Method for gene editing in amycolatopsis orientalis
By separating and introducing the CRISPR/Cas9 editing gene sequence and the DNA sequence encoding sgRNA into *Amylopectinus orientalis*, genetic manipulation was simplified, vancomycin production efficiency was improved, and the problem of low operational efficiency in existing technologies was solved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SHANGHAI JIAOTONG UNIV
- Filing Date
- 2024-10-31
- Publication Date
- 2026-05-01
AI Technical Summary
The existing CRISPR/Cas9 system has low efficiency in gene editing in *Amylopectinobacterium orientalis*, which affects the production efficiency of vancomycin.
Separating the CRISPR/Cas9 editing gene sequence from the DNA sequence encoding sgRNA and introducing it into *Amylopectinus orientalis* simplifies genetic manipulation. By constructing a CRISPR/Cas9 editing plasmid containing a homologous arm for repair and a recombinant DNA fragment encoding sgRNA, the production efficiency of vancomycin is improved.
The genetic manipulation process has been simplified, improving the production efficiency of vancomycin.
Smart Images
Figure CN121950882A_ABST
Abstract
Description
A method for gene editing in *Acidithiomycium orientalis* Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically, it relates to a method for gene editing in *Amylopectinus orientalis*. Background Technology
[0002] The CRISPR / Cas9 system is a rapidly developing genome editing technology. This technology, by binding the Cas9 protein to sgRNA, can efficiently identify and cut specific DNA sequences, thereby achieving gene editing. Since its first application in gene editing in 2013, CRISPR / Cas9 has been widely recognized as a rapid, simple, and efficient molecular tool and has been successfully applied in eukaryotes such as rice, wheat, malaria parasites, fruit flies, zebrafish, and mammals. This technology has not only achieved success in eukaryotes but has also demonstrated advantages in prokaryotes, such as *Escherichia coli* and *Streptomyces*, an important source of microbial drugs, in in vivo gene function studies, proving more efficient than traditional homologous recombination techniques. Experiments have shown that combining the Cas9 system with in vivo recombination systems can achieve precise cloning of large DNA fragments.
[0003] Vancomycin is one of the first-line drugs for combating infections caused by many drug-resistant bacteria, such as methicillin-resistant Staphylococcus aureus. *Amylopectinus keratiniphila* is a vancomycin-producing strain. Gene editing of this bacterium using genetic engineering techniques can increase vancomycin production, elucidate the biosynthetic mechanism of vancomycin, and further explore vancomycin derivatives, thus holding significant importance. However, the currently used CRISPR / Cas9 system, which integrates the gene editing sequence with the DNA sequence encoding sgRNA, has relatively low operational efficiency in genetic engineering. Therefore, a more efficient gene editing method needs to be developed. Summary of the Invention
[0004] This invention aims to separate the sequence of the CRISPR / Cas9 editing gene containing the repair homologous arm from the DNA sequence encoding sgRNA and introduce it into A. keratiniphila to simplify genetic manipulation and improve the production efficiency of vancomycin.
[0005] In one aspect, this invention provides a method for gene editing in *Amylopectinus orientalis*, comprising the following steps:
[0006] S1: Construct upstream and downstream homologous arm fragments nrps8-arm-A and nrps8-arm-Z for DNA repair after knockout;
[0007] S2: Construct the recombinant DNA fragment gDNA-nrps8 that encodes sgRNA;
[0008] S3: Constructing the CRISPR / Cas9 editing plasmid pLYCS01, which includes digesting plasmid pLYNY04 with a restriction endonuclease to obtain the linearized vector pLYNY04-NA; and ligating pLYNY04-NA, nrps8-arm-A, and nrps8-arm-Z using a ligase to obtain the CRISPR / Cas9 editing plasmid pLYCS01; and
[0009] S4: pLYCS01 and gDNA-nrps8 were electroporated into A. keratiniphila cells.
[0010] In one or more embodiments, in step S1, the construction of nrps8-arm-A uses the genome of A. keratiniphila as a template to perform PCR to obtain the upstream homologous arm fragment nrps8-arm-A, and the primer sequences used for PCR are shown in SEQ ID NO: 1 and SEQ ID NO: 2; the construction of nrps8-arm-Z uses the genome of A. keratiniphila as a template to perform PCR to obtain the downstream homologous arm fragment nrps8-arm-Z, and the primer sequences used for PCR are shown in SEQ ID NO: 3 and SEQ ID NO: 4.
[0011] In one or more embodiments, in step S2, the construction of gDNA-nrps8 is performed by PCR using pLYNY04 as a template to obtain the recombinant fragment gDNA-nrps8, and the primer sequences used for PCR are shown in SEQ ID NO: 5-8.
[0012] In one or more embodiments, in step S2, the construction of gDNA-nrps8 involves PCR using pLYNY04 as a template to obtain recombinant fragment gDNA-A, with primer sequences shown in SEQ ID NO: 5 and SEQ ID NO: 6; and PCR using pLYNY04 as a template to obtain recombinant fragment gDNA-B, with primer sequences shown in SEQ ID NO: 7 and SEQ ID NO: 8. Finally, PCR is performed using gDNA-A and gDNA-B as templates to obtain recombinant fragment gDNA-nrps8, with primer sequences shown in SEQ ID NO: 5 and SEQ ID NO: 8.
[0013] In one or more embodiments, in step S3, the restriction endonuclease is HindIII.
[0014] In one or more embodiments, the method includes a gene editing method in *Amylopectinobacterium orientalis* as described in any embodiment herein, expanding the electroporated cells in S4, and using the expanded culture for vancomycin isolation.
[0015] In one or more embodiments, the A. keratiniphila is A. keratiniphila HCCB10007.
[0016] In another aspect, this invention provides the application of the nrps8 gene of A. keratiniphila as a gene knockout target for CRISPR / Cas9 in the preparation of vancomycin, wherein the CRISPR / Cas9 editing plasmid and the DNA encoding nrps8 sgRNA are respectively introduced into A. keratiniphila.
[0017] In one or more embodiments, the A. keratiniphila is A. keratiniphila HCCB10007.
[0018] The gene editing method in A. keratiniphila provided by this invention involves separately introducing the CRISPR / Cas9 gene editing sequence with a repair homologous arm and the sgRNA coding sequence into A. keratiniphila. Compared with traditional methods, this method eliminates one cutting and ligation step, simplifies genetic operations, and improves the production efficiency of vancomycin. Attached Figure Description
[0019] Figure 1 is a schematic diagram of the structure of the pLYNY04 plasmid.
[0020] Figure 2 is a schematic diagram of the structure of the pLYNY04-NA vector.
[0021] Figure 3 is a schematic diagram of the structure of the CRISPR / Cas9 editing plasmid pLYCS01.
[0022] Figure 4 is a schematic diagram of the acquisition of gDNA-A, gDNA-B, and gDNA-nrps8 fragments.
[0023] Figure 5 shows the PCR verification results of the strain. Figure 5A shows the PCR verification results using primer pair verify-nrps8-in-F / verify-nrps8-in-R; Figure 5B shows the PCR verification results using primer pair verify-nrps8-out-F / verify-nrps8-out-R. Detailed Implementation
[0024] The present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.
[0025] The reagents and plasmid sources used in the following examples are as follows:
[0026] 1. Plasmid pLYNY04 was constructed using the method disclosed in the reference (Hu M, Chen S, NY, et al. CRISPR / Cas9-mediated genome editing in vancomycin-producing strain Amycolatopsiskeratiniphila. Frontiers in Bioengineering and Biotechnology, 2023, 1141176).
[0027] 2. Both E. coli JM110 and DH5α are commercially available products.
[0028] Example
[0029] Example 1: Construction of linearized vector pLYNY04-NA
[0030] The circular plasmid pLYNY04 was digested with Hind III enzyme to obtain the linearized vector pLYNY04-NA. The structure of pLYNY04 is shown in Figure 1, and the structure of pLYNY04-NA is shown in Figure 2.
[0031] The enzyme digestion system consisted of: 0.5 μg plasmid, 0.5 μL Hind III enzyme, 1 μL buffer, and finally deionized water to a total volume of 10 μL. The enzyme digestion reaction conditions were as follows: the enzyme digestion system was placed in a 37°C water bath for 2 hours, and then the enzyme digestion products were recovered using a DNA recovery kit (GEL / PCR Purification Kit, TOROIVD).
[0032] Example 2: Construction of homologous arms for the CRISPR / Cas9 gene editing system
[0033] S1: Using the genome of A. keratiniphila HCCB10007 (accession number CGMCC No. 6023) as a template, the upstream and downstream homologous arm fragments of the nrps8 gene were amplified using primers nrps8-arm-AF and nrps8-arm-AR, as well as nrps8-arm-ZF and nrps8-arm-ZR.
[0034] nrps8-arm-AF: CGACGGCCAGTGTCAAGCTTCCGTTCGTGCGTGCGTC (SEQ ID NO: 1)
[0035] nrps8-arm-AR:GGTCGATTTCTCTGGGCTTCGGTCTAC (SEQ ID NO: 2)
[0036] nrps8-arm-ZF: GAAGCCCAGAGAAATCGACCCCATCGG (SEQ ID NO: 3)
[0037] nrps8-arm-ZR: CGCGCCGCGGATCCTCTAGAGTGCTCGCCTTCAACAA (SEQ ID NO: 4)
[0038] The PCR reaction system consisted of: 5 μl of 10×reaction buffer, 1 μl each of nrps8-arm-AF (20 μM) / nrps8-arm-AR (20 μM) or nrps8-arm-ZF (20 μM) / nrps8-arm-ZR (20 μM), approximately 10 ng of HCCB10007 genomic DNA, 1 μl of dNTPs (2 mM), 1 μl of KOD DNA polymerase (5 U / μl), 2 μl of DMSO, and finally, deionized water was added to a final volume of 50 μl.
[0039] S2: The upstream and downstream homologous arm fragments of the amplified nrps8 gene were recovered using a DNA recovery kit, then T / A cloned and sequenced. The correctly sequenced upstream and downstream homologous arm fragments of the nrps8 gene, nrps8-arm-A and nrps8-arm-Z, were recovered.
[0040] Example 3: Obtaining the gDNA-nrps8 recombinant fragment
[0041] Small guide RNAs (sgRNAs) were designed based on the nrps8 gene cluster of *Acidithiobacillus keratiniphila* HCCB10007. Using pLYNY04 as a template, a recombinant gDNA-A fragment containing the promoter (1166 bp) was amplified using primers gDNA-AF and gDNA-AR. A recombinant gDNA-B fragment containing the promoter (604 bp) was then amplified using primers gDNA-BF and gDNA-BR. Finally, using both gDNA-A and gDNA-B as templates, and with gDNA-AF as the upstream primer and gDNA-BR as the downstream primer, a combined gDNA sequence fragment, gDNA-nrps8 (1740 bp), was amplified. (gDNA refers to guide DNA, which encodes the corresponding sgRNA sequence. The gDNA fragment contains the gDNA backbone sequence, the gDNA core sequence (corresponding to the nrps8 gene), and the gDNA transcription promoter erm*p.) The process for obtaining gDNA-nrps8 is shown in Figure 4.
[0042] The PCR reaction system consisted of: 5 μl of 10×reaction buffer, 1 μl each of 20 μM upstream and downstream primers, 10 ng of template (pLYNY04), 0.5 μl of dNTPs (2 mM), 1 μl of KOD DNA polymerase (5 U / μl), 2 μl of DMSO, and finally, deionized water was added to a final volume of 50 μl.
[0043] The PCR reaction program was as follows: hot start (94℃, 5 min); denaturation (94℃, 30 s); annealing (68℃, 30 s); extension (68℃, 10 s). The denaturation, annealing, and extension steps were repeated for a total of 30 cycles. The final extension (68℃) lasted for 10 min, yielding the product fragment gDNA-nrps8, which was then stored at 16℃.
[0044] gDNA-AF:
[0045] CTTATTTTAACTTGCTATTTCTAGCTCTAAAACCGGGTCCGTACGATTAGGTTACTAGTTCCTACCAACCGGCACGAT (SEQ ID NO: 5)
[0046] gDNA-AR:
[0047] CGTCGACCTTCGCCATC (SEQ ID NO: 6)
[0048] gDNA-BF:
[0049] GATCTCGACGGCCAGGTCGTAGTTGCAATCACTAGTTCCT (SEQ ID NO: 7)
[0050] gDNA-BR:
[0051] TTAAAATAAGGCTAGTCCGTTATCAACTTG (SEQ ID NO: 8).
[0052] Example 4: Construction of CRISPR / Cas9 editing plasmid pLYCS01 containing upstream and downstream homologous arms of the nrps8 gene
[0053] According to the DNA ligation kit instructions, the linearized vector pLYNY04-NA obtained in Example 1 was ligated with the upstream and downstream homologous arm fragments of the nrps8 gene obtained in Example 2 to obtain the CRISPR / Cas9 editing plasmid pLYCS01 containing the upstream and downstream homologous arms of the nrps8 gene. The structure of pLYCS01 is shown in Figure 3.
[0054] S1: Calculate the amount of DNA required for the ligation reaction (to ensure the accuracy of sample addition, the amount of each component added should not be less than 1 μl), and prepare the reaction system.
[0055] Linearized vector: X = [0.02 * number of base pairs in the cloning vector] ng;
[0056] Insertion fragment: Y = Y1 + Y2 ... + Yn = [0.04 * number of base pairs in each insertion fragment] ng;
[0057] Add 5 μl of 2*ClonExpress Mix, and finally add deionized water to a final volume of 10 μl;
[0058] S2: Gently pipette and mix (do not shake to mix), briefly centrifuge to collect the reaction solution to the bottom of the tube, place in a 50°C environment, and carry out the ligation reaction for 5 min to obtain the ligation product containing plasmid pLYCS01; place the ligation product at 4°C for later use.
[0059] S3: Mix the ligation product with 50 μl of DH5α competent cells and aspirate thoroughly. Transform the ligation product into DH5α competent cells using standard methods. Then, plate the cells onto LB agar plates containing the appropriate antibiotic resistance and incubate overnight at 37°C (inverted). Verified viable colonies are considered successfully transformed with the CRISPR / Cas9 editing plasmid pLYCS01. A schematic diagram of the plasmid structure is shown in Figure 3.
[0060] S4: Select the colonies that have been verified correctly on the plate for expansion culture. Process the obtained bacterial solution with a plasmid extraction kit to obtain the pLYCS01 plasmid.
[0061] S5: Transform the CRISPR / Cas9 editing plasmid pLYCS01 into E. coli JM110, then expand the culture. The resulting bacterial culture is then treated with a plasmid extraction kit to obtain the demethylated pLYCS01 plasmid.
[0062] Example 5: Electroporation of CRISPR / Cas9 editing plasmid and gDNA-nrps8 recombinant fragment into A. keratiniphila HCCB10007
[0063] S1: Take 2-5 μg of the demethylated pLYCS01 plasmid obtained in Example 4 and 18-54 μg of the gDNA-nrps8 recombinant fragment obtained in Example 3 into a 1.5 ml EP tube pre-chilled on ice, mix with 60 μl of HCCB10007 competent cells, and mix by pipetting. Immediately after mixing, place the mixture into a pre-chilled electroporation cuvette (BTX, Φ2 mm). Operate the electroporation cuvette to co-transform the demethylated pLYCS01 plasmid and gDNA-nrps8 recombinant fragment into HCCB10007 competent cells.
[0064] Electroconversion conditions: 600Ω, 25μF, 7.5kV / cm, duration 13 milliseconds.
[0065] S2: After electroporation, the bacterial cells were resuspended in 1 ml of TSB medium and transferred to a 15 ml glass tube. The cells were then cultured in a shaker at 28°C for 5–8 hours.
[0066] S3: Spread 100 μl of the cultured bacterial solution onto a Bennet agar plate containing the corresponding antibiotic. Concentrate the remaining bacterial solution by centrifugation and then spread it onto a Bennet agar plate containing the corresponding antibiotic. Incubate each culture at 28°C for 3–5 days.
[0067] Example 6: Elimination and Validation of CRISPR / Cas9 Editing Plasmids in Positive Strains
[0068] S1: On the plate medium of Example 5, select multiple transformants and transfer them to 3 ml of TSB liquid medium containing Apr resistance, and incubate at 28°C for 2-3 days.
[0069] S2: Take an appropriate amount of the transformed bacterial culture, inoculate a single colony on antibiotic-free bennet medium, and then incubate the antibiotic-free bennet medium at 37°C overnight.
[0070] S3: Pick single colonies from antibiotic-free Bennet medium and spread them separately onto antibiotic-free and Apr-resistant Bennet medium, respectively, and incubate at 28°C for 2-3 days. Single colonies that grow normally on antibiotic-free plates but not on antibiotic-resistant plates are positive strains with successfully eliminated plasmids. Using the plasmid from the strain as a template, perform PCR and gel electrophoresis to verify the elimination of the plasmid. The verify-nrps8-out primer set amplifies the fragment located outside the homologous arm; the verify-nrps8-in primer set amplifies the fragment located inside the knocked-out target gene.
[0071] PCR primers for verification:
[0072] verify-nrps8-out-F: CAGAGCCATTCCGCGTA (SEQ ID NO: 9)
[0073] verify-nrps8-out-R: CCAGCCTGCTGAACAAG (SEQ ID NO: 10)
[0074] verify-nrps8-in-F: CGGATCTTGCCGATGTG (SEQ ID NO: 11)
[0075] verify-nrps8-in-R: CTGCCCTGGCCCTGTC (SEQ ID NO: 12)
[0076] Experimental Results: As shown in Figure 5, positive transformants were those for which no band was detected when using the verify-nrps8-in primer set, while positive transformants were those for which a band was detected when using the verify-nrps8-out primer set (in Figure 5A, lanes 1-3 and 7 are positive gene knockout strains, lanes 4-6 are negative strains; lane O is the original control strain; lane M is a 1kb DNA ladder marker). In Figure 5B, lanes 2-4 are positive gene knockout strains, lane 1 is a negative strain; lane M is a 1kb DNA ladder marker.
[0077] Conclusion: A correctly edited positive strain was obtained, i.e., a strain that was positive when verified by both the verify-nrps8-in primer set and the verify-nrps8-out primer set.
[0078] As can be seen, this invention separates the sequence of the CRISPR / Cas9 edited gene with the homologous arm for repair from the DNA sequence encoding sgRNA and introduces it into A. keratiniphila. Compared with the traditional method, this eliminates one cutting and ligation step, simplifies the genetic operation, and improves the production efficiency of vancomycin.
[0079] The above description is merely a preferred embodiment of the present invention and does not constitute any limitation on the present invention in any form or substance. Any modifications, alterations, and variations made by those skilled in the art without departing from the scope of the present invention using the disclosed technical content are equivalent embodiments of the present invention. Furthermore, any modifications, alterations, and variations made to the above embodiments based on the essential technology of the present invention are still within the scope of the present invention.
Claims
1. A method for gene editing in *Amylopectinus orientalis*, characterized in that, The procedure includes the following steps: S1: Constructing upstream and downstream homologous arm fragments nrps8-arm-A and nrps8-arm-Z for the target gene nrps8 sequence used for DNA repair after knockout; S2: Constructing a recombinant DNA fragment gDNA-nrps8 that encodes sgRNA; S3: Constructing the CRISPR / Cas9 editing plasmid pLYCS01, which includes digesting plasmid pLYNY04 with restriction endonucleases to obtain the linearized vector pLYNY04-NA; and ligating pLYNY04-NA, nrps8-arm-A, and nrps8-arm-Z with a ligase to obtain the CRISPR / Cas9 editing plasmid pLYCS01; and S4: Electroporating pLYCS01 and gDNA-nrps8 into A. keratiniphila cells.
2. The method as described in claim 1, characterized in that, In step S1, the construction of nrps8-arm-A uses the genome of A. keratiniphila as a template to perform PCR to obtain the upstream homologous arm fragment nrps8-arm-A. The primer sequences used for PCR are shown in SEQ ID NO: 1 and SEQ ID NO:
2. The construction of nrps8-arm-Z uses the genome of A. keratiniphila as a template to perform PCR to obtain the downstream homologous arm fragment nrps8-arm-Z. The primer sequences used for PCR are shown in SEQ ID NO: 3 and SEQ ID NO:
4.
3. The method as described in claim 1, characterized in that, In step S2, the construction of gDNA-nrps8 is performed by PCR using pLYNY04 as a template to obtain the recombinant fragment gDNA-nrps8. The primer sequences used for PCR are shown in SEQ ID NO: 5-8.
4. The method as described in claim 3, characterized in that, In step S2, the construction of gDNA-nrps8 involves PCR using pLYNY04 as a template to obtain recombinant fragment gDNA-A, with primer sequences shown in SEQ ID NO: 5 and SEQ ID NO: 6; and PCR using pLYNY04 as a template to obtain recombinant fragment gDNA-B, with primer sequences shown in SEQ ID NO: 7 and SEQ ID NO:
8. Finally, PCR is performed using gDNA-A and gDNA-B as templates to obtain recombinant fragment gDNA-nrps8, with primer sequences shown in SEQ ID NO: 5 and SEQ ID NO:
8.
5. The method as described in claim 1, characterized in that, In step S3, the restriction endonuclease is HindIII.
6. A method for preparing vancomycin, characterized in that, The method includes the method of gene editing in *Amylopectinobacterium orientalis* as described in any one of claims 1-5, expanding the electroporated cells in S4, and using the expanded culture solution for vancomycin isolation.
7. The method according to any one of claims 1-6, characterized in that, The A. keratiniphila mentioned is A. keratiniphila HCCB10007.
8. The application of the nrps8 gene of *A. keratiniphila* as a gene knockout target for CRISPR / Cas9 in the preparation of vancomycin, characterized by: The CRISPR / Cas9 editing plasmid and the DNA encoding nrps8 sgRNA were respectively introduced into A. keratiniphila.
9. The application as described in claim 8, characterized in that, The A. keratiniphila mentioned is A. keratiniphilaHCCB10007.