ACC GA (SEQ ID NO: 1) or AAT GAT ACG GCGACC ACC GAG ATC TAC AC (SEQ ID NO: 2), and the P7 sequence includes a sequence CAA GCA GAA GACGGC ATA CG (SEQ ID NO: 3) or CAA GCA GAA GAC GGC ATA CGA GAT (SEQ ID NO: 4). In some embodiments, P5 or P7 sequence may also include spacer polynucleotides, and its length may be 1 to 20 nucleotides, such as 1 to 15 or 1 to 10 nucleotides, such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides. In some embodiments, the spacer includes 10 nucleotides. In some embodiments, the spacer includes 10 nucleotides. In some embodiments, the spacer is a polyT spacer, such as a 10T spacer. Spacer nucleotides may be included in the 5' end of the polynucleotide, which may be attached to a suitable carrier by a key with the 5' end of the oligonucleotide. Attachment may be achieved by sulfur-containing nucleophiles (such as thiophosphates) present at the 5' end of the polynucleotide. In some embodiments, oligonucleotides will include poly-T spacers and 5' thiophosphate groups. Thus, in some embodiments, the P5 sequence comprises 5' phosphorothioate-TTTTTTTTTTAATGATACGGCGACCACCGA-3' (SEQ ID NO: 17), and in some embodiments, the P7 sequence comprises 5' phosphorothioate-TTTTTTTTTTCAAGCAGAAGACGGCATACGA-3' (SEQ ID NO: 18). In certain embodiments, the oligonucleotides attached to the substrate comprise an address sequence that allows the x, y position of the oligonucleotide to be determined when decoded.In other embodiments, the address sequence is 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100 nucleotides in length, or a range including any two of the above nucleotides or between any two of the above nucleotides in length. In another embodiment, the oligonucleotide comprises a transposome hybridization region (Tsm hyb). In yet other embodiments, the oligonucleotide comprises a sequencing primer site sequence. Examples of sequencing primer site sequences include and from Illumina. TM The oligonucleotide may further comprise one or more linker sequences. In yet another embodiment, the oligonucleotide may further comprise one or more index sequences. In certain embodiments, the oligonucleotide may comprise one or more unique molecular identifier (UMI) sequences. A unique molecular identifier (UMI) is a class of molecular barcodes that provide error correction and increased accuracy during sequencing. These molecular barcodes are short sequences used to uniquely mark each molecule in a sample library. UMI is used in a wide range of sequencing applications, many of which are PCR replications around DNA and cDNA. UMI deduplication can also be used for RNA-seq gene expression analysis and other quantitative sequencing methods. As previously noted, oligonucleotides include portions or sequences that can specifically bind to polynucleotides from biological samples (e.g., tissue samples). Therefore, oligonucleotides are spatially addressable probes for polynucleotides from biological samples. Portions or sequences that can specifically bind to polynucleotides from biological samples can be selected for specific omics applications. For example, oligonucleotides may include oligo d (T) sequences for transcriptomics or for determination (e.g., RNA-seq determination). Alternatively, the oligonucleotide may comprise a sequence that binds to genomic DNA from a biological sample for genomic applications or for determination (e.g., ATAC-seq determination). As provided in the embodiments presented herein, the substrate may comprise various types of oligonucleotides having different portions or sequences, so that a spatially addressable probe can specifically bind to two or more different types of polynucleotides from a biological sample. The use of various types of oligonucleotides is ideally suitable for multi-omics or multi-determination applications.

[0163] In some embodiments, magnetic nanoparticles can be used to capture nucleic acids (eg, cDNA synthesized in situ) in tissue samples to generate spatially addressed libraries.

[0164] In some embodiments, spatial detection and analysis of nucleic acids in tissue samples can be performed on a droplet actuator.

[0165] Improved methods and compositions for spatial omics applications are described herein, which retain spatial information related to the source of RNA or DNA in tissues. Examples of spatial omics applications include, but are not limited to: spatial genomics applications, spatial proteomics applications; spatial transcriptomics applications; spatial agricultural genomics applications; spatial epigenomics applications; spatial phenotypic omics applications; spatial ligandomics applications; and spatial multi-omics applications (e.g., transcriptomics and genomics applications).

[0166] Isolation of polynucleotides

[0167] In various embodiments, one or more samples that have been contacted with a solid support can be lysed to release the target nucleic acid. Lysis can be performed using methods known in the art, such as those techniques that employ one or more of chemical treatment, enzymatic treatment, electroporation, heating, hypotonic treatment, ultrasonic treatment, etc.

[0168] In some embodiments, the tissue sample will be processed to remove the embedding material (e.g., paraffin or formalin) from the sample before releasing, capturing or modifying the nucleic acid. This can be achieved by contacting the sample with a suitable solvent (e.g., xylene and ethanol washing solution). The treatment can be carried out before the tissue sample contacts the solid carrier as described herein, or the treatment can be carried out when the tissue sample is on the solid carrier. An exemplary method for operating the tissue used together with the solid carrier attached to the nucleic acid is set forth in U.S. Patent Application Publication No. 2014 / 0066318, which is incorporated herein by reference.

[0169] Preparation of polynucleotides

[0170] The present disclosure is based in part on the recognition that there is a need to improve the amount of RNA or DNA information that can be isolated from fresh or frozen tissue samples and FFPE tissue samples to provide information related to the genetic profile of the tissue sample. The present disclosure provides methods for improving genetic information capture by increasing the amount and quality of RNA isolated from tissue samples, which RNA can be used for spatial transcriptomic analysis.

[0171] Total RNA may include ribosomal RNA (rRNA), messenger RNA (mRNA), transfer RNA (tRNA), microRNA (miRNA), non-coding RNA (ncRNA), small nucleolar RNA (snoRNA) and / or small nuclear RNA (snRNA). In various embodiments, the RNA is rRNA and / or mRNA.

[0172] In various embodiments, the RNA capture probe is selected from the group consisting of a poly-T sequence, a poly-U sequence, a random oligonucleotide, a semi-random sequence, or a target-specific probe. In various embodiments, the target-specific probe comprises a variety of different target-specific RNA capture probe sequences. In various embodiments, the RNA capture probe or surface capture probe is 8 to 80 nucleotides. In certain embodiments, the RNA capture probe or surface probe is 10 to 80 nucleotides, 10 to 70 nucleotides, 10 to 60 nucleotides, 10 to 50 nucleotides, 10 to 40 nucleotides, 10 to 30 nucleotides, 10 to 20 nucleotides, 20 to 80 nucleotides, 20 to 70 nucleotides, 20 to 60 nucleotides, 20 to 50 nucleotides, 20 to 40 nucleotides, or 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, or 80 nucleotides.

[0173] In various embodiments, the capture oligonucleotide comprises a clustering primer sequence and a capture nucleotide sequence configured to bind to a target nucleic acid of a biological sample. In some embodiments, the capture oligonucleotide comprises a clustering primer sequence (e.g., a P7 sequence), a spatial barcode (SBC) sequence, a sequencing primer sequence (e.g., a synthetic sequencing (SBS) sequence, such as SBS12), a single molecule identifier (SMI) sequence, a quality control sequence, and a TVN sequence, wherein "T" is a capture nucleotide sequence, "V" is adenine (A), cytosine (C) or guanine (G), and "N" is adenine (A), cytosine (C), guanine (G) or thymine (T). In various embodiments, the length of the capture oligonucleotide is between about 30 bases and about 100 bases, or between about 30 bases and about 90 bases, or between about 30 bases and about 80 bases, or between about 30 bases and about 70 bases, or between about 30 bases and about 60 bases, or between about 30 bases and about 55 bases, or between about 30 bases and about 50 bases in length, or between 20 bases and 80 bases, or between 10 bases and about 80 bases. In further embodiments, the capture oligonucleotides of the present disclosure are about 10 bases, 20 bases, 30 bases, 35 bases, 40 bases, 45 bases, 50 bases, 55 bases, 60 bases, 65 bases, 70 bases, 75 bases, 80 bases, 85 bases, 90 bases, 95 bases, or 100 bases in length. Capture nucleotide sequences capable of hybridizing or otherwise associating with an analyte (e.g., a target nucleic acid) are, for example, but not limited to, universal sequences (e.g., poly-T sequences, random nucleotide sequences, or semi-random nucleotide sequences) or target-specific (e.g., gene-specific) sequences. In various embodiments, the capture nucleotide sequence (e.g., a poly-T nucleotide sequence or a random nucleotide sequence) is, is about, or is at least about 2, 5, 8, 10, 12, 15, 18, 20, 22, 25, 28, 30, 32, 35, 38, 40, 45, 50 or more bases in length. Alternatively or in addition, the capture nucleotide sequence may include less than or equal to about 50, 45, 40, 38, 35, 32, 30, 28, 25, 22, 20, 18, 15, 12, 10, 8, 5, or 2 bases. The capture oligonucleotide may comprise additional elements, including, but not limited to, a single molecule identifier (SMI) (e.g., a unique molecular identifier (UMI)), an index sequence, a sequence complementary to a sequencing primer (e.g., SBS12), or a combination thereof.In some embodiments, beads are filled onto a solid support (e.g., a planar support or a flow cell), wherein the beads contain a plurality of capture oligonucleotides immobilized thereon, wherein one or more of the plurality of capture oligonucleotides contain from 5' to 3': (a) a first clustering primer sequence; (b) a spatial barcode (SBC) sequence; (c) a first sequencing primer sequence; (d) a single molecule identifier (SMI) sequence; (e) a quality control sequence; and (f) a TVN sequence, wherein "T" is a capture nucleotide sequence, "V" is adenine (A), cytosine (C) or guanine (G), and "N" is adenine (A), cytosine (C), guanine (G) or thymine (T), and wherein the spatial barcode sequence of the plurality of capture oligonucleotides is unique for each bead.

[0174] Oligonucleotides comprising surface oligonucleotides (e.g., poly-T sequences) may also include spatial index sequences, including but not limited to one or more of a P7 sequence, an index sequence, and / or a Read 2 (Rd2) sequence. In various embodiments, surface oligonucleotides include a P7 anchor sequence, a spatial barcode, and a sequence that hybridizes to a splint oligonucleotide.

[0175] In various embodiments, the sequence in the surface oligonucleotide that hybridizes to the splint oligonucleotide is a PZ (clustering) sequence. In various embodiments, the PZ sequence hybridizes to a splint oligonucleotide comprising a nucleotide sequence PZ' complementary to the PZ sequence and a PX' sequence complementary to the surface capture probe. In various embodiments, the PX sequence is a seeding sequence. In one embodiment, PX has the sequence AGGAGGAGGAGGAGGAGGAGGAGG (SEQ ID NO: 21).

[0176] In various embodiments, the cleavable linker attaching the capture probe to the nanostructure is a cleavable polynucleotide. In various embodiments, the cleavable polynucleotide is between 5 and 25 nucleotides, or is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides.

[0177] In some embodiments, total RNA is released from the tissue sample. Release includes lysis of the tissue or permeabilization of the tissue. In various embodiments, one or more samples that have been contacted with the solid support can be lysed to release the target nucleic acid. The lysis can be carried out using known techniques, such as those using one or more of chemical treatment, enzyme treatment, electroporation, heating, hypotonic treatment, ultrasonic treatment, etc. It is considered to permeabilize the tissue sample before capturing. In various embodiments, the tissue sample is treated with one or more blocking agents before capturing. In various embodiments, before capturing, the tissue sample is permeabilized and treated with one or more blocking agents.

[0178] In some embodiments, the tissue sample will be processed to remove the embedding material (e.g., paraffin or formalin) from the sample before releasing, capturing or modifying the nucleic acid. This can be achieved by contacting the sample with a suitable solvent (e.g., xylene and ethanol washing solution). The treatment can be carried out before the tissue sample contacts the solid carrier as described herein, or the treatment can be carried out when the tissue sample is on the solid carrier. An exemplary method for operating the tissue used together with the solid carrier attached to the nucleic acid is set forth in U.S. Patent Application Publication No. 2014 / 0066318, which is incorporated herein by reference.

[0179] Formalin-fixed tissue samples can also be decrosslinked using known techniques. In various embodiments, decrosslinking is performed using, for example, Tris-EDTA (TE) buffer at pH 8, pH 9, or another suitable buffer at a suitable pH. Decrosslinking can also be performed at high heat (e.g., 70° C.).

[0180] RNA from a sample can also be prepared by performing end repair of RNA with a polynucleotide kinase prior to the step of capturing RNA from a tissue sample and / or by performing in situ polyadenylation with a polyadenylation polymerase prior to the step of capturing RNA from a tissue sample. Methods for performing end repair of RNA from a tissue sample are described in co-owned U.S. Provisional Application No. 63 / 477,730 (Docket No. 33080 / IP-2625-P) (incorporated herein by reference).

[0181] The above methods can also be used to improve the capture efficiency of mRNA transcripts prepared from in situ mRNA transcript libraries, and / or to increase the nucleotide length of polynucleotides used to generate in situ transcriptome libraries (e.g., increasing the polynucleotide size of cDNA transcribed from mRNA isolated from a sample and used to generate an in situ transcriptome library).

[0182] Spatial detection and analysis of nucleic acids in tissue samples

[0183] According to the methods described herein, spatial detection and analysis of nucleic acids in tissue samples can be performed using a group of two or more capture probes (e.g., 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, or 10 or more capture probes). Typically, at least the first capture probe in a group of capture probes is fixed on a capture array. In some embodiments, the second capture probe may be fixed on the same capture array as the first capture probe, for example, near the first capture probe, for example, in the same capture site. In some embodiments, the second capture probe may be fixed on particles (such as magnetic particles or magnetic nanoparticles). In some embodiments, the second capture probe can be in a solution, for example, for performing an in situ reaction with nucleic acids in a tissue sample.

[0184] Typically, at least the first capture probe in a group of capture probes is fixed on a capture array or nanostructure. In some embodiments, the second capture probe may be fixed on the same capture array as the first capture probe, for example, near the first capture probe, for example, in the same capture site. In some embodiments, the second capture probe may be fixed on a nanostructure or particle (such as a magnetic particle or a magnetic nanoparticle). In some embodiments, the second capture probe can be in a solution, for example, for performing an in situ reaction with a nucleic acid in a tissue sample.

[0185] The capture probes in the capture probe group can individually and independently have a variety of different regions, for example, a capture region (e.g., a first universal or gene-specific capture region or a first cluster region), a primer binding region (e.g., an SBS primer region, such as an SBS3 or SBS12 region) or a second universal region / cluster sequence, such as a P5 or P7 region, a spatial address region (e.g., a partial or combined spatial address region) or a cleavable region.

[0186] "Sequencing by synthesis ("SBS") techniques" generally involve enzymatic extension of a nascent nucleic acid chain by repeated addition of nucleotides to a template strand. In traditional SBS methods, a single nucleomonomer can be provided to a target nucleic acid in each delivery in the presence of a polymerase. However, in the methods described herein, more than one type of nucleomonomer can be provided to a target nucleic acid in the presence of a polymerase in the delivery.

[0187] In short, SBS can be initiated by contacting a barcode with one or more labeled nucleotides, DNA polymerases, etc. The sequence comprising the barcode is used as a template to extend the features of the primers and will incorporate the detected labeled nucleotides. Optionally, the labeled nucleotides may also include a reversible termination property that terminates further primer extension once nucleotides are added to the primer. For example, a nucleotide analog with a reversible terminator portion may be added to the primer so that subsequent extension does not occur until a deblocking agent is delivered to remove the portion. Therefore, for the embodiment using reversible termination, the deblocking agent may be delivered to the flow cell (before or after detection occurs). Washing may be performed between each delivery step. The cycle may then be repeated n times so that the primers extend n nucleotides, thereby detecting a sequence of length n. Exemplary SBS procedures, fluid systems, and detection platforms that can be readily adapted for use with the methods of the present disclosure are described, for example, in Bentley et al., Nature 456:53-59 (2008); WO 04 / 018497; WO 91 / 06678; WO 07 / 123744; U.S. Pat. Nos. 7,057,026; 7,329,492; 7,211,414; 7,315,019 or 7,405,281, and U.S. Patent Application Publication No. 2008 / 0108082A1, each of which is incorporated herein by reference.

[0188] Exemplary sequences include the following Rd1 and Rd2 adaptor sequences. Second universal adaptor - Rd1SBS3 (long): ACACTCTTTCCCTACACGAC GCTCTTCCGATCT (SEQ ID NO: 13); Second universal adapter - Rd1 SBS3 (short): ACACTCTTTCCCTACACGAC (SEQ ID NO: 14); First universal adapter - Rd2SBS12 (long): GTGACTGGAGTTCAGACGTGT GCTCTTCCGATCT (SEQ ID NO: 15); First universal adaptor - Rd2 SBS12 (short): GTGACTGGAGTTCAGACGTGT (SEQ ID NO: 16).

[0189] In some embodiments, only one capture probe in a set of capture probes comprises a capture region. In some embodiments, two or more capture probes in a set of capture probes comprise a capture region.

[0190] In some embodiments, only one probe in a set of capture probes comprises a spatial address region, for example, a complete spatial address region such as describing the location of a capture site on a capture array. In some embodiments, two or more probes in a set of capture probes may comprise a spatial address region, for example, two or more probes may each comprise a partial spatial address region (i.e., a combined address region), wherein each partial address region describes the location of a capture site on a capture array, for example, along the x-axis or y-axis.

[0191] In some embodiments, a set of capture probes (e.g., a first capture probe and a second capture probe) may include at least one capture probe comprising a capture region and a spatial address region (e.g., a complete or partial spatial address region). In some embodiments, no capture probe in a set of capture probes comprises both a capture region and a spatial address region.

[0192] In some embodiments, the first capture probe is a 5' gene-specific probe comprising a sequence complementary to the first universal adapter sequence and a 5' gene-specific primer. In some embodiments, the RNA capture probe is a 5' gene-specific or target-specific probe comprising a sequence complementary to the first universal adapter sequence and a 5' gene-specific or target-specific primer.

[0193] In some embodiments, the second capture probe is a 3' gene-specific probe comprising a 3' gene-specific primer, a unique molecular index (UMI), and a second universal adapter sequence (e.g., an Rd1 adapter). In some embodiments, the second capture probe does not comprise a spatial address region. In some embodiments, the surface capture probe is a 3' gene-specific or target-specific probe comprising a 3' gene-specific or target-specific primer, a unique molecular index (UMI), and a second universal adapter sequence (e.g., an Rd1 adapter). In some embodiments, the surface capture probe does not comprise a spatial address region.

[0194] When the surface oligonucleotide molecules are randomly arranged on a substrate (e.g., a flow cell), the method further comprises determining the substrate position of one or more surface oligonucleotide molecules by sequencing the spatial barcodes of the surface oligonucleotide molecules and assigning the spatial barcode sequence to the position on the substrate. Optionally, in some embodiments, the RNA capture probe is a 5' gene-specific or target-specific probe, which comprises a sequence complementary to the first universal adapter sequence and a 5' gene-specific or target-specific primer. The method further comprises sequencing at least a portion of one or more spatially barcoded first-chain cDNA molecules or copies thereof to identify the spatial barcode sequence of one or more spatially barcoded first-chain cDNA molecules or copies thereof, and associating the spatial barcode sequence of the one or more spatially barcoded first-chain cDNA molecules or copies thereof with the known position of the spatial barcode sequence of the surface oligonucleotide molecules. In various embodiments, the sequence of the spatial barcode is determined by next-generation sequencing.

[0195] When the surface oligonucleotide molecules are arranged in clusters on a substrate (e.g., a flow cell), the method further includes, before contacting the tissue sample with the substrate, determining the substrate position of each cluster by sequencing the spatial barcode of at least one surface oligonucleotide molecule in each cluster and assigning the spatial barcode sequence to the position on the substrate. Optionally, the method further includes sequencing at least a portion of one or more spatially barcoded first-chain cDNA molecules or copies thereof to identify the spatial barcode sequence of the one or more spatially barcoded first-chain cDNA molecules or copies thereof, and associating the spatial barcode sequence of the one or more spatially barcoded first-chain cDNA molecules or copies thereof with the known position of the spatial barcode sequence of the surface oligonucleotide molecule to determine the spatial position of the RNA molecule within the tissue sample. In various embodiments, the sequence of the spatial barcode is determined by next-generation sequencing.

[0196] When the surface oligonucleotide molecules are arranged in a pattern on a substrate (e.g., a flow cell) so that the substrate position and the sequence of the spatial barcode of the surface oligonucleotide on the substrate are known before the tissue contacts the flow cell, the method also includes determining the spatial position of the RNA molecule within the tissue sample by sequencing at least a portion of one or more spatially barcoded first-chain cDNA molecules or copies thereof to identify the spatial barcode sequence of the spatially barcoded first-chain cDNA molecules or copies thereof, and associating the spatial barcode sequence of the spatially barcoded first-chain cDNA molecules or copies thereof with the known position of the spatial barcode sequence of the surface oligonucleotide molecule. Optionally, the method also includes determining the spatial position of the RNA molecule within the tissue sample by sequencing at least a portion of one or more spatially barcoded first-chain cDNA molecules and associating the spatial barcode sequence of the one or more spatially barcoded first-chain cDNA molecules or copies thereof with one or more corresponding spatial barcode sequences of surface oligonucleotide molecules having predetermined positions on the substrate.

[0197] In some embodiments, the capture site on the substrate is a plurality of capture sites. In some embodiments, the plurality of capture sites is 2 or more, 10 or more, 30 or more, 100 or more, 300 or more, 1,000 or more, 3,000 or more, 10,000 or more, 30,000 or more, 100,000 or more, 300,000 or more, 1,000,000 or more, 3,000,000 or more, or 10,000,000, or 1,000,000,000 or more capture sites.

[0198] In various embodiments, the capture array or substrate comprises 2 ) 1 or more, 2 or more, 10 or more, 30 or more, 100 or more, 300 or more, 1,000 or more, 3,000 or more, 10,000 or more, 100,000 or more, 1,000,000 or more capture sites. In various embodiments, the density is about 100 k / mm 2 To about 1000k / mm 2 Between, for example, about 100k clusters / mm 2 , about 200k clusters / mm 2 , about 300k clusters / mm 2 , about 400k clusters / mm 2 , about 500k clusters / mm 2 , about 600k clusters / mm 2, about 700k clusters / mm 2 , about 800k clusters / mm 2 , about 900k clusters / mm 2 or about 1000k clusters / mm 2 .

[0199] In various embodiments, the capture probe pairs in the capture site are multiple pairs of capture probes. In some embodiments, the multiple capture probes are 2 or more, 10 or more, 30 or more, 100 or more, 300 or more, 1,000 or more, 3,000 or more, 10,000 or more, 30,000 or more, 100,000 or more, 300,000 or more, 1,000,000 or more, 3,000,000 or more, or 10,000,000 or more, 100,000,000 or more, or 1,000,000,000 or more capture probes.

[0200] In some embodiments, the capture probe pairs in the capture sites of the substrate are multiple pairs of capture probes. In some embodiments, each first capture probe in multiple pairs of capture probes in the same capture site comprises the same spatial address sequence. In some embodiments, each first capture probe in multiple pairs of capture probes in different capture sites comprises different spatial address sequences.

[0201] In some embodiments, the surface of the capture array is a flat surface, e.g., a glass surface. In some embodiments, the surface of the capture array includes one or more holes. In some embodiments, the one or more holes correspond to one or more capture sites. In some embodiments, the surface of the capture array is a bead surface.

[0202] In some embodiments, the capture region in the second capture probe is a gene-specific capture region. In some embodiments, the gene-specific capture region in the second capture probe comprises a TruSeq TM Sequences of Custom Amplicon (TSCA) Oligonucleotide Probes (Illumina, Inc.) For example, the gene-specific capture regions in the plurality of second capture probes in a capture site can comprise a plurality of TSCA oligonucleotide probe sequences.

[0203] In some embodiments, the capture region in the second capture probe is a gene-specific or target-specific capture region. In some embodiments, the gene-specific or target-specific capture region in the second capture probe comprises a TruSeq TMSequences of Custom Amplicon (TSCA) Oligonucleotide Probes (Illumina, Inc.) For example, a gene-specific or target-specific capture region in a plurality of surface capture probes in a capture site may contain a plurality of TSCA oligonucleotide probe sequences.

[0204] Preparation of mRNA library

[0205] The present disclosure provides improved methods for preparing mRNA transcript libraries from samples, providing a more complete spatial transcriptomic profile. The genetic profile of the sample can be used to diagnose and determine treatment for subjects suffering from or at risk of suffering from a disease as determined by the genetic profile.

[0206] Contemplated herein are methods for preparing an mRNA transcript expression library from a tissue sample (e.g., a fixed tissue sample), the method comprising a) mounting the tissue sample on a substrate comprising a plurality of capture oligonucleotides, wherein the capture oligonucleotides comprise a first clustering sequence (e.g., P7), a spatial barcode sequence (SBC), and a first universal adapter sequence (e.g., Rd2 adapter); b) contacting the tissue sample with: i) a plurality of 5' gene-specific probes comprising a sequence complementary to the first universal adapter sequence and a 5' gene-specific primer; and ii) a plurality of 3' gene-specific probes under conditions such that the one or more 5' gene-specific probes and the one or more 3' gene-specific probes hybridize to one or more mRNA transcripts in the tissue sample. , the multiple 3' gene-specific probes comprising a 3' gene-specific primer, a unique molecular index and a second universal adapter sequence (e.g., Rd1 adapter); c) contacting the tissue sample in (b) with a ligation reagent so that the 5' gene-specific probe and the 3' gene-specific probe that hybridize to the mRNA transcript adjacent to each other are ligated together to form one or more ligated gene-specific probe pairs; d) removing the mRNA transcripts that hybridize to the ligated gene-specific probe pairs and leaving the ligated gene-specific probe pair oligonucleotide sequences; and e) capturing the ligated gene-specific probe pair oligonucleotides of (d) on a substrate by combining a sequence complementary to the first universal adapter sequence in the 5' gene-specific probe with the first universal adapter sequence (e.g., Rd2 adapter) of the capture oligonucleotide.

[0207] In various embodiments, the substrate is a glass slide, a bead, or a flow cell. In various embodiments, the flow cell is an ordered flow cell or a random flow cell.

[0208] In various embodiments, the 5' gene-specific probe and / or the 3' gene-specific probe is 10 to 50 nucleotides in length, or is 20 to 40 nucleotides in length, or 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length.

[0209] In various embodiments, the 3' gene-specific probe comprises one or more ribobases. In some embodiments, the 3' gene-specific probe comprises 1, 2, 3, 4, 5 or more ribobases.

[0210] In various implementations, the UMI comprises 6 to 20 nucleotides, or 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides.

[0211] In another embodiment, the method comprises hybridizing the transcripts as described above in step (a), but wherein the hybridization leaves nucleotide gaps between the hybridized probes. The following method is contemplated herein: wherein step (b) comprises contacting the tissue sample with the following substances under conditions such that one or more 5' gene-specific probes and one or more 3' gene-specific probes hybridize to one or more mRNA transcripts in the tissue sample: i) a plurality of 5' gene-specific probes comprising a sequence complementary to a first universal adapter sequence and a 5' gene-specific primer; and ii) a plurality of 3' gene-specific probes comprising a 3' gene-specific primer, a unique molecular index, and a second universal adapter sequence (e.g., an Rd1 adapter), wherein hybridization of the 5' gene-specific probes and the 3' gene-specific probes on the mRNA transcripts results in nucleotide gaps between the hybridized molecules; and c) contacting the tissue sample in (b) with nucleotide bases and a ligation reagent such that the nucleotide gaps between the 5' gene-specific probes and the 3' gene-specific probes hybridized to the mRNA transcripts are filled with nucleotide bases complementary to the mRNA transcripts, and the 5' gene-specific probes and the 3' gene-specific probes are ligated together to form one or more ligated gene-specific probe pairs. Steps (d) and (e) are similar to those described above.

[0212] For a gap filling reaction, the gap can be 1 to 50 or more nucleotides, such as 50 or more nucleotides, 1 to 50 nucleotides, 1 to 40 nucleotides, 1 to 30 nucleotides, 1 to 20 nucleotides, or 1 to 10 nucleotides.

[0213] In various embodiments, the 5' gene-specific probe and / or the 3' gene-specific probe comprises a locked nucleic acid (LNA) to reduce or prevent strand displacement.

[0214] The clustering sequence can be a known index sequence. For example, in some embodiments, the first clustering sequence comprises a P7 sequence (e.g., CAAGCAGAAGACGGCATACG (SEQ ID NO: 3) or CAAGCAGAAGACGGCATACGAGAT (SEQ ID NO: 4)) and the second clustering sequence comprises a P5 sequence (e.g., AATGATACGGCGACCACCGA (SEQ ID NO: 1) or AATGATACGGCGACCACCGAGATCTACAC (SEQ ID NO: 2)).

[0215] Universal primers also include sequences known in the field of spatial transcriptomics. In some embodiments, the first universal primer sequence comprises GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO: 19). In some embodiments, the second universal primer sequence comprises the Rd1 sequence listed in AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (SEQ ID NO: 20).

[0216] To prevent unintended premature capture onto the substrate, the 5' gene-specific probe and the 3' gene-specific probe are annealed at a different temperature than the capture probe. In various embodiments, the 5' gene-specific probe and / or the 3' gene-specific probe have a melting temperature (Tm) of about 50°C to 55°C. In various embodiments, the capture oligonucleotide has a melting temperature (Tm) of about 40°C to 42°C.

[0217] In view of the desired melting temperature, it is contemplated that step (b) of the process is conducted at about 50°C to 55°C. It is further contemplated that step (e) is conducted at about 40°C to 42°C.

[0218] For the ligation reaction, a variety of reverse transcriptases (RT) or polymerases can be used in the method. In various embodiments, the polymerase is T4 DNA ligase, T4 RNA ligase 2 (T4Rnl2), SplintR DNA ligase, E. coli DNA ligase or R2D ligase. In various embodiments, the ligation reaction is carried out at 37°C.

[0219] Prior to strand synthesis, the mRNA transcript can be removed from the reaction, for example, by enzymatic digestion. In various embodiments, RNase H or RNase A is used to remove the mRNA.

[0220] The method herein also includes indexing and sequencing the ligated gene-specific probe pairs, including, f) performing an extension reaction and PCR on the oligonucleotide of (e) to produce a PCR template representing one or more mRNA transcripts in the tissue sample; g) eluting the PCR template from the substrate; and h) performing index PCR to produce a double-stranded PCR product comprising a first-strand PCR product and a second-strand complementary to the first-strand PCR product.

[0221] In various embodiments, the PCR template is eluted from the substrate using sodium hydroxide elution. In various embodiments, the eluted PCR template is placed in a tube for mRNA transcript library preparation.

[0222] In various embodiments, the method further comprises sequencing the PCR product of (h), and determining the location of the mRNA transcript in the tissue based on the spatial barcode sequence of (a).

[0223] In various embodiments, the double-stranded PCR product comprises a second clustering sequence (eg, P5) on the second strand that is complementary to the first-strand PCR product and an index sequence.

[0224] It is contemplated that the methods herein provide information regarding the localization / position and expression level of a specific gene in a tissue sample. For example, in the method, contacting the tissue sample with a substrate enables the location of a capture site on the substrate to be associated with a location in the tissue sample, wherein the substrate comprises a plurality of capture sites, the plurality of capture sites comprising a plurality of capture probes fixed to a surface, wherein the capture probes comprise a spatial address region.

[0225] The present disclosure also provides an improved method for preparing a spatially barcoded RNA library from a tissue sample, providing a more complete spatial transcriptomic profile. Previous methods for generating RNA libraries from tissue samples involved connecting probe pairs to sample RNA and connecting the probes together, which provided little information about the RNA sequence itself. It is hypothesized herein that the separation hybridization and extension connection steps will provide more robust sequence information for the initial capture of RNA from the sample.

[0226] Various methods are proposed to copy or ligate portions of RNA with targeting probes, which can then be captured on (and then ligated to) a spatially barcoded substrate. RNA includes ribosomal RNA (rRNA), messenger RNA (mRNA), non-coding RNA (ncRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA) and / or micro RNA (miRNA).

[0227] In various embodiments, the substrate is a bead, a bead array, a spot array, a substrate comprising a plurality of holes, a flow cell (e.g., a collection flow cell), a collection of particles arranged on a chip surface, a membrane or a plate (e.g., a multi-well plate). In various embodiments, the substrate is a gel coating located in or on a flow cell.

[0228] In various embodiments, the substrate comprises a plurality of nanopores or micropores.

[0229] In various embodiments, the RNA capture probe is selected from the group consisting of a poly-T sequence, a random oligonucleotide, or a target-specific probe. In various embodiments, the target-specific probe comprises a variety of different target-specific RNA capture probe sequences. In various embodiments, the RNA capture probe or surface capture probe is 8 to 80 nucleotides. In certain embodiments, the RNA capture probe or surface probe is 10 to 80 nucleotides, 10 to 70 nucleotides, 10 to 60 nucleotides, 10 to 50 nucleotides, 10 to 40 nucleotides, 10 to 30 nucleotides, 10 to 20 nucleotides, 20 to 80 nucleotides, 20 to 70 nucleotides, 20 to 60 nucleotides, 20 to 50 nucleotides, 20 to 40 nucleotides, or 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, or 80 nucleotides.

[0230] In various embodiments, the target-specific probes and / or substrate-specific probes are 10 to 50 nucleotides in length, or are 20 to 40 nucleotides in length, or 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length.

[0231] In various implementations, the UMI comprises 6 to 20 nucleotides, or 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides.

[0232] If a clustering sequence is used, the clustering sequence can be a known index sequence. For example, in some embodiments, the first clustering sequence comprises a P7 sequence (e.g., CAAGCAGAAGACGGCATACG (SEQ ID NO: 3) or CAAGCAGAAGACGGCATACGAGAT (SEQ ID NO: 4)) and the second clustering sequence comprises a P5 sequence (e.g., AATGATACGGCGACCACCGA (SEQ ID NO: 1) or AATGATACGGCGACCACCGAGATCTACAC (SEQ ID NO: 2)).

[0233] Universal primers also include sequences known in the field of spatial transcriptomics. In some embodiments, the first universal primer sequence comprises GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO: 19). In some embodiments, the second universal primer sequence comprises the Rd1 sequence listed in AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (SEQ ID NO: 20).

[0234] Prior to strand synthesis, RNA (e.g., mRNA) transcripts can be removed from the reaction, for example, by enzymatic digestion. In various embodiments, RNA is removed using RNase H or RNase A.

[0235] The methods herein also include indexing and sequencing the linked gene-specific or target-specific probe pairs, including performing an extension reaction and PCR on the oligonucleotides to produce a PCR template representing one or more mRNA transcripts in the tissue sample; eluting the PCR template from the substrate; and indexing the PCR to produce a double-stranded PCR product comprising a first-strand PCR product and a second-strand complementary to the first-strand PCR product.

[0236] In various embodiments, the PCR template is eluted from the substrate using sodium hydroxide elution. In various embodiments, the eluted PCR template is placed in a tube for mRNA transcript library preparation.

[0237] In various embodiments, the method further comprises sequencing the PCR products and determining the location of the mRNA transcripts in the tissue based on the spatial barcode sequences.

[0238] In various embodiments, the double-stranded PCR product comprises a second clustering sequence (eg, P5) on the second strand that is complementary to the first-strand PCR product and an index sequence.

[0239] It is contemplated that the methods herein provide information regarding the localization / position and expression level of a specific gene in a tissue sample. For example, in the method, contacting the tissue sample with a substrate enables the location of a capture site on the substrate to be associated with a location in the tissue sample, wherein the substrate comprises a plurality of capture sites, the plurality of capture sites comprising a plurality of capture probes fixed to a surface, wherein the capture probes comprise a spatial address region.

[0240] Biological samples and methods of use

[0241] The present method can be used to determine genetic information or genetic profiles, i.e., the levels of specific genes or gene expression, from a biological sample, to detect mutations or defects in genes or changes in genetic markers, in order to help diagnose people with a disease or at risk of having a disease and to determine the efficacy of treatment. A genetic profile refers to the characteristic expression levels of one or more genes / genetic markers in a sample. In the present disclosure, a genetic profile can be measured before, during, and / or after administration of a therapeutic agent to treat a disease as described herein, and it can be determined whether the gene levels are altered, e.g., increased or decreased, in association with a particular disease, condition, or treatment regimen.

[0242] The biological sample used in the method is obtained from a subject. In various embodiments, the subject is a mammal, such as a human, a non-human primate (such as a chimpanzee), other ape and monkey species, cattle, horses, sheep, goats, pigs, rabbits, dogs, cats, rodents, rats, mice, guinea pigs, etc. In various embodiments, the subject is a human.

[0243] The sample may be derived from an organ or tissue, including, for example, from: the musculoskeletal system, such as muscle, bone, tendon or ligament; an organ of the digestive system, such as salivary glands, pharynx, esophagus, stomach, small intestine, large intestine, liver, gall bladder or pancreas; the respiratory system, such as the larynx, trachea, bronchi, lungs or diaphragm; the urinary system, such as the kidney, ureter, bladder or urethra; reproductive organs / tissues, such as ovaries, fallopian tubes, uterus, vagina, placenta, testes, epididymis, vas deferens, seminal vesicles, prostate, penis or scrotum; the endocrine system, such as the pituitary gland, pineal gland, thyroid gland, parathyroid gland or adrenal gland; the circulatory system, such as the heart, arteries, veins or capillaries; the lymphatic system, such as lymphatic vessels, lymph nodes, bone marrow, thymus gland or spleen; the central nervous system, such as the brain, brainstem, cerebellum, spinal cord, cranial nerves or spinal nerves; the eye, ear, nose or tongue; or the integument, such as the skin, subcutaneous tissue or breast.

[0244] When used in the method, samples from people can be considered (or suspected) to be healthy or sick. In some cases, two samples can be used: the first is considered to be sick, and the second is considered to be healthy (e.g., used as a healthy control). Any one of a variety of conditions can be evaluated, including but not limited to autoimmune diseases, cancer, cystic fibrosis, aneuploidy, pathogenic infection, psychological conditions, hepatitis, metabolic disorders, diabetes, sexually transmitted diseases, heart disease, stroke, cardiovascular disease, multiple sclerosis or muscular dystrophy. In various embodiments, the disease or condition is cancer, a genetic disorder or a condition associated with a pathogen with an identifiable genetic signature.

[0245] It is contemplated that the methods herein can be used to detect changes in genetic material compared to a control sample or a sample from a subject prior to the onset of disease, including mutations, deletions, insertions, single nucleotide polymorphisms (SNPs), combinations thereof, and other changes in the genetic profile.

[0246] The method can also be used to determine whether it is necessary to initiate therapy (e.g., cancer therapy) in a subject, the method comprising i) determining the genetic profile of the subject using the methods described herein; ii) determining whether the genetic profile indicates that the subject has a disease or condition; and iii) initiating treatment for the disease or condition with an appropriate therapy.

[0247] Sequencing methods

[0248] Methods described herein can be used in combination with multiple nucleic acid sequencing techniques. Particularly suitable techniques are those in which nucleic acids are attached to fixed positions in an array so that their relative positions do not change and in which the array is repeatedly imaged. Embodiments in which images are obtained in different color channels (e.g., matching different markers for distinguishing a nucleotide base type from another nucleotide base type) are particularly suitable. In some embodiments, the process of determining the nucleotide sequence of a target nucleic acid can be an automated process. Preferred embodiments include sequencing by synthesis ("SBS") technology.

[0249] SBS can utilize nucleotide monomers with terminator parts or lack nucleotide monomers of any terminator parts.The method utilizing the nucleotide monomers lacking terminator includes for example pyrophosphate sequencing and the sequencing of nucleotides using gamma-phosphate labeling, as described in further detail below.In the method using the nucleotide monomers lacking terminator, the number of nucleotides added in each cycle is usually variable, and the number depends on the mode of template sequence and nucleotide delivery.For utilizing the SBS technology of the nucleotide monomers with terminator parts, terminator can be effectively irreversible under the sequencing conditions used, such as the situation of traditional Sanger sequencing utilizing dideoxynucleotides, or terminator can be reversible, such as the situation of the sequencing method developed by Solexa (now Illumina, Inc.).

[0250] The SBS technique can utilize nucleotide monomers with a labeling portion or nucleotide monomers lacking a labeling portion. Thus, incorporation events can be detected based on the following: properties of the label, such as the fluorescence of the label; properties of the nucleotide monomer, such as molecular weight or charge; byproducts of the incorporated nucleotide, such as the release of pyrophosphate; and the like. In embodiments where two or more different nucleotides are present in the sequencing reagent, the different nucleotides may be distinguishable from each other, or alternatively, the two or more different labels may be indistinguishable under the detection technology used. For example, different nucleotides present in the sequencing reagent may have different labels, and they may be distinguished using appropriate optical devices, as exemplified by the sequencing method developed by Illumina, Inc.

[0251] In various embodiments, the technique is pyrophosphate sequencing. Pyrophosphate sequencing detects the release of inorganic pyrophosphate (PPi) when a specific nucleotide is incorporated into a nascent chain (Ronaghi, M., Karamohamed, S., Pettersson, B., Uhlen, M., and Nyren, P. (1996), "Real-time DNA sequencing using detection of pyrophosphate release.", Analytical Biochemistry 242 (1), 84-9; Ronaghi, M. (2001), "Pyrosequencing sheds light on DNA sequencing.", Genome Res. 11 (1), 3-11; Ronaghi, M., Uhlen, M., and Nyren, P. (1998) "A sequencing method based on real-time pyrophosphate." Science 281 (5375), 363; U.S. Pat. No. 6,210,891; U.S. Pat. No. 6,258,568 and U.S. Pat. No. 6,274,320, the disclosures of which are incorporated herein by reference in their entirety). In pyrophosphate sequencing, the released PPi can be detected by being immediately converted into ATP by adenosine triphosphate (ATP) sulfurylase, and the level of ATP generated is detected by photons generated by luciferase. The nucleic acid to be sequenced can be attached to the features in the array, and the array can be imaged to capture the chemiluminescent signal generated by the incorporation of nucleotides at the features of the array. The image can be obtained after the array is treated with a specific nucleotide type (e.g., A, T, C or G). The images obtained after adding each nucleotide type will differ in which features are detected in the array. These differences in the image reflect the different sequence contents of the features on the array. However, the relative position of each feature will remain unchanged in the image. The images can be stored, processed and analyzed using the methods described herein. For example, images obtained after treating the array with each different nucleotide type can be processed in the same manner as exemplified herein for images obtained from different detection channels for a reversible terminator-based sequencing method.

[0252] In another exemplary type of SBS, cycle sequencing is accomplished by gradually adding reversible terminator nucleotides containing, for example, cleavable or photobleachable dye labels, such as, for example, International Patent Publication No. WO04 / 018497 and U.S. Patent No. 7,057,026, the disclosures of which are incorporated herein by reference. The method is commercialized by Illumina Inc. and is also described in International Patent Publication No. WO 91 / 06678 and International Patent Publication No. WO 07 / 123,744, each of which is incorporated herein by reference. The availability of fluorescently labeled terminators, in which termination can be reversible and the fluorescent label can be cleaved, facilitates efficient cyclic reversible termination (CRT) sequencing. Polymerases can also be co-engineered to effectively incorporate these modified nucleotides and extend from these modified nucleotides.

[0253] Preferably, in the sequencing embodiment based on reversible terminator, the label does not substantially inhibit extension under SBS reaction conditions. However, the detection label can be removable, such as removed by cleavage or degradation. Images can be captured after the label is incorporated into the arrayed nucleic acid feature. In a specific embodiment, each cycle involves four different nucleotide types being delivered to the array simultaneously, and each nucleotide type has a label that is spectrally different. Four images can then be obtained, each image using a detection channel that is selective to one label in the four different labels. Alternatively, different nucleotide types can be added sequentially, and the image of the array can be obtained between each addition step. In such embodiments, each image will show the nucleic acid feature of the nucleotide that has been incorporated with a specific type. Due to the different sequence content of each feature, different features will be present or not present in different images. However, the relative position of the feature will remain unchanged in the image. The image obtained by such reversible terminator-SBS method can be stored, processed and analyzed as described herein. After the image capture step, the label can be removed and the reversible terminator part can be removed for subsequent cycles of nucleotide addition and detection. Removing labels after they have been detected in a particular cycle and before subsequent cycles can provide the advantage of reducing background signal and crosstalk between cycles. Examples of useful labeling and removal methods are set forth below.

[0254] In a specific embodiment, some or all of the nucleotide monomers may include a reversible terminator. In such embodiments, the reversible terminator / cleavable fluorophore may include a fluorophore (Metzker, Genome Res. 15: 1767-1776 (2005), which is incorporated herein by reference) connected to a ribose moiety via a 3' ester bond. Other methods have separated terminator chemistry from the cleavage of a fluorescent label (Ruparel et al., Proc Natl Acad Sci USA 102: 5932-7 (2005), which is incorporated herein by reference in its entirety). Ruparel et al. describe the development of reversible terminators that use small 3' allyl groups to block extension, but can be easily deblocked by a short treatment with a palladium catalyst. The fluorophore is attached to the base via a photocleavable linker that can be easily cleaved by exposure to long wavelength ultraviolet light for 30 seconds. Therefore, disulfide reduction or photocleavage can be used as a cleavable linker. Another method of reversible termination is to use natural termination, which occurs after a bulky dye is placed on a dNTP. The presence of a charged bulky dye on a dNTP can act as an efficient terminator by steric hindrance and / or electrostatic hindrance. Unless the dye is removed, the presence of an incorporation event prevents further incorporation. The cracking of the dye removes the fluorophore and effectively reverses termination. The example of modified nucleotides is also described in U.S. Patent No. 7,427,673 and U.S. Patent No. 7,057,026, the disclosures of which are incorporated herein by reference in their entirety.

[0255] Additional exemplary SBS systems and methods that may be utilized with the methods and systems described herein are described in U.S. Patent Publication No. 2007 / 0166705, U.S. Patent Publication No. 2006 / 0188901, U.S. Patent 7,057,026, U.S. Patent Publication No. 2006 / 0240439, U.S. Patent Publication No. 2006 / 0281109, International Patent Publication No. WO 05 / 065814, U.S. Patent Publication No. 2005 / 0100900, International Patent Publication No. WO 06 / 064199, International Patent Publication No. WO 07 / 010,251, U.S. Patent Publication No. 2012 / 0270305, and U.S. Patent Publication No. 2013 / 0260372, the disclosures of which are incorporated herein by reference in their entireties.

[0256] Reagent test kit

[0257] As an additional aspect, the disclosure includes a test kit, which includes one or more compounds or compositions, which are packaged in a manner that promotes them to be used to practice the disclosed method. In one embodiment, such a test kit includes a compound or composition as described herein packaged in a container (such as a sealed bottle or container), and a mark is attached to the container or included in the package, which describes the use of the compound or composition in practicing the method. Preferably, the compound or composition is packaged in a unit dosage form. Preferably, the test kit contains instructions for describing the use of the composition.

[0258] Kits and articles are contemplated herein. Such kits may include carriers, packages or containers, such as vials, tubes, etc., separated to receive one or more containers, each of which includes an element of the independent elements to be used in the methods described herein. Suitable containers include, for example, bottles, vials, syringes and test tubes. The container may be formed of a variety of materials, such as glass or plastic. For example, a container may include one or more spatially addressable probes disclosed herein, optionally in a composition or in combination with another reagent disclosed herein (e.g., arrays, bead chips). Optionally, the container has a sterile inlet (e.g., the container may be an intravenous bag or a vial with a stopper that can be pierced by a hypodermic needle). Optionally, such kits include an identification description or label or instructions for use thereof in the methods described herein.

[0259] The kit will typically include one or more additional containers, each with one or more of the various materials (such as reagents and / or devices, optionally in concentrated form) that are desirable from a commercial and user standpoint for use with the spatially addressable probes described herein. Non-limiting examples of such materials include, but are not limited to: buffers, diluents, filters, needles, syringes; carriers, packaging, containers, vials, and / or tube labels listing the contents and / or instructions for use, and package inserts with instructions for use. A set of instructions will also typically be included.

[0260] The mark may be on or associated with the container. In the case where the letters, numbers or other characters forming the mark are attached, molded or etched to the container itself, the mark may be on the container, and when it is present in a receptacle or carrier that also supports the container, such as in a package insert, the mark may be associated with the container. The mark may be used to indicate that the contents will be used for a specific spatial omics application. Such as in the method described herein, the mark may also indicate the direction in which the contents are used.

[0261] Additional aspects and details of the present disclosure will be apparent from the following examples, which are intended to be illustrative rather than limiting.

[0262] Example

[0263] Example 1 - In situ method for capturing mRNA transcripts

[0264] In order to improve the capture of mRNA transcripts from fixed or frozen tissue samples, improved methods for capturing mRNA transcripts from tissue samples have been developed.

[0265] A schematic diagram of the first method is presented in Figure 1 In the first approach, highly multiplexed oligonucleotide probes are hybridized to tissue mRNA, followed by ligation, release, and capture on a solid surface containing spatially barcoded capture oligonucleotides. The captured ligation products are eluted from the surface and PCR amplified by universal adapter sequences to generate a spatially barcoded library.

[0266] Two assay-specific oligonucleotides were designed to probe a single continuous mRNA sequence (≤50nt). Each of these oligonucleotides consists of two parts: an upstream specific oligonucleotide (USO) containing a 5' gene-specific sequence (5'GSP) with a terminal phosphate; and a 3' universal capture / partial Rd2' adapter sequence (Rd2'), while a downstream specific oligonucleotide (DSO) contains a 3' gene-specific sequence (3'GSP), followed by a unique molecular index (UMI) (N=6) and a 5'Rd1 sequence (Rd1). The GSPs of USO and DSO were designed to each have a Tm of approximately 55°C. Using this method, oligonucleotide pairs can be designed and multiplexed (pooled) to target the entire transcriptome. The spatially barcoded substrate contains a covalently bound surface capture oligonucleotide (SCO) containing a 5' sequence for clustering (e.g., P7), followed by a spatial barcode (SBC) and a capture sequence (Rd2) complementary to the USO capture sequence. The SCO Rd2 sequence has a Tm of approximately 40°C.

[0267] Hybridization of the oligonucleotide pool occurs at high temperature (about 50°C) to facilitate GSP-mediated hybridization, but to minimize hybridization of USO to the capture oligonucleotide RD2 sequence. Unbound 5' and 3' gene-specific probes are removed via heated washing (about 50°C). The 3' end of the 3' gene-specific probe contains one or more ribobases to facilitate RNA ligase 2-mediated ligation. After RNA removal and permeabilization via RNase H, the ligated cDNA is captured on the SCO via Rd2' / Rd2 hybridization.

[0268] Extension from the 3' end of the product containing Rd2' releases the captured template from the surface, enabling indexed PCR off the surface (in solution) using an RNA-tolerant PCR polymerase. For sequencing, Rd1 provides UMI and cDNA information, Rd2 generates spatial barcodes and Rd3 allows sample demultiplexing.

[0269] A schematic diagram of the second method is presented in Figure 2 The second approach is similar to that described in the first approach, with the important difference that sequences corresponding to endogenous transcripts are captured, providing additional assay specificity.

[0270] For the second method, the GSP of the 5' gene-specific probe and the 3' gene-specific probe is designed to have a gap of several nucleotides between the hybridized 3' end of the 3' gene-specific probe and the 5' end of the 5' specific probe to provide additional assay specificity (the gap corresponds to the endogenous mRNA sequence). Optionally, a polymerase with reverse transcriptase activity but lacking strand displacement activity is used for gap filling, followed by ligase to seal the nick. The 5' terminal base of the 5' gene-specific probe contains several locked nucleic acid bases (LNA) to minimize any polymerase-derived strand displacement activity. The subsequent steps are the same as those described in the first method, except that an LNA-tolerant PCR polymerase is used.

[0271] This paper develops a workflow for the ability to isolate and prepare mRNA libraries from formalin-fixed, paraffin-embedded (FFPE) tissues. Each step of hybridization, ligation, surface capture, and transcript copying is performed on a substrate containing a tissue sample. In order to minimize off-target binding, the initial hybridization of the probe to the target is performed at about 55°C using a probe with a high melting temperature and hybridized at this temperature range. Once hybridization is completed, washing is performed and ligation is performed at the same higher temperature (37°C). The capture reaction is performed at 40°C. The difference in reaction temperature prevents the capture probe from hybridizing prematurely with the substrate surface and minimizes incomplete or premature capture of mRNA from tissue samples.

[0272] Probe construction: As an initial step, probes were designed to generate libraries using RNA-mediated oligonucleotide annealing, selection, and ligation with next-generation sequencing (RASL-Seq) (Illumina), spatial annealing, selection, and ligation with next-generation sequencing (SPASL-Seq) or TruSeq methods (Illumina).

[0273] The probe for RASL-seq that binds RNA contains an index primer (Rd2 adapter) connected to a 3' target sequence (gene-specific probe) at the 5' end and a 5' target sequence (gene-specific probe) connected to a 3' P5 primer. TruSeq primers that bind cDNA contain 5'smRNA connected to USO and DSO connected to the SBS3 sequence 3'. Primers are designed to leave a gap or no gap once hybridized with the mRNA transcript. If primer hybridization leaves a gap between probes on the target polynucleotide, an extension reaction is performed to fill the gap. Probes are determined using two library models (i.e., a human control library containing genes expressed as low CV across cell types and an ERCC control model).

[0274] The probe is annealed to the target polynucleotide and connected together to form a single strand complementary to the target polynucleotide. It is then captured on a substrate comprising a poly-T and a sequence complementary to the 5' end of the connection product (Rd2 adapter), and extended via a polynucleotide extension reaction. The chain connected is then eluted from the capture surface, and a second strand is synthesized by PCR. The primer for the second strand synthesis contains an Rd1 adapter sequence, an index sequence (e.g., i5), and an Rd3 sequence (e.g., P5). It is noted that the use of 3' ribobases in the upstream connection oligonucleotide (USO) improves the efficiency of ssDNA connection in the solution. The ribobase reduces chain displacement during the connection reaction.

[0275] The probes for the TruSeq method were designed in a similar manner to the RASL-Seq described above, but included a 5'Rd2 sequence, a unique molecular identifier (UMI), and a ULSO on the first probe, and a DLSO and a 3' adapter sequence (Rd1) on the second probe. For the reaction, a 2-probe subpool on ERCC (30nM), 1μl or 0.1μl ERCC (3nM or 0.3nM in a 10μl mixture), and a titrated probe concentration titrated ERCC pool 8012 50μM, 5μM, or 0.5μM were used. Annealing conditions were 50mM NaCl in IDTE with a gradient of 65°C for 5', 45°C for 5', 37°C for 10', 25°C for 10'. The results showed that high probe concentrations seemed to inhibit qPCR.

[0276] Ligation assays: Ligation assays have also been designed for specific methods to allow in situ ligation of oligonucleotides on tissue-containing substrates. Several different ligases (T4 DNA ligase, T4 RNA ligase 2 (T4Rnl2), SplintRDNA ligase, Escherichia coli DNA ligase, and R2DLIGASE) were analyzed. TM) in the reaction. The 9x [enzyme] condition performed best among the conditions. T4 RNA Ligase 2 performed similarly to the other enzymes at higher concentrations. R2D also appeared to have similar ligation efficiency.

[0277] During the ligation assay analysis, a ribobase was added to the 3' end of DLSO to determine if this would increase ligation efficiency. Addition of a 3' ribobase to the ligation assay increased ligation efficiency for T4 RNA ligase 2 in both single-strand and splint reactions, but not for T4 DNA ligase, E. coli DNA ligase, or SplintR.

[0278] Prior to hybridization, test whether reversal of crosslinking of tissue samples (e.g., a byproduct of formalin fixation of samples) would improve hybridization and capture efficiency. TM Cross-link reversal was performed under different conditions. Fresh frozen (FF) or FFPE tissue sections were collected and if necessary, paraffin was removed from the samples and the tissue was lysed using standard protocols. Different RNA extraction conditions were used and the amount of RNA recovered was determined. For Qiagen RNeasy (Qiagen): FF, FFPE (50ul, 30ul elution respectively) a 15 minute reverse cross-linking step was included in the FFPE kit. The time course used was 70°C, O / N at 0', 15', 30', 45', 1h, 2h, 4h during extraction; 100ng in 20ul, or 0, 15', 30', 60' at 80°C. Under those conditions, the major increase in accessibility (RT-qPCR decrease in Cq) was from 0' to 30' at 80°C. It seems that the mRNA reduction is more strongly associated with the RNA in the input reaction. RNASTORM was performed under the same conditions as above TM (Cell Data Science) extraction and determination of the amount of RNA recovered. The reactions showed that there appeared to be a slight increase in RNA recovery using RNAeasy extraction, but additional experiments will be performed to confirm this.

[0279] Table 1

[0280]

[0281] Note: Difficulties with FFPE collection due to high laboratory temperatures result in each tube containing 2 to 3.5 mouse kidney sections.

[0282] The results show that the method of the present invention for capturing mRNA from FFPE tissue samples effectively improves capture efficiency and transcript integrity, thereby providing a more robust spatial transcriptomic library. This improved library can be used, for example, to more clearly characterize genetic profiles at the cellular and positional levels in samples from subjects with a disease or condition, and to aid in the diagnosis and treatment of such a disease or condition.

[0283] Example 2 - Method for generating RNA library

[0284] To improve the capture of RNA transcripts from fixed or frozen tissue samples, improved methods for capturing RNA from tissue samples have been developed.

[0285] A schematic diagram of the first method is presented in Figure 3 and an exemplary workflow is shown in Figure 8 middle.

[0286] In the first exemplary method, RNA capture probes are hybridized to RNA in tissue and subsequently extended with reverse transcriptase to form first-strand cDNA molecules ( Figure 3 ). The RNA capture probe comprises a capture oligonucleotide sequence complementary to the RNA in the sample and a first substrate capture oligonucleotide complementary to the first domain of multiple splint oligonucleotides. In an optional step, the extended probe is then melted from the RNA (or the RNA is digested with RNase), and the probe is hybridized to the surface barcoded oligonucleotide on the substrate via the splint oligonucleotide. The substrate capture probes each comprise a spatial barcode and a second substrate capture oligonucleotide complementary to the second domain of the splint oligonucleotide. The captured first-strand cDNA molecules are then connected to the surface barcode oligonucleotides of the extended probe, for example using T4 ligase, to produce a spatially barcoded first-strand cDNA. The surface oligonucleotides may also contain an adapter sequence, such as a P7 adapter, and the RNA capture probe may also contain a read primer hybridization site for reading the spatial barcode. Optionally, if the RNA is mobile (i.e., not cross-linked to the tissue, or released by de-crosslinking), the entire construct may be bound to the substrate surface oligonucleotides and connected, followed by reverse transcription on the surface, rather than de-hybridizing the extended probes. Optionally, the RNA may be digested, releasing the DNA probe, rather than dehybridizing the extended probe. Ligation may be performed via enzymatic or chemical methods.

[0287] As an alternative to the above strategy, in a second approach, an oligonucleotide is added to the 3' end of an extension probe that is complementary to a portion of the surface oligonucleotide ( Figure 4A , Fig. 9). In this method, the RNA capture probe comprises an oligonucleotide sequence complementary to the RNA in the sample and a handle sequence. Initially, the RNA capture oligonucleotide of the RNA capture probe is hybridized with the RNA in the tissue sample to form an RNA-RNA capture probe hybrid. The RNA-RNA hybrid is extended using RT to produce a first-strand cDNA. A 3' oligonucleotide sequence comprising a substrate capture oligonucleotide complementary to the first domain of the substrate capture probe is then added to the first-strand cDNA. The surface capture probe comprises a substrate anchor sequence, a spatial barcode, and a first domain in a 5' to 3' orientation. The substrate capture oligonucleotide of the first-strand cDNA molecule is then hybridized with the first domain of the substrate capture probe; extension of the first domain of the hybridized substrate capture probe is performed to produce a spatially barcoded first-strand cDNA molecule.

[0288] This 3' end oligonucleotide enables extension of the capture probe from the surface, and the 5' end of the probe can then be used to introduce a P5 or other adaptor. Figure 4A The method of adding oligonucleotides to the 3' end is shown as tagmentation. Tn5 has some activity on DNA / RNA hybrids and can be used to add 3'OH( Figure 4A 3' oligonucleotide addition can also be achieved by terminating the first extension step with a click-labeled nucleotide (e.g., azide or alkyne) or similarly by oNTP-directed adapter, followed by chemical ligation with the oppositely functionalized surface-barcoded oligonucleotide (or a sequence complementary thereto at the 3' end of the cDNA transcript) ( Figure 4B ).

[0289] Consider that the added 3' oligonucleotide sequence can be captured by surface oligonucleotides (such as poly A tail or other capture sequence). These modified nucleotides (click and oNTP) can also be used to terminate the cDNA product at an insertion length suitable for sequencing. An alternative method is to use TdT (or other single nucleotide addition) to polyadenylate the extended probe and bind the product to the poly T at the 3' end of the spatial barcode oligonucleotide.

[0290] Template switching can be another method to add a poly A tail or other capture sequence to the 3' end of the first strand cDNA molecule ( Figure 4C , Fig.10). Similar to the above method, the RNA capture oligonucleotide of the RNA capture probe is hybridized with the RNA in the tissue sample to form an RNA-RNA capture probe hybrid. The RNA-RNA hybrid is extended using RT to produce a first-strand cDNA. In order to add a 3' oligonucleotide, the first-strand cDNA molecule is contacted with a reverse transcriptase (RT) and a template switching oligonucleotide (TSO), wherein the RT incorporates an untemplated cytosine nucleotide at the 3' end of the first cDNA, and the TSO contains a sequence capable of hybridizing with an untemplated cytosine nucleotide, and the RT is extended to produce a TSO complement. In this embodiment, the 3' end oligonucleotide contains a substrate capture oligonucleotide complementary to the first domain of a plurality of substrate capture probes on a substrate, and each of the plurality of substrate capture probes contains a substrate anchor sequence, a spatial barcode, and a first domain in a 5' to 3' orientation.

[0291] Once the 3' oligonucleotide is added by template switching, the 3' end oligonucleotide is used to hybridize with the spatially barcoded surface oligonucleotide, which is then extended to attach the spatial barcode to the first strand cDNA sequence. In one variation, the DNA is dC-tailed by reverse transcription and used as a capture sequence, hybridizing with the dG end sequence on the spatially barcoded substrate capture oligonucleotide.

[0292] In another variation of template switching, spatially barcoded oligonucleotides can be released on the substrate surface to serve as template switching primers ( Figure 4D , Fig.11 ). In this exemplary method, the 3' end oligonucleotide may comprise a substrate capture oligonucleotide complementary to the first domain of a substrate capture probe on a substrate, wherein each of the substrate capture probes comprises a substrate anchor sequence, a second handle, a spatial barcode, and a first domain in a 5' to 3' orientation. The surface capture probe is released from the substrate and used as a template switching primer, which can then be used to spatially barcode the first strand cDNA. Releasing the surface capture probe from the surface can be used to spatially address tissue mounted on a slide that does not have a capture oligonucleotide thereon.

[0293] Downstream library preparation steps on the ligated surface may include random priming of the second strand using random primers containing a P5 sequence or similar handle, ligation of a P5 adaptor, polyadenylation via TdT, followed by PCR to introduce the P5 adaptor, etc. The P5 end may also be introduced during RT extension using template switching. The SMI may also be introduced during library preparation via any of the above methods.

[0294] In another approach, random priming is performed from pulled-down RNA. RNA (e.g., mRNA) is bound downward to the substrate surface via hybridization between a blocked probe (e.g., containing a 3' phosphate) and a surface capture oligonucleotide anchored to the substrate (shown with the 5' as the free end of the hybridization, i.e., 5' fly, but could also be 3' fly) Figure 5A , Fig.12 ). The second barcoded oligonucleotide (5' anchor) is also adjacent to the substrate capture oligonucleotide on the substrate. The RNA capture oligonucleotide with a 3'OH-blocked probe hybridizes with the RNA in the tissue sample to form an RNA-RNA capture probe hybrid with a 5' single-stranded RNA region. The substrate capture oligonucleotide of the RNA-RNA capture probe hybridizes with the first domain of the substrate capture probe, and the 5' single-stranded RNA region of the RNA-RNA capture probe hybrid anneals with the random priming sequence of the barcoded substrate probe. RT is used to extend the random priming sequence hybridized with the 5' single-stranded RNA to form a spatially barcoded first-strand cDNA molecule.

[0295] As from Figure 5A As seen, barcoded oligonucleotides are used to randomly initiate RNA, thereby connecting spatial barcodes to RNA transcripts. The barcode oligonucleotide will also contain P7 or other adapters and barcode reading primer sites. The downstream library preparation step as described above will be used to produce the second chain cDNA. If the capture oligonucleotide is poly-T, random initiation of poly-A mRNA can also be performed. This will enable copying of segments of mRNA away from the 3' end of the poly-A tail (i.e., possibly in the coding region rather than in the 3' UTR). This is lacking in the standard poly-A capture spatial method.

[0296] Another variation of this approach has the capture oligonucleotide and barcode oligonucleotide linked via a linker that is not readable by the polymerase ( Figure 5B , Fig.13 The advantage of this approach is that more space is available on the substrate surface, allowing the use of higher complexity probe sets to pull down RNA in the sample.

[0297] Probe extension followed by ligation to surface-space barcoded oligonucleotides is also contemplated as a method herein ( Fig. 6A , Fig.14). In this method, an unblocked RNA capture probe comprising an RNA capture oligonucleotide complementary to the RNA in the sample and a substrate capture oligonucleotide complementary to the first domain of a plurality of substrate capture probes is used to bind RNA to a surface. The substrate capture probe may comprise a first domain and a first substrate anchor sequence in a 5' to 3' orientation, and be close to a barcoded substrate probe on a substrate, the barcoded substrate probe comprising a spatial barcode and a second substrate anchor sequence in a 5' to 3' orientation. RNA-RNA hybrids are also used to trigger RT. For example, an extension of the RNA capture oligonucleotide of the captured RNA-RNA capture probe hybrid is performed using RT to form a first-chain cDNA molecule. The first-chain cDNA is connected to the spatial barcode oligonucleotide. The difference between this method and the previous method is that a splint connection is not required because the concentration is enhanced by forcing localization to the connection target, and the P5 adapter can be introduced into the 5' attachment of the probe. Optionally, chemical connection can be performed using a 3' click nucleotide in the cDNA or via an oNTP incorporated at the 3' end, which acts as its own splint to connect to the barcode oligonucleotide. Other chemical ligation methods may also be used, such as using EDC or oNTP incorporation followed by 5'OH to 3' phosphorylation of the ligation.

[0298] Another permutation of this approach uses blocked RNA capture probes and 3' polyadenylation of the RNA (eg, using PAP) to enable poly A addition and extension ( Figure 6B , Fig.15 ). The barcode oligonucleotide may comprise a poly-T sequence bound to poly-A, and the capture oligonucleotide on the substrate may be, but is not necessarily, 5'-flying. The RNA capture probe oligonucleotide binds to the capture probe and facilitates the ligation of the extended RT to the barcode oligonucleotide on the substrate surface.

[0299] In another approach, we consider directly attaching RNA to surface-sterically barcoded oligonucleotides ( Figure 7 , Fig.16). In this method, an RNA capture probe having a hairpin structure and comprising a DNA capture oligonucleotide complementary to the RNA in the sample and a substrate capture oligonucleotide complementary to the first domain of the substrate capture probe is used. The DNA capture oligonucleotide comprises a single-stranded region, and each of the substrate capture probes may comprise a substrate anchor sequence, a spatial barcode, a first domain, and a second domain in a 5' to 3' orientation, wherein the second domain comprises at least one RNA nucleotide or nucleoside. An RNA-RNA capture probe hybrid is formed, and each of the RNA-RNA capture probe hybrids comprises a 5' single-stranded RNA terminal region. The 5' RNA may be connected to the 3' DNA using T4 ligase. The RNA-RNA capture probe hybrid is captured by the substrate capture oligonucleotide in the substrate capture probe. A probe that is also bound to a surface barcode oligonucleotide may be used to capture RNA. The hairpin probe may prevent excess probe from occupying surface sites, which would otherwise require more stringent washing or a surface capture oligonucleotide with a higher Tm. Next, the 5' single-stranded RNA may be 5' phosphorylated so that the 5' to 3' exoribonuclease is able to digest the overhanging RNA. For example, the digested 5' RNA terminal region of the captured RNA-RNA capture probe hybrid is connected to the second domain of the substrate capture probe of the DNA-RNA chimera using T4 ligase. The surface oligonucleotide can have several ribobases at the 3' end. The DNA-RNA chimera can be converted to DNA by reverse transcription using a DNA random primer that can also contain P5. 3' polyadenylation of the chimera can also be used to enable the use of poly-T priming. If performed on FFPE tissue, the RNA can be de-crosslinked. If the method is performed with fresh frozen tissue, the tissue is permeabilized to release the RNA.

[0300] It should be understood, therefore, that the invention is not limited to the particular embodiments disclosed, but is intended to cover modifications within the spirit and scope of the invention as defined in the appended claims, the foregoing description and / or shown in the accompanying drawings. Therefore, only such limitations as appear in the appended claims should be placed on the present disclosure.

Claims

1. A method for preparing an mRNA transcript expression library from a tissue sample, the method comprising: a) mounting the tissue sample on a substrate comprising a plurality of capture oligonucleotides, wherein the capture oligonucleotides comprise a first clustering sequence, a spatial barcode sequence (SBC), and a first universal adapter sequence; b) contacting the tissue sample with: i) a plurality of 5' gene-specific probes comprising a sequence complementary to the first universal adaptor sequence and a 5' gene-specific primer, under conditions such that one or more 5' gene-specific probes and one or more 3' gene-specific probes hybridize to one or more mRNA transcripts in the tissue sample; and ii) a plurality of 3' gene-specific probes comprising a 3' gene-specific primer, a unique molecular index, and a second universal adaptor sequence; c) contacting the tissue sample in (b) with a ligation reagent, so that the 5' gene-specific probe and the 3' gene-specific probe that are adjacent to each other and hybridized to the mRNA transcript are ligated together to form one or more ligated gene-specific probe pairs; d) removing the mRNA transcripts hybridized to the linked gene-specific probe pair and leaving behind the linked gene-specific probe pair oligonucleotide sequences; e) capturing the ligated gene-specific probe pair oligonucleotides of (d) on the substrate by binding the sequence complementary to the first universal adaptor sequence in the 5' gene-specific probe to the first universal adaptor sequence of the capture oligonucleotide.

2. A method for determining the expression of mRNA transcripts in a tissue sample, the method comprising a) mounting the tissue sample on a substrate comprising a plurality of capture oligonucleotides, wherein the capture oligonucleotides comprise a first clustering sequence, a spatial barcode sequence (SBC), and a first universal adapter sequence; b) contacting the tissue sample with: i) a plurality of 5' gene-specific probes comprising a sequence complementary to the first universal adaptor sequence and a 5' gene-specific primer; and ii) a plurality of 3' gene-specific probes comprising a 3' gene-specific primer, a unique molecular index and a second universal adaptor sequence, under conditions such that one or more 5' gene-specific probes and one or more 3' gene-specific probes hybridize to one or more mRNA transcripts in the tissue sample; c) contacting the tissue sample in (b) with a ligation reagent, so that the 5' gene-specific probe and the 3' gene-specific probe that are adjacent to each other and hybridized to the mRNA transcript are ligated together to form one or more ligated gene-specific probe pairs; d) removing the mRNA transcripts that hybridized to the linked gene-specific probe pair and leaving behind the linked gene-specific probe pair oligonucleotide sequences; e) capturing the ligated gene-specific probe pair oligonucleotides of (d) on the substrate by binding the sequence complementary to the first universal adaptor sequence in the 5' gene-specific probe to the first universal adaptor sequence of the capture oligonucleotide.

3. The method according to claim 1 or 2, wherein the 3' gene-specific probe comprises one or more ribobases.

4. A method for preparing an mRNA transcript expression library from a tissue sample, the method comprising: a) mounting the tissue sample on a substrate comprising a plurality of capture oligonucleotides, wherein the capture oligonucleotides comprise a first clustering sequence, a spatial barcode sequence (SBC), and a first universal adapter sequence; b) contacting the tissue sample with: i) a plurality of 5' gene-specific probes comprising a sequence complementary to the first universal adaptor sequence and a 5' gene-specific primer, under conditions such that one or more 5' gene-specific probes and one or more 3' gene-specific probes hybridize to one or more mRNA transcripts in the tissue sample; and ii) a plurality of 3' gene-specific probes comprising a 3' gene-specific primer, a unique molecular index, and a second universal adapter sequence, wherein hybridization of the 5' gene-specific probe and the 3' gene-specific probe on the mRNA transcript results in a nucleotide gap between the hybrid molecules; c) contacting the tissue sample in (b) with nucleotide bases and a ligation reagent, so that the nucleotide gap between the 5' gene-specific probe and the 3' gene-specific probe hybridized to the mRNA transcript is filled with a nucleotide base complementary to the mRNA transcript, and the 5' gene-specific probe and the 3' gene-specific probe are ligated together to form one or more ligated gene-specific probe pairs; d) removing the mRNA transcripts that hybridized to the linked gene-specific probe pair and leaving behind the linked gene-specific probe pair oligonucleotide sequences; e) capturing the ligated gene-specific probe pair oligonucleotide sequence of (d) on the substrate by binding the sequence complementary to the first universal adaptor sequence in the 5' gene-specific probe to the first universal adaptor sequence of the capture oligonucleotide.

5. A method for isolating mRNA transcript expression in a tissue sample, the method comprising a) mounting the tissue sample on a substrate comprising a plurality of capture oligonucleotides, wherein the capture oligonucleotides comprise a first clustering sequence, a spatial barcode sequence (SBC), and a first universal adapter sequence; b) contacting the tissue sample with: i) a plurality of 5' gene-specific probes comprising a sequence complementary to the first universal adaptor sequence and a 5' gene-specific primer; and ii) a plurality of 3' gene-specific probes comprising a 3' gene-specific primer, a unique molecular index, and a second universal adaptor sequence, under conditions such that the one or more 5' gene-specific probes and the one or more 3' gene-specific probes hybridize to one or more mRNA transcripts in the tissue sample, wherein hybridization of the one or more 5' gene-specific probes and the one or more 3' gene-specific probes on the mRNA transcript results in a nucleotide gap between the hybrid molecules; c) contacting the tissue sample in (b) with nucleotide bases and a ligation reagent, so that the nucleotide gap between the 5' gene-specific probe and the 3' gene-specific probe hybridized to the mRNA transcript is filled with a nucleotide base complementary to the mRNA transcript, and the 5' gene-specific probe and the 3' gene-specific probe are ligated together to form one or more ligated gene-specific probe pairs; d) removing the mRNA transcripts hybridized to the linked gene-specific probe pair and leaving the linked gene-specific probe pair oligonucleotide sequences; e) capturing the ligated gene-specific probe pair oligonucleotide sequence of (d) on the substrate by binding the sequence complementary to the first universal adaptor sequence in the 5' gene-specific probe to the first universal adaptor sequence of the capture oligonucleotide. The method according to claim 4 or 5 , wherein the nucleotide gap is 1 to 50 or more nucleotides.

7. The method according to any one of claims 1 to 6, further comprising indexing and sequencing the ligated gene-specific probe pairs, comprising: f) performing an extension reaction and PCR on the oligonucleotides of (e) to generate a PCR template representing one or more RNA transcripts in the tissue sample; g) eluting the PCR template; h) performing index PCR to generate a double-stranded PCR product comprising a first-strand PCR product and a second-strand complementary to the first-strand PCR product.

8. The method according to claim 7, further comprising sequencing the PCR product of (h), and determining the location of the mRNA transcript in the tissue based on the spatial barcode of (a).

9. The method of claim 7 or 8, wherein the double-stranded PCR product comprises a second clustering sequence on the second strand that is complementary to the first-strand PCR product, and optionally comprises an index sequence.

10. The method according to any one of claims 1 to 9, wherein the 5' gene-specific probe and / or the 3' gene-specific probe is 10 to 50 nucleotides.

11. The method according to any one of claims 1 to 10, wherein the first cluster sequence comprises a P7 sequence.

12. The method of any one of claims 1 to 11, wherein the first universal adaptor sequence comprises GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO: 19).

13. The method of any one of claims 1 to 12, wherein the second universal adaptor sequence comprises AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTG (SEQ ID NO: 20).

14. The method according to any one of claims 1 to 13, wherein the 5' gene-specific probe and / or the 3' gene-specific probe has a melting temperature (Tm) of about 50°C to 55°C.

15. The method of any one of claims 1 to 14, wherein the capture oligonucleotide has a melting temperature (Tm) of about 40°C to 42°C.

16. The process of any one of claims 1 to 15, wherein step (b) is performed at about 50°C to 55°C.

17. The method of any one of claims 1 to 16, wherein step (e) is performed at about 40°C to 42°C.

18. A method according to any one of claims 1 to 17, wherein contacting the tissue sample with the substrate associates the position of a capture site on the substrate with a position in the tissue sample, wherein the substrate comprises a plurality of capture sites, the plurality of capture sites comprising a plurality of capture probes immobilized on a surface, wherein the capture probes comprise spatial address regions.

19. The method according to any one of claims 1 to 18, wherein the sample is from a mammal.

20. The method according to any one of claims 1 to 19, wherein the sample is from a human.

21. The method of any one of claims 1 to 20, wherein the tissue sample is a tumor biopsy.

22. The method of any one of claims 1 to 21, wherein the tissue sample is formalin-fixed paraffin-embedded (FFPE) tissue or fresh frozen (FF) tissue.

23. A method of identifying a genetic variation in a subject having a disease or at risk of having a disease, the method comprising: i) the method according to any one of claims 1 to 21, generating a sample mRNA library from a tissue sample from the subject, i) comparing the genetic information from the sample mRNA library with a control mRNA library, and iii) identifying genetic variations in the sample mRNA library that are associated with the disease.

24. The method of claim 23, wherein the disease is a genetic defect, cancer, an autoimmune disease, or a metabolic disorder.

25. The method of claim 23 or 24, wherein the disease is cancer.

26. A method for preparing a spatially barcoded RNA library from a tissue sample, the method comprising: (a) contacting the tissue sample with a plurality of RNA capture probes that hybridize to RNA in the tissue sample, wherein each of the RNA capture probes comprises an RNA capture oligonucleotide sequence that is complementary to RNA in the sample and a first substrate capture oligonucleotide that is complementary to a first domain of a plurality of splint oligonucleotides; (b) hybridizing the RNA capture oligonucleotide of the RNA capture probe with RNA in the tissue sample to form an RNA-RNA capture probe hybrid; (c) extending the RNA capture oligonucleotide of the RNA-RNA capture probe hybrid using a reverse transcriptase to form a plurality of first-strand cDNA molecules, wherein each of the first-strand cDNA molecules comprises the RNA capture oligonucleotide and the first substrate capture oligonucleotide; (d) capturing the first strand cDNA molecule on a substrate, wherein the substrate comprises a plurality of substrate capture probes, each substrate capture probe comprising a spatial barcode and a second substrate capture oligonucleotide complementary to the second domain of the splint oligonucleotide, and wherein the capturing comprises hybridizing the splint oligonucleotide to the first substrate capture oligonucleotide of the first strand cDNA molecule and the second substrate capture oligonucleotide of the substrate capture probe; as well as (e) connecting the captured first-strand cDNA molecules to the substrate capture probes to form spatially barcoded first-strand cDNA molecules.

27. The method of claim 26, wherein the substrate capture probe further comprises a substrate anchoring moiety.

28. The method of claim 26 or 27, wherein the surface oligonucleotide further comprises a P7 adaptor and an RNA capture probe primer for reading the spatial barcode sequence.

29. A method for preparing a spatially barcoded RNA library from a tissue sample, the method comprising: (a) contacting the tissue sample with a plurality of RNA capture probes that hybridize to RNA in the tissue sample, wherein the RNA capture probes comprise RNA capture oligonucleotides that are complementary to RNA in the sample and a handle sequence; (b) hybridizing the RNA capture oligonucleotide of the RNA capture probe with RNA in the tissue sample to form an RNA-RNA capture probe hybrid; (c) extending the RNA capture oligonucleotide of the RNA-RNA capture probe hybrid using a reverse transcriptase to form a plurality of first-strand cDNA molecules, wherein each of the first-strand cDNA molecules comprises the RNA capture oligonucleotide and the handle sequence; (d) adding a 3' end oligonucleotide to the 3' end of each first strand cDNA molecule, wherein the 3' end oligonucleotide comprises a substrate capture oligonucleotide complementary to a first domain of a plurality of substrate capture probes on a substrate, wherein each substrate capture probe of the plurality of substrate capture probes comprises a substrate anchor sequence, a spatial barcode and the first domain in a 5' to 3' orientation; (e) hybridizing the substrate capture oligonucleotide of the first strand cDNA molecule to the first domain of the substrate capture probe; as well as (f) extending the first domain of the hybridized substrate capture probe to form a plurality of spatially barcoded first-strand cDNA molecules.

30. The method of claim 29, wherein the handle sequence is a PCR handle sequence, a molecular identifier, a UMI, or any combination thereof.

31. The method of claim 29 or 30, wherein the handle sequence is a P5 adaptor sequence.

32. The method of any one of claims 29 to 31 , wherein the 3' terminal oligonucleotide is added by tagmentation.

33. The method of any one of claims 29 to 32, wherein the 3' end oligonucleotide is added by click chemistry or oNTP directed adapter.

34. The method of claim 33, wherein the 3' OH is added by terminating the extension reaction with a click-labeled nucleotide.

35. The method of claim 34, wherein the click-labeled nucleotide is an azide- or alkyne-labeled oligonucleotide.

36. The method of claim 34 or 35, wherein the extension reaction adds a poly A sequence to the 3' extended sequence.

37. The method of any one of claims 29 to 36, wherein the first strand cDNA is captured using a poly-T sequence on the surface capture oligonucleotide.

38. A method for preparing a spatially barcoded RNA library from a tissue sample, the method comprising: (a) contacting the tissue sample with a plurality of RNA capture probes that hybridize to RNA in the tissue sample, wherein the RNA capture probes comprise RNA capture oligonucleotides that are complementary to RNA in the sample and a handle sequence; (b) hybridizing the RNA capture oligonucleotide of the RNA capture probe with RNA in the tissue sample to form an RNA-RNA capture probe hybrid; (c) extending the RNA capture oligonucleotide of the RNA-RNA capture probe hybrid using a reverse transcriptase to form a plurality of first-strand cDNA molecules, wherein each of the first-strand cDNA molecules comprises the RNA capture oligonucleotide and the handle sequence; (d) adding a 3' terminal oligonucleotide to the 3' end of each first strand cDNA molecule via template switching, comprising contacting the first strand cDNA molecule with a reverse transcriptase (RT) and a template switching oligonucleotide (TSO), wherein the RT incorporates an untemplated cytosine nucleotide at the 3' end of the first cDNA, and the TSO comprises a sequence capable of hybridizing to the untemplated cytosine nucleotide, wherein the 3' terminal oligonucleotide is appended to the 3' end of the first cDNA, and the RT is extended to produce the complement of the TSO; wherein the 3' end oligonucleotide comprises a substrate capture oligonucleotide complementary to a first domain of a plurality of substrate capture probes on a substrate, wherein each substrate capture probe of the plurality of substrate capture probes comprises a substrate anchor sequence, a spatial barcode, and the first domain in a 5' to 3' orientation; (e) hybridizing the substrate capture oligonucleotide of the first strand cDNA molecule to the first domain of the substrate capture probe; as well as (f) extending the first domain of the hybridized substrate capture probe to form a plurality of spatially barcoded first-strand cDNA molecules.

39. The method of claim 38, wherein the first domain is a poly-T sequence.

40. A method for preparing a spatially barcoded RNA library from a tissue sample, the method comprising: (a) contacting the tissue sample with a plurality of RNA capture probes that hybridize to RNA in the tissue sample, wherein the RNA capture probes comprise RNA capture oligonucleotides that are complementary to RNA in the sample and a handle sequence; (b) hybridizing the RNA capture oligonucleotide of the RNA capture probe with RNA in the tissue sample to form an RNA-RNA capture probe hybrid; (c) extending the RNA capture oligonucleotide of the RNA-RNA capture probe hybrid using a reverse transcriptase to form a plurality of first-strand cDNA molecules, wherein each of the first-strand cDNA molecules comprises the RNA capture oligonucleotide and the handle sequence; (d) adding a 3' terminal oligonucleotide to the 3' end of each first strand cDNA molecule via template switching, comprising contacting the first strand cDNA molecule with a reverse transcriptase (RT) and a template switching oligonucleotide (TSO), wherein the RT incorporates an untemplated cytosine nucleotide at the 3' end of the first cDNA, and the TSO comprises a sequence capable of hybridizing to the untemplated cytosine nucleotide, wherein the 3' terminal oligonucleotide is appended to the 3' end of the first cDNA, and the RT is extended to produce the complement of the TSO; wherein the 3' end oligonucleotide comprises a substrate capture oligonucleotide complementary to a first domain of a plurality of substrate capture probes on a substrate, wherein each substrate capture probe of the plurality of substrate capture probes comprises a substrate anchor sequence, a second handle, a spatial barcode, and the first domain in a 5' to 3' orientation; (e) releasing the substrate capture probe from the substrate; (f) hybridizing the substrate capture oligonucleotide of the first strand cDNA molecule to the first domain of the substrate capture probe; as well as (g) contacting the first strand with a second strand synthesis mixture comprising a TSO primer, and extending the TSO primer using the first strand as a template to generate a second strand complementary to the first strand, wherein the second strand comprises the TSO, a second cDNA complementary to the first cDNA, and second strand barcode information comprising a spatial barcode sequence complement (SBC') complementary to the spatial barcode sequence (SBC).

41. The method of claim 40, wherein the first domain is a poly-G sequence that hybridizes to the poly-C sequence on the TSO.

42. The method of claim 40 or 41, wherein the handle is a P5 sequence and the second handle is a P7 sequence.

43. A method for preparing a spatially barcoded RNA library from a tissue sample, the method comprising: (a) contacting the tissue sample with a plurality of RNA capture probes that bind to RNA in the tissue sample, wherein each of the RNA capture probes comprises an RNA capture oligonucleotide complementary to RNA in the sample and a substrate capture oligonucleotide complementary to a first domain of a plurality of substrate capture probes on a substrate, wherein the RNA capture oligonucleotide complementary to the RNA is blocked at the 3' end; wherein each of the substrate capture probes comprises the first domain and a first substrate anchor sequence in a 5' to 3' orientation and is adjacent to one or more barcoded substrate probes on the substrate, and wherein each of the barcoded substrate probes comprises a second substrate anchor sequence, a spatial barcode, and a random priming sequence in a 5' to 3' orientation; (b) hybridizing the RNA capture oligonucleotide of the RNA capture probe with RNA in the tissue sample to form an RNA-RNA capture probe hybrid having a 5' single-stranded RNA region; (c) hybridizing the substrate capture oligonucleotide of the RNA-RNA capture probe hybrid to the first domain of the substrate capture probe; (d) hybridizing the 5' single-stranded RNA region of the RNA-RNA capture probe hybrid to the random priming sequence of the barcoded substrate probe; and (e) extending the random priming sequence hybridized to the 5' single-stranded RNA region using a reverse transcriptase to form a plurality of spatially barcoded first-strand cDNA molecules.

44. The method of claim 43, wherein the nucleotide sequence complementary to the RNA in the sample is a poly-T oligonucleotide, a random oligonucleotide, a semi-random oligonucleotide, or a target-specific sequence.

45. The method of claim 43 or 44, wherein the nucleotide sequence complementary to RNA in the sample is a poly-T oligonucleotide.

46. ​​The method of claim 43, wherein the RNA is removed from the sample.

47. The method of claim 46, wherein RNA is removed from the sample after extension to form first strand cDNA.

48. The method of claim 47, wherein the RNA is removed enzymatically or thermally.

49. A method for preparing a spatially barcoded RNA library from a tissue sample, the method comprising: (a) contacting the tissue sample with a plurality of RNA capture probes that hybridize to RNA in the tissue sample, wherein each of the RNA capture probes comprises an RNA capture oligonucleotide complementary to RNA in the sample and a substrate capture oligonucleotide complementary to a first domain of a plurality of substrate capture probes on a substrate, wherein each of the substrate capture probes comprises a substrate anchor sequence, the first domain, a linker, a spatial barcode, and a random priming sequence in a 5' to 3' orientation; (b) hybridizing the RNA capture probe with the RNA in the tissue sample to form an RNA-RNA capture probe hybrid having a 5' single-stranded RNA region; (c) hybridizing the substrate capture oligonucleotide of the RNA-RNA capture probe hybrid to the first domain of the substrate capture probe; (d) hybridizing the 5' single-stranded RNA region of the RNA-RNA capture probe hybrid to the random priming sequence of the substrate capture probe; and (e) extending the random priming sequence hybridized to the 5' single-stranded RNA region using a reverse transcriptase to form a plurality of spatially barcoded first-strand cDNA molecules.

50. The method of claim 49, wherein the linker is a linker that is not readable by a polymerase.

51. A method for preparing a spatially barcoded RNA library from a tissue sample, the method comprising: (a) contacting the tissue sample with a plurality of RNA capture probes that bind to RNA in the tissue sample, wherein each of the RNA capture probes comprises an RNA capture oligonucleotide complementary to RNA in the sample and a substrate capture oligonucleotide complementary to a first domain of a plurality of substrate capture probes on a substrate; wherein each of the substrate capture probes comprises the first domain and a first substrate anchor sequence in a 5' to 3' orientation and is adjacent to at least one barcoded substrate probe of a plurality of barcoded substrate probes on the substrate, and wherein each barcoded substrate probe comprises a spatial barcode and a second substrate anchor sequence in a 5' to 3' orientation; (b) hybridizing the RNA capture oligonucleotide of the RNA capture probe with RNA in the tissue sample to form an RNA-RNA capture probe hybrid; (c) capturing the RNA-RNA capture probe hybrid on the substrate by hybridizing the substrate capture oligonucleotide of the RNA-RNA capture probe hybrid to the first domain of the substrate capture probe; (d) extending the RNA capture oligonucleotide of the captured RNA-RNA capture probe hybrid using a reverse transcriptase to form a plurality of first-strand cDNA molecules; as well as (e) ligating each of the first-strand cDNA molecules to the proximal barcoded base probe to form spatially barcoded first-strand cDNA molecules.

52. A method for preparing a spatially barcoded RNA library from a tissue sample, the method comprising: (a) contacting the tissue sample with a plurality of RNA capture probes that bind to RNA in the tissue sample, wherein each of the RNA capture probes comprises an RNA capture oligonucleotide complementary to the RNA in the sample and a substrate capture oligonucleotide complementary to a first domain of a plurality of substrate capture probes on a substrate, wherein the RNA capture oligonucleotide complementary to the RNA is blocked at the 3' end; wherein each of the substrate capture probes comprises the first domain and a first substrate anchor sequence in a 5' to 3' orientation and is adjacent to at least one barcoded substrate probe of a plurality of barcoded substrate probes on the substrate, and wherein each barcoded substrate probe comprises a poly-T sequence, a spatial barcode, and a second substrate anchor sequence in a 5' to 3' orientation; (b) hybridizing the RNA capture oligonucleotide of the RNA capture probe with RNA in the tissue sample to form an RNA-RNA capture probe hybrid; (c) capturing the RNA-RNA capture probe hybrid on the substrate by hybridizing the substrate capture oligonucleotide of the RNA-RNA capture probe hybrid to the first domain of the substrate capture probe; (d) polyadenylation of the RNA in the sample at the 3' end; as well as (e) Extending the RNA capture oligonucleotide of the captured RNA-RNA capture probe hybrid using a reverse transcriptase to form a plurality of first-strand cDNA molecules.

53. The method of claim 52, wherein the polyadenylation is performed using poly A polymerase.

54. A method for preparing a spatially barcoded RNA library from a tissue sample, the method comprising: (a) contacting the tissue sample with a plurality of RNA capture probes that hybridize to RNA in the tissue sample, wherein each of the RNA capture probes has a hairpin structure and comprises a DNA capture oligonucleotide complementary to the RNA in the sample and a substrate capture oligonucleotide complementary to a first domain of a plurality of substrate capture probes on a substrate, wherein the DNA capture oligonucleotides of the RNA capture probes comprise a single-stranded region, and wherein each of the substrate capture probes comprises a substrate anchor sequence, a spatial barcode, the first domain, and a second domain in a 5' to 3' orientation, wherein the second domain comprises at least one RNA nucleotide or nucleoside; (b) hybridizing the RNA capture probe to the RNA in the tissue sample to form RNA-RNA capture probe hybrids, wherein each of the RNA-RNA capture probe hybrids comprises a 5' single-stranded RNA terminal region; (c) capturing the substrate capture oligonucleotide of the RNA-RNA capture probe hybrid on the substrate by hybridizing the substrate capture oligonucleotide of the RNA-RNA capture probe hybrid to the first domain of the substrate capture probe; (d) phosphorylating the 5' single-stranded RNA terminal region of the captured RNA-RNA capture probe hybrid, and contacting the captured RNA-RNA capture probe hybrid with a 5' to 3' exoribonuclease to digest the phosphorylated 5' single-stranded RNA terminal region; and (e) ligating the digested 5' RNA terminal region of the captured RNA-RNA capture probe hybrid to the second domain of the substrate capture probe to form a plurality of DNA-RNA chimeras on the substrate.

55. The method of claim 54, wherein the ligation is performed using T4 ligase.

56. The method of claim 54, wherein the RNA of the captured RNA-RNA capture probe hybrid is 5' phosphorylated prior to ligation.

57. The method of claim 56, further comprising generating first-strand cDNA from the plurality of DNA-RNA chimeras on the substrate.

58. The method of claim 57, wherein the first strand cDNA can be hybridized from the surface and processed for sequencing.

59. The method according to any one of claims 54 to 58, wherein reverse transcription is performed using DNA random primers optionally comprising a P5 adaptor.

60. The method of any one of claims 26 to 59, wherein the cDNA extension template can be dehybridized from the RNA in the tissue by chemical, enzymatic or thermal dehybridization.

61. The method of any one of claims 29 to 59, wherein the cDNA extension template can be dehybridized from the RNA on a substrate by chemical, enzymatic or thermal dehybridization.

62. The method of claim 60 or 61, wherein the dehybridization step is performed before or after the capture step.

63. The method of any one of claims 26 to 62, wherein the tissue sample is formalin-fixed paraffin-embedded (FFPE) tissue or fresh frozen (FF) tissue.

64. The method of claim 63, further comprising decrosslinking the FFPE sample, optionally wherein the decrosslinking is performed using TE buffer at pH 9.

65. The method of any one of claims 26 to 64, wherein the RNA capture probe is selected from the group consisting of a poly-T sequence, a poly-U sequence, a random oligonucleotide, a semi-random sequence, or a target-specific probe.

66. The method of claim 65, wherein the RNA capture probe is a poly-T sequence.

67. The method of claim 65 or 66, wherein the RNA capture probe comprises at least 10 deoxythymidine residues.

68. The method of claim 67, wherein the target-specific probe comprises a plurality of different target-specific RNA capture probe sequences.

69. The method of claim 68, wherein the target-specific probe comprises at least 10 nucleotides that are complementary to a nucleotide sequence of a target RNA.

70. The method of claim 68 or 69, wherein the RNA capture probe or surface capture probe is 8 to 80 nucleotides.

71. The method of any one of claims 26 to 70, wherein the targeting probe is 8 to 80 nucleotides or 10 to 50 nucleotides.

72. The method of any one of claims 26 to 71, wherein the tissue sample is permeabilized prior to contacting the tissue sample with a plurality of RNA capture probes.

73. The method of any one of claims 26 to 72, wherein the tissue sample is treated with one or more blocking reagents prior to contacting the tissue sample with a plurality of RNA capture probes.

74. The method of any one of claims 26 to 73, wherein the tissue sample is permeabilized and treated with one or more blocking reagents prior to contacting the tissue sample with a plurality of RNA capture probes.

75. The method of any one of claims 26 to 74, wherein the substrate is a bead, a bead array, a spotted array, a substrate comprising a plurality of wells, a flow cell, aggregated particles arranged on a chip surface, a membrane or a plate.

76. The method of claim 75, wherein the substrate comprises a plurality of nanopores or micropores.

77. A method according to any one of claims 26 to 76, wherein the spatially barcoded first-strand cDNA molecule is recovered by contacting the spatially barcoded first-strand cDNA on the substrate with a DNA polymerase and one or more primers to produce a spatially barcoded second-strand cDNA that is complementary to the spatially barcoded first-strand cDNA and removing the spatially barcoded second-strand cDNA from the substrate.

78. The method of claim 77, wherein the one or more primers each comprise a random priming sequence.

79. The method of claim 78, wherein the random priming sequence comprises nine random nucleotides.

80. The method of claim 78 or 79, wherein the spatially barcoded second strand cDNAs each comprise a unique molecular identifier (UMI), wherein the UMI comprises an intrinsic sequence and an extrinsic sequence, wherein the extrinsic sequence is a sequence complementary to the random priming sequence used to generate the second strand cDNA, and wherein the intrinsic sequence is a sequence complementary to the first strand cDNA template sequence used to generate the second strand cDNA.

81. The method of claim 77, wherein each of the one or more primers comprises a molecular identifier barcode.

82. The method of claim 77, wherein the one or more primers each comprise a UMI barcode.

83. The method of any one of claims 77 to 82, wherein the spatially barcoded second strand cDNA is removed from the substrate by chemical or physical dehybridization.

84. The method of any one of claims 77 to 83, wherein the anchor sequence comprises a cleavage site and the hybrid of the spatially barcoded first-strand cDNA and the spatially barcoded second-strand cDNA is removed from the substrate by enzymatic cleavage at the cleavage site.

85. The method of claim 84, wherein the cleavage site is a binding site for a restriction endonuclease.

86. The method of claim 84, wherein the anchor sequence comprises a cleavage site, and wherein the spatially barcoded first-strand cDNA molecule is recovered by enzymatic cleavage at the cleavage site.

87. The method of claim 86, wherein the cleavage site is a binding site for a restriction endonuclease.

88. The method of any one of claims 77 to 87, further comprising sequencing at least a portion of the cDNA library to determine the spatial barcode sequence of each molecule.

89. The method according to claim 88 further includes determining the spatial position of the one or more cDNA molecules by associating the spatial barcode sequence of the one or more cDNA molecules with the spatial position of the surface oligonucleotide molecules on the substrate containing the corresponding spatial barcode sequence.

90. The method of any one of claims 26 to 89, further comprising indexing and sequencing the spatially barcoded first strand cDNA, comprising: performing an extension reaction and PCR on the spatially barcoded first-strand cDNA to generate a PCR template comprising a first-strand PCR product representing one or more RNA transcripts in the tissue sample; eluting the PCR template; Index PCR is performed to generate a double-stranded PCR product comprising the first-strand PCR product and a second strand complementary to the first-strand PCR product.

91. The method of claim 90, further comprising sequencing the PCR product and determining the location of the RNA transcript in the tissue based on the spatial barcode of the first strand cDNA.

92. The method of claim 90 or 91, wherein the double-stranded PCR product comprises a second clustering sequence on the second strand that is complementary to the first-strand PCR product, and optionally comprises an index sequence.

93. The method of claim 91 or 92, wherein the PCR products are further processed by tagmentation to generate a spatial transcriptomics library.

94. The method of claim 93, wherein the labeling comprises labeling on a substrate.

95. The method of any one of claims 26 to 94, wherein the method uses the tissue sample to determine RNA expression in a single cell.

96. The method of claim 95, wherein the method determines RNA expression in one or more subcellular fractions in the single cell.

97. The method of claim 96, wherein the subcellular component is the nucleus, cytoplasm, or mitochondria.

98. A method according to any of the preceding claims, wherein the substrate or the surface of the substrate comprises a material selected from glass, silicon, poly-L-lysine coated material, nitrocellulose, polystyrene, cyclic olefin copolymer (COC), cyclic olefin polymer (COP), polyacrylamide, polypropylene, polyethylene or polycarbonate.

99. The method of any one of claims 26 to 98, wherein the RNA library is an mRNA library.

Images