Plant endophyte with antibacterial activity and application

Abstract

The invention relates to the field of microorganisms, and discloses a plant endophyte with antibacterial activity and application, the name of the strain is Penicillium rubens Dh15, the strain is preserved in China Center for Type Culture Collection, the address of the preservation unit is Wuhan University, Wuchang District, Wuhan, Wuhan, the preservation number is CCTCC NO: M20231054, and the preservation date is June 19, 2023; the plant endophytic fungus Dh15 provided by the invention has antibacterial activity, especially can effectively inhibit clinical pathogenic bacteria such as staphylococcus aureus, bacillus subtilis, escherichia coli, micrococcus luteus, bacillus violaceus, pseudomonas aeruginosa and the like, makes up for the blank of the strains in clinical research, and provides a new way for developing new antibacterial substances.

Description

Technical Field

[0001] The present invention relates to the field of microorganisms, and more specifically, to plant endophytes with antibacterial activity and applications thereof. Background Art

[0002] Natural products are an important source for discovering drug lead compounds. Microorganisms are an important source of natural products. They are widely distributed and ecologically diverse. In order to adapt to diverse biological environments, microorganisms produce secondary metabolites with diverse structures and activities. According to literature statistics, 12 of the 22 antibacterial drugs launched after 2000 are derived from microbial secondary metabolites; in the world drug market, about 70% of antibiotics are derived from microorganisms.

[0003] As a valuable microbial resource, plant endophytic fungi have diverse secondary metabolites with a wide range of biological activities and are the main producers of a variety of active substances such as antibacterial and antitumor substances.

[0004] Antimicrobial drugs are generally drugs with bactericidal or bacteriostatic activity. Most antimicrobial drugs are derived from microorganisms such as bacteria, fungi, and actinomycetes. Antimicrobial drugs are widely used and relatively important drugs in clinical practice. However, with the extensive use of antimicrobial drugs, more and more bacteria have become resistant to known antibiotics. Therefore, it is required to accelerate the research and development of new antimicrobial substances and develop drugs with higher antimicrobial activity. Summary of the invention

[0005] The present invention provides a plant endophyte with antibacterial activity and application thereof. The plant endophyte is named Dh15, and the bacterium has good antibacterial effects on Staphylococcus aureus, Bacillus subtilis, Escherichia coli, Micrococcus luteus, Bacillus violaceus, and Pseudomonas aeruginosa, and has good development and application prospects in antibacterial drugs.

[0006] The present invention provides a plant endophyte with antibacterial activity, which is classified and named Penicillium rubens Dh15. The strain has been deposited in the China Center for Type Culture Collection, the address of the depository is: Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, the deposit number is CCTCC NO: M20231054, and the deposit date is June 19, 2023.

[0007] An application of plant endophytes with antibacterial activity, wherein the Dh15 bacterium is used to prepare an antibacterial agent for inhibiting pathogenic bacteria.

[0008] Pathogens include clinical pathogens such as Staphylococcus aureus, Bacillus subtilis, Escherichia coli, Micrococcus luteus, Bacillus violaceus, and Pseudomonas aeruginosa.

[0009] Preferred: Dh15 bacteria are isolated from the rhizomes of Dendrobium huoshanense, and its morphological characteristics are: the strain grows rapidly on the PDA plate, produces relatively sparse hyphae with fluffy and white texture within 24 hours; after 48 hours, the surface of the colony is green, and a large number of powdery green spores are produced, the conidiophores are broom-shaped, the mature conidia are spherical, and the back of the colony is brown-red fat-soluble pigment.

[0010] The method for preparing an antibacterial extract using Dh15 bacteria comprises the following steps: S1: Inoculate the fungus Dh15 into potato solid culture medium for activation and culture at 28°C for 3-4 days; then take an appropriate amount of the activated strain and inoculate it into 100 mL potato liquid culture medium (250 mL bottle), and culture it at 28°C and 150-200r / min on a shaker for 3-4 days to obtain seed liquid; S2: Add 100 g of rice and 100 mL of distilled water to a 500 mL conical flask, and sterilize in an autoclave at 121°C for 30 min. After sterilization, place in a clean bench to room temperature, take 10-30 mL of the cultured fungal seed culture solution and add it to the rice culture medium, and culture it in a constant temperature incubator at 28°C for 15-30 days. S3: After fermentation is completed, add 200-400 mL of ethyl acetate to each conical flask to cover the rice culture medium, perform ultrasonic extraction for 20-40 min, repeat 1-3 times, filter to obtain the ethyl acetate layer, and use a rotary evaporator to evaporate the ethyl acetate layer under reduced pressure to obtain an extract.

[0011] The extract concentration was 50 mg / mL, and the sizes of inhibition zones against Staphylococcus aureus, Bacillus subtilis, and Escherichia coli were 24 mm, 13 mm, and 9 mm, respectively.

[0012] The minimum inhibitory concentrations of the extract against Staphylococcus aureus, Bacillus subtilis and Escherichia coli were 3.125 mg / mL, 12.5 mg / mL and 25 mg / mL, respectively.

[0013] The beneficial effects of the present invention are as follows: the plant endophytic fungus Dh15 provided by the present invention has antibacterial activity, especially can effectively inhibit clinical pathogenic bacteria such as Staphylococcus aureus, Bacillus subtilis, Escherichia coli, Micrococcus luteus, Bacillus violaceus, Pseudomonas aeruginosa, etc., fills the gap in clinical research of such strains, and provides a new way for the development of new antibacterial substances. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 is an electron microscope photograph of the bacterial strain Dh15 of the present invention; Figure 2 This is a photo of the colony morphology of the strain Dh15 of the present invention; Figure 3 It is the phylogenetic tree of strain Dh15 of the present invention. DETAILED DESCRIPTION

[0015] The subject matter described herein will now be discussed with reference to example embodiments. It should be understood that the discussion of these embodiments is only to enable those skilled in the art to better understand and implement the subject matter described herein, and the functions and arrangements of the elements discussed may be changed without departing from the scope of protection of the contents of this specification. Each example may omit, replace or add various processes or components as needed. In addition, the features described relative to some examples may also be combined in other examples.

[0016] Example 1: Isolation, purification and preservation of plant endophytic fungus strain Dh15 Rinse the rhizomes of Dendrobium huoshanense with tap water for 10-20 minutes, remove the surface debris, then wash with sterile water for 3 times, disinfect with 75% ethanol for 30 seconds, and disinfect with 3% NaClO solution for 3 minutes. Repeat the operation 2-3 times, place the disinfected samples on sterile absorbent paper, cut the disinfected samples into pieces, and inoculate the samples into PDA culture medium (200g peeled potatoes, cut into pieces and boiled for 20 minutes, 8 layers of gauze to remove the filtrate, 20g glucose, 20g agar, water to 1L, 121℃, sterilized for 20 minutes) with sterilized tweezers; place the above culture dishes in a constant temperature incubator at 28℃ and culture for 3-5 days.

[0017] According to the top purification method, combined with the morphology and color of the colonies, after the culture medium grows colonies, they are transferred to new PDA culture medium and purified multiple times until a single, stable colony is obtained, which is stored in a glycerol tube at -80°C. Figure 1 The colony morphology is shown in Figure 2 shown.

[0018] Example 2: Molecular Biological Identification of Bacterial Species Dh15 The present invention uses molecular biological technology to perform species identification analysis on the purified strain through ITS sequence. The technical route is: DNA extraction → ITS fragment amplification → sequence determination → Blast comparative analysis. The sequenced sequence is shown in SEQ ID No. 1, and is submitted to the NCBI database for Blast comparison, and the result shows Penicillium rubens.

[0019] SEQ ID No.1: TTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAACCTGGATAAAAATTTGGGTTGATCGGCAAGCGCCGGCCGGGCCTACAGAGCGGGTGACAAAGCCCCATACGCTCGAGGACCGGACGCGGTGCC GCCGCTGCCTTTCGGGCCCGTCCCCGGGATCGGAGGACGGGGCCCAACACACAAGCCGTGCTTGAGGGCAGAAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGA TTCACTGAATTTGCAATTCACATTACGTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCGTTGTTGAAAGTTTTAAAATAATTTATATTTTCACTCAGACTACAATCTTCAGACAGAGTTCGAGGGT GTCTTCGGCGGGCGCGGGCCCGGGGGCGTAAGCCCCCCGGCGGCCAGTTAAGGCGGGCCCGCCGAAGCAACAAGGTAAAATAAACACGGGTGGGAGGTTGGACCCAGAGGGCCCTCACTCGGTAATGATCCTTCCGCAGGT Based on the above characteristics, the plant endophyte was identified as Penicillium rubens and named Dh15. The strain has been deposited in the China Center for Type Culture Collection, the address of the depository is: Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, the deposit number is CCTCC NO: M20231054, and the deposit date is June 19, 2023.

[0020] Example 3: Application of Dh15 bacteria in the preparation of antibacterial agents for inhibiting pathogenic bacteria The method for preparing an antibacterial extract using Dh15 bacteria comprises the following steps: S1: Inoculate the fungus Dh15 into potato solid culture medium for activation and culture at 28°C for 3-4 days; then take an appropriate amount of the activated strain and inoculate it into 100 mL potato liquid culture medium (250 mL bottle), shake and culture at 28°C and 150-200 r / min for 3-4 days to obtain seed liquid; S2: Add 100g rice and 100mL distilled water to a 500mL conical flask, sterilize in an autoclave at 121℃ for 30min; after sterilization, place in a clean bench to room temperature, take 10-30mL of the cultured fungal seed culture solution and add it to the rice culture medium, and culture it in a constant temperature incubator at 28℃ for 15-30d; S3: After fermentation is completed, 200-400 mL of ethyl acetate is added to each conical flask to cover the rice culture medium, and ultrasonic extraction is performed for 20-40 minutes. The extraction is repeated 1-3 times, and the ethyl acetate layer is filtered to obtain the ethyl acetate layer. The ethyl acetate layer is evaporated to dryness under reduced pressure using a rotary evaporator to obtain an extract.

[0021] Example 4: Preparation of extract from fermentation broth of plant endophytic fungus strain Dh15 S1: Take out the fungus Dh15 stored in the glycerol tube at -80℃, activate it in PDA medium, and culture it at 28℃ for 3-4 days. Then take an appropriate amount of the activated strain and inoculate it into 100mL PDA liquid medium (250mL bottle), and culture it at 28℃ and 180r / min shaking to obtain seed liquid.

[0022] S2: Add 100g rice and 100mL distilled water to a 500mL conical flask and sterilize at 121℃ for 30min in an autoclave. After sterilization, place it in a clean bench to room temperature, take 10-30mL of the cultured fungal seed culture solution and add it to the rice culture medium, and culture it in a constant temperature incubator at 28℃ for 15-30d.

[0023] S3: After fermentation is completed, 300 mL of ethyl acetate is added to each conical flask to cover the rice culture medium, and ultrasonic extraction is performed for 20 minutes, which is repeated twice, and the ethyl acetate layer is filtered and evaporated to dryness under reduced pressure using a rotary evaporator to obtain an extract.

[0024] Example 4: Antimicrobial activity test of the fermentation broth extract of the plant endophytic fungus strain Dh15 (1) The extract was dissolved in methanol to prepare a solution with a concentration of 50 mg / mL. The solvent was filtered through a filter membrane with a pore size of 0.22 μm to obtain a test sample.

[0025] (2) Staphylococcus aureus, Bacillus subtilis, Escherichia coli, Micrococcus luteus, Bacillus violaceus, and Pseudomonas aeruginosa were inoculated into sterilized LB liquid culture medium, and cultured at 30°C and 180 rpm for 12 h.

[0026] (3) Take 100 μL of the pathogen mixture and spread it evenly on the plate. Use an Oxford cup to test the antibacterial activity. Incubate at 30°C for 24 hours and measure the diameter of the inhibition zone. Determination of the diameter of the inhibition zone: if the diameter of the inhibition zone is ≤8 mm, it is judged as no antibacterial effect; if the diameter of the inhibition zone is greater than 8 mm, it is judged as having an antibacterial effect. If the diameter of the inhibition zone is greater than 8 mm and less than 10 mm, it is judged as having a weak antibacterial effect; if the diameter is between 10 mm and 15 mm, it is judged as having a moderate antibacterial effect; if the diameter of the inhibition zone is greater than 15 mm, it is judged as having a strong antibacterial effect.

[0027] Table 1 Antimicrobial activity of endophytic fungus Dh15

[0028] Example 5: Minimum inhibitory concentration of extracts tested by two-fold dilution method Pathogens with inhibition zone diameters of more than 15 mm were selected: Staphylococcus aureus, Bacillus subtilis, and Escherichia coli, and the minimum inhibitory concentration of the extract against the three pathogens was explored.

[0029] (2) The original sample was diluted by the two-fold dilution method to obtain solutions with concentrations of 25 mg / mL, 12.5 mg / mL, 6.25 mg / mL, 3.125 mg / mL, and 1.5625 mg / mL. Chloramphenicol at a concentration of 30 mg / mL was prepared as a positive control.

[0030] (3) Take 100 μL of overnight cultured pathogens and spread them evenly on the LB plate. Use an Oxford cup to test the in vitro antibacterial activity (three parallel samples are required for each sample), incubate in a 30°C incubator for 24 hours, and measure and record the diameter of each inhibition zone.

[0031] The results showed that the minimum inhibitory concentrations of the extract against Staphylococcus aureus, Bacillus subtilis and Escherichia coli were 3.125 mg / mL, 12.5 mg / mL and 25 mg / mL respectively.

[0032] The above describes an embodiment of the present embodiment, but the present embodiment is not limited to the above-mentioned specific implementation methods. The above-mentioned specific implementation methods are merely illustrative and not restrictive. Under the guidance of the present embodiment, ordinary technicians in this field can also make many forms, all of which are within the protection of the present embodiment.

Claims

1. A plant endophyte with antibacterial activity, characterized in that: The plant endophyte is classified and named Penicillium rubens Dh15. The strain has been deposited in the China Center for Type Culture Collection. The address of the depository is: Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City. The deposit number is CCTCC NO: M20231054, and the deposit date is June 19, 2023.

2. The use of a plant endophyte with antibacterial activity according to claim 1, characterized in that: Dh15 bacteria are used to prepare antibacterial agents that inhibit pathogenic bacteria.

3. The plant endophyte with antibacterial activity according to claim 2, characterized in that: Pathogens include clinical pathogens such as Staphylococcus aureus, Bacillus subtilis, Escherichia coli, Micrococcus luteus, Bacillus violaceus, and Pseudomonas aeruginosa.

4. The plant endophyte with antibacterial activity according to claim 1, characterized in that: Dh15 was isolated from the rhizomes of Dendrobium huoshanense, and its morphological characteristics are as follows: The strain grows rapidly on PDA plates, producing relatively sparse, fluffy, white hyphae within 24 hours; after 48 hours, the surface of the colony turns green and produces a large amount of powdery green spores, the conidiophores are broom-shaped, the mature conidia are spherical, and the back of the colony is brown-red fat-soluble pigment.

5. The plant endophyte with antibacterial activity according to claim 3, characterized in that: The method for preparing an antibacterial extract using Dh15 bacteria comprises the following steps: S1: Inoculate the fungus Dh15 into potato solid culture medium for activation and culture at 28°C for 3-4 days; then take an appropriate amount of the activated strain and inoculate it into 100 mL potato liquid culture medium (250 mL bottle), and culture it at 28°C and 150-200r / min on a shaker for 3-4 days to obtain seed liquid; S2: Add 100g rice and 100mL distilled water to a 500mL conical flask, sterilize in an autoclave at 121℃ for 30min; after sterilization, place in a clean bench to room temperature, take 10-30mL of the cultured fungal seed culture solution and add it to the rice culture medium, and culture it in a constant temperature incubator at 28℃ for 15-30d; S3: After fermentation is completed, 200-400 mL of ethyl acetate is added to each conical flask to cover the rice culture medium, and ultrasonic extraction is performed for 20-40 minutes. The extraction is repeated 1-3 times, and the ethyl acetate layer is filtered to obtain the ethyl acetate layer. The ethyl acetate layer is evaporated to dryness under reduced pressure using a rotary evaporator to obtain an extract.

6. The plant endophyte with antibacterial activity and its use according to claim 5, characterized in that: The extract concentration was 50 mg / mL, and the sizes of inhibition zones against Staphylococcus aureus, Bacillus subtilis, and Escherichia coli were 24 mm, 13 mm, and 9 mm, respectively.

7. The plant endophyte with antibacterial activity and its use according to claim 6, characterized in that: The minimum inhibitory concentrations of the extract against Staphylococcus aureus, Bacillus subtilis and Escherichia coli were 3.125 mg / mL, 12.5 mg / mL and 25 mg / mL, respectively.

Images