A highly active S-sulfo-L-cysteine ​​synthetase mutant and its application

By screening and modifying the highly active S-sulfo-L-cysteine ​​synthetase mutant SSC03-S256PΔCT, the problem of insufficient enzyme activity was solved, efficient production of S-sulfo-L-cysteine ​​was achieved, production costs were reduced, and the needs of industrial applications were met.

CN119592536BActive Publication Date: 2025-09-26SHENZHEN READLINE BIOTECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411868535.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-17
Publication Date
2025-09-26
Estimated Expiration
2044-12-17

AI Technical Summary

Technical Problem

The existing S-sulfo-L-cysteine ​​synthetase mtCysK2 has a low enzyme kinetic parameter Kcat/Km, which cannot meet the requirements of industrial catalysis. In addition, the market price of S-sulfo-L-cysteine ​​sodium salt is high, which hinders its application in the field of cell culture media.

Method used

A highly active S-sulfo-L-cysteine ​​synthetase mutant was obtained by screening and modification. Through cluster analysis and phylogenetic analysis, the mutant SSC03-S256PΔCT was designed to improve its catalytic efficiency. The conversion rate of S-sulfo-L-cysteine ​​reached 56%, meeting industrial production needs.

Benefits of technology

Efficient production of S-sulfo-L-cysteine ​​was achieved. The mutant SSC03-S256PΔCT produced 84 mM S-sulfo-L-cysteine ​​within 24 hours, meeting the needs of industrial production and reducing production costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005196269520000071
    Figure BDA0005196269520000071
  • Figure BDA0005196269520000072
    Figure BDA0005196269520000072
  • Figure BDA0005196269520000073
    Figure BDA0005196269520000073
Patent Text Reader

Abstract

The present invention relates to the field of biotechnology, and more particularly to a highly active S-sulfo-L-cysteine ​​synthetase mutant and its applications. The present invention screened and identified a preferred SSC03 enzyme through cluster analysis and phylogenetic analysis, and further engineered mutations thereof. The resulting SSC03-S256PΔCT achieved a 24-hour conversion rate of 56% and produced 84 mM of S-sulfo-L-cysteine, demonstrating its applicability to further purification process development.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to a highly active S-sulfo-L-cysteine ​​synthetase mutant and application thereof. Background Art

[0002] Mammalian cell cultures, such as Chinese hamster ovary (CHO) and human embryonic kidney (HEK293) cells, are widely used for the recombinant expression of therapeutic proteins and monoclonal antibodies. To grow cells to high densities and maximize recombinant protein production, nutrient feeds are required during fermentation. Because L-tyrosine and L-cysteine ​​require high pH for solubility, the typical feed system involves a single alkaline feed containing L-tyrosine and L-cysteine, which presents challenges in scaling up the fermentation process. The newly modified amino acids phospho-L-tyrosine disodium salt and S-sulfo-L-cysteine ​​sodium salt have high solubility at neutral pH and can replace L-tyrosine and L-cysteine ​​to produce high-concentration neutral feeds. This can prevent cell damage caused by the local alkaline environment and the exothermic heat of acid-base neutralization, and reduce the complexity of feed preparation and fed-batch processes (Zimmer, A., Mueller, R., Wehsling, M., Schnellbaecher, A., & Von Hagen, J. (2014). Improvement and simplification of fed-batch bioprocesses with a highly soluble phosphotyrosine sodium salt. Journal of Biotechnology, 186, 110–118. https: / / doi.org / 10.1016 / j.jbiotec.2014.06.026; Hecklau, C., Pering, S., Seibel, R., Schnellbaecher, A., Wehsling, M., Eichhorn, T., Hagen, JV, & Zimmer, A. (2016). S-Sulfocysteine simplifies fed-batch processes and increases the CHO specific productivity via anti-oxidant activity. Journal of Biotechnology, 218, 53–63. https: / / doi.org / 10.1016 / j.jbiotec.2015.11.022).

[0003] S-sulfo-L-cysteine ​​sodium salt has a complex chemical synthesis process and a market price of up to 9,000 yuan / kg, which hinders its application in the field of cell culture. In 2010, researchers from the Institute of Plant Biochemistry and Photosynthesis in Spain discovered that S-sulfo-L-cysteine ​​synthase atCS26 in Arabidopsis thaliana synthesizes S-sulfo-L-cysteine ​​using O-acetylserine (OAS) and thiosulfate as substrates (Bermúdez, MA, Páez-Ochoa, MA, Gotor, C., & Romero, LC (2010). Arabidopsis S-Sulfocysteine ​​Synthase Activity Is Essential for Chloroplast Function and Long-Day Light-Dependent Redox Control. The Plant Cell, 22(2), 403–416. https: / / doi.org / 10.1105 / tpc.109.071985), but O-acetylserine is not easy to obtain. In 2014, researchers at the Karolinska Institute in Sweden discovered the S-sulfo-L-cysteine ​​synthetase mtCysK2 (Steiner, EM, D., P., Vilaplana, F., Schnell, R., & Schneider, G. (2014). CysK2 from Mycobacterium tuberculosis Is an O-Phospho-l-Serine-Dependent S-Sulfocysteine ​​Synthase. Journal of Bacteriology, 196(19), 3410–3420. https: / / doi.org / 10.1128 / JB.01851-14). Figure 1 shown.

[0004] The mtCysK2 enzyme from Mycobacterium tuberculosis is the only reported S-sulfo-L-cysteine ​​synthetase that uses O-phosphoserine as a substrate, but its enzyme kinetic parameter K cat / K m (OPS)=0.84mM -1 s -1The yield is relatively low and cannot meet the requirements of industrial catalysis (Steiner et al., 2014). Summary of the Invention

[0005] In view of this, the present invention provides a highly active S-sulfo-L-cysteine ​​synthetase mutant and its application, aiming to screen and transform a highly active S-sulfo-L-cysteine ​​synthetase for synthesizing S-sulfo-L-cysteine ​​(SSC).

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides a mutant of S-sulfo-L-cysteine ​​synthetase having:

[0008] (1), the amino acid sequence shown in SEQ ID NO: 9, SEQ ID NO: 11 or SEQ ID NO: 13; or

[0009] (2) an amino acid sequence obtained by substituting, deleting or adding one or more residues of the amino acid sequence shown in (1), and having the same or similar function as (1); or

[0010] (3) an amino acid sequence having at least 90% homology to the amino acid sequence shown in (1) or (2);

[0011] The plurality is 2 to 5.

[0012] The present invention also provides a nucleic acid molecule encoding the mutant.

[0013] In some specific embodiments of the present invention, the nucleic acid molecule has:

[0014] (4) the nucleotide sequence shown in SEQ ID NO: 10, SEQ ID NO: 12 or SEQ ID NO: 14; or

[0015] (5) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (4), and having the same or similar function as (4); or

[0016] (6) a nucleotide sequence having at least 90% homology to the nucleotide sequence shown in (4) or (5);

[0017] The number is 2 to 15.

[0018] The present invention also provides an expression vector comprising the above nucleic acid molecule.

[0019] In some specific embodiments of the present invention, the backbone of the above-mentioned expression vector is a prokaryotic expression vector or a eukaryotic expression vector;

[0020] The prokaryotic expression vector may be an Escherichia coli expression vector.

[0021] The present invention also provides a host cell, which comprises the above nucleic acid molecule or the above expression vector.

[0022] In some specific embodiments of the present invention, the host cell can be a prokaryotic organism or a eukaryotic organism;

[0023] The prokaryotic organism may be Escherichia coli.

[0024] The present invention also provides use of S-sulfo-L-cysteine ​​synthetase with UniProt ID A0A7U5MJ26 in the preparation of S-sulfo-L-cysteine.

[0025] In some specific embodiments of the present invention, the nucleotide sequence encoding the S-sulfo-L-cysteine ​​synthetase is:

[0026] (10), the nucleotide sequence shown in SEQ ID NO: 3; or

[0027] (11) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (10), and having the same or similar function as (10); or

[0028] (12) A nucleotide sequence having at least 90% homology to the nucleotide sequence shown in (10) or (11);

[0029] The number is 2 to 15.

[0030] The present invention also provides the use of the mutant in preparing S-sulfo-L-cysteine.

[0031] The present invention also provides the use of the nucleic acid molecule in preparing S-sulfo-L-cysteine.

[0032] The present invention also provides the use of the above expression vector in the preparation of S-sulfo-L-cysteine.

[0033] The present invention also provides use of the host cell in preparing S-sulfo-L-cysteine.

[0034] The present invention also provides a method for preparing S-sulfo-L-cysteine, which comprises: mixing a substrate with the mutant, reacting the mixture, and obtaining S-sulfo-L-cysteine.

[0035] The present invention also provides a method for preparing S-sulfo-L-cysteine, which comprises: expressing the nucleic acid molecule to obtain an expression product, mixing the expression product with a substrate, reacting the mixture, and obtaining S-sulfo-L-cysteine.

[0036] The present invention also provides a method for preparing S-sulfo-L-cysteine, which comprises: expressing the above expression vector, mixing the expression product with a substrate, and reacting to obtain S-sulfo-L-cysteine.

[0037] The present invention also provides a method for preparing S-sulfo-L-cysteine, which comprises: culturing the host cell, mixing the culture product with a substrate, and reacting the mixture to obtain S-sulfo-L-cysteine.

[0038] The present invention also provides a method for preparing S-sulfo-L-cysteine, which comprises: mixing a substrate with the S-sulfo-L-cysteine ​​synthetase in the application, reacting the mixture, and obtaining S-sulfo-L-cysteine.

[0039] In some specific embodiments of the present invention, the substrate of the above method comprises O-phosphoserine and / or sodium thiosulfate.

[0040] The highly active S-sulfo-L-cysteine ​​synthetase mutant of the present invention and its application have the following effects:

[0041] The present invention screened for highly effective S-sulfo-L-cysteine ​​synthetases through cluster and phylogenetic analysis. Surprisingly, the SSC03 enzyme exhibited significantly higher product concentrations within 7 hours. To better meet industrial production requirements, further mutational engineering and construction were performed. The resulting SSC03-S256PΔCT enzyme achieved a 56% conversion rate within 24 hours, producing 84 mM of S-sulfo-L-cysteine, which can be used for further purification process development. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for describing the embodiments or the prior art.

[0043] Figure 1 The reaction formula of S-sulfo-L-cysteine ​​synthetase CS26 and CysK2 is shown;

[0044] Figure 2 Threshold 10 -152 Sequence similarity network diagram (yellow is mtCysK2 enzyme);

[0045] Figure 3 Threshold 10 -151 Sequence similarity network diagram (yellow is mtCysK2 enzyme);

[0046] Figure 4 The consistency is >70%, the threshold is 10 -151 Sequence similarity network diagram (yellow is mtCysK2 enzyme);

[0047] Figure 5 Shows the phylogenetic tree diagram after being beautified by the iTOL tool;

[0048] Figure 6 The expression results of candidate enzymes are shown;

[0049] Figure 7 The activity screening results of the candidate enzymes are shown;

[0050] Figure 8 Shown is the molecular docking model of SSC03 enzyme and its product S-sulfo-L-cysteine ​​(green represents the flexible loop region);

[0051] Figure 9 Shows the multiple sequence alignment results of the flexible loop region of the candidate enzyme;

[0052] Figure 10 Shown is the comparison of the responses of SSC03 mutants;

[0053] Figure 11 Shows laboratory amplification of an enzyme reaction. DETAILED DESCRIPTION

[0054] The present invention discloses a highly active S-sulfo-L-cysteine ​​synthetase mutant and its applications. Those skilled in the art can refer to the disclosure herein and appropriately modify the process parameters to achieve the desired results. It should be noted that all similar substitutions and modifications apparent to those skilled in the art are considered encompassed by the present invention. The methods and applications of the present invention have been described using preferred embodiments. It is apparent that those skilled in the art can modify, alter, and combine the methods and applications described herein to implement and apply the technology of the present invention without departing from the disclosure, spirit, and scope of the present invention.

[0055] The present invention provides a method for screening and modifying a highly active S-sulfo-L-cysteine ​​synthetase for synthesizing S-sulfo-L-cysteine. The undisclosed sequence information involved is as follows:

[0056] SSC01 DNA sequence:

[0057] 1);

[0059] SSC02 DNA sequence:

[0060]

[0061] SSC03 DNA sequence:

[0062]

[0063] SSC04 DNA sequence:

[0064]

[0065] SSC05 DNA sequence:

[0066]

[0067] SSC06 DNA sequence:

[0068]

[0069] SSC07 DNA sequence:

[0070]

[0071] mtCysK2 DNA sequence:

[0072]

[0073] SSC03-S256P protein sequence:

[0074] MTHVLSIDTPRISRDHHTSCRYPVGAERFRPAPQQCRHAPDRYRRVGAMVGNTPVLWVGEPFGRGERGFWAKLEGTNPGGMKDRPAMHMVERAGLRGELLPGARIVESTSGTLGLGLALAGQVYRHPVTLVTDPGMEPIIRHMLAAYGARVDLVSQPHPVGGWQQARKDRVAELLAAEPDAWCPDQYSNPDNIDAYRPLALELLDQLGDIDVLVCSVGTGGHSAGVARVLRQHNPELELIGVDTIGSTIFGQPAGPRLMRGLGSSIYPRNVDYSAFTEVHWVAPAEAVWAARTLAATYYTSGGWSVGAVALVAGWAARTYPRGTRIAAVFPDGPQRYFDTIYNDDYCRDHHLLDTNPPSDPEEISTPTQAVVNRWTRCTTVVDPTATTTQPAEDHRSQLKIPTGKDGEHQIPA(SEQ ID NO:9);

[0075] SSC03-S256P DNA sequence:

[0076]

[0077] SSC03 - S256PΔCT protein sequence:

[0078] MTHVLSIDTPRISRDHHTSCRYPVGAERFRPAPQQCRHAPDRYRRVGAMVGNTPVLWVGEPFGRGERGFWAKLEGTNPGGMKDRPAMHMVERAGLRGELLPGARIVESTSGTLGLGLALAGQVYRHPVTLVTDPGMEPIIRHMLAAYGARVDLVSQPHPVGGWQQARKDRVAELLAAEPDAWCPDQYSNPDNIDAYRPLALELLDQLGDIDVLVCSVGTGGHSAGVARVLRQHNPELELIGVDTIGSTIFGQPAGPRLMRGLGSSIYPRNVDYSAFTEVHWVAPAEAVWAARTLAATYYTSGGWSVGAVALVAGWAARTYPRGTRIAAVFPDGPQRYFDTIYNDDYCRDHHLLDTNPPSDPEEISTPTQAVVNRWTRCTTVVDPTATTT(SEQ ID NO:11);

[0079] SSC03 - S256PΔCT DNA sequence:

[0080]

[0081] SSC03ΔCT protein sequence:

[0082] MTHVLSIDTPRISRDHHTSCRYPVGAERFRPAPQQCRHAPDRYRRVGAMVGNTPVLWVGEPFGRGERGFWAKLEGTNPGGMKDRPAMHMVERAGLRGELLPGARIVESTSGTLGLGLALAGQVYRHPVTLVTDPGMEPIIRHMLAAYGARVDLVSQPHPVGGWQQARKDRVAELLAAEPDAWCPDQYSNPDNIDAYRPLALELLDQLGDIDVLVCSVGTGGHSAGVARVLRQHNPELELIGVDTIGSTIFGQPAGSRLMRGLGSSIYPRNVDYSAFTEVHWVAPAEAVWAARTLAATYYTSGGWSVGAVALVAGWAARTYPRGTRIAAVFPDGPQRYFDTIYNDDYCRDHHLLDTNPPSDPEEISTPTQAVVNRWTRCTTVVDPTATTT(SEQ ID NO:13);

[0083] SSC03ΔCT DNA sequence:

[0084]

[0085] It should be understood that the expression "one or more of" includes individually each of the items recited after the expression and various combinations of two or more of the recited items, unless otherwise apparent from the context and usage. The expression "and / or" in conjunction with three or more recited items should be understood to have the same meaning, unless otherwise apparent from the context.

[0086] The terms "comprising", "having" or "containing", including their grammatical synonyms, should generally be understood as open and non-restrictive, e.g., not excluding other unrecited elements or steps, unless otherwise specifically stated or understood from the context.

[0087] It should be understood that the order of steps or the order in which certain actions are performed is not important as long as the application remains operable. Additionally, two or more steps or actions may be performed simultaneously.

[0088] The use of any and all examples or exemplary language such as "for example" or "including" herein is intended only to better illustrate the present application and does not limit the scope of the present application. No language in this specification should be construed as indicating any non-claimed element is essential to the practice of the present application.

[0089] In addition, the numerical ranges and parameters used to define this application are approximate values. The relevant numerical values ​​in the specific examples have been presented as accurately as possible. However, any numerical value inherently inevitably contains standard deviations due to individual testing methods. Therefore, unless otherwise expressly stated, all ranges, amounts, values, and percentages used in this disclosure should be understood to be modified by the word "about." As used herein, "about" generally means that the actual value is within plus or minus 10%, 5%, 1%, or 0.5% of a particular value or range.

[0090] Unless otherwise specified, the raw materials, reagents, consumables and instruments involved in the present invention are all common commercial products and can be purchased from the market.

[0091] The present invention will be further described below with reference to the embodiments.

[0092] Example 1: Enzyme acquisition

[0093] 1. Cluster analysis and phylogenetic analysis of enzymes

[0094] The protein sequence of mtCysK2 enzyme was input into the local alignment search tool (Blastp) of the National Center for Biotechnology Information (NCBI) of the United States to search for homologous sequences, and the first 1000 results were taken to generate a sequence similarity network (SSN) using the enzyme similarity tool (EFI-EST). -152When the mtCysK2 enzyme was classified into a medium-sized cluster consisting entirely of mycobacteria, the identity of its 49 sequences was >73%, indicating that the threshold was set too high and it was difficult to screen for enzymes with significant differences in this cluster ( Figure 2 ). When the threshold is lowered to 10 -151 , the mtCysK2 enzyme was just classified back into the first large cluster containing 603 sequences. The large number of sequences was also not conducive to enzyme screening ( Figure 3 ). Try to merge sequences with identity > 70% into one macro node, with a threshold of 10 -151 In the sequence similarity network of mtCysK2, the enzyme was classified into the second largest cluster ( Figure 4 ).

[0095] The representative results of these 69 nodes were extracted in the network visualization analysis software Cytoscape, and the sequences were extracted using the ID mapping tool of UniProt. The sequences were processed by the ID Simplify tool of the software TBtool-II and imported into the software MEGA for alignment, and then the Neighbor-Joining phylogenetic tree was constructed ( Figure 5 ). 1 to 3 sequences were selected from each of the four groups in the phylogenetic tree for subsequent verification.

[0096] 2. Enzyme expression and activity screening

[0097] The protein sequences of the candidate enzymes in Table 1 were codon-optimized using the ExpOptimizer tool based on the expression host E. coli. The optimized coding nucleic acid sequences were submitted to Beijing Qingke Biotechnology for full gene synthesis, constructed into the pET-28a vector, and transformed into the BL21 (DE3) expression host to produce puncture bacteria.

[0098] Table 1

[0099] UniProt accession number Species origin Enzyme name A0A554ULZ9 Skermania sp.ID1734 SSC01 A0A1A0KB32 Nocardia sp.852002-20019_SCH5090214 SSC02 A0A7U5MJ26 Mycobacterium intracellulare subsp. chimaera SSC03 H5X8L3 Saccharomonospora marina XMU15 SSC04 A0A1X1VCX8 Mycobacterium gastri SSC05 A0A1A0V3F6 Mycobacterium sp.852014-52144_SCH5372336 SSC06 A0A1X1YUE3 Mycobacterium nebraskense SSC07 Q79FV4 Mycobacterium tuberculosis mtCysK2

[0100] Dip the delivered puncture bacteria and streak them onto LB plates (Kan). Culture them overnight in a 37°C incubator. Then, pick two single colonies of appropriate size from each plate and place them in 5 mL of LB liquid medium (Kan). Incubate at 37°C, 200 rpm, and incubate at 6-8 hours until turbid. Prepare glycerol stock by taking 1.5 mL of the culture medium and add 5 mL of fresh LB liquid medium (Kan). Add 0.1 mM IPTG and induce expression at 16°C, 200 rpm, and incubate at 16°C, 200 rpm for 16-20 hours. Collect the cells by centrifugation, add disruption buffer (20 mM Na2HPO4 / NaH2PO4, 100 mM NaCl, pH 7.6), and ultrasonically disrupt them. After high-speed centrifugation, sample the supernatant and precipitate for protein electrophoresis to detect expression.

[0101] SSC06 and SSC07 were expressed in the precipitate, SSC03, SSC05, and mtCysK2 were expressed in the supernatant, SSC04 was expressed in both the supernatant and the precipitate, while SSC01 and SSC02 were expressed at low levels ( Figure 6 ).

[0102] 100 μL of the stored glycerol bacteria were pipetted into 10 mL of LB liquid medium (Kan) and cultured at 37°C 200 rpm overnight. Then all of them were transferred to 400 mL of LB liquid medium (Kan) and cultured at 37°C 200 rpm for 2-3 hours until the OD 600 =0.6-1.0, add 0.1 mM IPTG, and transfer to 16°C, 200 rpm to induce expression for 16-20 hours. Centrifuge at 4°C, 7000 rpm, 8 minutes to collect the bacterial sludge, weigh it, and resuspend it in disruption buffer at a weight-to-volume ratio of 1:4 (g / ml), followed by ultrasonic disruption.

[0103] 5 mL of the broken liquid was added to 45 mL of the reaction solution (10 mM O-phosphoserine, 15 mM sodium thiosulfate, pH 7.0). The reaction was shaken in a water bath at 25°C while monitoring the pH. Samples were taken at 15 min, 1 h, and 6 h, and the formation of the product S-sulfo-L-cysteine ​​was detected by high-performance liquid chromatography (HPLC).

[0104] The optimal SSC03 enzyme produced S-sulfo-L-cysteine ​​at a concentration of 8.28 mM at 7 h, which was twice that of mtCysK2 ( Figure 7 ).

[0105] 3. Design and construction of mutations to improve activity

[0106] The AlphaFold2 predicted structure of SSC03 was molecularly docked with the product S-sulfo-L-cysteine ​​using the tool HDOCK. In seven of the top ten models, the products were distributed around the flexible loop region of Ile245-Asp272. The catalytic conserved residue Arg260 showed a significant interaction with the product in one of the models ( Figure 8 ). From the multiple sequence alignment results of the flexible loop region of the candidate enzyme ( Figure 9 ) As can be seen, the Ser256 residue in SSC03_A0A7U5MJ26 is a rigid Pro in some species, potentially reducing loop swing, accelerating substrate entry and product release, and thus enhancing the enzyme's catalytic activity. The predicted structure and overall multiple sequence alignment revealed that the C-terminal Gln390-end of SSC03 is a non-conserved disordered region, and truncation may enhance protein expression and stability.

[0107] The reverse primer SSC03-T389-dn for ΔCT (Δ390-end) was designed using the SSC03 coding nucleic acid sequence as a template. A Ser256Pro mutation primer was designed using the PrimerX tool and submitted to Beijing Qingke Biosynthesis. The primer sequences are as follows:

[0108] SSC03-T389-dn: TTCTCGAGTTAGGTGGTAGTCGCGGTCGGAT (SEQ ID NO: 15);

[0109] SSC03-S256P-up: CAGCCCGGCCGGCCCTCGCCTGATGC (SEQ ID NO: 16);

[0110] SSC03-S256P-dn: GCATCAGGCGAGGGCCGGCCGGCTG (SEQ ID NO: 17).

[0111] After amplifying the up and dn fragments according to the system shown in Table 2 and the procedure shown in Table 3, the fragments were recovered in 30 μL ddH2O using the Magen HiPureGel Pure DNA Mini Kit.

[0112] Table 2

[0113]

[0114] Table 3

[0115] 95℃ 3min 95℃ 15s 1(30cycles) 60℃ 15s 2(30cycles) 72℃ 45s 3(30cycles) 72℃ 5min

[0116] Then, different fusion fragments were amplified according to the system shown in Table 4 and the procedure shown in Table 5, and recovered in 30 μL ddH2O.

[0117] Table 4

[0118]

[0119] Table 5

[0120] 95℃ 3min 95℃ 15s 1(30cycles) 60℃ 15s 2(30cycles) 72℃ 70s 3(30cycles) 72℃ 5min

[0121] The fragments and vectors were digested with enzymes according to the system shown in Table 6 at 37°C for 2 h and recovered in 30 μL ddH2O.

[0122] Table 6

[0123]

[0124] According to the system shown in Table 7, different fragments were ligated into the vector pET-28a. After ligation at room temperature for 10 min, the fragments were transformed into DH5α plates. The next day, positive clones were screened by colony PCR, and the plasmids were extracted and sent for sequencing and transformed into the BL21 (DE3) expression host.

[0125] Table 7

[0126]

[0127] Example 2: Comparison of responses of SSC03 mutants

[0128] Plasmids pET28a-SSC03-S256P, pET28a-SSC03-S256PΔCT, and pET28a-SSC03ΔCT were transformed into homemade BL21 (DE3) competent cells, and all the recovered bacterial suspensions were transferred to 10 mL LB liquid medium (Kan) and cultured at 37°C 200 rpm overnight. 1.5 mL was taken from the suspension to prepare glycerol bacteria for storage, and the rest was transferred to 400 mL LB liquid medium (Kan) and cultured at 37°C 200 rpm for 2-3 h until the OD 600 =0.6-1.0, add 0.1 mM IPTG, and transfer to 16°C, 200 rpm to induce expression for 16-20 hours. Centrifuge at 4°C, 7000 rpm, 8 minutes to collect the bacterial sludge, weigh it, and resuspend it in disruption buffer at a weight-to-volume ratio of 1:4 before ultrasonic disruption.

[0129] 3 mL of the crushed liquid was added to 27 mL of the reaction solution (100 mM O-phosphoserine, 150 mM sodium thiosulfate, pH 7.0). The reaction was shaken in a 38°C water bath while monitoring the pH. Samples were taken at 1 h, 2 h, and 4 h, and the formation of the product S-sulfo-L-cysteine ​​was detected by high-performance liquid chromatography (HPLC).

[0130] In the 100mM substrate system, the wild type SSC03 (WT) produced only 19.69mM of the product S-sulfo-L-cysteine ​​after 4h of reaction, which may be due to factors such as low enzyme activity, high concentration substrate inhibition, or miscellaneous enzyme degradation products. In contrast, the optimal SSC03-S256PΔCT mutant produced 47.85mM of the product S-sulfo-L-cysteine ​​after 4h of reaction. Figure 10 ).

[0131] Example 3: Laboratory scale-up of enzyme reactions

[0132] Take 100 g of SSC03-S256PΔCT fermentation sludge from a small tank, add disruption buffer at a weight-to-volume ratio of 1:4, resuspend, and homogenize twice at 800 bar to obtain a crude enzyme solution for later use.

[0133] The reaction solution was prepared according to Table 8. The O-phosphoserine reaction solution was obtained by reacting serine and adenosine disodium triphosphate with serine kinase. The initial concentration of O-phosphoserine was 191 mM, which was diluted to 167 mM before the reaction. Sodium thiosulfate was then added to completely dissolve the solution, and the pH was adjusted to 7.0. The crude SSC03-S256PΔCT enzyme solution was then added to initiate the reaction. Reaction control and detection were similar to those in Example 2.

[0134] Table 8

[0135]

[0136] When SSC03-S256PΔCT used fermentation sludge instead of shake flask sludge and the substrate O-phosphoserine was homemade, the conversion rate was 56% after 24 h, and 84 mM S-sulfo-L-cysteine ​​was produced ( Figure 11 ), which can be used for further purification process development.

[0137] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A mutant of S-sulfo-L-cysteine ​​synthetase, characterized in that The sequence is shown in SEQ ID NO: 9, SEQ ID NO: 11 or SEQ ID NO:

13.

2. A nucleic acid molecule encoding the mutant according to claim 1.

3. The nucleic acid molecule according to claim 2, wherein The sequence is shown in SEQ ID NO: 10, SEQ ID NO: 12 or SEQ ID NO:

14.

4. An expression vector, characterized in that The nucleic acid molecule according to claim 2 or 3.

5. A host cell, characterized in that The method comprises the nucleic acid molecule according to claim 2 or 3 or the expression vector according to claim 4.

6. Use of any of the following in the preparation of S-sulfo-L-cysteine ​​using O-phosphoserine and thiosulfate as substrates: (i) The mutant according to claim 1; (ii) the nucleic acid molecule according to claim 2 or 3; (iii) the expression vector according to claim 4; (iv) The host cell according to claim 5.

7. A method for preparing S-sulfo-L-cysteine, characterized in that include: (I) mixing the substrate with the mutant according to claim 1, reacting the mixture to obtain S-sulfo-L-cysteine; (II) expressing the nucleic acid molecule according to claim 2 or 3 to obtain an expression product, mixing the expression product with a substrate, and reacting the mixture to obtain S-sulfo-L-cysteine; (III) expressing the expression vector according to claim 4, mixing the expression product with a substrate, and reacting the mixture to obtain S-sulfo-L-cysteine; (IV) Cultivating the host cell according to claim 5, mixing the culture product with a substrate, and reacting the mixture to obtain S-sulfo-L-cysteine, wherein the substrate is O-phosphoserine and thiosulfate.