MODY subtype diabetes mellitus genetic typing detection primer pair, kit and application thereof

Abstract

The invention provides an MODY subtype diabetes mellitus genotyping detection primer pair, a kit and application of the MODY subtype diabetes mellitus genotyping detection primer pair. The invention provides a primer pair for detecting an MODY subtype, a kit containing the primer pair and application of the primer pair to identification of an MODY1 type, an MODY2 type, an MODY3 type, an MODY4 type, an MODY5 type, an MODY6 type, an MODY10 type and an MODY13 type.

Description

Technical Field

[0001] The present disclosure relates to the field of gene diagnosis, and more specifically, to primer pairs for detecting different subtypes of maturity-onset diabetes of the young (MODY), a kit containing the primer pairs, and applications thereof. Background Art

[0002] MODY is an early-onset autosomal dominant monogenic diabetes, usually with an onset age of less than 25 years. It is easily misdiagnosed because its clinical phenotype is similar to that of type 1 and type 2 diabetes. Currently, 13 MODY subtypes have been discovered, accounting for approximately 1-5% of all diabetic patients, involving different pathogenic genes, clinical phenotypes, and treatment regimens. Taking MODY12 and MODY13 as examples, both are sensitive to sulfonylureas; MODY2 does not require medication, while MODY10 requires insulin treatment; other types require different treatments depending on the cause and subtype. Therefore, it is of great significance to clarify the MODY subtypes.

[0003] Hepatocyte nuclear factor 4-alpha (HNF4A) is a member of the nuclear transcription factor receptor family, encoded by the HNF4A gene, expressed in multiple organs such as the liver, kidney, and pancreas, and is involved in the development, differentiation, and normal function of pancreatic β cells and liver, and in maintaining normal blood sugar levels. HNF4A gene mutations can lead to impaired insulin secretion, causing patients to gradually lose their ability to control blood sugar, and other diabetic microvascular complications, such as retinopathy and kidney-related diseases, occur at the same time. Clinically, diabetes caused by this gene mutation is classified as MODY1 type.

[0004] MODY type 2 diabetes caused by glucokinase (GCK) gene mutation is the most common MODY subtype. The proportion of MODY2 reported in various countries in the MODY population ranges from 10% to 60%. In China, MODY type 2 diabetes accounts for about 10.4% of the MODY population. MODY2 is characterized by mild clinical symptoms, usually without the "three more and one less" symptoms of diabetes, rarely with diabetic ketoacidosis, and a low risk of related chronic complications. Therefore, MODY type 2 diabetes is often missed, undiagnosed, or misdiagnosed as type 1 or type 2 diabetes. Moreover, MODY2 patients usually only need diet control and do not need medication; however, for couples in which one of them is MODY type 2 diabetes, whether the GCK gene mutation during pregnancy is inherited to the fetus will lead to different pregnancy outcomes, mainly reflected in the different intrauterine development status of the fetus and the decrease or increase in birth weight. Therefore, it is very important to distinguish between MODY2 combined with pregnancy and gestational diabetes. It is necessary to clarify the inheritance of GCK gene mutations in this population and provide corresponding pregnancy management, treatment, and follow-up.

[0005] Hepatocyte nuclear factor 1A (HNF1A) is a MODY-related gene. Its corresponding MODY3 is the most common monogenic diabetes, accounting for about 30-65% of the total number of monogenic diabetes in European Caucasians. HNF1A is an important transcription factor in the process of pancreatic islet development and β-cell differentiation. It is widely expressed in pancreatic β-cells, liver, intestines and other organs. Mutations in this gene can lead to progressive decline in pancreatic islet function. At the same time, since HNF1A is an important transcription factor that regulates the expression of renal tubular epithelial sodium glucose cotransporter 2 (SGLT2), mutations in the HNF1A gene can lead to decreased SGLT2 expression, reduced glucose reabsorption, and lowered renal glucose threshold. The HNF1A gene is located at human 12q24.31, with a total length of 23969bp and 10 exons.

[0006] Among the confirmed MODY subtypes, MODY4 is a relatively rare one, caused by mutations in the PDX1 gene, which is located on human chromosome 13q12.1 and is related to pancreatic islet cell development. Homozygous mutations in the PDX1 gene can cause pancreatic dysgenesis, while heterozygous mutations cause abnormal apoptosis of pancreatic beta cells, leading to diabetes. When MODY patients have typical clinical features of type 1 or type 2 diabetes, they are easily misdiagnosed, which in turn affects subsequent interventions and treatments. Genetic testing can identify the cause and avoid this.

[0007] MODY5 is caused by mutations in the HNF1B gene, which is located on human chromosome 17q12 and is expressed in multiple tissues of the human body. It is an important upstream regulator of lipoprotein metabolism and insulin genes, directly affecting insulin transcription; in addition, in the development of nephrons, it plays a decisive role in the formation of renal tubules and is involved in the development of glomeruli. Therefore, MODY5 is a multi-system disease, and kidney involvement is more common than diabetes. HNF1B gene mutations include single nucleotide variants and intragenic fragment deletions; in addition, the loss of HNF1B and at least 7 adjacent genes caused by heterozygous deletion of at least 1.2Mb at chromosome 17q12 accounts for about 50% of MODY5 types.

[0008] MODY6 is a rare monogenic diabetes. The pathogenic gene NEUROD1 is located on the long arm of chromosome 2, 2q32, and was first reported by Malecki et al. in 1999. NEUROD1 is a type II basic helix-loop-helix (bHLH) transcription factor, also known as BETA2. It is involved in regulating the development of the endocrine pancreas and binds to the bHLH protein E47 to form a heterodimer, acting on the insulin promoter to activate insulin gene expression. In addition, NEUROD1 is also related to the transcription and expression of other MODY subtype genes. The full length of the NEUROD1 gene is 12kb and contains 2 exons. If conventional PCR and first-generation sequencing methods are used, the detection efficiency is low.

[0009] The MODY10 subtype is caused by mutations in the INS gene, which is located on the short arm of human chromosome 11, 11p15.5, with a total length of 1.3kb, encoding insulin A chain, B chain and C peptide. Mutations in the INS gene can lead to disorders in the synthesis of preproinsulin, proinsulin and insulin, and affect the binding of insulin to the insulin receptor, causing preproinsulin, proinsulin or insulin to accumulate and degrade in the endoplasmic reticulum, activating apoptotic signals, causing β-cell apoptosis, and ultimately leading to insufficient insulin secretion. Complete deletion and homozygous mutations of the INS gene can cause neonatal diabetes, while heterozygous deletions and heterozygous mutations are associated with early onset in adolescents and adults.

[0010] Maturity-onset diabetes of the young, MODY13, caused by mutations in the KCNJ11 gene was first reported by Bonnefond et al. in 2012. The KCNJ11 gene is a member 11 of the inward-rectifying potassium channel subfamily J, located on human chromosome 11, with a total length of 4.098 kb, encoding the Kir6.2 subunit of the ATP-sensitive potassium channel (KATP). Mutations in the KCNJ11 gene can lead to abnormal closure of the KATP channel, thereby causing abnormal insulin secretion in β cells, and ultimately leading to abnormal blood sugar control in patients. Although the KCNJ11 gene contains only one exon, 150 gene mutations associated with it have been found to date, which are closely related to neonatal diabetes, MODY13, and hyperinsulinemia.

[0011] Different MODY types correspond to different treatments. For example, MODY type 2 corresponding to the GCK gene only requires diet control and no drug treatment, while MODY type 13 is sensitive to sulfonylurea drugs and can achieve better blood sugar control by taking these drugs orally. Therefore, accurate MODY typing of patients is of great significance.

[0012] MODY is a monogenic diabetes, and genetic diagnosis is its gold standard. However, the pathogenic genes that cause each subtype of MODY are very long, and the pathogenic or potentially pathogenic mutation sites associated with MODY are distributed throughout the gene sequence, from the promoter region to the 3'UTR region, without specific mutation hotspots. Using the multiplex PCR method, it is necessary to design multiple pairs of primers and optimize the amplification uniformity of the multiplex PCR, which requires a large amount of preliminary work. With the popularization of second-generation sequencing technology, whole exome detection (WES) and customized probes or primer pools are currently the main detection methods for MODY genes. Although the cost of sequencing is constantly decreasing, genetic testing is still an expense that cannot be ignored, and the above-mentioned methods based on probes or primer pools all have the problems of high reagent costs and cumbersome detection processes. For example, the WES method involves more than 20,000 genes, and the amount of sequencing data is large, which causes unnecessary data waste for detecting only the MODY gene. The primer pool method requires a large number of primer pairs, high primer costs, and a large workload for primer design and optimization. Currently, there is no low-cost detection method for each pathogenic gene of MODY subtype that can detect variations in exons, introns, and UTR regions.

[0013] Therefore, there is an urgent need for a low-cost, efficient and accurate detection method for detecting different genotypes of MODY subtypes. Summary of the invention

[0014] In order to solve the above-mentioned technical problems existing in the prior art, the present disclosure provides a genotyping primer pair for MODY subtypes, a kit and a genotyping method for MODY subtypes. The genotyping method for MODY subtypes disclosed herein can use the primer pair provided by the present disclosure in combination with the second generation sequencing to detect the variation information of the pathogenic gene corresponding to the MODY subtype, so as to analyze and identify the MODY subtype. The primer pair, kit and method disclosed herein can be used to quickly diagnose and identify MODY subtype diabetes (e.g., MODY type 1, MODY type 2, MODY type 3, MODY type 4, MODY type 5, MODY type 6, MODY type 10, MODY type 13).

[0015] According to one aspect of the present disclosure, there is provided a primer pair for detecting MODY subtypes, comprising:

[0016] a forward primer selected from the group consisting of the nucleotide sequences shown in one or more of SEQ ID NOs: 1, 7, 13, 15, 17, 19, 37, 39, 49, 51, 53, 55, 73, 75, 77, 79, 81, 83, 109 and 115, or a nucleotide sequence having at least 65% identity thereto; and

[0017] The reverse primer is selected from the nucleotide sequences shown in one or more of SEQ ID NO: 2, 8, 14, 16, 18, 20, 38, 40, 50, 52, 54, 56, 74, 76, 78, 80, 82, 84, 110, 116, or a nucleotide sequence having at least 65% identity thereto.

[0018] In some embodiments, the primer pairs disclosed herein can be used to detect any variation in the entire gene sequence of one or more of the HNF4A, GCK, HNF1A, PDX1, HNF1B, NEUROD1, INS and KCNJ11 genes, including substitution, insertion and / or deletion mutations of one or more nucleotides.

[0019] The primer pairs disclosed in the present invention can be used to detect any one or more of MODY type 1, MODY type 2, MODY type 3, MODY type 4, MODY type 5, MODY type 6, MODY type 10 and MODY type 13 diabetes.

[0020] In some embodiments, the primer pair includes a primer pair for detecting HNF1B gene variation, comprising: a forward primer selected from the nucleotide sequence shown in one or more of SEQ ID NOs: 49, 51, 53 and 55, or a nucleotide sequence having at least 65% identity thereto; and, a reverse primer selected from the nucleotide sequence shown in one or more of SEQ ID NOs: 50, 52, 54 and 56, or a nucleotide sequence having at least 65% identity thereto. In some embodiments, the primer pair includes a primer pair for detecting HNF1B gene variation, comprising: a forward primer having a nucleotide sequence as shown in SEQ ID NO: 49, or a nucleotide sequence having at least 65% identity thereto; and, a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 50, or a nucleotide sequence having at least 65% identity thereto. In some embodiments, the primer pair includes a primer pair for detecting HNF1B gene variation, comprising: a forward primer having a nucleotide sequence as shown in SEQ ID NO:51, or a nucleotide sequence having at least 65% identity thereto; and, a reverse primer having a nucleotide sequence as shown in SEQ ID NO:52, or a nucleotide sequence having at least 65% identity thereto. In some embodiments, the primer pair includes a primer pair for detecting HNF1B gene variation, comprising: a forward primer having a nucleotide sequence as shown in SEQ ID NO:53, or a nucleotide sequence having at least 65% identity thereto; and, a reverse primer having a nucleotide sequence as shown in SEQ ID NO:54, or a nucleotide sequence having at least 65% identity thereto. In some embodiments, the primer pair includes a primer pair for detecting HNF1B gene variation, comprising: a forward primer having a nucleotide sequence as shown in SEQ ID NO:55, or a nucleotide sequence having at least 65% identity thereto; and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:56, or a nucleotide sequence having at least 65% identity thereto.

[0021] In some embodiments, the primer pair includes a primer pair for detecting KCNJ11 gene variation, which includes: a forward primer having a nucleotide sequence as shown in SEQ ID NO:115, or a nucleotide sequence having at least 65% identity thereto; and, a reverse primer having a nucleotide sequence as shown in SEQ ID NO:116, or a nucleotide sequence having at least 65% identity thereto.

[0022] In some embodiments, the primer pair includes a primer pair for detecting NEUROD1 gene variation, which includes: a forward primer having a nucleotide sequence as shown in SEQ ID NO:1, or a nucleotide sequence having at least 65% identity thereto; and, a reverse primer having a nucleotide sequence as shown in SEQ ID NO:2, or a nucleotide sequence having at least 65% identity thereto.

[0023] In some embodiments, the primer pair includes a primer pair for detecting PDX1 gene variation, which includes: a forward primer having a nucleotide sequence as shown in SEQ ID NO:7, or a nucleotide sequence having at least 65% identity thereto; and, a reverse primer having a nucleotide sequence as shown in SEQ ID NO:8, or a nucleotide sequence having at least 65% identity thereto.

[0024] In some embodiments, the primer pair includes a primer pair for detecting a GCK gene variation, comprising: a forward primer selected from the nucleotide sequence shown in one or more of SEQ ID NOs: 13, 15, 17 and 19, or a nucleotide sequence having at least 65% identity thereto; and, a reverse primer selected from the nucleotide sequence shown in one or more of SEQ ID NOs: 14, 16, 18 and 20, or a nucleotide sequence having at least 65% identity thereto. In some embodiments, the primer pair includes a primer pair for detecting a GCK gene variation, comprising: a forward primer having a nucleotide sequence as shown in SEQ ID NO: 13, or a nucleotide sequence having at least 65% identity thereto; and, a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 14, or a nucleotide sequence having at least 65% identity thereto. In some embodiments, the primer pair includes a primer pair for detecting a GCK gene variation, comprising: a forward primer having a nucleotide sequence as shown in SEQ ID NO: 15, or a nucleotide sequence having at least 65% identity thereto; and, a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 16, or a nucleotide sequence having at least 65% identity thereto. In some embodiments, the primer pair includes a primer pair for detecting a GCK gene variation, comprising: a forward primer having a nucleotide sequence as shown in SEQ ID NO: 17, or a nucleotide sequence having at least 65% identity thereto; and, a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 18, or a nucleotide sequence having at least 65% identity thereto. In some embodiments, the primer pair includes a primer pair for detecting GCK gene variation, which includes: a forward primer having a nucleotide sequence as shown in SEQ ID NO:19, or a nucleotide sequence having at least 65% identity thereto; and, a reverse primer having a nucleotide sequence as shown in SEQ ID NO:20, or a nucleotide sequence having at least 65% identity thereto.

[0025] In some embodiments, the primer pair includes a primer pair for detecting HNF1A gene variation, comprising: a forward primer selected from the nucleotide sequence shown in one or more of SEQ ID NOs: 37 and 39, or a nucleotide sequence having at least 65% identity thereto; and, a reverse primer selected from the nucleotide sequence shown in one or more of SEQ ID NOs: 38 and 40, or a nucleotide sequence having at least 65% identity thereto. In some embodiments, the primer pair includes a primer pair for detecting HNF1A gene variation, comprising: a forward primer having a nucleotide sequence as shown in SEQ ID NO: 37, or a nucleotide sequence having at least 65% identity thereto; and, a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 38, or a nucleotide sequence having at least 65% identity thereto. In some embodiments, the primer pair includes a primer pair for detecting HNF1A gene variation, comprising: a forward primer having a nucleotide sequence as shown in SEQ ID NO:39, or a nucleotide sequence having at least 65% identity thereto; and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:40, or a nucleotide sequence having at least 65% identity thereto.

[0026] In some embodiments, the primer pair includes a primer pair for detecting HNF4A gene variation, comprising: a forward primer selected from the nucleotide sequence shown in one or more of SEQ ID NOs: 73, 75, 77, 79, 81 and 83, or a nucleotide sequence having at least 65% identity thereto; and, a reverse primer selected from the nucleotide sequence shown in one or more of SEQ ID NOs: 74, 76, 78, 80, 82 and 84, or a nucleotide sequence having at least 65% identity thereto. In some embodiments, the primer pair includes a primer pair for detecting HNF4A gene variation, comprising: a forward primer having a nucleotide sequence as shown in SEQ ID NO: 73, or a nucleotide sequence having at least 65% identity thereto; and, a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 74, or a nucleotide sequence having at least 65% identity thereto. In some embodiments, the primer pair includes a primer pair for detecting HNF4A gene variation, comprising: a forward primer having a nucleotide sequence as shown in SEQ ID NO: 75, or a nucleotide sequence having at least 65% identity thereto; and, a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 76, or a nucleotide sequence having at least 65% identity thereto. In some embodiments, the primer pair includes a primer pair for detecting HNF4A gene variation, comprising: a forward primer having a nucleotide sequence as shown in SEQ ID NO: 77, or a nucleotide sequence having at least 65% identity thereto; and, a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 78, or a nucleotide sequence having at least 65% identity thereto. In some embodiments, the primer pair includes a primer pair for detecting HNF4A gene variation, comprising: a forward primer having a nucleotide sequence as shown in SEQ ID NO: 79, or a nucleotide sequence having at least 65% identity thereto; and, a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 80, or a nucleotide sequence having at least 65% identity thereto. In some embodiments, the primer pair includes a primer pair for detecting HNF4A gene variation, comprising: a forward primer having a nucleotide sequence as shown in SEQ ID NO: 81, or a nucleotide sequence having at least 65% identity thereto; and, a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 82, or a nucleotide sequence having at least 65% identity thereto.In some embodiments, the primer pair includes a primer pair for detecting HNF4A gene variation, comprising: a forward primer having a nucleotide sequence as shown in SEQ ID NO: 83, or a nucleotide sequence having at least 65% identity thereto; and a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 84, or a nucleotide sequence having at least 65% identity thereto.

[0027] In some embodiments, the primer pair includes a primer pair for detecting INS gene variation, comprising: a forward primer having a nucleotide sequence as shown in SEQ ID NO: 109, or a nucleotide sequence having at least 65% identity thereto; and, a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 110, or a nucleotide sequence having at least 65% identity thereto.

[0028] In some embodiments, the primer pairs can each independently amplify an amplification product of about 10 kb or more in length, preferably an amplification product of 10 to 15 kb.

[0029] In some embodiments, the above primer pairs or combinations thereof can be used to amplify the full length of a gene, including exons, introns, part of the 5' UTR and part of the 3' UTR of HNF4A, GCK, HNF1A, PDX1, HNF1B, NEUROD1, INS and KCNJ11 genes.

[0030] In some embodiments, the interval or gap between the respective amplification products of the above primer pairs is located in the intron of each gene.

[0031] According to another aspect of the present disclosure, a kit for detecting MODY subtype diabetes genotyping is provided, which comprises the above-mentioned primer pair of the present disclosure.

[0032] In some embodiments, the kit can be used to detect one or more of MODY type 1, MODY type 2, MODY type 3, MODY type 4, MODY type 5, MODY type 6, MODY type 10, and MODY type 13.

[0033] It is known to those skilled in the art that MODY is a monogenic diabetes, and the corresponding MODY subtype diabetes can be detected by detecting the pathogenic genes of each MODY subtype diabetes. For example, HNF1B gene variation corresponds to MODY type 5; KCNJ11 gene variation corresponds to MODY type 13 diabetes; HNF4A gene variation corresponds to MODY type 1 diabetes; GCK gene variation corresponds to MODY type 2 diabetes; HNF1A gene variation corresponds to MODY type 3 diabetes; PDX1 gene variation corresponds to MODY type 4 diabetes; NEUROD1 gene variation corresponds to MODY type 6 diabetes; INS gene variation corresponds to MODY type 10 diabetes.

[0034] In some embodiments, the kit may further include a fidelity DNA polymerase. In some embodiments, the DNA polymerase is capable of amplifying products of more than 10 kb. In some embodiments, the DNA polymerase is capable of amplifying products of 10 kb to 15 kb.

[0035] In some embodiments, the DNA polymerase can be selected by a person skilled in the art, for example, including, but not limited to, KOD FX DNA polymerase, Takara LA DNA polymerase and Taq DNA polymerase.

[0036] In some embodiments, the kit may further include a dNTP mix.

[0037] In some embodiments, the dNTP mixture can include dATP, dCTP, dGTP, and dTTP.

[0038] According to another aspect of the present disclosure, provided is the use of the primer pairs or kits of the present disclosure in detecting any variation in the full gene sequence of one or more of the HNF4A, GCK, HNF1A, PDX1, HNF1B, NEUROD1, INS and KCNJ11 genes, including substitution, insertion and / or deletion mutations of one or more nucleotides.

[0039] According to another aspect of the present disclosure, the use of the primer pair or kit of the present disclosure in detecting MODY subtype diabetes genes is provided. In some embodiments, MODY subtype diabetes can include the use of detecting any one or more of MODY type 1, MODY type 2, MODY type 3, MODY type 4, MODY type 5, MODY type 6, MODY type 10 and MODY type 13 diabetes.

[0040] In some embodiments, the primer pairs or kits disclosed herein can be used to amplify the full length of one or more genes in the HNF4A, GCK, HNF1A, PDX1, HNF1B, NEUROD1, INS and KCNJ11 genes. In some embodiments, the amplified product obtained by amplification using the primer pairs or kits disclosed herein can detect any mutation in the gene, such as nucleotide substitution, insertion and / or deletion mutation.

[0041] In some embodiments, the detection further includes using a next-generation sequencing method to identify the amplified product and obtain gene mutation information.

[0042] In some embodiments, the detection may include the following steps: 1) using the primer pair disclosed herein to amplify the genomic DNA of the sample as a template to obtain an amplified product; 2) using the amplified product to construct a sequencing library; and, 3) using a second-generation sequencing method to identify the sequencing library to obtain gene mutation information. In some embodiments, the mutation of the gene may include that the genomic DNA of the sample includes a substitution, insertion and / or deletion of one or more nucleotides compared to the wild-type genome.

[0043] In some embodiments, in the above step 1), the primer pair is annealed with the genomic DNA of the sample, preferably at a temperature of 60-68°C (e.g., 60°C, 61°C, 62°C, 63°C, 64°C, 65°C, 66°C, 67°C or 68°C).

[0044] In some embodiments, the amplification product of each primer pair may have a length of more than 10 kb. In some embodiments, the amplification product of each primer pair may have a length of 10 kb to 15 kb.

[0045] In some embodiments, the sample may be derived from tissue, feces, saliva, or blood. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1a The schematic diagram shows the positions of the primers for NEUROD1 gene amplification, where F: forward primer; R: reverse primer; black square: exon; black arrow: primer extension direction, and the NEUROD1 gene is amplified by one pair of primers.

[0047] Figure 1b The electrophoresis diagrams of PCR products of NEUROD1 gene using three sets of primer pairs are shown.

[0048] Figure 2aThe schematic diagram shows the positions of primers for amplifying the PDX1 gene, where F: forward primer; R: reverse primer; black square: exon; black arrow: primer extension direction, and the PDX1 gene is amplified by one pair of primers.

[0049] Figure 2b The electrophoresis diagrams of PCR products of the PDX1 gene using three sets of primer pairs are shown.

[0050] Figure 3a The schematic diagram shows the positions of the primers for amplifying the GCK gene, where F is the forward primer, R is the reverse primer, black squares are exons, and black arrows are the primer extension directions. The GCK gene is amplified by four pairs of primers.

[0051] Figure 3b The electrophoresis diagram of PCR products of GCK gene using 12 sets of primer pairs is shown.

[0052] Figure 4a The schematic diagram shows the positions of primers for amplifying the HNF1A gene, where F: forward primer; R: reverse primer; black square: exon; black arrow: primer extension direction. The HNF1A gene is amplified by two pairs of primers.

[0053] Figure 4b The electrophoresis diagram of PCR products of HNF1A gene using six sets of primer pairs is shown.

[0054] Figure 5a The schematic diagram shows the positions of primers for amplifying the HNF1B gene, where F: forward primer; R: reverse primer; black square: exon; black arrow: primer extension direction. The HNF1B gene is amplified by 4 pairs of primers.

[0055] Figure 5b The electrophoresis diagram of PCR products of HNF1B gene using 12 sets of primer pairs is shown.

[0056] Figure 6a The schematic diagram shows the positions of primers for amplifying the HNF4A gene, where F: forward primer; R: reverse primer; black square: exon; black arrow: primer extension direction. The HNF4A gene is amplified by 6 pairs of primers.

[0057] Figure 6b The electrophoresis diagram of PCR products of HNF4A gene using 12 sets of primer pairs is shown.

[0058] Figure 7a The schematic diagram shows the positions of the primers for INS gene amplification, where F is the forward primer, R is the reverse primer, black squares are exons, and black arrows are the primer extension directions. The INS gene is amplified by one pair of primers.

[0059] Figure 7bThe electrophoresis diagrams of PCR products of INS gene using three sets of primers are shown.

[0060] Figure 8a The schematic diagram shows the positions of the primers for amplifying the KCNJ11 gene, where F: forward primer; R: reverse primer; black square: exon; black arrow: primer extension direction, and the KCNJ11 gene is amplified by one pair of primers.

[0061] Figure 8b The electrophoresis diagrams of PCR products of KCNJ11 gene using three sets of primer pairs are shown.

[0062] Figure 9a The electrophoresis diagram of PCR products amplified by three different PCR enzymes for NEUROD1 gene is shown.

[0063] Figure 9b The electrophoresis diagram of PCR products amplified by three different PCR enzymes for PDX1 gene is shown.

[0064] Fig.9c The electrophoresis diagram of PCR products amplified by three different PCR enzymes for GCK gene is shown.

[0065] Figure 9d The electrophoresis diagram of PCR products amplified by three different PCR enzymes for HNF1A gene is shown.

[0066] Fig.9e The electrophoresis diagram of PCR products amplified by three different PCR enzymes for HNF1B gene is shown.

[0067] Figure 9f The electrophoresis diagram of PCR products amplified by three different PCR enzymes for HNF4A gene is shown.

[0068] Figure 9g The electrophoresis diagram of PCR products amplified by three different PCR enzymes for INS gene is shown.

[0069] Figure 9h The electrophoresis diagram of PCR products amplified by three different PCR enzymes for KCNJ11 gene is shown.

[0070] Fig.10a The figure shows the coverage of NEUROD1 gene displayed by IGV (Integrative genomics viewer, IGV), wherein the bottom is a schematic diagram of NEUROD1 gene, and the height of gray peaks indicates the coverage depth.

[0071] Fig.10b The results of first-generation sequencing of NEUROD1 gene in healthy samples are shown.

[0072] Fig.10cThe first generation sequencing test results of NEUROD1 gene of sample No. 1 are shown.

[0073] Fig.10d The results of first-generation sequencing of NEUROD1 gene in healthy samples are shown.

[0074] Fig.10e The first generation sequencing test results of NEUROD1 gene of sample No. 2 are shown.

[0075] Fig.11a The PDX1 gene coverage displayed by IGV is shown. The bottom is a schematic diagram of the PDX1 gene, and the height of the gray peak indicates the coverage depth.

[0076] Fig.11b The results of first-generation sequencing of the PDX1 gene in healthy samples are shown.

[0077] Fig.11c The first generation sequencing test results of the PDX1 gene of sample No. 1 are shown.

[0078] Fig.11d The results of first-generation sequencing of the PDX1 gene in healthy samples are shown.

[0079] Fig.11e The first generation sequencing test results of the PDX1 gene of sample No. 2 are shown.

[0080] Fig.12a The figure shows the coverage of the GCK gene displayed by IGV. The bottom is a schematic diagram of the GCK gene, and the height of the gray peak indicates the coverage depth.

[0081] Figure 12b The results of first-generation sequencing of the GCK gene in healthy samples are shown.

[0082] Fig.12c The first generation sequencing test results of the GCK gene of sample No. 1 are shown.

[0083] Fig.12d The results of first-generation sequencing of the GCK gene in healthy samples are shown.

[0084] Fig.12e The first generation sequencing test results of the GCK gene of sample No. 2 are shown.

[0085] Fig.12f The results of first-generation sequencing of the GCK gene in healthy samples are shown.

[0086] Figure 12g The first generation sequencing test results of the GCK gene of sample No. 3 are shown.

[0087] Fig.13aThe figure shows the HNF1A gene coverage displayed by IGV, where the bottom is a schematic diagram of the HNF1A gene, and the height of the gray peak indicates the coverage depth.

[0088] Fig.13b The results of first-generation sequencing of the HNF1A gene in healthy samples are shown.

[0089] Fig.13c The first generation sequencing test result of HNF1A gene of sample No. 1 is shown.

[0090] Fig.13d The results of first-generation sequencing of the HNF1A gene in healthy samples are shown.

[0091] Fig.13e The first generation sequencing test results of the HNF1A gene of sample No. 2 are shown.

[0092] Fig.13f The results of first-generation sequencing of the HNF1A gene in healthy samples are shown.

[0093] Figure 13g The first generation sequencing test results of the HNF1A gene of sample No. 3 are shown.

[0094] Fig.14a The figure shows the HNF1B gene coverage displayed by IGV, wherein the bottom is a schematic diagram of the HNF1B gene, and the height of the gray peak indicates the coverage depth.

[0095] Fig.14b The results of first-generation sequencing of the HNF1B gene in healthy samples are shown.

[0096] Fig.14c The first generation sequencing test result of HNF1B gene of sample No. 1 is shown.

[0097] Fig.14d The results of first-generation sequencing of the HNF1B gene in healthy samples are shown.

[0098] Fig.14e The first generation sequencing test result of HNF1B gene of sample No. 2 is shown.

[0099] Fig.15a The figure shows the HNF4A gene coverage displayed by IGV, wherein the bottom is a schematic diagram of the HNF4A gene, and the height of the gray peak indicates the coverage depth.

[0100] Fig.15b The results of first-generation sequencing of the HNF4A gene in healthy samples are shown.

[0101] Fig.15c The first generation sequencing test result of HNF4A gene of sample No. 1 is shown.

[0102] Fig.15d The results of first-generation sequencing of the HNF4A gene in healthy samples are shown.

[0103] Fig.15e The first generation sequencing test result of HNF4A gene of sample No. 2 is shown.

[0104] Fig.15f The results of first-generation sequencing of the HNF4A gene in healthy samples are shown.

[0105] Figure 15g The first generation sequencing test results of the HNF4A gene of sample No. 3 are shown.

[0106] Fig.16a The INS gene coverage displayed by IGV is shown in Figure 1. The bottom is a schematic diagram of the INS gene, and the height of the gray peak indicates the coverage depth.

[0107] Fig.16b The first generation sequencing test results of INS gene of healthy samples are shown.

[0108] Fig.16c The first generation sequencing test results of the INS gene of sample No. 1 are shown.

[0109] Fig.16d The first generation sequencing test results of INS gene of healthy samples are shown.

[0110] Fig.16e The first generation sequencing test results of the INS gene of sample No. 2 are shown.

[0111] Fig.16f The first generation sequencing test results of INS gene of healthy samples are shown.

[0112] Figure 16g The first generation sequencing test results of the INS gene of sample No. 3 are shown.

[0113] Fig.17a The figure shows the KCNJ11 gene coverage displayed by IGV. The bottom is a schematic diagram of the KCNJ11 gene, and the height of the gray peak indicates the coverage depth.

[0114] Fig.17b The first-generation sequencing test results of KCNJ11 gene of healthy samples are shown.

[0115] Fig.17c The first generation sequencing test results of the KCNJ11 gene of sample No. 1 are shown.

[0116] Fig.17d The first-generation sequencing test results of KCNJ11 gene of healthy samples are shown.

[0117] Fig.17e The first generation sequencing test results of KCNJ11 gene of sample No. 2 are shown.

[0118] Fig.18a KCNJ11 gene coverage is shown.

[0119] Fig.18b INS gene coverage is shown.

[0120] Fig.18c HNF1A gene coverage is shown.

[0121] Fig.18d PDX1 gene coverage is shown.

[0122] Fig.18e HNF1B gene coverage is shown.

[0123] Fig.18f HNF4A gene coverage is shown.

[0124] Figure 18g NEUROD1 gene coverage is shown.

[0125] Figure 18h GCK gene coverage is shown. DETAILED DESCRIPTION

[0126] At present, the examination of diabetes mainly includes traditional biochemical detection methods (such as blood sugar, urine sugar, insulin function, etc.) and genetic detection methods. However, biochemical detection methods are prone to false positive and false negative results, and some items need to be tested repeatedly, which makes it difficult to quantify.

[0127] Most of the existing gene sequencing methods are based on multiplex PCR combined with next-generation sequencing (NGS). Multiplex PCR requires the addition of multiple primer pairs, which cannot bind to each other or to regions other than the target fragment on the template DNA. Different amplified fragments in multiplex PCR will also compete for resources with each other, resulting in high-abundance templates being easily detected, while low-abundance templates will become background. Therefore, there are many technical difficulties in the early stage of primer design and optimization, which takes a long time.

[0128] On the other hand, the detection cost of the WES-based method is relatively high. Although the first-generation sequencing method is simple, its detection throughput is low, and it can only detect the variant sites on a gene fragment of about 400bp at a time, and currently it mainly detects known variant sites.

[0129] The present disclosure utilizes molecular biology techniques to combine long-fragment PCR with a second-generation sequencing method for MODY gene detection. In some embodiments, the present disclosure provides a primer pair and a detection method for identifying MODY type 13 diabetes by designing and screening long-fragment PCR primer pairs based on the size of the target gene KCNJ11, and by optimizing the PCR reaction system, selecting the PCR enzyme, adjusting the PCR extension time, etc.

[0130] In some embodiments, the primer pairs provided in the present disclosure can fully cover the target gene KCNJ11, including exons, introns, 5'UTR, 3'UTR and promoter regions, and the amplicons obtained in this way can be used to detect all known mutations and unknown mutations on the KCNJ11 gene. The present disclosure reduces the number of primer pairs used and reduces the detection cost through the long-fragment PCR method, and highly simplifies the experimental protocol.

[0131] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with embodiments. The specific embodiments described herein are only used to explain the present invention and are not intended to constitute any limitation of the present invention. In addition, in the following description, the description of known structures and technologies is omitted to avoid unnecessary confusion of the concepts of the present disclosure. Such structures and technologies are also described in many publications.

[0132] definition

[0133] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly used in the field to which the present invention belongs. For the purpose of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural form, and vice versa.

[0134] Unless the context clearly dictates otherwise, the expressions "a", "an" and "an" as used herein include plural references. For example, reference to "a cell" includes a plurality of such cells and equivalents thereof known to those skilled in the art, and so forth.

[0135] As used herein, the term "about" refers to a range of ±20% of the value that follows. In some embodiments, the term "about" refers to a range of ±10% of the value that follows. In some embodiments, the term "about" refers to a range of ±5% of the value that follows.

[0136] "Percent sequence identity," "percent identity," or "percent identity" between two polynucleotide or polypeptide sequences refers to the number of identical matching positions shared by the sequences over the comparison window, taking into account additions or deletions (i.e., gaps) that must be introduced for optimal alignment of the two sequences. A matching position is any position where the same nucleotide or amino acid is present in both the target sequence and the reference sequence. Since a gap is not a nucleotide or amino acid, gaps present in the target sequence are not counted. Likewise, since target sequence nucleotides or amino acids are counted and nucleotides or amino acids from the reference sequence are not counted, gaps present in the reference sequence are not counted.

[0137] The sequence identity percentage can be calculated by the following process: determine the number of positions where the same amino acid residue or nucleic acid base occurs in both sequences to obtain the number of matching positions, divide the number of matching positions by the total number of positions in the comparison window, and multiply the result by 100 to obtain the sequence identity percentage. The determination of the sequence identity percentage between the comparison of the sequence and the two sequences can be completed using software that is easy to use and download online. Suitable software programs can be obtained from various sources for the comparison of protein and nucleotide sequences. A suitable program for determining the sequence identity percentage is bl2seq, which is a part of the BLAST program suite that can be obtained from the BLAST website (blast.ncbi.nlm.nih.gov) of the National Center for Biotechnology Information of the U.S. Government. Bl2seq uses BLASTN or BLASTP algorithms to compare between two sequences. BLASTN is used for comparing nucleic acid sequences, and BLASTP is used for comparing amino acid sequences. Other suitable programs are, for example, Needle, Stretcher, Water or Matcher, part of the EMBOSS suite of bioinformatics programs, and also available from the European Bioinformatics Institute (EBI) at www.ebi.ac.uk / Tools / psa. In the present disclosure, when compared to a sequence, another sequence having at least 60% sequence identity with the sequence encompasses having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.3%, at least 999.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9% or 100% sequence identity with the sequence.

[0138] The term "primer" as used herein is generally a nucleic acid that can hybridize with a template nucleic acid and allow chain extension or elongation by using, for example, a biocatalyst that can incorporate nucleotides, such as a thermostable polymerase under appropriate reaction conditions. Typical primer nucleic acids are natural or synthetic oligonucleotides (e.g., single-stranded oligodeoxynucleotides, etc.). Although other primer nucleic acid lengths can be used arbitrarily, the length is generally between 15 and 35 nucleotides. A relatively low temperature (Tm) is generally used to allow short primer nucleic acids to form a stable hybridization complex (also referred to as "annealing") with template nucleic acids. Primer nucleic acids that are complementary to at least a portion of the sequence of the template nucleic acid are sufficient to hybridize with the template nucleic acid to allow extension to occur. In addition, primer nucleic acids can easily serve as biocatalyst substrates for nucleotide incorporation in a template-dependent manner.

[0139] The term "second generation sequencing" used herein refers to a method including large-scale parallel sequencing, which provides a much higher sequence output than traditional sequencing (e.g., traditional Sanger sequencing). The term is also generally defined as "deep sequencing" or "second generation sequencing" (Metzker, ML, Nat. Rev. Genet. 11 (2010) 31-46; Mardis, ER, Annu. Rev. Genom. Hum. Genet. 9 (2008) 387-402). The use of second generation sequencing methods allows sequencing data to be obtained in a very short time. Different technologies for performing next-generation sequencing are commercially available, such as pyrosequencing (454 Life Sciences, Roche Diagnostics Corp., Basel, Switzerland), sequencing by synthesis (HiSeq™ and MiSeq™, Illumina, Inc., San Diego, CA), sequencing by ligation (SOLiD™, Life Technologies Corp. Logan, UT), Polonator sequencing, ion semiconductor sequencing (Ion PGM™ and Ion Proton™, Life Technologies Corp., Logan, UT), Ion Torrent sequencing, nanopore sequencing, single-molecule real-time sequencing (SMRT™, Pacific Biosciences, Menlo Park, CA), HeliScope single-molecule sequencing, tunneling current sequencing, hybridization sequencing, mass spectrometry sequencing, microfluidic Sanger sequencing, RNA polymerase (RNAP) sequencing, and the like.

[0140] Examples and drawings are provided below to help understand the present invention. However, it should be understood that these examples and drawings are only used to illustrate the present invention, but do not constitute any limitation. The actual protection scope of the present invention is set forth in the claims. It should be understood that any modifications and changes can be made without departing from the spirit of the present invention.

[0141] Example

[0142] The test methods in the embodiments of the present invention are conventional methods unless otherwise specified.

[0143] Unless otherwise specified, the test materials used in the examples of the present invention are all commercially available conventional biochemical reagents.

[0144] Materials and methods

[0145] Sample source and processing

[0146] Blood samples were obtained from Shanghai Sixth People's Hospital, and the patients had signed the informed consent for this study. The blood samples were extracted using the Tiangen Blood Genomic DNA Extraction Kit (P348-03, Tiangen Biochemical Technology) to obtain gDNA.

[0147] Long-range PCR

[0148] PCR was performed on blood gDNA samples of qualified quality.

[0149] 1. Use KOD FX Neo (KFX-201, TOYOBO) to perform PCR. The PCR reaction system is shown in Table 1 or Table 2, and the PCR reaction program is shown in Table 3.

[0150] Table 1. KOD FX PCR reaction system 1 configuration

[0151]

[0152]

[0153] Table 2 KOD FX PCR reaction system 2 configuration

[0154] name Volume (μL) KOD FX 0.5 2×KOD Buffer 12.5 2mM dNTP 5 Forward primer (10 μM) 0.375 Reverse primer (10 μM) 0.375 DNA 50ng <![CDATA[H2O]]> Top up to 25

[0155] Table 3. KOD FX PCR reaction program

[0156]

[0157] 2. Use TaKaRa LA The PCR reaction system and PCR reaction program are shown in Table 4 and Table 5, respectively.

[0158] Table 4 TaKaRa LAPCR reaction system configuration

[0159] name Volume (μL) Takara LA Taq 0.5 10×LA buffer 5 dNTP mix (2.5 mM) 8 Primer mix (10 μM) 1 DNA 50ng <![CDATA[H2O]]> Top up to 50

[0160] Table 5 TaKaRa LA PCR reaction program

[0161]

[0162] 3. Use Hot Start Taq DNA Polymerase (NEB) was used for PCR. The PCR reaction system and PCR reaction program are shown in Table 6 and Table 7, respectively.

[0163] Table 6 NEB PCR reaction system configuration

[0164] name Volume (μL) NEB Taq 1 5×buffer 5 dNTP mix (2.5 mM) 3 Primer mix (10 μM) 1 DNA 50ng <![CDATA[H2O]]> Top up to 25

[0165] Table 7 NEB PCR reaction program

[0166]

[0167] Next-generation sequencing library preparation

[0168] The PCR products were used to construct a library using the Twist EF library preparation kit (104119, Twist Bioscience).

[0169] Configure the enzyme digestion reaction system according to Table 8, set the enzyme digestion reaction program according to Table 9 and run it.

[0170] Table 8 Enzyme Digestion Reaction System

[0171] name Volume μL Frag / AT Buffer 4 Frag / AT enzyme 6 DNA 40 Total 50

[0172] Table 9 Reaction Procedure

[0173] temperature time 4℃ Keep 37℃ 15min 65℃ 30min 4℃ Keep

[0174] After the reaction is completed, 5 μL Twist Universal Adapters and 20 μL Ligation Master Mix are added to the above reaction product, gently mixed, and run on a PCR instrument at 20°C for 15 minutes to obtain the adapter ligation product.

[0175] The adapter ligation product was purified using 60 μL AMPure beads (purification magnetic beads) and eluted with 15 μL water.

[0176] Configure the PCR reaction system according to Table 10, set the PCR program according to Table 11 and run.

[0177] Table 10 Sequencing PCR reaction system

[0178] name Volume μL Twist UDIPrimer 10 Equinox Library Amp Mix 25 DNA 15 total 50

[0179] Table 11 Sequencing PCR reaction program

[0180]

[0181]

[0182] After the reaction was completed, 50 μL AMPure beads (purification magnetic beads) were used to purify the PCR product, and 30 μL water was used to elute to obtain the final library.

[0183] Next-generation sequencing and data analysis

[0184] The constructed library was sequenced using BGI MGISeq-T7 in PE-150 mode.

[0185] The sequencing sequences were aligned to the human genome GRCh38 reference sequence using BWA software, the sequences were sorted and deduplicated using Samtools software, and variants were detected using GATK software to obtain vcf files containing variant information.

[0186] The data coverage of each gene was checked using IGV software.

[0187] Example 1. Selection of primers for NEUROD1 gene amplification

[0188] 1) Primer design

[0189] The NEUROD1 gene was amplified using a pair of primers. The amplification length of the primers was controlled between 10 and 15 kb. The primers were set as follows: Figure 1a shown.

[0190] Three sets of primers were designed using Primer Premier 5 software to test the amplification effect. The primers were synthesized by Beijing Qingke Biotechnology Co., Ltd. (the same below). The primer information is shown in Table 12.

[0191] Table 12 NEUROD1 gene primer sequence information

[0192]

[0193] 2) Primer verification

[0194] Blood gDNA was used as a template and PCR amplification was performed according to KOD FX PCR reaction system 1. Agarose gel electrophoresis was used to check the quality of the amplified product. Figure 1b shown.

[0195] from Figure 1b It can be seen that by comparing the results, primers in group 1 were selected as the optimal primer combination, with a fragment length between 10 and 15 kb, primers in group 2 had a low amplification efficiency, and primers in group 3 had non-specific amplification.

[0196] Example 2. Selection of primers for PDX1 gene amplification

[0197] 1) Primer design

[0198] The PDX1 gene was amplified using a pair of primers. The amplification length of the primers was controlled between 10 and 15 kb. The primers were set as follows: Figure 2a shown.

[0199] Three sets of primers were designed using Primer Premier 5 software to test the amplification effect. The primer information is shown in Table 13.

[0200] Table 13 PDX1 gene primer sequence information

[0201]

[0202] 2) Long fragment PCR

[0203] Blood gDNA was used as a template and PCR amplification was performed according to KOD FX PCR reaction system 1. Agarose gel electrophoresis was used to check the quality of the amplified product. Figure 2b shown.

[0204] from Figure 2b It can be seen that by comparing the results, group 1 primers were selected as the optimal primer combination, with a fragment length between 10-15 kb, group 2 primers exhibited non-specific amplification, and group 3 primers had a lower amplification efficiency than group 1 primers.

[0205] Example 3. Selection of primers for GCK gene amplification

[0206] 1) Primer design

[0207] Four sets of primer pairs were designed to amplify the GCK gene. The amplification length of each pair of primers was controlled between 10 and 15 kb. The gap between each amplification product was located in the intron region. The primers were set as follows: Figure 3a shown.

[0208] Primer pairs 1, 2, 3, and 4 are combination 1, primer pairs 5, 6, 7, and 8 are combination 2, and primer pairs 9, 10, 11, and 12 are combination 3. The primer pairs in each combination amplify fragments 1, 2, 3, and 4 of the GCK gene, respectively. The primer sequences are shown in Table 14 below.

[0209] Table 14 GSK gene primer sequence information

[0210]

[0211] 2) Multiplex long fragment PCR

[0212] Blood gDNA was used as a template and PCR amplification was performed according to KOD FX PCR reaction system 1. Agarose gel electrophoresis was used to check the quality of the amplified product. Figure 3b As shown. Figure 3b As can be seen, the products amplified by primer pairs 1 to 4 of combination 1 all showed bright bands and no mixed bands; other combinations of primer pairs had problems of non-specific amplification or low amplification efficiency. Therefore, in order to ensure the quality and amplification efficiency of the amplified products, combination 1 consisting of primer pairs 1, 2, 3, and 4 was selected as the optimal primer pair combination, and the fragment length was between 10-15 kb.

[0213] Example 4. Selection of primers for HNF1A gene amplification

[0214] In this example, primers for HNF1A gene amplification were screened.

[0215] 1) PCR primer design

[0216] HNF1A was amplified using two sets of primers. The amplification length of each pair of primers was controlled between 10-15 kb. The gap between the amplified products was placed in the intron region. The primers were set as follows: Figure 4a shown.

[0217] Six groups of primers were designed to test the amplification effect, where groups 1, 3, and 5 amplified fragment 1, and groups 2, 4, and 6 amplified fragment 2. The primer sequences are shown in Table 15 below.

[0218] Table 15 HNF1A gene primer sequence information

[0219]

[0220] 2) Long fragment PCR

[0221] Blood gDNA was used as a template and PCR amplification was performed according to KOD FX PCR reaction system 2. Agarose gel electrophoresis was used to check the quality of the amplified product. Figure 4b As shown. Figure 4b As can be seen, the products amplified using primer combination 1 all showed bright bands and no mixed bands; other primer combinations had problems of non-specific amplification or low amplification efficiency. The primer pair of combination 1 was selected as the optimal primer combination.

[0222] Example 5. HNF1B gene amplification reaction system

[0223] 1) PCR primer design

[0224] Four sets of primer pairs were designed to amplify the HNF1B gene. The amplification length of each primer pair was controlled between 10 and 15 kb. The gap between each amplification product was located in the intron region. The primers were set as follows: Figure 5a shown.

[0225] Primer pairs 1, 2, 3, and 4 are combination 1, primer pairs 5, 6, 7, and 8 are combination 2, and primer pairs 9, 10, 11, and 12 are combination 3. The primer pairs in each combination amplify fragments 1, 2, 3, and 4 of the HNF1B gene, respectively. The primer sequences are shown in Table 16 below.

[0226] Table 16 HNF1B gene amplification primer sequence information

[0227]

[0228]

[0229] 2) Long fragment PCR

[0230] Blood gDNA was used as a template and PCR amplification was performed according to KOD FX PCR reaction system 2. Agarose gel electrophoresis was used to check the quality of the amplified product. Figure 5b As shown. Primer pairs 1, 2, 3, 4, 5, and 9 can all be effectively amplified, while other primer pairs have the problem of non-specific amplification. Finally, the four primer pairs of combination 1 were selected as the optimal combination, and the fragment length was between 10-15 kb.

[0231] Example 6. HNF4A gene amplification reaction system

[0232] 1) PCR primer design

[0233] The HNF4A gene was amplified using 6 sets of primers. The amplification length of each pair of primers was controlled between 10-15 kb. The gap between the amplified products was placed in the intron region. The primers were set as follows: Figure 6a shown.

[0234] A total of 12 sets of primers were designed using Primer Premier 5 software to test the amplification effect, wherein sets 1, 2, 3, 4, 5, and 6 are one combination, sets 7, 8, 9, 10, 11, and 12 are one combination, and sets 13, 14, 15, 16, 17, and 18 are one combination, each corresponding to amplifying fragments 1, 2, 3, 4, 5, and 6 of the HNF4A gene. The primer sequences are shown in Table 17 below.

[0235] Table 17 HNF4A gene amplification primer sequence information

[0236]

[0237]

[0238] 2) Long fragment PCR

[0239] Blood gDNA was used as a template and PCR amplification was performed according to KOD FX PCR reaction system 1. Agarose gel electrophoresis was used to check the quality of the amplified product. Figure 6b As shown, by comparing the results, combination 1 primers were screened as the optimal primer combination, with a fragment length between 10-15 kb, and other primers had the problem of non-specific amplification or low amplification efficiency.

[0240] Example 7. INS gene amplification reaction system

[0241] 1) PCR primer design

[0242] The INS gene was amplified by a pair of primers. The amplification length of each pair of primers was controlled between 10-15 kb. The primers were set as follows: Figure 7a shown.

[0243] Three sets of primers were designed using Primer Premier 5 software to test the amplification effect. The primer sequences are shown in Table 18 below.

[0244] Table 18 INS gene amplification primer sequence information

[0245]

[0246] 2) Long fragment PCR

[0247] Blood gDNA was used as a template and PCR amplification was performed according to KOD FX PCR reaction system 1. Agarose gel electrophoresis was used to check the quality of the amplified product. Figure 7b As shown, by comparing the results, combination 1 primers were screened as the optimal primer combination, with a fragment length between 10-15 kb, and other primers had problems of non-specific amplification or amplification failure.

[0248] Example 8. KCNJ11 gene amplification reaction system

[0249] In this example, primers for KCNJ11 gene amplification were screened.

[0250] 1) PCR primer design

[0251] Three sets of primer pairs were designed to amplify the KCNJ11 gene. The amplification length of each primer pair was controlled between 10 and 15 kb. The primer settings were as follows: Figure 8a A total of 3 sets of primer pairs were designed to test the amplification effect, and the primer sequences are shown in Table 19 below.

[0252] Table 19. KCNJ11 gene amplification primer sequence information:

[0253]

[0254] 2) Long fragment PCR:

[0255] Blood gDNA was used as a template and PCR amplification was performed according to KOD FX PCR reaction system 2. Agarose gel electrophoresis was used to check the quality of the amplified product. Figure 8b As shown, by comparing the results, combination 1 primers were selected as the optimal primer combination, with a fragment length between 10-15 kb. The product amplified by combination 2 primers showed a bright band but contained other miscellaneous bands, and combination 3 had no amplified product.

[0256] Example 9. Selection of PCR enzyme

[0257] In this example, three enzymes were used for PCR test comparison, wherein the primers used were the primer combinations screened in Examples 1 to 8, and the samples used were blood gDNA.

[0258] KOD FX Neo (KFX-201, TOYOBO), TaKaRa LA Hot Start Version (RR042B, TaKaRa) and Hot Start Taq DNA Polymerase (M0534, NEB) was used as a DNA amplification enzyme, and the primer sets with the best amplification effects screened in Examples 1 to 8 were used to perform PCR amplification with blood gDNA. The primer sets for NEUROD1, PDX1, GCK, HNF1A, HNF1B, HNF4A, INS, and KCNJ11 genes were all the primer pairs of combination 1 in each example.

[0259] Agarose gel electrophoresis was used to check the quality of the amplified products. Figure 9a to Figure 9h shown.

[0260] Depend on Figure 9a It can be seen that the three PCR enzymes can effectively amplify the target fragment of NEUROD1 gene.

[0261] Depend on Figure 9bIt can be seen that the three PCR enzymes have a strong affinity for PDX1 gene, among which KOD FX Neo and TaKaRa LA HotStart DNA polymerase gave better amplification results. Hot Start Taq DNA polymerase can cause non-specific amplification.

[0262] Depend on Fig.9c It can be seen that the three PCR enzymes can effectively amplify the target fragment of the GCK gene.

[0263] Depend on Figure 9d It can be seen that the three PCR enzymes can effectively amplify the target fragment of HNF1A gene.

[0264] Depend on Fig.9e It can be seen that the three PCR enzymes can effectively amplify the target fragment of HNF1B gene.

[0265] Depend on Figure 9f It can be seen that the three PCR enzymes can effectively amplify the target fragment of HNF4A gene.

[0266] Depend on Figure 9g It can be seen that the amplification results of the INS gene by the three PCR enzymes are better with KOD FX NeoDNA polymerase and TaKaRa LA Hot Start DNA amplification has low efficiency and non-specific amplification occurs. Hot Start Taq DNA amplification failed.

[0267] Depend on Figure 9h It can be seen that the three PCR enzymes can effectively amplify the target fragment of KCNJ11 gene.

[0268] Example 10. Genetic testing / verification of MODY6 positive samples

[0269] In this example, the primers in Group 1 selected in Example 1 were used to detect blood samples from two patients clinically diagnosed as MODY6-positive, and the blood samples were extracted using the Tiangen Blood Genomic DNA Extraction Kit (P348-03, Tiangen Biochemical Technology) to obtain gDNA.

[0270] 1. Long fragment PCR:

[0271] The primer pair combinations screened in Example 1 were mixed in equal proportions and diluted to a concentration of 10 μM to prepare a primer mixture.

[0272] Use KOD FX Neo (KFX-201, TOYOBO) PCR reaction system 1 to configure, set the PCR program, and run.

[0273] 2. Next-generation sequencing (NGS) library preparation:

[0274] The PCR products were used to construct a library using the Twist EF library preparation kit (104119, Twist Bioscience).

[0275] 3. Sequencing and data analysis:

[0276] The obtained library was sequenced using BGI MGISeq-T7, with sequencing mode PE-150.

[0277] The sequencing sequences were aligned to the human genome GRCh38 reference sequence using BWA software, the sequences were sorted and deduplicated using Samtools software, and variants were detected using GATK software to obtain vcf files containing variant information.

[0278] Check the data coverage of NEUROD1 gene by IGV software (such as Fig.10a As shown in the figure, it can be seen that all regions amplified by the primers are effectively covered.

[0279] The mutation detection results are shown in Table 20 below.

[0280] Table 20

[0281] Serial number Mutation information Chromosome location (GRCh38) Gene Ref Alt Test results 1 NM_002500.5:c.175G>C:p.E59Q chr2:181678686 NEUROD1 G C G / C 2 NM_002500.5:c.751G>T:p.A251S chr2:181678110 NEUROD1 G T G / T

[0282] Note: Ref: wild genotype; Alt mutant genotype; test result 0 / 1 indicates heterozygosity, followed by allele sequencing depth. (same below)

[0283] 4. First-generation sequencing verification:

[0284] The results of the second-generation sequencing were verified by first-generation sequencing. The samples of the above two patients clinically diagnosed as MODY6-positive were used for first-generation sequencing, and blood gDNA from healthy subjects was used as a wild-type control.

[0285] 1) The 100bp sequences of the variant NM_002500.5: c.175G>C (underlined bases) of sample No. 1 are as follows. DNA fragments containing the following sequences were amplified from patient sample No. 1 and wild-type control sample by PCR and sequenced for the first generation. The sequencing results of the wild-type are as follows Fig.10b As shown, the sequencing results of sample 1 are as follows Fig.10c shown.

[0286] >hg38_dna range=chr2:181678586-181678786, SEQ ID NO: 121

[0287] GTGTCTCAGTTCTCAGGACGAGGAGCACGAGGCAGACAAGAAGGAGGACGACCTCGAAACCATGAACGCAGAGGAGGACTCACTGAGGAACGGGGGAGAG G AGGAGGACGAAGATGAGGACCTGGAAGAGGAGGAAGAAGAGGAAGAGGAGGATGACGATCAAAAGCCCAAGAGACGCGGCCCCAAAAAGAAGAAGATGAC

[0288] 2) The 100bp sequences upstream and downstream of the variant NM_002500.5: c.751G>T (underlined bases) of sample No. 2 are as follows. DNA fragments containing the following sequences were amplified from patient sample No. 2 and wild-type control sample by PCR and sequenced for the first generation. The sequencing results of the wild-type are as follows Fig.10d As shown in Figure 2, the sequencing results of sample No. 2 are as follows Fig.10e shown.

[0289] >hg38_dna range=chr2:181678010-181678210, SEQ ID NO: 122

[0290] CCCCTACTCCTACCAGTCGCCTGGGCTGCCCAGTCCGCCTTACGGTACCATGGACAGTCCCCATGTCTTCCACGTTAAGCCTCCGCCGCACGCCTACAGC G CAGCGCTGGAGCCCTTCTTTGAAAGCCCTCTGACTGATTGCACCAGCCCTTCCTTTGATGGACCCCTCAGCCCGCCGCTCAGCATCAATGGCAACTTCTC

[0291] The above results are the same as those of the second generation sequencing detection method. The first generation sequencing results verified that the accuracy of the detection method is 100%.

[0292] Example 11. Detection / verification of PDX1 gene in MODY4 positive samples

[0293] In this example, the primers in Group 1 selected in Example 2 were used to detect blood samples from two patients clinically diagnosed as MODY4-positive, and the blood samples were extracted using the Tiangen Blood Genomic DNA Extraction Kit (P348-03, Tiangen Biochemical Technology) to obtain gDNA.

[0294] 1. Long fragment PCR:

[0295] The primer pairs of Group 1 screened in Example 2 were mixed in equal proportions and diluted to a concentration of 10 μM to prepare a primer mixture.

[0296] Use KOD FX Neo (KFX-201, TOYOBO) PCR reaction system 1 to configure, set the PCR program, and run.

[0297] 2. Next-generation sequencing (NGS) library preparation:

[0298] The PCR products were used to construct a library using the Twist EF library preparation kit (104119, Twist Bioscience).

[0299] 3. Sequencing and data analysis:

[0300] The obtained library was sequenced using BGI MGISeq-T7, with sequencing mode PE-150.

[0301] The sequencing sequences were aligned to the human genome GRCh38 reference sequence using BWA software, the sequences were sorted and deduplicated using Samtools software, and variants were detected using GATK software to obtain vcf files containing variant information.

[0302] Use IGV software to check the data coverage of PDX1 gene (such as Fig.11a ), it can be seen that all regions amplified by the primers are effectively covered.

[0303] The mutation detection results are shown in Table 21 below.

[0304] Table 21

[0305] Serial number Mutation information Chromosome location (GRCh38) Gene Ref Alt Test results 1 NM_000209.4:c.697G>A:p.E233K chr13:27924546 PDX1 G A G / A 2 NM_000209.4:c.398A>G:p.Q133R chr13:27920536 PDX1 A G A / G

[0306] 4. First-generation sequencing verification

[0307] The results of the second generation sequencing were verified by first generation sequencing. Blood gDNA from healthy subjects was used as a wild type control.

[0308] 1) The 100bp sequences upstream and downstream of the variant NM_000209.4:c.697G>A:p.E233K (underlined bases) of sample No. 1 are as follows. DNA fragments containing the following sequences were amplified from patient No. 1 sample and wild-type control by PCR and sequenced for the first generation. The sequencing results of the wild-type are as follows Fig.11b As shown, the sequencing results of sample 1 are as follows Fig.11c shown.

[0309] >hg38_dna range=chr13:27924446-27924646, SEQ ID NO: 123

[0310] GAAGTGGAAAAAGGAGGAGGACAAGAAGCGCGGCGGCGGGACAGCTGTCGGGGGTGGCGGGGTCGCGGAGCCTGAGCAGGACTGCGCCGTGACCTCCGGC G AGGAGCTTCTGGCGCTGCCGCCGCCGCCGCCCCCCGGAGGTGCTGTGCCGCCCGCTGCCCCCGTTGCCGCCCGAGAGGGCCGCCTGCCGCCTGGCCTTAG

[0311] 2) The 100bp sequences upstream and downstream of the variant NM_000209.4:c.398A>G:p.Q133R (underlined bases) of sample No. 2 are as follows. DNA fragments containing the following sequences were amplified from patient No. 2 sample and wild-type control by PCR and sequenced for the first generation. The sequencing results of the wild-type are as follows Fig.11d As shown, the sequencing results of sample No. 2 are as follows Fig.11e shown.

[0312] >hg38_dna range=chr13:27920436-27920636, SEQ ID NO: 124

[0313] TTCCCGGAGGGAGCCGAGCCGGGCGTCCTGGAGGAGCCCAACCGCGTCCAGCTGCCTTTCCCATGGATGAAGTCTACCAAAGCTCACGCGTGGAAAGGCC A GTGGGCAGGTAAGCCTGGCTCCCCACCCCTTTCTCCTTTCCGGTTCTCACCCGGCCGCCTTACCTCCAAGCGCTCCCAGGAGCCTTCTCTCTGTTCCCGG

[0314] The above results are the same as those of the second generation sequencing detection method. The first generation sequencing results verified that the accuracy of the detection method is 100%.

[0315] Example 12 Detection / verification of GCK gene in MODY2 positive samples

[0316] In this example, primer pairs 1, 2, 3, and 4 screened in Example 3 were used to detect blood samples from three patients clinically diagnosed as MODY type 2 positive, and the blood samples were extracted using the Tiangen Blood Genomic DNA Extraction Kit (P348-03, Tiangen Biochemical Technology) to obtain gDNA.

[0317] 1. Multiplex long fragment PCR:

[0318] The primer pairs 1 to 4 screened in Example 3 were mixed in equal proportions and diluted to a concentration of 10 μM, and each diluted primer pair was mixed in equal proportions to prepare a primer mixture.

[0319] Use KOD FX Neo (KFX-201, TOYOBO) PCR reaction system 1 to configure, set the PCR program, and run.

[0320] 2. Next-generation sequencing (NGS) library preparation:

[0321] The PCR products were used to construct a library using the Twist EF library preparation kit (104119, Twist Bioscience).

[0322] 3. Sequencing and data analysis:

[0323] The obtained library was sequenced using BGI MGISeq-T7, with sequencing mode PE-150.

[0324] The sequencing sequences were aligned to the human genome GRCh38 reference sequence using BWA software, the sequences were sorted and deduplicated using Samtools software, and variants were detected using GATK software to obtain vcf files containing variant information.

[0325] Check the data coverage of GCK gene by IGV software (such as Fig.12a ), it can be seen that all regions amplified by the primers are effectively covered.

[0326] The mutation detection results are shown in Table 22 below.

[0327] Table 22

[0328]

[0329]

[0330] 4. First-generation sequencing verification

[0331] The results of the second generation sequencing were verified by first generation sequencing. Blood gDNA from healthy subjects was used as a wild type control.

[0332] 1) For sample No. 1, the 100bp sequences upstream and downstream of the variant site NM_000162.5: exon8: c.1019+20G>A (underlined bases) are as follows. DNA fragments containing the following sequences were amplified from patient No. 1 sample and wild-type control by PCR, and first-generation sequencing was performed. The sequencing results of the wild-type are as follows Figure 12b As shown, the sequencing results of sample 1 are as follows Fig.12c shown.

[0333] >hg38_dna range=chr7:44146343-44146543, SEQ ID NO: 125

[0334] CCTGCTCTTCCACGGGGAGGCCTCCGAGCAGCTGCGCACACGCGGAGCCTTCGAGACGCGCTTCGTGTCGCAGGTGGAGAGGTGTGCGGAGGAGGAGGGT G GGTGCAAAGGGCAGGGGCTGGGGACGCCCGGGCACTGCAGACTTGGTCTCAGGGCGACGCTGAGTCCCAGGCCCGGGGCGCAGGGATGGGAAAACTAGGGC

[0335] 2) For sample No. 2, the 100bp sequences upstream and downstream of the variant site NM_000162.5:c.746delG:p.G249Afs*45 (underlined bases) are as follows. DNA fragments containing the following sequences were amplified from patient No. 2 sample and wild-type control by PCR, and first-generation sequencing was performed. The sequencing results of the wild-type are as follows Fig.12d As shown, the sequencing results of sample No. 2 are as follows Fig.12e shown.

[0336] >hg38_dna range=chr7:44147667-44147867, SEQ ID NO: 126

[0337] CTCTCGCTGACAGTCCCCCCGACCTCCACCCCAGGCACGGGCTGCAATGCCTGCTACATGGAGGAGATGCAGAATGTGGAGCTGGTGGAGGGGGACGAGG GCCGCATGTGCGTCAATACCGAGTGGGGCGCCTTCGGGGACTCCGGCGAGCTGGACGAGTTCCTGCTGGAGTATGACCGCCTGGTGGACGAGAGCTCTGCA

[0338] 3) For sample No. 3, the 100bp sequences upstream and downstream of the variant site NM_000162.5: exon2: c.146C>A: p.T49N (underlined bases) are as follows. DNA fragments containing the following sequences were amplified from patient No. 3 sample and wild-type control by PCR, and first-generation sequencing was performed. The sequencing results of the wild-type are as follows Fig.12f As shown in Figure 2, the sequencing results of sample No. 3 are as follows: Figure 12g shown.

[0339] >hg38_dna range=chr7:44153263-44153463, SEQ ID NO: 127

[0340] GTAGAGCAGATCCTGGCAGAGTTCCAGCTGCAGGAGGAGGACCTGAAGAAGGTGATGAGACGGATGCAGAAGGAGATGGACCGCGGCCTGAGGCTGGAGA C CCATGAAGAGGCCAGTGTGAAGATGCTGCCCACCTACGTGCGCTCCACCCCAGAAGGCTCAGGTACCACATGGTAACCGGCTCCTCATCCAGAAGCAGCT

[0341] from Figure 12b and Fig.12c It can be seen that the first-generation sequencing results of sample No. 1 showed a C / T mutation at the position corresponding to chr7: 44146443, and it was a heterozygous type.

[0342] from Fig.12d and Fig.12e It can be seen that the test results of sample No. 2 show that the corresponding chr7:44147767 position is a continuous double peak caused by the deletion of one base, and it is a heterozygous type.

[0343] from Fig.12f and Figure 12g It can be seen that the test results of sample No. 3 show that the corresponding position of chr7:44153363 is a G / T mutation, and it is a heterozygous type.

[0344] The above results are the same as those of the second generation sequencing detection method. The first generation sequencing results verified that the accuracy of the detection method is 100%.

[0345] Example 13 Detection / verification of HNF1A gene in MODY3 positive samples

[0346] In this example, the primer combination screened in Example 4 was used to detect blood samples from three patients clinically diagnosed as MODY type 3 positive, and the blood samples were extracted using the Tiangen Blood Genomic DNA Extraction Kit (P348-03, Tiangen Biochemical Technology) to obtain gDNA.

[0347] 1. Multiplex long fragment PCR:

[0348] The primer pairs screened in Example 4 were mixed in equal proportions and diluted to a concentration of 10 μM, and each diluted primer pair was mixed in equal proportions to prepare a primer mixture.

[0349] Use KOD FX Neo (KFX-201, TOYOBO) PCR reaction system 1 to configure, set the PCR program, and run.

[0350] 2. Next-generation sequencing (NGS) library preparation:

[0351] The PCR products were used to construct a library using the Twist EF library preparation kit (104119, Twist Bioscience).

[0352] 3. Sequencing and data analysis:

[0353] The obtained library was sequenced using BGI MGISeq-T7, with sequencing mode PE-150.

[0354] The sequencing sequences were aligned to the human genome GRCh38 reference sequence using BWA software, the sequences were sorted and deduplicated using Samtools software, and variants were detected using GATK software to obtain vcf files containing variant information.

[0355] Check the data coverage of HNF1A gene by IGV software (such as Fig.13a ), it can be seen that all regions amplified by the primers are effectively covered.

[0356] The mutation detection results are shown in Table 23 below.

[0357] Table 23

[0358]

[0359] 4. First-generation sequencing verification

[0360] The results of the second generation sequencing were verified by first generation sequencing. Blood gDNA from healthy subjects was used as a wild type control.

[0361] 1) For sample No. 1, the 100bp sequences upstream and downstream of the variant site NM_000545.8: exon2: c.475C>T: p.R159W (underlined bases) are as follows. DNA fragments containing the following sequences were amplified from patient No. 1 sample and wild-type control by PCR, and first-generation sequencing was performed. The sequencing results of the wild-type are as follows Fig.13b As shown, the sequencing results of sample 1 are as follows Fig.13c shown.

[0362] >hg38_dna range=chr 12:121426784, SEQ ID NO: 128

[0363] GCACAACATCCCACAGCGGGAGGTGGTCGATACCACTGGCCTCAACCAGTCCCACCTGT

[0364] CCCAACACCTCAACAAGGGCACTCCCATGAAGACGCAGAAG C GGGCCGCCCTGTACAC

[0365] CTGGTACGTCCGCAAGCAGCGAGAGGTGGCGCAGCGTAAGTAATGACCCTACCCGCAT

[0366] CTTCCCTGGGAGGGCCCAGGACTCT

[0367] 2) For sample No. 2, the 100bp sequences upstream and downstream of the variant site NM_000545.8:c.1061C>T:p.Thr354Met (underlined bases) are as follows. DNA fragments containing the following sequences were amplified from patient No. 2 sample and wild-type control by PCR, and first-generation sequencing was performed. The sequencing results of the wild-type are as follows Fig.13d As shown, the sequencing results of sample No. 2 are as follows Fig.13e shown.

[0368] >hg38_dna range=chr12:121434170, SEQ ID NO: 129

[0369] CGCTATGGACAGCCTGCGACCAGTGAGACTGCAGAAGTACCCTCAAGCAGCGGCGGTC

[0370] CCTTAGTGACAGTGTCTACACCCCTCCACCAAGTTGTCCCCCA C GGGCCTGGAGCCCAGC

[0371] CACAGCCTGCTGAGTACAGAAGCCAAGCTGGTGAGTGTCCTTGCTTGTAAGGAAAACC

[0372] CAACCTCATCTTTCCTTGGCAGGGAG

[0373] 3) For sample No. 3, the 100bp sequences upstream and downstream of the variant site NM_000545.8: exon8: c.1621C>T: p.Q541X (underlined bases) are as follows. DNA fragments containing the following sequences were amplified from patient No. 3 sample and wild-type control by PCR, and first-generation sequencing was performed. The sequencing results of the wild-type are as follows Fig.13f As shown in Figure 2, the sequencing results of sample No. 3 are as follows: Figure 13g shown.

[0374] >hg38_dna range=chr12:120999387, SEQ ID NO: 130

[0375] CGAGGTGGCCCAGTACACCCACACGGGCCTGCTCCCGCAGACTATGCTCATCACCGACA

[0376] CCACCAACCTGAGCGCCCTGGCCAGCCTCACGCCCACCAAG C AGGTAAGGTCCAGGCC

[0377] TGCTGGCCCTCCCTTGGCCTGTGACAGAGCCCCTCACCCCCACATCCCCCGGGCTCAGG

[0378] AGGCTGCTCTGCTCCCCCAGGTCTT

[0379] from Figure 13b to Figure 13g From the results, it can be seen that the first-generation sequencing result of sample No. 1 showed C / T heterozygous; the first-generation sequencing result of sample No. 2 showed C / T heterozygous; and the test result of sample No. 3 showed C / T heterozygous.

[0380] The above results are the same as those of the second generation sequencing detection method. The first generation sequencing results verified that the accuracy of the detection method is 100%.

[0381] Example 14 Detection / verification of HNF1B gene in MODY5 positive samples

[0382] In this example, the primer pairs of Group 1 screened in Example 5 were used to detect blood samples from two patients clinically diagnosed as MODY5-positive, and the blood samples were extracted using the Tiangen Blood Genomic DNA Extraction Kit (P348-03, Tiangen Biochemical Technology) to obtain gDNA.

[0383] 1. Multiplex long fragment PCR:

[0384] Each pair of primers in Group 1 screened out in Example 5 was mixed in equal proportions and diluted to a concentration of 10 μM, and each diluted pair of primers was mixed in equal proportions to prepare a primer mixture.

[0385] Use KOD FX Neo (KFX-201, TOYOBO) PCR reaction system 1 to configure, set the PCR program, and run.

[0386] 2. Next-generation sequencing (NGS) library preparation:

[0387] The PCR products were used to construct a library using the Twist EF library preparation kit (104119, Twist Bioscience).

[0388] 3. Sequencing and data analysis:

[0389] The obtained library was sequenced using BGI MGISeq-T7, with sequencing mode PE-150.

[0390] The sequencing sequences were aligned to the human genome GRCh38 reference sequence using BWA software, the sequences were sorted and deduplicated using Samtools software, and variants were detected using GATK software to obtain vcf files containing variant information.

[0391] Check the data coverage of HNF1B gene by IGV software (such as Fig.14a ), it can be seen that all regions amplified by the primers are effectively covered.

[0392] The mutation detection results are shown in Table 24 below.

[0393] Table 24

[0394]

[0395] 4. First-generation sequencing verification

[0396] The results of the second generation sequencing were verified by first generation sequencing. Blood gDNA from healthy subjects was used as a wild type control.

[0397] 1) For sample No. 1, the 100bp sequences upstream and downstream of the variant site HNF1B: NM_000458.4: exon2: c.455C>A: p.H149N (underlined bases) are as follows. DNA fragments containing the following sequences were amplified from patient No. 1 sample and wild-type control by PCR, and first-generation sequencing was performed. The sequencing results of the wild-type are as follows Fig.14b As shown, the sequencing results of sample 1 are as follows Fig.14c shown.

[0398] >hg38_dna range=chr17:36099530, SEQ ID NO: 131

[0399] TGAGGACCCTTGGAGGGCTGCTAAAATGATCAAGGGTTACATGCAGCAACACAACATCC

[0400] CCCAGAGGGAGGTGGTCGATGTCACCGGCCTGAACCAGTCG C ACCTCTCCCAGCATCTC

[0401] AACAAGGGCACCCCTATGAAGACCCAGAAGCGTGCCGCTCTGTACACCTGGTACGTCAG

[0402] AAAGCAACGAGAGATCCTCCGACG

[0403] 2) For sample No. 2, the 100bp sequences upstream and downstream of the variant site HNF1B: NM_000458.4: exon1: c.160dupG: p.A54Gfs*34 (underlined bases) are as follows. DNA fragments containing the following sequences were amplified from patient No. 2 sample and wild-type control by PCR, and first-generation sequencing was performed. The sequencing results of the wild-type are as follows Fig.14d As shown, the sequencing results of sample No. 12 are as follows Fig.14e shown.

[0404] >hg38_dna range=chr17:36104716, SEQ ID NO: 132

[0405] GGTCACCAAGGAGGTGCTGGTTCAGGCCTTGGAGGAGTTGCTGCCATCCCCGAACTTCG

[0406] GGGTGAAGCTGGAGACGCTGCCCCTGTCCCCTGGCAGCGGG GCCGAGCCCGACACCAA

[0407] GCCGGTCTTCCATACTCTCACCAACGGGCCACGCCAAGGGCCGCTTGTCCGGCGACGAGG

[0408] GCTCCGAGGACGGCGACGACTATGA

[0409] from Figures 14b to 14e It can be seen that the first-generation sequencing result of sample No. 1 showed C / A heterozygosity (indicated by N in the figure) (ie, G / T); the detection result of sample No. 2 showed continuous double peaks caused by the insertion of one base.

[0410] The above results are the same as those of the second generation sequencing detection method. The first generation sequencing results verified that the accuracy of the detection method is 100%.

[0411] Example 15 Detection / verification of HNF4A gene in MODY1 positive samples

[0412] In this example, the primer pair combination 1 screened in Example 6 was used to detect blood samples from three patients clinically diagnosed as MODY type 1 positive, and the blood samples were extracted using the Tiangen Blood Genomic DNA Extraction Kit (P348-03, Tiangen Biochemical Technology) to obtain gDNA.

[0413] 1. Multiplex long fragment PCR:

[0414] Each pair of primers in combination 1 screened out in Example 6 was mixed in equal proportions and diluted to a concentration of 10 μM, and each diluted pair of primers was mixed in equal proportions to prepare a primer mixture.

[0415] Use KOD FX Neo (KFX-201, TOYOBO) PCR reaction system 1 to configure, set the PCR program, and run.

[0416] 2. Next-generation sequencing (NGS) library preparation:

[0417] The PCR products were used to construct a library using the Twist EF library preparation kit (104119, Twist Bioscience).

[0418] 3. Sequencing and data analysis:

[0419] The obtained library was sequenced using BGI MGISeq-T7, with sequencing mode PE-150.

[0420] The sequencing sequences were aligned to the human genome GRCh38 reference sequence using BWA software, the sequences were sorted and deduplicated using Samtools software, and variants were detected using GATK software to obtain vcf files containing variant information.

[0421] Check the data coverage of HNF4A gene by IGV software (such as Fig.15a ), it can be seen that all regions amplified by the primers are effectively covered.

[0422] The mutation detection results are shown in Table 25 below.

[0423] Table 25

[0424]

[0425] 4. First-generation sequencing verification

[0426] The results of the second generation sequencing were verified by first generation sequencing. Blood gDNA from healthy subjects was used as a wild type control.

[0427] 1) The 100 bp sequences upstream and downstream of the variant NM_001030003.3: c.926G>A (underlined bases) in sample No. 1 are as follows. DNA fragments containing the following sequences were amplified from patient sample No. 1 and wild-type control by PCR, and first-generation sequencing was performed. The sequencing results of the wild-type are as follows Fig.15b As shown, the sequencing results of sample 1 are as follows Fig.15c shown.

[0428] >hg38_dna range=chr20:44424017-44424217, SEQ ID NO: 133

[0429] GATGCCAAGGGGCTGAGCGATCCAGGGAAGATCAAGCGGCTGCGTTCCCAGGTGCAGGTGAGCTTGGAGGACTACATCAACGACCGCCAGTATGACTCGC G TGGCCGCTTTGGAGAGCTGCTGCTGCTGCTGCCCACCTTGCAGAGCATCACCTGGCAGATGATCGAGCAGATCCAGTTCATCAAGCTCTTCGGCATGGCC

[0430] 2) The 100 bp sequences of the variant NM_001030003.3: c.1063+120G>A (underlined bases) in sample No. 2 are as follows. DNA fragments containing the following sequences were amplified from patient No. 2 sample and wild-type control by PCR, and first-generation sequencing was performed. The sequencing results of the wild-type are as follows Fig.15d As shown in Figure 2, the sequencing results of sample No. 2 are as follows Fig.15e shown.

[0431] >hg38_dna range=chr20:44424274-44424474, SEQ ID NO: 134

[0432] GGGGCGGGGTTGGAGTGGGGACTCCCCAGGAGACAGGCCTCACACAGTGAGCTCACCCCTCAGCTCCTTGGCTTCCCCACTGTGCCGCTTTGGGCAAGTT G CTTAACCTGTCTGTGCCTCAGTTTCCTCACCAGAAAAATGGGAACAAGGCAATGGTCTATTTGTTCAGGCACCGAGAACCTAGCACGTGCCAGTCACTGT

[0433] 3) The 100 bp sequences of the variant NM_001030003.3: c.200G>A (underlined bases) in sample No. 3 are as follows. DNA fragments containing the following sequences were amplified from patient No. 3 sample and wild-type control by PCR, and first-generation sequencing was performed. The sequencing results of the wild-type are as follows Fig.15f As shown in Figure 2, the sequencing results of sample No. 3 are as follows: Figure 15g shown.

[0434] >hg38_dna range=chr20:44406108-44406308, SEQ ID NO: 135

[0435] GTCAGCGCCCTGTGTGCCATCTGCGGGGACCGGGCCACGGGCAAACACTACGGTGCCTCGAGCTGTGACGGCTGCAAGGGCTTCTTCCGGAGGAGCGTGC G GAAGAACCACATGTACTCCTGCAGGTGAGGAGCCTCAATTTCTTCAGCTGGGAAATGGGCACACTTGGGCTCATGGCCCCAAGGTCTGTCTTTCTCCTGA

[0436] The above results are the same as those of the second generation sequencing detection method. The first generation sequencing results verified that the accuracy of the detection method is 100%.

[0437] Example 16. Detection / verification of INS gene in MODY10 positive samples

[0438] In this example, the primers in Group 1 selected in Example 7 were used to detect blood samples from three patients clinically diagnosed as MODY type 10 positive, and the blood samples were extracted using the Tiangen Blood Genomic DNA Extraction Kit (P348-03, Tiangen Biochemical Technology) to obtain gDNA.

[0439] 1. Long fragment PCR:

[0440] The primers screened in Example 7 were mixed in equal proportions and diluted to a concentration of 10 μM to prepare a primer mixture.

[0441] Use KOD FX Neo (KFX-201, TOYOBO) PCR reaction system 1 to configure, set the PCR program, and run.

[0442] 2. Next-generation sequencing (NGS) library preparation:

[0443] The PCR products were used to construct a library using the Twist EF library preparation kit (104119, Twist Bioscience).

[0444] 3. Sequencing and data analysis:

[0445] The obtained library was sequenced using BGI MGISeq-T7, with sequencing mode PE-150.

[0446] The sequencing sequences were aligned to the human genome GRCh38 reference sequence using BWA software, the sequences were sorted and deduplicated using Samtools software, and variants were detected using GATK software to obtain vcf files containing variant information.

[0447] Check the data coverage of INS genes using IGV software (such as Fig.16a ), it can be seen that all regions amplified by the primers are effectively covered.

[0448] The mutation detection results are shown in Table 26 below.

[0449] Table 26

[0450]

[0451] 4. First-generation sequencing verification

[0452] The results of the second generation sequencing were verified by first generation sequencing. Blood gDNA from healthy subjects was used as a wild type control.

[0453] 1) The 100bp sequences of the variant NM_001185098.2:c.188-31G>A (underlined bases) in sample No. 1 are as follows. DNA fragments containing the following sequences were amplified from patient sample No. 1 and wild-type control by PCR and sequenced for the first generation. The sequencing results of the wild-type are as follows Fig.16b As shown, the sequencing results of sample 1 are as follows Fig.16c shown.

[0454] >hg38_dna range=chr11:2159928-2160128,SEQ ID NO: 136

[0455] GCTGGAGATGGGTGGGAGTGCGACCTAGGGCTGGCGGGCAGGCGGGCACTGTGTCTCCCTGACTGTGTCCTCCTGTGTCCCTCTGCCTCGCCGCTGTTCC G GAACCTGCTCTGCGCGGCACGTCCTGGCAGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCT

[0456] 2) The 100 bp sequences upstream and downstream of the variant NM_001185098.2: c.250G>A (underlined bases) in sample No. 2 are as follows. DNA fragments containing the following sequences were amplified from patient No. 2 sample and wild-type control by PCR, and first-generation sequencing was performed. The sequencing results of the wild-type are as follows Fig.16d As shown in Figure 2, the sequencing results of sample No. 2 are as follows Fig.16e shown.

[0457] >hg38_dna range=chr11:2159835-2160035, SEQ ID NO: 137

[0458] CTGTTCCGGAACCTGCTCTGCGCGGCACGTCCTGGCAGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAG GGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTGCAACTAGACGCAGCCCGCAGGCAG

[0459] 3) The 100 bp sequences upstream and downstream of the variant NM_001185098.2:c.188-15G>A (underlined bases) in sample No. 3 are as follows. DNA fragments containing the following sequences were amplified from patient No. 3 sample and wild-type control by PCR, and first-generation sequencing was performed. The sequencing results of the wild-type are as follows Fig.16f As shown in Figure 2, the sequencing results of sample No. 3 are as follows: Figure 16g shown.

[0460] >hg38_dna range=chr11:2159912-2160112, SEQ ID NO: 138

[0461] AGTGCGACCTAGGGCTGGCGGGCAGGCGGGCACTGTGTCTCCCTGACTGTGTCCTCCTGTGTCCTCTGCCTCGCCGCTGTTCCGGAACCTGCTCTGCGC G GCACGTCCTGGCAGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATT

[0462] The above results are the same as those of the second generation sequencing detection method. The first generation sequencing results verified that the accuracy of the detection method is 100%.

[0463] Example 17. Detection / verification of KCNJ11 gene in MODY13 positive samples

[0464] In this example, the primers in Group 1 selected in Example 8 were used to detect blood samples from two patients clinically diagnosed as MODY13 positive, and the blood samples were extracted using the Tiangen Blood Genomic DNA Extraction Kit (P348-03, Tiangen Biochemical Technology) to obtain gDNA.

[0465] 1. Long fragment PCR:

[0466] The primers screened in Example 8 were mixed in equal proportions and diluted to a concentration of 10 μM to prepare a primer mixture.

[0467] Use KOD FX Neo (KFX-201, TOYOBO) PCR reaction system 1 to configure, set the PCR program, and run.

[0468] 2. Next-generation sequencing (NGS) library preparation:

[0469] The PCR products were used to construct a library using the Twist EF library preparation kit (104119, Twist Bioscience).

[0470] 3. Sequencing and data analysis:

[0471] The obtained library was sequenced using BGI MGISeq-T7, with sequencing mode PE-150.

[0472] The sequencing sequences were aligned to the human genome GRCh38 reference sequence using BWA software, the sequences were sorted and deduplicated using Samtools software, and variants were detected using GATK software to obtain vcf files containing variant information.

[0473] Use IGV software to check the data coverage of KCNJ11 gene (such as Fig.17a ), it can be seen that all regions amplified by the primers are effectively covered.

[0474] The mutation detection results are shown in Table 27 below.

[0475] Table 27

[0476]

[0477] 4. First-generation sequencing verification

[0478] The results of the second generation sequencing were verified by first generation sequencing. Blood gDNA from healthy subjects was used as a wild type control.

[0479] 1) For sample 1, the 100 bp sequences upstream and downstream of the variant NM_000525.4 (KCNJ11): c.509A>G (p.Lys170Arg) (underlined bases) are shown below. A DNA fragment containing the following sequence was amplified by PCR and sequenced for the first generation. The sequencing results of the wild type are as follows: Fig.17b As shown, the sequencing results of sample 1 are as follows Fig.17c shown.

[0480] >hg38_dna range=chr11:17387483-17387683, SEQ ID NO: 139

[0481] ATGGTGACTGAGGAGTGCCCACTGGCCATCCTGATCCTCATCGTGCAGAACATCGTGGGGCTCATGATCAACGCCATCATGCTTGGCTGCATCTTCATGA A GACTGCCCAAGCCCACCGCAGGGCTGAGACCCTCATCTTCAGCAAGCATGCGGTGATCGCCCTGCGCCACGGCCGCCTGCTTCATGCTACGTGTGGGT

[0482] 2) For sample No. 2, the 100bp sequences upstream and downstream of the variant NM_000525.4 (KCNJ11): c.10C>T (p.Arg4Cys) (underlined bases) are shown below. A DNA fragment containing the following sequence was amplified by PCR and sequenced for the first generation. The sequencing results of the wild type are as follows Fig.17d As shown in Figure 2, the sequencing results of sample No. 2 are as follows Fig.17e shown.

[0483] >hg38_dna range=chr11:17387982-17388182, SEQ ID NO: 140

[0484] GCCCACCGAGAGGACTCTGCAGTGAGGCCCTAGGCCACGTCCGAGGGGTGCCTCCGATGGGGGAAGCCCCTCCCTGGGGGTCACCGGAGCCATGCTGTCC C GCAAGGGCATCATCCCCGAGGAATACGTGCTGACACGCCTGGCAGAGGACCCTGCCAAGCCCAGGTACCGTGCCCGCCAGCGGAGGGCCCGCTTTGTGTC

[0485] from Fig.17b and Fig.17e It can be seen that the first-generation sequencing results of sample No. 1 showed T / C heterozygous; the test results of sample No. 2 showed G / A heterozygous.

[0486] The above results are the same as those of the second generation sequencing detection method. The first generation sequencing results verified that the accuracy of the detection method is 100%.

[0487] Example 18. Single-tube multiplex PCR for simultaneous detection of MODY subtypes

[0488] 1) Primer mix:

[0489] Mix all primers into one tube according to Table 28 below.

[0490] Table 28. Primer mixing ratio

[0491] Primer name Primer concentration Volume μL Primer name Primer concentration Volume μL KCNJ11-F1 / R1 200μM 1 HNF4A-F3 / R3 200μM 2 INS-F1 / R1 200μM 1 HNF4A-F4 / R4 200μM 2 HNF1A-F1 / R1 200μM 2 HNF4A-F5 / R5 200μM 2 HNF1A-F2 / R2 200μM 2 HNF4A-F6 / R6 200μM 2 HNF1B-F1 / R1 200μM 3 NEUROD1-F / R 200μM 2 HNF1B-F2 / R2 200μM 3 GCK-F1 / R1 200μM 1 HNF1B-F3 / R3 200μM 2 GCK-F2 / R2 200μM 2 HNF1B-F4 / R4 200μM 3 GCK-F3 / R3 200μM 2 HNF4A-F1 / R1 200μM 1 GCK-F4 / R4 200μM 1 HNF4A-F2 / R2 200μM 1 PDX1-F1 / R1 200μM 2

[0492] 2) Long fragment PCR:

[0493] KOD FX Neo (KFX-201, TOYOBO) was used to perform PCR on the blood gDNA sample of the MODY4-positive patient No. 1 in Example 11. The PCR reaction system is shown in Table 29 below.

[0494] Table 29

[0495] name Volume (μL) KOD FX 1 2*KOD Buffer 25 2mM dNTP 10 Primers 1 DNA 100ng <![CDATA[H2O]]> to 50

[0496] The PCR reaction program is shown in Table 30 below.

[0497] Table 30

[0498]

[0499] 3) Preparation of next-generation sequencing library:

[0500] The PCR products were used to construct a library using the Twist EF library preparation kit (104119, Twist Bioscience).

[0501] 4) Sequencing and data analysis:

[0502] The sequencing was performed using BGI MGISeq-T7, sequencing mode PE-150.

[0503] The sequencing sequences were aligned to the human genome GRCh38 reference sequence using BWA software, the sequences were sorted and deduplicated using Samtools software, and variants were detected using GATK software to obtain vcf files containing variant information.

[0504] The sequencing depth of each primer pair was counted, as shown in Table 31 below.

[0505] Table 31

[0506] Gene Gene 5'UTR, exon, and 3'UTR region coverage Average gene coverage depth GCK 100％ 83.59 HNF1A 100％ 55.305 HNF1B 100％ 34.9475 HNF4A 100％ 102.28 INS 100％ 31.84 ISL1 100％ 68.79 KCNJ11 100％ 55.22 NEUROD1 100％ 74.92 PDX1 100％ 55.26

[0507] By checking the data coverage of each gene through IGV software, we can see that all regions amplified by the primers are effectively covered. Figures 18a to 18h shown.

[0508] The mutation detection results for the PDX1 gene are shown in Table 32 below.

[0509] Table 32

[0510] Sample Type Mutation information Blood samples NM_000209.4(PDX1):exon2:c.697G>A:p.E233K

[0511] The results show that the primer pair of the present invention can detect 8 genes and the variation information therein in the same tube.

[0512] The technical solution of the present disclosure is not limited to the above-mentioned specific embodiments. All technical variations made according to the technical solution of the present disclosure fall within the protection scope of the present disclosure.

Claims

1. A primer pair for detecting MODY subtypes, characterized in that: The primer pair comprises: a forward primer selected from the group consisting of the nucleotide sequences shown in one or more of SEQ ID NOs: 1, 7, 13, 15, 17, 19, 37, 39, 49, 51, 53, 55, 73, 75, 77, 79, 81, 83, 109 and 115, or a nucleotide sequence having at least 65% identity thereto; and The reverse primer is selected from the nucleotide sequences shown in one or more of SEQ ID NO: 2, 8, 14, 16, 18, 20, 38, 40, 50, 52, 54, 56, 74, 76, 78, 80, 82, 84, 110, 116, or a nucleotide sequence having at least 65% identity thereto.

2. The primer pair according to claim 1, characterized in that The primer pair comprises: A primer pair for detecting a KCNJ11 gene variation, comprising: a forward primer having a nucleotide sequence as shown in SEQ ID NO: 115, or a nucleotide sequence having at least 65% identity thereto; and a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 116, or a nucleotide sequence having at least 65% identity thereto; A primer pair for detecting HNF1A gene variation, comprising: a forward primer selected from the nucleotide sequences shown in one or more of SEQ ID NOs: 37 and 39, or a nucleotide sequence having at least 65% identity thereto; and a reverse primer selected from the nucleotide sequences shown in one or more of SEQ ID NOs: 38 and 40, or a nucleotide sequence having at least 65% identity thereto; A primer pair for detecting HNF1B gene variation, comprising: a forward primer selected from the nucleotide sequences shown in one or more of SEQ ID NOs: 49, 51, 53 and 55, or a nucleotide sequence having at least 65% identity thereto; and a reverse primer selected from the nucleotide sequences shown in one or more of SEQ ID NOs: 50, 52, 54 and 56, or a nucleotide sequence having at least 65% identity thereto; A primer pair for detecting a variation in the NEUROD1 gene, comprising: a forward primer having a nucleotide sequence as shown in SEQ ID NO: 1, or a nucleotide sequence having at least 65% identity thereto; and a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 2, or a nucleotide sequence having at least 65% identity thereto; A primer pair for detecting a PDX1 gene variation, comprising: a forward primer having a nucleotide sequence as shown in SEQ ID NO:7, or a nucleotide sequence having at least 65% identity thereto; and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:8, or a nucleotide sequence having at least 65% identity thereto; A primer pair for detecting a GCK gene variation, comprising: a forward primer selected from the nucleotide sequences shown in one or more of SEQ ID NOs: 13, 15, 17 and 19, or a nucleotide sequence having at least 65% identity thereto; and a reverse primer selected from the nucleotide sequences shown in one or more of SEQ ID NOs: 14, 16, 18 and 20, or a nucleotide sequence having at least 65% identity thereto; A primer pair for detecting HNF4A gene variation, comprising: a forward primer selected from the nucleotide sequence shown in one or more of SEQ ID NOs: 73, 75, 77, 79, 81 and 83, or a nucleotide sequence having at least 65% identity thereto; and a reverse primer selected from the nucleotide sequence shown in one or more of SEQ ID NOs: 74, 76, 78, 80, 82 and 84, or a nucleotide sequence having at least 65% identity thereto; and / or A primer pair for detecting INS gene variation, comprising: a forward primer having a nucleotide sequence as shown in SEQ ID NO: 109, or a nucleotide sequence having at least 65% identity thereto; and a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 110, or a nucleotide sequence having at least 65% identity thereto.

3. The primer pair according to claim 2, characterized in that: The primer pair for detecting HNF1B gene variation includes: a forward primer having the nucleotide sequence shown in SEQ ID NO:49, or a nucleotide sequence having at least 65% identity thereto; and a reverse primer having the nucleotide sequence shown in SEQ ID NO:50, or a nucleotide sequence having at least 65% identity thereto; a forward primer having a nucleotide sequence as shown in SEQ ID NO:51, or a nucleotide sequence having at least 65% identity thereto; and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:52, or a nucleotide sequence having at least 65% identity thereto; a forward primer having a nucleotide sequence as shown in SEQ ID NO: 53, or a nucleotide sequence having at least 65% identity thereto; and a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 54, or a nucleotide sequence having at least 65% identity thereto; and / or A forward primer having a nucleotide sequence as shown in SEQ ID NO:55, or a nucleotide sequence having at least 65% identity thereto; and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:56, or a nucleotide sequence having at least 65% identity thereto.

4. The primer pair according to claim 2, characterized in that The primer pair for detecting GCK gene variation includes: a forward primer having a nucleotide sequence as shown in SEQ ID NO: 13, or a nucleotide sequence having at least 65% identity thereto; and a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 14, or a nucleotide sequence having at least 65% identity thereto; a forward primer having a nucleotide sequence as shown in SEQ ID NO: 15, or a nucleotide sequence having at least 65% identity thereto; and a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 16, or a nucleotide sequence having at least 65% identity thereto; a forward primer having a nucleotide sequence as shown in SEQ ID NO: 17, or a nucleotide sequence having at least 65% identity thereto; and a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 18, or a nucleotide sequence having at least 65% identity thereto; and / or A forward primer having the nucleotide sequence shown in SEQ ID NO: 19, or a nucleotide sequence having at least 65% identity thereto; and a reverse primer having the nucleotide sequence shown in SEQ ID NO: 20, or a nucleotide sequence having at least 65% identity thereto.

5. The primer pair according to claim 2, characterized in that: The primer pair for detecting HNF1A gene variation includes: a forward primer having a nucleotide sequence as shown in SEQ ID NO: 37, or a nucleotide sequence having at least 65% identity thereto; and a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 38, or a nucleotide sequence having at least 65% identity thereto; and / or A forward primer having the nucleotide sequence shown in SEQ ID NO:39, or a nucleotide sequence having at least 65% identity thereto; and a reverse primer having the nucleotide sequence shown in SEQ ID NO:40, or a nucleotide sequence having at least 65% identity thereto.

6. The primer pair according to claim 2, characterized in that: The primer pair for detecting HNF4A gene variation includes: a forward primer having a nucleotide sequence as shown in SEQ ID NO: 73, or a nucleotide sequence having at least 65% identity thereto; and a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 74, or a nucleotide sequence having at least 65% identity thereto; a forward primer having a nucleotide sequence as shown in SEQ ID NO: 75, or a nucleotide sequence having at least 65% identity thereto; and a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 76, or a nucleotide sequence having at least 65% identity thereto; a forward primer having the nucleotide sequence shown in SEQ ID NO: 77, or a nucleotide sequence having at least 65% identity thereto; and a reverse primer having the nucleotide sequence shown in SEQ ID NO: 78, or a nucleotide sequence having at least 65% identity thereto; a forward primer having the nucleotide sequence as shown in SEQ ID NO:79, or a nucleotide sequence having at least 65% identity thereto; and a reverse primer having the nucleotide sequence as shown in SEQ ID NO:80, or a nucleotide sequence having at least 65% identity thereto; a forward primer having a nucleotide sequence as shown in SEQ ID NO: 81, or a nucleotide sequence having at least 65% identity thereto; and a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 82, or a nucleotide sequence having at least 65% identity thereto; and / or A forward primer having a nucleotide sequence as shown in SEQ ID NO: 83, or a nucleotide sequence having at least 65% identity thereto; and a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 84, or a nucleotide sequence having at least 65% identity thereto.

7. A kit for detecting MODY subtypes, comprising the primer pair according to any one of claims 1 to 6, preferably, the MODY subtype is selected from one or more of MODY1, MODY2, MODY3, MODY4, MODY5, MODY6, MODY10, and MODY13.

8. The kit according to claim 7, characterized in that The kit also includes a fidelity DNA polymerase, preferably KOD FX DNA polymerase, Takara LA DNA polymerase and Any one or more of Taq DNA polymerase, Preferably, the kit further comprises a dNTP mixture, preferably comprising dATP, dCTP, dGTP and dTTP.

9. Use of the primer pair according to any one of claims 1 to 6 or the kit according to claim 7 or 8 in detecting MODY subtype diabetes or detecting a variation in one or more of the HNF4A, GCK, HNF1A, PDX1, HNF1B, NEUROD1, INS and KCNJ11 genes, wherein the variation comprises a substitution, insertion and / or deletion mutation of one or more nucleotides, Preferably, the primer pair or kit is used to detect any one or more of MODY type 1, MODY type 2, MODY type 3, MODY type 4, MODY type 5, MODY type 6, MODY type 10 and MODY type 13 diabetes.

10. The use according to claim 9, characterized in that: Said The test also includes the use of next-generation sequencing methods to identify the amplified products and obtain gene mutation information; Preferably, the detection comprises the following steps: 1) using the primer pair to amplify the genomic DNA of the sample as a template to obtain an amplified product; 2) using the amplified product to construct a sequencing library; and, 3) using a next-generation sequencing method to identify the sequencing library to obtain gene mutation information; Preferably, the sample is derived from tissue, feces, saliva or blood. Preferably, in step 1), the primer pair is annealed with the genomic DNA of the sample, more preferably at a temperature of 60-68°C.

Images