Non-transgenic method for producing low-nicotine tobacco mutant plant

Abstract

The invention discloses a non-transgenic method for producing a low-nicotine tobacco mutant plant, which comprises the following steps: infecting a tobacco plant by using an engineered RNA (Ribonucleic Acid) virus vector carrying CRISPR / Cas nuclease, and editing one or more genes of a tobacco berberine bridging enzyme-like protein gene family in a targeted manner by nuclease; carrying out in-vitro tissue culture on tobacco cells infected by viruses to regenerate tobacco mutant plants; homozygous tobacco mutant plants which are obviously reduced in nicotine content, normal in growth and development and free of influence on yield are screened. The method has the following beneficial effects that the EMDV can efficiently and stably express Cas9 protein and guide RNA in infected tobacco tissues, so that multi-copy gene editing is realized; an exogenous DNA sequence does not need to be introduced into a to-be-modified cell in the gene editing process, and the risk of exogenous gene integration does not exist; nicotine of a / b / d1 / d2 / e and a / b / e mutants is obviously reduced, and the yield is not influenced.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering, and in particular to a non-transgenic method for producing low-nicotine tobacco mutant plants. Background Art

[0002] Common tobacco (Nicotiana tabacum L.) is an allotetraploid tobacco of the genus Nicotiana, which is widely cultivated worldwide as a non-food crop of great economic significance. Nicotine, also known as nicotine, is a special secondary metabolite mainly found in Nicotiana species and is the main substance responsible for the addictiveness of smoking. In order to reduce the public health problems caused by smoking, it is imperative to develop tobacco strains with low nicotine levels. Nicotine consists of a pyridine ring and a pyrrole ring, both of which originate from amino acid precursors and condense to form nicotine in the final stage, but the exact mechanism of condensation remains unclear. Among them, the oxidoreductase-berberine bridge enzyme-like protein (BBL) is related to the final biosynthetic step of nicotine and other pyridine alkaloids, but the specific biochemical details remain to be fully elucidated.

[0003] Common tobacco encodes six BBL genes: BBLa, BBLb, BBLc, BBLd1, BBLd2, and BBLe. RNAi inhibition of some members of the BBL family resulted in a significant reduction in the level of pyridine alkaloids. Currently, knocking out the six BBL genes significantly reduced tobacco nicotine levels, but tobacco yields were also significantly reduced. Therefore, it is necessary to comprehensively evaluate the specific roles of different BBL members in the biosynthesis of nicotine and other alkaloids, so as to cultivate materials with low nicotine without affecting tobacco yield.

[0004] The emergence of genome editing technologies, especially those based on the CRISPR / Cas system, has the potential to rapidly and precisely modify genomes that are indistinguishable from natural genetic variation, offering great promise for accelerating crop improvement. Traditional plant gene editing methods achieve stable expression of CRISPR / Cas in plant cells through Agrobacterium-mediated transformation or bioparticle bombardment. Although this approach is effective for some plant species, the isolation of transgenes is a time-consuming process. In particular, when the edited plants are used for field trait evaluation or for targeting multiple gene copies, transgene isolation is more challenging due to genetic linkage issues. In recent years, viral vectors have emerged as a promising alternative method for introducing CRISPR / Cas components into plants. Certain plant RNA viral vectors, such as sonchus yellow net virus (SYNV) and tospovirus tomato spotted wiltvirus (TSWV) vectors, have the ability to deliver complete CRISPR / Cas elements, thereby circumventing the need for stable transformation in plant genome editing. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a non-transgenic method for producing low-nicotine tobacco mutant plants, which utilizes gene editing methods without exogenous DNA to create a method for producing tobacco mutant materials with low nicotine content but normal growth and development.

[0006] The technical problem to be solved by the present invention is achieved through the following technical solutions:

[0007] A non-transgenic method for producing low-nicotine tobacco without affecting yield, characterized in that it comprises the following steps:

[0008] (1) Infecting tobacco plants with an engineered RNA viral vector carrying a CRISPR / Cas nuclease that targets and edits one or more genes of the tobacco berberine bridge-like protein (BBL) gene family;

[0009] (2) Using virus-infected tobacco cells to perform in vitro tissue culture to regenerate tobacco mutant plants (the nicotine content of tobacco mutant plants is significantly reduced but the yield is not affected);

[0010] (3) Screening homozygous tobacco mutant plants with significantly reduced nicotine content and normal growth and development and unaffected yield (tobacco plants containing the homozygous mutant combination of bbla bblb bble or bbla bblb bbld1 bbld2 bble).

[0011] Preferably, in the above technical solution, the CRISPR / Cas nuclease is Streptococcus pyogenes CRISPR nuclease SpCas9, and its sequence is shown in SEQ ID NO.2.

[0012] Preferably, in the above technical solution, the engineered RNA virus vector is an eggplant dwarf virus (EMDV) virus, and its positive chain genome sequence is shown in SEQ ID NO. 1. The EMDV vector belongs to the genus Nucleorhabdovirus of the family Rhabdoviridae, and is a nonsegmented negative-sense RNA virus. It is known to those skilled in the art that other similar viruses, such as chicory yellow web virus and tomato spotted wilt virus, can also be used to deliver complete nucleases.

[0013] Preferably, in the above technical scheme, the recombinant EMDV transiently expresses Cas protein and guide RNA in the infected plant cells. Wherein, the Cas9 nuclease is guided by the guide RNA to cut the plant-specific genomic DNA sequence. The method for recombinant EMDV to infect Nicotiana benthamiana is to inoculate plants with Agrobacterium, that is, to mix the Agrobacterium strain containing the EMDV recombinant virus vector and the auxiliary plasmid vector in a suitable proportion and then infiltrate the Nicotiana benthamiana leaves to produce recombinant viruses, which infect plant tissues and express gene editing elements. Alternatively, the method for recombinant EMDV to infect tobacco (N. tabacum cv. Honda) is grafting, that is, to graft Nicotiana benthamiana as a rootstock onto tobacco (N. tabacum cv. Honda), or to graft Nicotiana benthamiana as a rootstock onto Nicotiana benthamiana. After the grafted plants survive, the Nicotiana benthamiana leaves containing the EMDV recombinant virus are fully ground in a friction buffer, and the virus-carrying friction solution is inoculated into the Nicotiana benthamiana part of the grafted plant. The recombinant virus infects the red flower tobacco variety (N. tabacum cv. Honda) through the Nicotiana benthamiana.

[0014] Preferably, in the above technical solution, the CRISPR / Cas nuclease targets one or more BBL gene family members, and achieves knockout or mutation of the BBL gene through gene editing. The BBL gene family includes: BBLa, BBLb, BBLc, BBLd1, BBLd2 and BBLe, and the conserved target site is BBL1, whose sequence is shown in SEQ ID NO.3.

[0015] Preferably, in the above technical solution, the tissue culture process has no selection marker, the mutant screening method is through gene sequencing screening, and the tobacco mutant plants do not contain the integration of exogenous DNA.

[0016] A tobacco mutant plant is cultivated by the above method. The nicotine content of the tobacco mutant plant is significantly reduced, the growth and development are normal, and the yield is not affected. At the same time, the tobacco mutant plant does not contain exogenous genetic material.

[0017] BBL gene pure mutation combinations include: bble, bbla bble, bblb bble, bbld1 bble, bblbbbld1 bble, bblb bbld2 bble, bbld1 bbld2 bble, bbla bbld1 bble, bbla bbld2bble, bbla bblb bble, bblb bbld1 bbld2 / e, bbla bbld1bbld2 bble, bbla bblb bbld1bble, bbla bblb bbld2 bble, bbla bblb bbld1 bbld2 bble and bbla bblb bblc bbld1bbld2bble.

[0018] Preferably, the nicotine content of the bbla bblb bble, bbla bblb bbld1 bble, bbla bblb bbld2 bble, bblabblb bbld1 bbld2 bble and bbla bblb bblc bbld1 bbld2 bble mutants is reduced by 14.1-21.6 times compared with that of wild-type tobacco.

[0019] More preferably, the plant height, leaf length and leaf width of the bbla bblb bble and bbla bblb bbld1 bbld2 bble mutants are not significantly different from those of the wild-type plants.

[0020] A non-transgenic method for producing low-nicotine tobacco without affecting yield or use of tobacco mutant plants in any of the following:

[0021] (1) Application in the preparation of transgenic tobacco;

[0022] (2) Application in tobacco breeding;

[0023] (3) Application in the construction of DNA template library.

[0024] The above technical solution of the present invention has the following beneficial effects:

[0025] (1) EMDV can efficiently and stably express Cas9 protein and guide RNA in infected tobacco tissues, achieving multi-copy gene editing;

[0026] (2) The gene editing process does not require the introduction of exogenous DNA sequences into the cells to be modified, and there is no risk of exogenous gene integration;

[0027] (3) Nicotine levels in the a / b / d1 / d2 / e and a / b / e mutants were significantly reduced, but yield was not affected. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] The accompanying drawings, which are incorporated in and constitute a part of the specification, illustrate embodiments of the invention and, together with the description, serve to explain the principles of the invention.

[0029] Figure 1 Construction and rescue of EMDV-gRNA-Cas9 vector. (A) Schematic diagram of recombinant virus vector rescued by Agrobacterium infiltration into Nicotiana benthamiana; (B) Schematic diagram of the genome structure of EMDV-gRNA-Cas9 vector; (C) Symptoms of Nicotiana benthamiana infected by viral vector system. Mock refers to simulated inoculated plants; (D) Immunoblotting of EMDV-specific antiserum and FLAG antibody to detect EMDV structural proteins and Cas9 proteins. Staining of Rubisco large subunit (Rub L) was used as a protein loading control;

[0030] Figure 2 Generation of tobacco BBL gene mutants and genotypic analysis. (A) Shows the technical flow chart for editing tobacco genes using EMDV-gRNA-Cas9 vectors; (B) Shows that the selected BBL1 site sequence is conserved in all six tobacco BBL genes; (C) Shows the mutation frequency of BBLa and BBLe genes produced by EMDV-gRNA-Cas9 in leaf tissues of systemically infected tobacco plants detected by high-throughput sequencing; (D) Shows the mutation types and trees of the six BBL genes in 24 tobacco regenerated plants (M0). WT, wild type; Chi, mosaic; He, heterozygous; Bi, biallelic mutation; Ho, homozygous; (E) Shows the BBL target site mutation sequence and mutation type in M0-#5 and -#24 plants. Base deletions (d#) and insertions (i#) are represented by dashes and blue letters, respectively, and the percentage of reads is represented on the right side of each sequence;

[0031] Figure 3 These are the M1 generation strains with 16 homozygous mutations of the BBL gene. The M1 generation strains were derived from 460 and 92 M1 segregating progenies of the self-pollinated M0-#5 and M0-#24 strains, and the sequences and genotypes of the 6 BBL genes were sequenced and analyzed. Italic lowercase letters represent homozygous BBL mutants of a specific combination, for example, e represents a BBLe homozygous mutant.

[0032] Figure 4Analysis of pyridine alkaloid content in tobacco BBL mutant strains. (A) Schematic diagram of the biosynthesis of pyridine alkaloids in tobacco. Full arrows indicate characterized enzymatic steps, and dashed arrows indicate undefined or hypothetical steps. Question marks next to enzymes indicate that their precise catalytic reactions have not been confirmed by biochemical assays. A622, PIP family reductase; BBL, berberine bridge enzyme-like protein; CYP82E, cytochrome P450 monooxygenase; (B) Analysis of alkaloid content in leaves of tobacco wild type (WT) and BBL mutants. Leaf samples were collected at the flowering bud stage, and alkaloid content was determined by gas chromatography-mass spectrometry in μg / g dry leaf weight (DW). BBL genotypes are shown below the bar graphs. Data are presented as individual data points and mean ± standard deviation. Different letters above the bar graphs indicate statistically significant differences determined using one-way ANOVA and Tukey's test and are represented by letters, P < 0.05.

[0033] Figure 5 The growth phenotype of tobacco BBL mutant. (A) shows the growth phenotype of wild-type and BBL mutant tobacco grown in the greenhouse before topping (left) and after topping (right). Plants were photographed at 98 days and 140 days after sowing, respectively. Five wild-type plants are located at the far end of the right row; (B) shows the plant height (top), waist leaf length (middle) and width (bottom) of wild-type and BBL mutant plants under greenhouse conditions; (C) shows the plant height (top), waist leaf length (middle) and waist leaf width (bottom) of wild-type and BBL mutant plants in two different areas under field conditions. Different letters above the bars indicate statistically significant differences (P<0.05) determined using one-way ANOVA and post hoc Tukey test. DETAILED DESCRIPTION

[0034] Various exemplary embodiments of the present invention will now be described in detail with reference to the accompanying drawings. It should be noted that the relative arrangement of components and steps, numerical expressions and numerical values ​​set forth in these embodiments do not limit the scope of the present invention unless otherwise specifically stated.

[0035] Unless otherwise specified, the reagents used in this application are all commercially available or obtained through commercial channels, or can be prepared by referring to existing chemical methods.

[0036] The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.

[0037] Example 1 Construction and rescue of recombinant EMDV vector expressing CRISPR / Cas9

[0038] The transcription plasmid pEMDV containing the full-length genomic cDNA of EMDV, the core protein expression vectors pGD-N, pGD-P and pCB-L, and the expression vectors of RNA silencing suppressor proteins (p19, γb and Hc-Pro) from other viruses can refer to published studies (Wang et al., 2024, Virology 591, 109980).

[0039] In order to design an EMDV vector for expressing gRNA and Cas9 and to facilitate the insertion of a target site-specific spacer sequence, an intermediate vector pGD Bsp-AarI-XmaJ (SEQ ID NO. 4) was first constructed. The vector contains an EMDV cDNA fragment (from Bsp119I to XmaJ site), a tRNA-gRNA-tRNA transcription cassette (whose spacer sequence is replaced by two AarI restriction sites) and a Cas9 transcription cassette.

[0040] To this end, three EMDV-derived fragments were amplified by PCR using pEMDV(+) as template and the following primer pairs: pGD / Bsp119 I / F and NXJ / I / R, NXJ / II / F and NXJ / II / R, NXJ / III / F and pGD / XmaJ I / R. Their sequences are as follows:

[0041] pGD / Bsp119I / F: ACAAATCTATCTCTGGATCCTTCGAAAGAATGGCAGATAATTTCC; NXJ / I / R: CACTGGTGCTTTGTTGGTGTGTTGGGTTTTTATTAAAGG;

[0042] NXJ / II / F: TTCCCGGCTGGTGCAGATGATTTCTAATTTCAATTGCATGTG;

[0043] NXJ / II / R:GTCCTTATAGTCCATGGTGTGTTGGGTTTTTATTAAAGG;

[0044] NXJ / III / F: AAAAAGAAAAAGTAAGATGATTTCTAATTTCAATTGCATGTG;

[0045] pGD / XmaJI / R: TTTGAACGAGCTCTGTCGACCCTAGGTGGAGCTCTCACATAAG.

[0046] In addition, three CRISPR fragments were amplified from pSYNV-tgtRNA-Cas9 (Ma et al., 2020, Nat Plants 6, 773-779) using primer pairs sgRNA / F and sgRNA / AarI / R, sgRNA / AarI / F and sgRNA / R, and Cas9 / F and Cas9 / R.

[0047] sgRNA / F: AACAAAGCACCAGTGGTCTAG;

[0048] sgRNA / AarI / R:

[0049] AGGTGTTGGTAGTAGCGACTCCATGCACCTGCTTGTTGCACCAGCCGGGAATC;

[0050] sgRNA / AarI / F:

[0051] CTACTACCAACACCTGCGAACGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAG;

[0052] sgRNA / R: TGCACCAGCCGGGAATC;

[0053] Cas9 / F: ATGGACTATAAGGACCACGACG;

[0054] Cas9 / R: TTACTTTTTTCTTTTTTGCCTGGCC.

[0055] The pEMDV-gRNA-Cas9 vector, pGD-N, pGD-P and pCB-L vectors, as well as the p19, γb and Hc-Pro vectors were introduced into the Agrobacterium EHA105 strain, and the above Agrobacterium strains were mixed in appropriate proportions to make the final concentration of the pEMDV-gRNA-Cas9 strain be OD 600 =0.23, and the final concentration of the remaining Agrobacterium components was OD 600 = 0.08. The above Agrobacterium mixture was inoculated with Nicotiana benthamiana ( Figure 1 For detailed inoculation methods, please refer to published studies (Wang et al., 2024, Virology 591, 109980).

[0056] Thirty days after Agrobacterium inoculation, EMDV vector system infected N. benthamiana, showing slight leaf curling and yellowing symptoms ( Figure 1Figure B is a schematic diagram of the EMDV-gRNA-Cas9 vector genome structure, and Figure C shows the symptom manifestations). Cas9 nuclease and viral proteins are expressed in systemically infected leaf tissues ( Figure 1 Figure D).

[0057] Example 2 EMDV-gRNA-Cas9 vector-mediated site-directed editing of tobacco BBL gene

[0058] Based on the established EDMV delivery method, this method was applied to edit the BBL gene family members of the tobacco red flower Dajinyuan variety (N. tabacum cv. Honda). The basic technical process is to use the Nicotiana benthamiana leaves infected with the EMDV-gRNA-Cas9 system as the virus source, and friction inoculate the Nicotiana benthamiana leaves in the Nicotiana benthamiana-tobacco heterologous grafted plants. The recombinant virus is transmitted to the tobacco through the Nicotiana benthamiana part. After that, the tobacco leaves infected with the virus system are used as explants for tissue culture to obtain tobacco regenerated plants, and the mutant plants are obtained by analyzing and screening the sequence of the BBL gene ( Figure 2 Figure A).

[0059] As previously described (Lewis et al., 2020, Front Plant Sci, 368), a CRISPR / Cas9 target site (BBL1) conserved among six BBL genes (BBLa, BBLb, BBLc, BBLd1, BBLd2, and BBLe) in tobacco was selected ( Figure 2 Two partially complementary primers BBL1 / F and BBL1 / R were designed. Their sequences are as follows:

[0060] BBL1 / F: TGCAGAAATCAGAGTAAGGTGCGG;

[0061] BBL1 / R:AAACCCGCACCTTACTCTGATTTC.

[0062] After annealing, the three pairs of primers were cloned into the pGD Bsp-AarI-XmaJ plasmid through AarI Golden Gate. Then, the inserted fragment was subcloned into pEMDV through double restriction of Bsp119I and XmaJI to obtain the pEMDV-gBBL-Cas9 vector.

[0063] The method described in Example 1 was used to inoculate Nicotiana benthamiana with Agrobacterium to obtain the EMDV-gBBL1-Cas9 recombinant virus. The Nicotiana benthamiana scion and tobacco stock were heterologously grafted according to the method of Wang et al. (2024, Virology 591, 109980). After the grafted plants survived, the Nicotiana benthamiana leaves containing the EMDV-gBBL1-Cas9 recombinant virus were fully ground in a friction buffer, and the poisonous juice was mechanically rubbed and inoculated into the Nicotiana benthamiana part of the grafted plant. About two weeks after inoculation, the Nicotiana benthamiana part of the grafted plant began to show systemic infection. Two weeks later, the recombinant virus spread to the tobacco part and caused viral symptoms in the tobacco.

[0064] Four weeks after inoculation, in the tobacco infected tissues of the grafted plants, the total DNA of the leaf tissues was extracted by CTAB method, and the gene editing efficiency of the BBLa and BBLe loci was analyzed by high-throughput sequencing, and the mutation frequencies of 69.6% and 74.7% were detected, respectively ( Figure 2 The HTS amplification primers involved are HTS / NtBBLa / b / c / F, HTS / NtBBLa / b / c / e / R and HTS / NtBBLe / F, and their sequences are as follows:

[0065] HTS / NtBBLa / b / c / F:GGAGTGAGTACGGTGTGCGAGGAGCTTCGTGAGCACCA;

[0066] HTS / NtBBLa / b / c / e / R: GAGTTGGATGCTGGATGGAATTTGGCCAATTGTTGCGC;

[0067] HTS / NtBBLe / F:GGAGTGAGTACGGTGTGCAAAGAGGAGCTCGTGAG.

[0068] Then, virus-infected tobacco leaves were collected and cut into 1 cm 2 The leaf disks were placed on antibiotic-free MS induction medium (4.4 g / L MS salt, 30 g / L sucrose, 2 mg / L 6-benzylaminopurine, 4 g / L phytagel) for culture. After 4-6 weeks, the differentiated buds were cut and transferred to antibiotic-free MS rooting medium (4.4 g / L MS salt, 30 g / L sucrose, 4 g / L phytagel) for culture for 20 days. The regenerated seedlings with fully developed root systems were transplanted into the soil, and a total of 24 regenerated M0 generation strains were obtained.

[0069] High-throughput sequencing was used to determine the sequence of the BBL gene target site in the regenerated plants and genotype them. In addition to the above-mentioned HTS / NtBBLa / b / c / F, HTS / NtBBLa / b / c / e / R and HTS / NtBBLe / F primers, the HTS amplification primers involved also included HTS / NtBBLd1 / d2 / F and HTS / NtBBLd1 / d2 / R. The sequences are as follows:

[0070] HTS / NtBBLd1 / d2 / F: GGAGTGAGTACGGTGTGCAAGGAGCAGCTGGTGAG;

[0071] HTS / NtBBLd1 / d2 / R:GAGTTGGATGCTGGATGGAGTCTGGCCAAGTGTAGCGC.

[0072] The results showed that 8 (33.3%) regenerated strains carried the target mutation, of which 6 (25.0%) strains had frameshift (knockout) mutations in all 6 BBL genes, including homozygous or biallelic mutation types ( Figure 2 D Figure, Table 1), such as M0-#24 ( Figure 2 It is worth noting that the M0-#5 line exhibited a complex genotype: BBLa, BBLb, BBLd1, and BBLd2 were heterozygous, BBLe was biallelic, and BBLc was mosaic ( Figure 2 Figure E, right side.

[0073] Table 1 Mutation types and genotypes of the six BBL genes in the M0 generation plants

[0074]

[0075]

[0076]

[0077] Example 3 Screening and identification of tobacco BBL gene homozygous mutant combinations

[0078] M0-#5 plants contain heterozygous mutations of BBLa, BBLb, BBLd1, and BBLd2 genes, and their self-pollination-produced M1 segregating offspring can have various combinations of homozygous BBL mutations. Sanger sequencing was used to determine and genotype the sequences of the six BBL gene target sites in 460 M1 isolates of M0-#5 plants. The results showed that, except for the mosaic mutation of the BBLc gene, which was not heritable, the heterozygous mutations and biallelic mutations of the other five BBL genes were successfully inherited to the M1 offspring, resulting in 15 mutant lines with different combinations of homozygous mutations of the BBL gene ( Figure 3, Table 2). Similarly, 92 offspring from M0-#24 (these offspring contained biallelic or homozygous mutations in all 6 BBL genes) were genotyped, and the segregating offspring of M0-#24-018 was selected as the strain with homozygous mutations in the 6 BBL genes ( Figure 3 , Table 2).

[0079] Table 2 BBL genotypes of the self-segregating progeny plants of M0-#5 and M0-#24

[0080]

[0081]

[0082] Example 4 Alkaloid content and analysis of tobacco BBL mutants

[0083] BBL enzymes can catalyze the coupling reaction of nicotinic acid or its metabolites with N-methylpyrrolidone, Δ1-piperidine and nicotinic acid derivatives to synthesize nicotine, anabasine and anabasine, respectively. In tobacco, nicotine can be further metabolized into other alkaloids, including nornicotine, myosamine and cotinine ( Figure 4 Figure A) (Kaminski et al., 2020, Phytochemistry 177, 112424).

[0084] The 16 BBL mutants obtained in Example 3 were self-crossed with M2 offspring and a wild-type control strain in a greenhouse. When the tobacco grew to the bud stage, leaf tissue was collected. Six leaf discs without midribs were collected from the 9th to 10th leaves of each plant (three per leaf) in a mortar, freeze-dried and ground into fine powder. 0.2 g of leaf powder was fully mixed with 2 mL of 5% sodium hydroxide aqueous solution, and 50 μL of standard solution (dimethylquinoline and 2,3-bipyridine were dissolved in methanol and diluted with dichloromethane to final concentrations of 1.0 mg / mL and 0.5 mg / mL respectively) and 10 mL of extraction solution (dichloromethane: methanol = 4:1) were added successively and mixed. Oscillate at 2000 rpm for 40 minutes and incubate at room temperature for one hour. The sample was then centrifuged at 12000 rpm for 1 minute, and the organic phase was collected for alkaloid analysis.

[0085] Alkaloid content was analyzed using a GC-MS system (TQ / SQ, Bruker, Bremen, Germany) equipped with a DB-35MS column (30 m × 0.25 mm × 0.25 μm) (Agilent, Santa Clara, CA, USA). Organic separation was performed under the conditions of an inlet temperature of 250 °C and a helium flow rate of 1 mL / min. The partition ratio of nicotine was 40:1 and that of other alkaloids was 10:1. The oven temperature program was set to maintain at 100 °C for 3 min at the beginning, then increase to 260 °C at a rate of 8 °C / min and maintain at 260 °C for 10 min. The temperature of the transfer line and ion source was maintained at 280 °C and 250 °C, respectively. The ionization mode was electron bombardment at 70 eV, and the solvent delay was 5 min for nicotine and 7 min for other alkaloids. After the program was set, the samples were subsequently tested for alkaloids by SIM detector, and the test data were analyzed using Compass CDS software.

[0086] The mutants were divided into two groups according to the nicotine level. The first group included homozygous BBLa, BBLb and BBLe mutants (abbreviated as a / b / e) and their higher-order mutants a / b / d1 / e, a / b / d2 / e, a / b / d1 / d2 / e and a / b / c / d1 / d2 / e. The nicotine content in this group of plants was significantly reduced, ranging from 0.27 to 0.40 mg / g, which was 14.4 to 21.6 times lower than that of the wild type. The second group included the remaining lines, which had no difference or a small reduction in nicotine content compared to the wild type ( Figure 4 Figure B).

[0087] Analysis of other pyridine alkaloids showed that nicotine, anatabine and cotinine contents were positively correlated, and the anatabine and cotinine contents of the five mutants in the low-nicotine group were also significantly reduced ( Figure 4 (B). The levels of anabasine were largely unaffected in most combinations of BBL mutants, suggesting that the condensation of pyridine and pyridine rings does not require the BBL enzyme. Notably, the levels of nornicotine (nicotine produced by nicotine-N-demethylase) were elevated in most mutants, especially in the five low-nicotine lines, which showed a 2.3- to 3.5-fold increase compared to the wild type. In addition, the levels of myosamine (likely produced by the degradation of nornicotine) increased by 1.9- to 3.2-fold.

[0088] Example 5 Growth phenotype analysis of tobacco BBL mutants

[0089] Under greenhouse conditions, all mutants showed similar growth phenotypes ( Figure 5However, the average plant height at topping was measured in some higher-order mutants, such as a / b / c / d1 / d2 / e, a / b / d1 / e, a / b / d2 / e, a / d1 / d2 / e, and a / d1 / e, which were about 6% to 12% shorter than the wild-type plants. Although the width of the mid-leaf (measured 45 days after topping) increased in the a / b / d2 / e and a / d1 / d2 / e lines, the mid-leaf length (measured 45 days after topping) of all lines remained comparable to that of the wild-type ( Figure 5 Figure B).

[0090] In addition, a / b / c / d1 / d2 / e, a / b / d1 / d2 / e and a / b / e low-nicotine mutants were selected for trial planting in two fields to analyze their growth phenotypes. Compared with the wild type, the plant height of the a / b / c / d1 / d2 / e strain was reduced by about 10% at topping, and the waist leaf length (measured 10 days after topping) was reduced by 9%. In contrast, the a / b / d1 / d2 / e and a / b / e genotypes did not have significant statistical differences in plant height at topping, waist leaf length (measured 10 days after topping) and waist leaf width (measured 10 days after topping) compared with the wild type ( Figure 5 Figure C).

[0091] Although the present invention has been disclosed as above by the embodiments, it is not intended to limit the present invention. Any person skilled in the art may make various choices and modifications without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention is limited by the claims and their equivalents.

Claims

1. A non-transgenic method for producing low-nicotine tobacco without affecting yield, characterized in that: The following steps are involved: (1) Infecting tobacco plants with an engineered RNA viral vector carrying a CRISPR / Cas nuclease that targets and edits one or more genes of the tobacco berberine bridge-like protein (BBL) gene family; (2) Regeneration of tobacco mutant plants by in vitro tissue culture using virus-infected tobacco cells; (3) Screening for homozygous tobacco mutant plants with significantly reduced nicotine content and normal growth and development but unaffected yield.

2. The non-transgenic method for producing low-nicotine tobacco without affecting yield according to claim 1, characterized in that: The CRISPR / Cas nuclease is the Streptococcus pyogenes CRISPR nuclease SpCas9, and its sequence is shown in SEQ ID NO.

2.

3. The non-transgenic method for producing low-nicotine tobacco without affecting yield according to claim 1, characterized in that: The engineered RNA virus vector is the eggplant dwarf virus (EMDV) virus, and its positive chain genome sequence is shown in SEQ ID NO.

1.

4. The non-transgenic method for producing low-nicotine tobacco without affecting yield according to claim 1, characterized in that: The recombinant EMDV transiently expresses Cas protein and guide RNA in infected plant cells, where the Cas9 nuclease is guided by the guide RNA to cut plant-specific genomic DNA sequences.

5. The non-transgenic method for producing low-nicotine tobacco without affecting yield according to claim 1, characterized in that: The CRISPR / Cas nuclease targets one or more BBL gene family members, and achieves knockout or mutation of the BBL gene through gene editing.

6. The non-transgenic method for producing low-nicotine tobacco without affecting yield according to claim 1, characterized in that: The tissue culture process has no selection marker, the mutant screening method is through gene sequencing screening, and the tobacco mutant plants do not contain the integration of exogenous DNA.

7. The non-transgenic method for producing low-nicotine tobacco without affecting yield according to claim 1, characterized in that: The BBL gene family includes: BBLa, BBLb, BBLc, BBLd1, BBLd2 and BBLe, the conservative target site is BBL1, and its sequence is shown in SEQ ID NO.3; in the pure and mutant combinations of BBL genes, the nicotine of a / b / e and a / b / d1 / d2 / e mutants is significantly reduced and the yield is not affected.

8. A tobacco mutant plant, characterized in that: The tobacco mutant plant is cultivated by the method according to any one of claims 1 to 7, the nicotine content of the tobacco mutant plant is significantly reduced, the growth and development are normal and the yield is not affected.

9. The tobacco mutant plant according to claim 8, characterized in that: There were no significant differences in plant height, leaf length and leaf width between the bblabblb bble or bbla bblb bbld1 bbld2 bble mutants in the BBL gene homozygous mutation combination and the wild-type plants.

10. Use of the method according to any one of claims 1 to 7 or the tobacco mutant plant according to claim 9 in any of the following: (1) Application in the preparation of transgenic tobacco; (2) Application in tobacco breeding; (3) Application in the construction of DNA template library.

Images