Target gene knockout method for photobacterium dama subspecies fish killing

Abstract

The invention belongs to the technical field of aquatic product pathogen gene editing, and particularly relates to a target gene knockout method for photobacterium damsela subsp. Piscicida (PDP), which is characterized in that the target gene knockout method for the photobacterium damsela subsp. Piscicida (PDP) is disclosed. The method comprises the following steps: obtaining a DNA fusion fragment with deletion of a target region fragment of a target gene (MshL) by adopting overlapping PCR (Polymerase Chain Reaction), constructing a recombinant vector by using the obtained DNA fusion fragment, and obtaining the target gene knocked-out photobacterium damnieri subspecies fish by taking escherichia coli S17-1 lambda pir as a donor bacterium of a recombinant plasmid and PDP as a recipient bacterium. Specific knockout of the PDP specific gene is achieved for the first time, the knockout efficiency is high (the single-exchange positive rate is 29.2%, and the double-exchange positive rate is 30.8%), the cost is low, and the method is suitable for construction of a PDP specific gene deleted strain and functional research of the specific gene.

Description

Technical Field

[0001] This invention belongs to the field of aquatic pathogen gene editing technology, specifically relating to a fish-killing subspecies of *Bacillus violaceus* (also known as *Bacillus violaceus*). Photobacterium damselae subsp. piscicida PDP (Peripheral Gene Detection Method) target gene knockout method. Background Technology

[0002] Mermaid bioluminescent bacteria fish-killing subspecies ( Photobacterium damselae subsp. piscicida *Proteobacterium tumefaciens* is a Gram-negative, halophilic bacterium widely distributed in the global marine environment and a typical pathogenic bacterium for aquatic animals. *Proteobacterium tumefaciens* subspecies *Pyrophorus* is hemolytic and exhibits multidrug resistance to antibiotics such as erythromycin and streptomycin, often causing severe losses to the aquaculture industry. In recent years, *Proteobacterium tumefaciens* disease has frequently occurred in major deep-sea aquaculture species in my country, such as sea bass and rockfish, seriously hindering the healthy and sustainable development of my country's deep-sea aquaculture industry. However, research on the pathogenic mechanism of *Proteobacterium tumefaciens* subspecies *Pyrophorus* is limited. Gene knockout technology provides an effective approach and method for studying the pathogenic genes of *Proteobacterium tumefaciens* subspecies *Pyrophorus*, and also provides a technical means for developing a live attenuated vaccine against *Proteobacterium tumefaciens* subspecies *Pyrophorus*.

[0003] Bacterial gene knockout is a genetic engineering technique that involves altering or deleting specific gene sequences in bacteria to inactivate or eliminate those genes, thereby allowing the study of their biological functions. Currently, there are many methods for bacterial gene knockout, making it difficult to develop a unified and effective knockout technique for any specific bacterium. While gene knockout technology is widely used in gene function research, it lacks a unified and effective method for different bacterial species. For example, the function of the same vector may vary significantly in different bacterial genetic systems, and different plasmids and bacteria have different requirements for transformation conditions. Furthermore, the vast diversity of bacteria, with their significant differences in morphology, gene regulatory characteristics, and physicochemical properties, particularly the thick and poorly permeable cell walls of many bacteria, also contributes to the low efficiency of bacterial gene knockout.

[0004] Currently, there are no reports of successful gene knockout cases for the fish-killing subspecies of *Bacillus merantii*, which to some extent limits the study of the bacterium's gene function. Therefore, establishing a gene knockout technology applicable to the fish-killing subspecies of *Bacillus merantii* will provide important reference for the study of the bacterium's virulence and pathogenicity. Summary of the Invention

[0005] The purpose of this invention is to provide a fish-killing subspecies of *Bacillus mermaidus* ( ). Photobacterium damselae subsp. piscicida PDP (Peripheral Gene Detection Method) target gene knockout method.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows: A method for knocking out the target gene of *Bacillus violaceus* subspecies *Pyrophorus* from mermaids, using overlap PCR to obtain the target gene ( MshL The DNA fusion fragment with the missing target region was obtained, and the obtained DNA fusion fragment was used to construct a recombinant vector. Escherichia coli S17-1 λpir was used as the donor bacteria for the recombinant plasmid, and PDP was used as the recipient bacteria to obtain the 'Mermaid luminescent bacillus' subspecies with the target gene knocked out.

[0007] The target gene is a gene encoding fimbriae biosynthesis proteins. MshL .

[0008] To elaborate further, 1) Construction of homologous arms: The fimbriae biosynthesized proteins were obtained using overlap PCR technology. MshL Δ fusion fragment of upstream and downstream homologous arms of the gene MshL The fusion fragment was then recombined into the T vector and transformed into E. coli Trans-T1 competent cells. The recombinant vector Δ was identified and obtained. MshL -T; 2) Construction of recombinant suicide plasmid: Δ MshL The target DNA fragment was obtained by double digestion with BamHI and XhoI. The suicide plasmid PDM4 was knocked out by double digestion with BglII and XhoI. After gel extraction and recovery, the fragments were ligated and transformed into Trans-T1 competent cells. Positive clones were selected, and the recombinant vector Δ was extracted. MshL -PDM4; 3) Transformation of recombinant plasmids (in conjunction with transfer experiments): Δ MshL -PDM4 was used to transform S17-1λpir competent cells to obtain the S17-1λpir strain carrying the recombinant (S17-Δ MshL Using PDM4 as the donor bacterium, PDP as the recipient bacterium, and Pen and Cm as double antibodies, binding transfer experiments were conducted to obtain transformed strains of recombinant plasmids. Further screening was then performed to obtain knockout strains. MshL The mermaid bioluminescent bacillus subsp. fish-killing.

[0009] In step 1), The base sequences of the upstream homologous arm amplification primers are as follows: ΔMshL-UpF: GGATCCAGCATCAGGAAACACAGTTAAAGCTCGAAC; ΔMshL-UpR:CATTAAGCAGTACAGCGACTCGACGCAT; The base sequences of the downstream homologous arm amplification primers are as follows: ΔMshL-LowF: AGTCGCTGTACTGCTTAATGAGTGGTTC; ΔMshL-LowR:CTCGAGCGGAATACCGTTACTGGCCTGCCA.

[0010] The fusion DNA fragment obtained by overlap PCR was ligated into the T vector, and the target fragment was obtained by double digestion with restriction endonucleases BamHI and XhoI. PDM4 was then double digested with restriction endonucleases BglII and XhoI. Finally, the fragments were recovered by gel excision and ligated with T4 DNase to construct the recombinant vector.

[0011] Both the obtained strain S17-1 λpir and strain PDP were subjected to OD. 600 nm Collected at approximately 0.6 μg / mL and bound to transfer at a 2:1 mass ratio for 48 h. Screened and identified using LB plates containing Pen and Cm dual antibodies. Identification primers were: ΔMshL-UpF: GGATCCAGCATCAGGAAACACAGTTAAAGCTCGAAC ΔMshL-UpR: CTCGAGCGGAATACCGTTACTGGCCTGCCA.

[0012] The transformed strains of the recombinant plasmid were screened and identified in LB medium with 12% sucrose to obtain the target gene knocked out of the *Bacillus merantii* subsp. *merantii*. The identification primers are: ΔMshL-UpF:GGATCCAGCATCAGGAAACACAGTTAAAGCTCGAAC ΔMshL-LowR: CTCGAGCGGAATACCGTTACTGGCCTGCCA.

[0013] The present invention has the following advantages: (1) This invention significantly improves the PDP binding and transformation efficiency by optimizing the conditions of binding, culture and induction, and successfully achieves high-efficiency knockout of specific genes of PDP through two homologous recombinations (single crossover positive rate 29.2%, double crossover positive rate 30.8%).

[0014] (2) The PDP gene knockout platform established by this invention is easy to operate, highly reliable, and does not introduce exogenous DNA. The knockout strains obtained can be applied to the research of specific functional genes, the preparation of attenuated vaccines, and other fields. Attached Figure Description

[0015] Figure 1 This is a schematic diagram of primer design in an embodiment of the present invention.

[0016] Figure 2 These are the PCR amplification results of the upstream ΔMshL-Up fragment and the downstream ΔMshL-Low fragment in an embodiment of the present invention. 1-3 represent ΔMshL-Up, and 4-6 represent ΔMshL-Low.

[0017] Figure 3 For the embodiment of the present invention Δ MshL Results of fusion fragment amplification.

[0018] Figure 4 This is an embodiment of the present invention. ΔMshL PCR identification results of -T positive clones.

[0019] Figure 5 S17 of the present invention ΔMshL PCR identification results of PDM4 positive strains.

[0020] Figure 6 This is the PCR identification result of the single-exchange experiment in an embodiment of the present invention.

[0021] Figure 7 This is the PCR identification result of the double exchange experiment in this embodiment of the invention.

[0022] Figure 8 MshL The sequence of a gene and its upstream and downstream DNA.

[0023] Figure 9 PDP knockout strain ΔMshL MshL DNA sequence at the location of the gene Detailed Implementation

[0024] The present invention will be further described below with reference to embodiments. These embodiments are intended to illustrate the invention and are not intended to limit the invention in any way.

[0025] This invention relates to the fish-killing subspecies of *Bacillus merantii* (also known as Mermaid luminescent bacteria). Photobacterium damselae subsp. piscicida PDP gene knockout technology and its applications. This technology achieves specific knockout of specific genes in PDP for the first time, with high knockout efficiency (single crossover positive rate 29.2%, double crossover positive rate 30.8%) and low cost, and is suitable for the construction of PDP gene deletion strains and the functional study of specific genes.

[0026] Example 1: Activation and resistance screening of PDP strains Step (1) Activation culture of PDP: Take out PDP from the -80℃ freezer and streak it on LB plate and incubate overnight at 28℃. Then pick a single colony and inoculate it into 5 ml of LB liquid medium and incubate at 28℃ for activation. Transfer it to an appropriate amount of LB liquid medium at a bacterial culture: medium ratio of 1:100. All experiments use PDP in the logarithmic growth phase (when the bacteria are most viable).

[0027] Step (2) PDP Antibiotic Sensitivity Test: Antibiotic sensitivity was performed in a conventional manner. Nine common antibiotics were selected to test and analyze the sensitivity of PDP to antibiotics, including Pen (penicillin), Amp (ampicillin), Kan (kanamycin), Van (vancomycin), Cm (chloramphenicol), Gen (gentamicin), Cli (clindamycin), Ery (erythromycin), and Pip (piperacillin). The results showed that *Bacillus medusa* subsp. *fish-killing* was sensitive to Kan, Cm, Gen, and Pip, but not sensitive to Pen, Amp, Van, Cli, and Ery (Table 1). Therefore, this invention uses Pen as the antibiotic for screening PDP strains, and Cm as the antibiotic for identifying knockout plasmids.

[0028] Step (3) Determination of the optimal antibiotic concentration: Prepare LB solid plates with Pen concentrations of 100 μg / ml, 300 μg / ml, 1 mg / ml, 3 mg / ml and 10 mg / ml, respectively. Take 100 μL of each plate, with a concentration of 10 mg / ml. 7 PDP and S17-1λpir strains at CFU / ml were plated on the above LB plates. Pen concentrations that allowed PDP to grow normally but not S17-1λpir were selected for subsequent experiments. The final working concentration of Pen was determined to be 1 mg / ml, while the working concentration of chloramphenicol Cm was 30 μg / ml.

[0029] Table 1 shows the drug susceptibility test results of the PDP strain of the present invention.

[0030] Example 2: Construction of knockout plasmid Step (1) Amplification of homologous arm DNA fragments Genomic DNA was extracted from PDPs (GeneBank numbers CP184801 and CP184802). Using these as templates, primers ΔMshL-UpF / ΔMshL-UpR and ΔMshL-LowF / ΔMshL-LowR were used to amplify DNA fragments 715 bp upstream and 721 bp downstream of the fimbrial biosynthesis protein ΔMshL gene, respectively. The positional characteristics of the primer design are described in [reference needed]. Figure 1The PCR amplification program was as follows: 94℃ for 3 min, 35 Cycle (94℃ 30 sec, 58℃ 30 sec, 72℃ 1 min), 72℃ for 5 min, and hold at 4℃. This yielded the upstream Δ... MshL -Up fragments and downstream ΔMshL -Low segment ( Figure 2 ).

[0031] Figure 2 In the diagram, 1-3 represent the amplification results of the upstream fragment, and 4-6 represent the amplification results of the downstream primer.

[0032] Step (2) Obtaining the fused fragment The above obtains upstream Δ MshL -Up fragments and downstream ΔMshL -Low, after being purified using a PCR purification kit, was used as a template for overlap PCR amplification using primers ΔMshL-UpF / ΔMshL-LowR according to the following program: 94℃ for 3 min, 34 cycles (94℃ 30 sec, 58℃ 30 sec, 72℃ 2 min), 72℃ for 5 min, and hold at 12℃. The fusion fragment ΔMshL obtained using overlap PCR technology was 1436 bp in length. Figure 3 ).

[0033] Depend on Figure 3 As can be seen, 1-4 are all amplification results of overlapping fragments, and the target fragment size is correct, which will be used for subsequent experiments.

[0034] Step (3) Construction of the fusion fragment recombination T-vector The fusion fragment was purified using a PCR purification kit. The fusion fragment was then recombined into a T vector using the TransGen Biotech p-EASY Simple-T kit and transformed into *E. coli* Trans T1 competent cells. Positive clones were screened using Kansas medium and identified by PCR using primers M13-F / M13-R. The recombinant plasmid ΔMshL-T was extracted using a plasmid extraction kit. PCR amplification conditions were as follows: 95℃ for 3 min, 34 cycles (95℃ 30, 55℃ 30 sec, 72℃ 2 min), 72℃ for 5 min, and 4℃ hold. Multiple positive clones were picked, and the fragment length of each positive clone was determined to be 1436 bp. Figure 4 ).

[0035] Depend on Figure 4 As can be seen, 4, 7, and 14 are positive clones, while the rest are negative clones. Therefore, clones 4, 7, and 14 were selected for subsequent experiments.

[0036] Step (4) Construction of the suicide plasmid for knockout The recombinant plasmid ΔMshL-T was digested with restriction endonucleases BamHI and XhoI (37 ℃, 60 min). The digestion products were purified by agarose gel electrophoresis and gel extraction, and the fusion fragment at the 1436 bp position was extracted. Plasmid PDM4 was also digested with restriction endonucleases BglII and XhoI (37 ℃, 60 min). The digestion products were purified by agarose gel electrophoresis and gel extraction. The fusion fragment and linearized PDM4 were ligated overnight at 16 ℃ using T4 DNA ligase. The ligation was then performed on Trans T1 competent cells, and colony PCR was conducted using primers (ΔMshL-UpF / PDM4-R). Plasmid ΔMshL-PDM4 was extracted, transformed into S17-1 λpir competent cells, plated on Cm antibody plates, and colony PCR was performed using primers (ΔMshL-UpF / PDM4-R). Identification yielded the S17-1λpir strain carrying the recombinant (S17-ΔMshL-PDM4). Figure 5 ).

[0037] Depend on Figure 5 As can be seen, 1-5 are all positive clones, indicating that the S17-ΔMshL-PDM4 strain was successfully constructed and can be used for subsequent binding transfer experiments.

[0038] Example 3: Combined with transfer experiment Step (1) Prepare S17-Δ according to the above examples. MshL -PDM4 was used as the donor strain (S17-1λpir strain) for the recombinant plasmid, and PDP was used as the recipient strain for binding transfer experiments. PDP and S17-Δ MshL - PDM4 strains were streaked onto LB agar plates, incubated overnight, and then PDP and S17-Δ strains were picked. MshL -PDM4 monoclonal antibodies were inoculated into LB and LB liquid medium (containing 30 μg / ml Cm) and cultured for a further period of time.

[0039] Step (2) Wait for the bacteria to grow to OD 600 Binding transfer experiments were performed at a concentration of ≈0.6, and strain S17-Δ was transferred to the target strain. MshL - PDM4 and PDP were cultured in LB (containing 30 μg / ml Cm) and LB, respectively. The resulting culture solutions were mixed in volume ratios of 1:1, 2:1, 3:1 and 4:1. After vortexing and mixing, the supernatant was discarded by centrifugation. The cells were then washed twice with 1 ml of sterile PBS buffer, centrifuged again to discard the supernatant, and resuspended in 20 μl of sterile PBS. The cells were then dropped onto solid LB medium for culture.

[0040] Example 4: Single Exchange Experiment Step (1) After culturing the mixed bacterial cells in Example 3 at 28°C for 24 h, 48 h or 72 h, the bacterial plaques were washed with 1 ml of sterile PBS at different times, the bacterial suspension was collected, and serially diluted 10 times and 100 times. The original solution and the serially diluted bacterial solutions were spread onto solid double-antibiotic LB medium containing Cm (30 μg / ml) and Pen (1 mg / ml) and cultured at 28°C for 48 h.

[0041] Step (2) Pick large single colonies on the double antibody plate and identify positive clones by PCR using primers ΔMshL-UpF / ΔMshL-LowR. Theoretically, two bands should appear (one is a long band of 3082 bp of PDP itself, and the other is a short band of 1436 bp of the fusion fragment of the suicide plasmid integration). However, if the short band appears and sequencing confirms that it is PDP, the next step of screening can be carried out. Figure 6 ).Depend on Figure 6 As can be seen, clones 14, 15, 17, and 20-24 were suspected positive clones. Further sequencing confirmed the positive clones for subsequent experiments. Finally, the optimal mixing ratio of strain S17-ΔMshL-PDM4 with PDP was determined to be 2:1, the optimal binding time was 48 h, and the positive rate reached 29.2%.

[0042] Example 5: Sucrose-induced double exchange experiment Step (1) The sequencing-correct positive single-exchange strain from Example 4 was cultured in antibiotic-free LB medium until OD. 600 ≈0.5, spread onto solid LB agar plates containing different concentrations of sucrose (6%, 8%, 10%, 12%, 14%, and 16%) and pen (1 mg / ml). After 24 h of incubation, single colonies were picked and PCR was performed using primers ΔMshL-UpF / ΔMshL-LowR. The PCR product length of the wild-type bacteria was 3082 bp, and that of the knockout bacteria was 1436 bp. Figure 7 Clones 2, 9, 11, and 12 were identified as suspected positive clones and were confirmed by sequencing. The optimal concentration of sucrose was determined to be 12%, with a positive clone rate of 30.8%.

[0043] Step (2) involves sequencing and identifying the PCR amplification products described above. Figure 8 It was measured from a wild-type plant. MshL The sequence of the gene and its upstream and downstream DNA. Figure 9 It is the knockout strain ΔMshL. MshL The DNA sequence containing the gene. Note: The part in red is... MshLThe open reading frame DNA sequence is highlighted in yellow, which is the design reference sequence for the upstream arm primers ΔMshL-UpF / ΔMshL-UpR used in this invention, and highlighted in green, which is the design reference sequence for the downstream arm primers ΔMshL-LowF / ΔMshL-LowR used in this invention.

Claims

1. A method for knocking out the target gene of *Bacillus violaceus* var. *mermaidensis* subspecies that kills fish, characterized in that: Target genes were obtained using overlap PCR. MshL The DNA fusion fragment with the missing target region was obtained, and the obtained DNA fusion fragment was used to construct a recombinant vector. Escherichia coli S17-1 λpir was used as the donor bacteria of the recombinant plasmid, and PDP was used as the recipient bacteria to obtain the bryophyte subsp. mermaidae with the target gene knocked out.

2. The method for knocking out the target gene of *Bacillus merantii* subspecies *Pyrophyllariae* according to claim 1, characterized in that: The target gene is a gene encoding a fimbriae biosynthesis protein. MshL .

3. The method for knocking out the target gene of *Bacillus merantii* subspecies *Pyrophyllariae* according to claim 1 or 2, characterized in that: 1) Construction of homologous arms: The fimbriae biosynthesized proteins were obtained using overlap PCR technology. MshL Δ fusion fragment of upstream and downstream homologous arms of the gene MshL The fusion fragment was then recombined into the T vector and transformed into E. coli Trans-T1 competent cells. The recombinant vector Δ was identified and obtained. MshL -T; 2) Construction of recombinant suicide plasmid: Δ MshL The target DNA fragment was obtained by double digestion with BamHI and XhoI. The suicide plasmid PDM4 was knocked out by double digestion with BglII and XhoI. After gel extraction and recovery, the fragments were ligated and transformed into Trans-T1 competent cells. Positive clones were selected, and the recombinant vector Δ was extracted. MshL -PDM4; 3) Transformation of recombinant plasmids (in conjunction with transfer experiments): Δ MshL -PDM4 was used to transform S17-1λpir competent cells to obtain the S17-1λpir strain carrying the recombinant (S17-Δ MshL Using PDM4 as the donor bacterium, PDP as the recipient bacterium, and Pen and Cm as double antibodies, binding transfer experiments were conducted to obtain transformed strains of recombinant plasmids. Further screening was then performed to obtain knockout strains. MshL The mermaid bioluminescent bacillus subsp. fish-killing.

4. The method for knocking out the target gene of *Bacillus merantii* subspecies *Pyrophyllariae* according to claim 3, characterized in that: In step 1), The base sequences of the upstream homologous arm amplification primers are as follows: ΔMshL-UpF: GGATCCAGCATCAGGAAACACAGTTAAAGCTCGAAC; ΔMshL-UpR:CATTAAGCAGTACAGCGACTCGACGCAT; The base sequences of the downstream homologous arm amplification primers are as follows: ΔMshL-LowF: AGTCGCTGTACTGCTTAATGAGTGGTTC; ΔMshL-LowR:CTCGAGCGGAATACCGTTACTGGCCTGCCA.

5. The method for knocking out the target gene of *Bacillus merantii* subspecies *Pyrophyllariae* according to any one of claims 1-4, characterized in that: The fusion DNA fragment obtained by overlap PCR was ligated into the T vector, and the target fragment was obtained by double digestion with restriction endonucleases BamHI and XhoI. PDM4 was then double digested with restriction endonucleases BglII and XhoI. Finally, the fragments were recovered by gel excision and ligated with T4 DNase to construct the recombinant vector.

6. The method for knocking out the target gene of *Bacillus merantii* subspecies *Pyrophyllariae* according to claim 3, characterized in that: Both the obtained strain S17-1 λpir and strain PDP were subjected to OD. 600 nm Collected at approximately 0.6 μg / mL and bound to transfer at a 2:1 mass ratio for 48 h. Screened and identified using LB plates containing Pen and Cm dual antibodies. Identification primers were: ΔMshL-UpF: GGATCCAGCATCAGGAAACACAGTTAAAGCTCGAAC ΔMshL-UpR: CTCGAGCGGAATACCGTTACTGGCCTGCCA.

7. The method for knocking out the target gene of *Bacillus merantii* subspecies *Pyrophyllariae* according to claim 3 or 6, characterized in that: The transformed strains of the recombinant plasmid were screened and identified in LB medium with 12% sucrose to obtain the target gene knocked out of the *Bacillus merantii* subsp. *merantii*. The identification primers are: ΔMshL-UpF:GGATCCAGCATCAGGAAACACAGTTAAAGCTCGAAC ΔMshL-LowR: CTCGAGCGGAATACCGTTACTGGCCTGCCA.

Images