Two MYB transcription factors involved in the regulation of biosynthesis of dihydroartemisinic acid and their use
By isolating and identifying MYB transcription factors StMYB76 and StMYB13, the molecular mechanism regulating the synthesis of menthol in catnip volatile oil was solved, and the menthol content was significantly increased, providing a genetic engineering approach for improving the quality and resistance of catnip essential oil.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-05
- Publication Date
- 2026-03-24
AI Technical Summary
The regulatory molecular mechanism of menthone in the volatile oil of Catnipae tangutica is unclear, and existing technologies are insufficient to effectively improve its synthesis and accumulation.
Two MYB transcription factors, StMYB76 and StMYB13, were isolated, identified, and demonstrated through gene cloning, yeast one-hybrid, and transient expression techniques that they can significantly induce the expression of the key gene StLS in menthol synthesis and increase the transcript abundance of related enzyme genes, thereby enhancing menthol accumulation.
Transient overexpression of StMYB76 and StMYB13 transcription factors in catnip leaves significantly increased the content of menthol, providing a genetic engineering application for improving the quality and resistance of catnip essential oil.
Smart Images

Figure CN119613515B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of plant molecular biotechnology and genetic engineering, and to two MYB-type transcription factors (StMYB76 and StMYB13) involved in the transcriptional regulation of menthone biosynthesis and their applications. Background Technology
[0002] *Schizonepeta tenuifolia*, a plant in the Lamiaceae family, is a well-known traditional Chinese medicine widely used to treat colds and early-stage sores. The main chemical components of *Schizonepeta tenuifolia* include volatile oils, flavonoids, and glycosides, with the volatile oil components being particularly noteworthy. It has been reported that the main components of *Schizonepeta tenuifolia* volatile oil are menthol monoterpenoids such as menthol, limonene, and menthone, which account for more than 90% of the total volatile oil. Menthol, an oxygen-containing monoterpene compound, is the main volatile oil component in *Schizonepeta tenuifolia*, peppermint, and other Lamiaceae plants, possessing anti-inflammatory, antiviral, and analgesic pharmacological effects.
[0003] Terpenes are the largest class of plant secondary metabolites, possessing antioxidant, anti-inflammatory, anticancer, and tumor-inhibiting biological activities. Terpenes can be classified according to the number of basic isoprene units (C5H8) that make up their skeleton: monoterpenes (10C), sesquiterpenes (15C), diterpenes (20C), etc. There are two pathways for terpene synthesis: the mevalonic acid (MVA) pathway and the 2-methyl-D-erythritol-4-phosphate (MEP) pathway. Terpenoids derived from the MVA or MEP pathway share common precursors dimethylallyl diphosphate (DMAPP) and isopentenyl diphosphate (IPP), which are catalyzed by pentenyltransferases to produce direct precursors geranyl pyrophosphate (GPP), farnesyl pyrophosphate (FPP), and geranylgeranylpyrophosphate (GGPP). These direct precursors are then catalyzed by terpenoid synthases to generate various terpenoid compounds.
[0004] The applicant previously used a combination of techniques, including transcriptome sequencing, gene cloning, heterologous expression, and transient silencing of the VIGS gene, to conduct in vivo and in vitro functional verification of key enzyme genes that may be involved in the biosynthesis of monoterpenes in the volatile oil of *Nepeta cataria*. Key enzyme genes in the menthol biosynthesis pathway, including limonene synthase (StLS), limonene hydroxylase (StL3OH), isomenthol dehydrogenase (StISPD), isomenthol reductase (StIPR), and menthol reductase (StPR), were successfully screened and identified, providing important theoretical basis for subsequent research.
[0005] In medicinal plants, transcription factors are key regulators of the biosynthesis and accumulation of secondary metabolites. Among them, MYBs are a plant-specific family of transcription factors (TFs) that play a crucial role in plant growth and development, primary and secondary metabolism regulation, and responses to biotic and abiotic stresses. Previous studies have shown that the R2R3-MYB type transcription factor FaMYB63 can directly activate key genes in the phenylpropanoid synthesis pathway (such as FaEGS1, FaEGS2, FaCAD1, FaEOBI, and FaMYB10), thereby inducing eugenol biosynthesis. In Panax notoginseng, PnMYB1, as a positive regulator of saponin biosynthesis, interacts with PnbHLH to regulate saponin synthesis, while PnMYB4 negatively regulates saponin accumulation by competitively inhibiting the formation of the PnMYB1-PnbHLH complex and suppressing the promoter activity of saponin synthesis genes. Furthermore, under salt stress, the high accumulation of SmMYB1R1-L in Salix matsudana leads to the high expression of SmEXPA13, thereby enhancing the plant's tolerance to salt stress.
[0006] Menthane monoterpenoids in the volatile oil of *Nepeta cataria* are closely related to its quality and resistance, but the molecular mechanisms regulating them remain unclear. Therefore, this study used the rate-limiting enzyme in the menthol monoterpene biosynthesis pathway, namely limonene synthase (StLS) gene, as bait to develop a transcription factor that positively regulates the synthesis of menthol monoterpenes in *Nepeta cataria*, which is of great significance for improving the quality and resistance of *Nepeta cataria* essential oil. Summary of the Invention
[0007] The purpose of this invention is to provide two MYB transcription factors involved in the biosynthesis of menthol, namely StMYB76 and StMYB13, whose CDS sequences are shown in SEQ:NO.1 and SEQ:NO.2. Specific features are as follows:
[0008] 1. Sequence characteristics:
[0009] The full-length CDS of StMYB76 is 801 bp, theoretically encoding 267 amino acids, with an isoelectric point (pI) of 5.10 and a theoretical molecular weight (Mw) of 65533.07 Da. The full-length CDS of StMYB13 is 753 bp, theoretically encoding 251 amino acids, with an isoelectric point (pI) of 5.11 and a theoretical molecular weight (Mw) of 59910.38 Da. Both StMYB76 and StMYB13 contain a highly conserved PLN03091 superfamily at their N-terminus. Evolutionary relationship analysis with members of the Lamiaceae MYB family shows that StMYB76 and StMYB13 cluster with *Salvia miltiorrhiza* Bunge. (SmMYB76 and SmMYB13), respectively, belonging to the R2R3-MYB family. They possess six highly conserved motifs, with motif 4, motif 1, and motif 2 constituting the PLN03091 superfamily.
[0010] 2. Gene function
[0011] Both StMYB76 and StMYB13 can significantly induce the activity of the StLS promoter, a key gene for menthol synthesis, and significantly increase the abundance of transcripts of other key enzyme genes in the menthol synthesis pathway, such as StL3OH, StIPR, and StPR, thereby enhancing the accumulation of menthol in Nepeta cataria leaves.
[0012] The main objective of this invention is to provide the application of the two MYB transcription factors (StMYB76 and StMYB13) involved in the regulation of pemphigone biosynthesis in plants, particularly in the genetic engineering of improving the content and composition of pemphigone in plants.
[0013] Transient overexpression of StMYB76 and StMYB13 in Nepeta cataria leaves strongly induced the accumulation of menthol, resulting in a high concentration of menthol in the leaves. Therefore, StMYB76 and StMYB13 can be used for transcriptional regulation of menthol biosynthesis in plants, thereby increasing menthol content.
[0014] StMYB76 and StMYB13 are the first reported MYB members in Nepeta cataria that can regulate the biosynthesis of menthol.
[0015] This invention uses *Nepeta cataria* (Lamiaceae) as the experimental material and employs biotechnologies such as gene cloning, real-time quantitative PCR, yeast one-hybrid assay, and transient expression to isolate and identify MYB members StMYB76 and StMYB13, which are involved in the regulation of menthol biosynthesis in *Nepeta cataria*. The study found that StMYB76 and StMYB13 can bind to elements in the StLS promoter and activate its expression. Furthermore, expression of StMYB76 and StMYB13 transcription factors in *Nepeta cataria* leaves not only positively regulates the transcriptional level of StLS but also significantly affects the transcript abundance of other key enzyme genes in the menthol biosynthesis pathway. Transient overexpression of StMYB76 and StMYB13 transcription factors in *Nepeta cataria* leaves significantly increases the content of menthol monoterpenes in the leaves. This invention uses *Nepeta cataria* (Lamiaceae) as the experimental material and employs bioanalysis, in vitro yeast one-hybrid assay, and in vivo transient expression to isolate and identify two MYB transcription factors, StMYB76 and StMYB13, that have transcriptional regulatory effects on menthol biosynthesis in *Nepeta cataria*. This invention can be used for transcriptional regulation of the biosynthesis of plant menthol monoterpenes, providing a theoretical basis and research direction for improving the regulatory mechanism of volatile oil synthesis in Lamiaceae plants and for molecular breeding. Attached Figure Description
[0016] Figure 1 Visual analysis of the gene regulatory network between the StLS gene and transcription factors.
[0017] Figure 2 Visual analysis of StLS gene promoter functional elements.
[0018] Figure 3 Evolutionary relationship analysis between StMYB76 and StMYB13 and members of the MYB family of the Lamiaceae family.
[0019] Figure 4 Interaction analysis of StMYB76 and StMYB13 with StLS promoter elements. (Figure A: Schematic diagram of the truncation of the 2000bp upstream promoter region of StLS; B: Self-activation analysis of StLS-P1, StLS-P2, and StLS-P3; C: Yeast one-hybrid analysis of StLS-P1 with StMYB76 and StMYB13, respectively; D: Yeast one-hybrid analysis of StLS-P2 and StLS-P3 with StMYB76 and StMYB13, respectively)
[0020] Figure 5This study investigated the content of menthol by transient overexpression of StMYB76 and StMYB13 in Nepeta cataria leaves and analyzed the expression patterns of genes related to the menthol biosynthesis pathway. (Figure A: Changes in the expression levels of key genes in the StMYB76 and menthol biosynthesis pathways; B: Changes in the expression levels of key genes in the StMYB13 and menthol biosynthesis pathways; C: Changes in the content of menthol monoterpenes in Nepeta cataria after overexpression of StMYB76 and StMYB13.) Detailed Implementation
[0021] The present invention will be further illustrated below with reference to embodiments and accompanying drawings, using the genes StMYB76 and StMYB13, which have this function, as examples. In the following embodiments, conventional gene manipulation methods are performed in accordance with *Molecular Cloning: A Laboratory Manual* (Third Edition).
[0022] Example 1: Screening and cloning of StMYB76 and StMYB13 genes from Nepeta cataria
[0023] (I) Experimental Methods
[0024] This invention, based on *Nepeta cataria* transcriptome data, identifies transcription factors within a gene set and obtains their binding motifs. Using the 2000 bp upstream sequence of StLS (SEQ: NO.3) as the promoter region, binding sites were searched, ultimately identifying 1192 transcription factors capable of binding to the StLS promoter region. The PlantCare online tool (http: / / bioinformatics.psb.ugent.be / webtools / plantcare / html / ) was used to predict cistropic elements in the StLS promoter region, with a focus on the MYBHV1 binding site based on the prediction results. The gene sequence of MYBHv1 (Hordeum vulgare subsp. vulgare) was obtained from the NCBI database (https: / / www.ncbi.nlm.nih.gov / ). Combined with homology alignment data of transcription factor binding motifs, two MYB transcription factors, StMYB76 (SEQ:NO.1) and StMYB13 (SEQ:NO.2), were screened that may affect the biosynthesis of menthol by regulating the expression of the StLS gene.
[0025] Based on the CDS sequence, specific primer pairs SEQ:NO.4 and SEQ:NO.5, and SEQ:NO.6 and SEQ:NO.7 were designed for PCR amplification to obtain the full-length sequences of StMYB76 and StMYB13, which were then verified by sequencing. The PCR reaction volume was 10 μL, consisting of 5 μL of 2×PhantaMax Master Mix, 1 μL of cDNA, 0.4 μL each of forward and reverse primers, and 3.2 μL of sterile water. The PCR program was 95℃ pre-denaturation for 3 min, followed by 35 cycles of 95℃ for 15 s, 55℃ for 15 s, 72℃ for 1 min, 72℃ for 5 min, and a 72℃ hold.
[0026] (II) Experimental Results
[0027] Sequencing verification yielded the StMYB76 sequence SEQ:NO.1 and the StMYB13 sequence SEQ:NO.2, which matched the *Nepeta cataria* transcriptome data.
[0028] Example 2: Interaction analysis with the target gene StLS
[0029] (I) Experimental Methods
[0030] Application of primer combinations: upstream primer of yeast one-hybrid StMYB76:
[0031] agtggtctctgtccagtcctATGGGTAGGTCTCCTTGCTGTG and yeast one-hybrid StMYB76 downstream primers:
[0032] upstream primers for yeast one-hybrid StMYB13: agtggtctctgtccagtcctATGGGACGATCTCCCTGCTG and downstream primers for yeast one-hybrid StMYB13:
[0033] The full-length sequences of StMYB76 (SEQ: NO.1) and StMYB13 (SEQ: NO.2) were amplified by ggtctcagcagaccacaagtTCATTTCATCTCCAAACTTCTGTAATC, and then inserted into the pGADT7 vector to obtain the prey vectors pGADT7-StMYB76 and pGADT7-StMYB13. Furthermore, based on the analysis of the promoter cis-acting elements, the StLS promoter region was truncated into three segments, and the upstream primer of yeast one-hybrid StLS-P1 was used: agtggtctctgtccagtcctGAAGATTTATTCTCATTTTTTAGGATAATATTTATTCTCA
[0034] Yeast one-hybrid StLS-P1 downstream primer: ggtctcagcagaccacaagtCGCTCCTGCAATTTACTATCG
[0035] and yeast one-hybrid StLS-P2 upstream primer:
[0036] agtggtctctgtccagtcctCACTACATAATTAAAAACAAAAACACTACATAAAAC
[0037] Downstream primers for yeast one-hybridization StLS-P2:
[0038] ggtctcagcagaccacaagtGAATTTTCTTCAATAATGGGCCTAAAAG
[0039] And the upstream primer for yeast one-hybrid StLS-P3:
[0040] agtggtctctgtccagtcctGAAATTGATGAAATTGATGCAAAAACTG
[0041] Yeast one-hybrid StLS-P3 downstream primer:
[0042] The promoter sequences of StLS-P1, StLS-P2, and StLS-P3 were inserted into the pAbAi vector to construct bait vectors pAbAi-StLS-P1, pAbAi-StLS-P2, and pAbAi-StLS-P3. The bait vectors were linearized using the BstBI enzyme and transformed into Y1HGold yeast strain. The transformed yeast was then serially diluted four times (10-fold) and inoculated onto SD / -Ura solid medium containing different concentrations of AbA (0, 100, 200, 400, and 600 ng mL⁻¹) for self-activation detection. pAbAi-StLS-P1, pAbAi-StLS-P2, and pAbAi-StLS-P3 were co-transformed with pGADT7-StMYB76 and pGADT7-StMYB13 in yeast cells using a yeast transformation kit (Coolaber, Beijing). Spot identification experiments were performed on SD / -Leu / AbA solid medium containing AbA (600 ng mL⁻¹) and cultured at 28°C for 2–3 days. The interaction between transcription factors and promoter fragments was determined based on the growth of yeast on the selective medium.
[0043] (II) Experimental Results
[0044] like Figure 4 The results of the yeast one-hybrid (YIH) experiment showed that both StMYB76 and StMYB13 had the effect of activating the StLS-P2 promoter, a key enzyme gene for menthone synthesis, but had no effect on the StLS-P1 and StLS-P3 promoters.
[0045] Example 3: Analysis of Induced Menthol Accumulation
[0046] (I) Experimental Methods
[0047] Thermo Scientific was selected TM FastDigest Eco31I (IIs type) was used to linearize the Phreac-GFP vector, and primer combinations were applied to transiently overexpress the upstream primer of StMYB76:
[0048] The downstream primer for transient overexpression of StMYB76 is: aatttaatgaaaccagagcgTCATTTCATTTCCAAGCTTCTGTAATCCAAAAC. The upstream primer for transient overexpression of StMYB13 is: tatattaaacgtctctaaaaATGGGACGATCTCCCTGCTG. The downstream primer for transient overexpression of StMYB13 is:
[0049] The full-length sequences of StMYB76 (SEQ: NO.1) and StMYB13 (SEQ: NO.2) were amplified using the ClonExpress II One Step Cloning Kit. StMYB76 and StMYB13 were then homologously recombinated with the linearized Phreac-GFP vector. The recombinant plasmids were transformed into Agrobacterium GV3101 competent cells and cultured in liquid medium containing 50 mg / L kanamycin until OD600 = 0.6. The bacterial suspension was centrifuged at 4000 rpm at room temperature, and the cells were collected and resuspended in resuspending buffer (10 mM / L MES, 10 mM / L MgCl, 200 μM / L AS). The resuspending buffers containing Phreac-GFP, Phreac-GFP-StMYB76, and Phreac-GFP-StMYB13 were incubated at 25°C and 50 rpm for 2–3 hours. S. tenuifolia leaves were infected using the injection permeation method. The suspension was slowly injected into the lower epidermis of the leaf until the entire leaf was soaked. The leaves were cultured for three days under the conditions of 16 h / d light, 10000 X light intensity, and 25 °C humidity.
[0050] The injected leaves were frozen in liquid nitrogen for subsequent detection of menthol content and gene expression analysis. The primers for StLS qPCR are as follows: StLS qPCR upstream primer: ACGGATTCACTCGCAAAGGACAC; StLS qPCR downstream primer: TTGGCACATCACCTCTGCTCACC. The primers for StL3OH qPCR are as follows: StL3OH qPCR upstream primer: CTCGCCAATGTAGAGGTT; StL3OH qPCR downstream primer: GGGAGTGGGGATTAAGAC. The primers for StIPD qPCR are as follows: StIPD qPCR upstream primer: TGGGACAGCCGACGATGTGGAGAGTT; StIPD qPCR downstream primer: AAAGCCGCCTCATCCGAAGCCAAAAA. The primers for StIPR qPCR are as follows: StIPR qPCR upstream primer: AAGCCGGTGGTGGAAAGAAT; StIPR qPCR downstream primer: CCACTTGTAGGAGATTGGCT. The primers for StPR qPCR are as follows: StPR. The qPCR upstream primers were: TCCCAACATGAAAACGAAAGG and StPR qPCR downstream primers were: GCGGCACAACTAAATCGAAAA. The qPCR primers for StMYB76 were: GCGTGGACTAAAGAAGAAGAC and GTTGCCGAGAAGGCTATG. The qPCR primers for StMYB13 were: TCGCCTACATCCGCTCCCA and TCTCGTTGTCGGTCCTTCC. For the *Nepeta cataria* (StEF) internal reference gene, the qPCR primers were: StEF qPCR upstream primers: GACAAGCCTCTTCGTCTCCC and GTTCGATGCAACAAACCCAC. Each of the three positive clones for each gene was used as a repeat of the above operations, forming three biological replicates. The qPCR reaction system consisted of 5 μL of 2×ChamQ UniversalSTBR qPCR Master Mix, 0.2 μL each of forward and reverse primers, 0.5 μL of cDNA, and 4.1 μL of RNase-free ddH2O.The reaction procedure was as follows: pre-denaturation: 95℃ for 30 s; cyclic reaction: 95℃ for 10 s, 60℃ for 30 s, 40 cycles. Three technical replicates were set for all samples. To determine the specificity of the quantitative fluorescence amplification, melting curve analysis was performed after amplification. The procedure was as follows: gradually increase the temperature from 60℃ to 95℃, taking readings every 0.5℃ for 5 s, continuously recording the changes in fluorescence signal. The experimental data were plotted as follows: -ΔΔCT The computational method is used to analyze the relative expression levels of genes.
[0051] The content of menthol monoterpenes in *Nepeta cataria* leaves after transient overexpression treatment was determined using a gas chromatograph (8860 (G2790A), Agilent Technologies). 0.05 g of *Nepeta cataria* leaves from the same location were mixed with 0.7 mL of camphor internal standard solution, followed by the addition of 4 steel beads. The mixture was then ground in a tissue homogenizer (60 Hz, 60 s), centrifuged at 12,000 rpm for 5 minutes, and centrifuged again at 12,000 rpm for 1 minute after adding an appropriate amount of anhydrous sodium sulfate. The supernatant was collected and filtered through a 0.22 μm organic filter membrane to obtain the sample. Each sample was tested three times. The gas chromatography program was as follows: Agilent 19091S-433HP-5ms capillary column (250μm×30m×0.25μm), temperature program: initial 50℃, hold for 3 min, increase to 90℃ at a rate of 3℃ / min, increase to 150℃ at a rate of 5℃ / min, increase to 220℃ at a rate of 10℃ / min, hold for 5 min; injection port temperature was 250℃; carrier gas was nitrogen; flow rate was 1.0 mL / min; injection volume was 1 μL; splitless.
[0052] (II) Experimental Results
[0053] like Figure 5 Gene expression analysis and menthol content analysis showed that, compared with the Phreac-GFP(OE) control group, the expression level of the StLS gene in the Phreac-GFP-StMYB76 and Phreac-GFP-StMYB13 overexpressing plants in the experimental group was significantly increased. Furthermore, the expression levels of menthol biosynthesis-related genes StL3OH, StIPD, and StPR were also significantly increased. In addition, the menthol content in the leaves of *Nepeta cataria* was also significantly increased.
[0054] This invention uses Nepeta cataria, a plant of the Lamiaceae family, as the test material. It employs biotechnologies such as gene cloning, real-time quantitative PCR, yeast one-hybridization, and transient expression to isolate and identify that Nepeta cataria StMYB76 and StMYB13 have a transcriptional regulatory effect on the biosynthesis of menthol, which can be applied to the genetic engineering of plant menthol biosynthesis.
Claims
1. A MYB transcription factor involved in the regulation of nepeta tenuifolia menthone biosynthesis, characterized by: The MYB transcription factor is either StMYB76 or StMYB13; the nucleotide sequences of StMYB76 and StMYB13 are shown in SEQ NO.1 and SEQ NO.2, respectively.
2. The application of MYB transcription factor overexpression as described in claim 1 in the transcriptional regulation that promotes the biosynthesis of nepeta tenuifolia menthone.
3. According to the application described in claim 2, the MYB transcription factors all bind to the StLS promoter element and activate its expression; significantly enhance the transcript abundance of StLS, StL3OH, StIPD, and StPR, which are related to the synthesis of peperomia oleifera; and promote the accumulation of peperomia oleifera leaves.
Citation Information
Patent Citations
MYB (myeloblastosis) transcription factors involved in regulation of biological synthesis of peach flavonol and their application
CN107955067A
Application of DsMYB (Desmodium styracifolium transcription factor) in regulation and control of flavone biosynthesis
CN117625640A