An alginate lyase mutant and its application

Abstract

The present invention relates to the technical field of genetic engineering and protein engineering modification, and particularly relates to an alginate lyase mutant and its application. Compared with the wild type, the A17S single-point mutant provided by the present invention has a 55.3% increase in the residual enzyme activity rate after being treated at 45°C for 20 minutes, with a remarkable effect. It can be widely used in the field of seaweed processing, effectively improving the enzymatic hydrolysis efficiency of seaweeds such as Sargassum and Ascophyllum nodosum, and has broad market prospects.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering and protein engineering modification, and particularly relates to an alginate lyase mutant and its application. Background Art

[0002] Brown algae mainly consist of alginate, laminarin, mannitol, fucoidan, etc. Among them, alginate is an anionic polysaccharide derived from the cell wall of brown algae, which is the main structural component in brown algae and is also called sodium alginate or alginic acid sodium. The first problem to be solved in the utilization of brown algae is the utilization of alginate.

[0003] The main methods for the degradation of alginate are as follows: (1) Chemical degradation. Acid, hydrothermal or alkali pretreatment has been used for the hydrolysis of alginate. Acid hydrolysis is relatively commonly used in chemical degradation. However, alginate is relatively acid-resistant and it is difficult to control the production of uronic acid. In addition, high concentrations of acid are required to obtain a high yield of uronic acid. (2) Hydrothermal pretreatment. Alginate can produce alginate monomers (mannuronate and guluronate) through hydrothermal treatment (180°C - 240°C), and at the same time, substances such as lactic acid and glycolic acid are produced. (3) Enzymatic degradation. The enzymatic degradation of alginic acid has mild conditions, a controllable process, a high yield, is green and safe, environmentally friendly, has a clear action mechanism, and the products are determined. Different enzyme preparations with substrate specificity can be selected singly or in combination according to the requirements of specific target products. Endo-type alginate lyase produces alginate oligosaccharides with different DPs, while exo-type enzymes degrade alginate or alginate oligosaccharides to produce monosaccharides.

[0004] The production of alginate lyase mostly relies on alginate-decomposing bacteria. Although wild-type alginate-decomposing bacteria can effectively obtain a quantitative amount of enzyme protein, the yield is very low and the cost is relatively high, making it difficult to meet the requirements of practical applications. Therefore, using genetic engineering means to heterologously express the alginate lyase gene is the most effective way to increase the yield of alginate lyase. The research mainly focuses on the cloning of the alginate lyase gene from alginate-decomposing bacteria and its overexpression in Bacillus subtilis. Currently, the alginate lyase genes of more than twenty alginate-decomposing bacteria have been cloned, and most of these genes have been successfully heterologously expressed. The expression levels of recombinant alginate lyases are all higher than those of wild strains. According to the classification of the CAZY database, alginate lyase belongs to polysaccharide-degrading enzymes (PL), and is specifically divided into seven families: PL5, PL6, PL7, PL14, PL15, PL17, and PL18.

[0005] In recent years, with the wide application of protein engineering modification technology in the field of enzyme preparations, the development of new alginate lyases with high enzyme activity levels and excellent properties has become a research hotspot in this field, which is of great significance for reducing the production cost of alginate lyase and promoting the industrialization of alginate lyase. Summary of the Invention

[0006] The object of the present invention is to provide an alginate lyase mutant and its application. The stability of the mutant is significantly improved compared with that of the wild type, which is beneficial to its wide application in industrial fields such as seaweed processing.

[0007] On the one hand, the present invention relates to an alginate lyase mutant, in which the 17th amino acid of the alginate lyase with the amino acid sequence of SEQ ID NO:1 is changed from Ala to Ser.

[0008] The present invention also relates to a DNA molecule encoding the above-mentioned alginate lyase mutant.

[0009] The present invention also relates to a recombinant expression plasmid containing the above DNA molecule.

[0010] The present invention also relates to a host cell containing the above recombinant expression plasmid.

[0011] After transferring the above plasmid into the host cell, the stability of the recombinantly expressed alginate lyase mutant is significantly improved.

[0012] In some embodiments of the present invention, the host cell is Bacillus subtilis ( Bacillus subtilis )

[0013] Compared with the wild-type alginate lyase AH1, after the A17S single-point mutant provided by the present invention is treated at 45°C for 20 min, the residual enzyme activity rate is increased by 55.3% and reaches as high as 82.5%, achieving an unexpected technical effect. The mutant can be widely used in the field of seaweed processing, effectively improving the enzymatic hydrolysis efficiency of seaweeds such as Sargassum and Ascophyllum nodosum, and having a broad market prospect. Detailed implementation manners

[0014] The following further illustrates the method of the present invention with reference to examples. For the experimental methods without specific conditions indicated in the examples, they can generally be carried out under conventional conditions, such as the conditions described in "Molecular Cloning: A Laboratory Manual" written by J. Sambrook et al., or according to the conditions recommended by the manufacturer. Those skilled in the relevant art can better understand and master the present invention with the help of the examples. However, the methods for implementing the present invention should not be limited to the specific method steps described in the embodiments of the present invention.

[0015] The method for measuring the enzyme activity of the alginate lyase in the embodiments of the present invention is as follows:

[0016] Principle of enzyme activity measurement: Alginate lyase can cleave the glycosidic bond in the alginate molecule through a β-elimination reaction, generating an unsaturated double bond at the non-reducing end. The double bond is located between C4 and C5 at the non-reducing end of the product, and the maximum ultraviolet absorption occurs at 235 nm.

[0017] (1) Definition of enzyme activity unit:

[0018] Under the conditions of 40 °C and pH 7.0, in the reaction system specified by this method. Per minute, the substrate sodium alginate is degraded to produce unsaturated double bonds. At 235 nm, when the absorbance increases by 0.1, it is 1 enzyme activity unit U.

[0019] (2) Determination method

[0020] Dilute to an appropriate multiple with buffer, and control the absorbance OD 235 between 0.22 - 0.35, and the enzyme activity is about 0.5 U / mL.

[0021] Enzyme reaction: Take three 15 mm * 150 mm test tubes, add 1.8 mL of substrate, preheat in a 40 °C water bath for 5 min, add 0.2 mL of the diluted enzyme solution, accurately time, vortex, incubate at 40 °C for 10 min, take the test tubes out of the water bath and immediately add 2 mL of phosphoric acid termination solution, vortex, and place the test tubes on the test tube rack outside the water bath.

[0022] Blank: Take a 15 mm * 150 mm test tube, add 1.8 mL of substrate, preheat in a 40 °C water bath for 5 min, add 0.2 ml of buffer, accurately time, vortex, incubate at 40 °C for 10 min, take the test tubes out of the water bath and immediately add 2 mL of phosphoric acid termination solution, vortex, and place the test tubes on the test tube rack outside the water bath.

[0023] The present invention will be described in detail below in conjunction with specific embodiments.

[0024] Example 1 Screening of alginate lyase mutants

[0025] The amino acid sequence of wild-type alginate lyase AH1 is SEQ ID NO: 1, and the coding nucleotide sequence is SEQ ID NO: 2.

[0026] In order to further improve the stability of alginate lyase AH1, the applicant analyzed its protein structure. This protein is an alginate lyase of the PL7 family, and its structure is a β-jelly roll structure. Both the protein surface and the active center of the protein are exposed to the external environment, so it is considered that changes in the external environment can directly affect the stability of the enzyme's active center. Without destroying the protein secondary structure and active center, the applicant further mutated this gene.

[0027] Primer AH1-ss-F: CGG GGTACC ATGGATCCGAATCTGGAGATTT (SEQ ID NO:3);

[0028] Primer AH1-ss-R: CG ACGCGTTTAATCATGTGTATGTTCCAGGC (SEQ ID NO:4).

[0029] Using the AH1 gene as a template, PCR amplification was carried out with the above primers using the GeneMorph II Random Mutagenesis PCR Kit (Bioline). The PCR products were recovered by gel electrophoresis, digested with KpnI and MluI, ligated to the expression plasmid pSZX101 digested with the same enzymes, transformed into Escherichia coli DH5α, and spread on LB + Amp plates. After culturing at 37°C in an inverted position, when transformants appeared, the plasmids were extracted and transformed into Bacillus subtilis. After the transformants grew out, they were picked one by one with toothpicks into a 48-well plate, and 20 μg / ml kanamycin was added to each well. After culturing at 37°C and 500 rpm for about 48 h, the supernatant was collected by centrifugation for high-throughput determination. After incubation at 45°C for 20 minutes, the alginate lyase activity was measured respectively, and the residual rate of enzyme activity of different mutants was calculated.

[0030] The experimental results showed that different mutants had different stabilities. Some mutants still had high enzyme activity under the same temperature treatment conditions, some mutants even made their tolerance worse; in addition, there were some mutants whose enzymatic properties changed significantly after mutation, and these did not meet the requirements. Finally, the applicant screened and obtained mutation sites that could significantly improve the stability of alginate lyase without significantly affecting its original enzymatic properties, namely: A17S.

[0031] Based on the truncated form AH1 of alginate lyase, the present invention provides mutants containing a single mutation site of A17S. Referring to the amino acid sequence of the mutants, the coding nucleotide sequences of the alginate lyase mutants were obtained respectively.

[0032] Example 2 Expression of Alginate Lyase Mutants in Bacillus subtilis

[0033] According to the codon preference of Bacillus, the gene sequences of alginate lyase AH1 and its mutants were optimized and synthesized respectively, and two restriction enzyme sites, KpnI and MluI, were added to the 5' and 3' ends of the synthesized sequences.

[0034] 2.1 Vector Construction

[0035] The synthesized alginate lyase gene fragment was obtained by PCR, and the obtained gene fragment and the expression plasmid pSZX101 were digested with KpnI and MluI respectively, and the target fragments were recovered by gel electrophoresis. T4 ligase was used for overnight ligation. The ligation product was transformed into competent Escherichia coli DH5α, spread on LB + Amp plates, and single colonies grew out after culturing at 37°C overnight. The transformants with correct ligation were verified by colony PCR, and the plasmids were extracted and sent to Beijing Genomics Institute for sequencing analysis.

[0036] Plasmids were purified from E. coli clones with correct sequencing results using a plasmid midi-prep kit (Axygen).

[0037] 2.2 Preparation and transformation of competent Bacillus subtilis

[0038] The transformation solution was prepared as follows:

[0039] 1× Minimum Salt Solution: K 2 HPO 4 7g, KH 2 PO 4 3g, (NH 4 ) 2 SO4 1g, trisodium citrate Na 2 C 6 H 5 O 7 ·2H 2 O0.5g, MgSO 4 7H 2 O 0.1g, add water to 500 mL.

[0040] GMⅠ solution: 95.6 mL of 1× minimum salt solution, 2.5 mL of 20% glucose, 0.4 mL of 5% hydrolyzed casein, and 1 mL of 10% yeast powder juice.

[0041] GMⅡ solution: 96.98 mL of 1× minimum salt solution, 2.5 mL of 20% glucose, 0.08 mL of 5% hydrolyzed casein, 0.04 mL of 10% yeast powder juice, 1M MgCl 2 0.25 mL, 1M CaCl 2 0.05 mL.

[0042] Transformation operation method: Inoculate the bacteria on the LB plate and culture at 37℃ overnight. Use an inoculation loop to inoculate a loop of bacterial moss in 5mL GMⅠ solution, and culture it overnight at 30℃ slow shaker (125rpm). The next day, take 2 mL and transfer it to 18 mL GMⅠ, and culture it at 37℃ fast shaker (220rpm) for 3.5h. Take 5 mL of the culture solution in the previous step and transfer it to 45 mL GMⅡ. After 90min of culture at 37℃ slow shaker (125rpm), centrifuge at 8000g for 10min to collect the bacteria. Gently suspend the bacteria with 5 mL of the original culture supernatant. The suspended bacteria are competent cells and can be used for transformation. Storage of competent cells: Add 30% sterilized glycerol to a final concentration of 10%, mix well and dispense into centrifuge tubes, and then store them at -70℃.

[0043] Mix 1 μg of the recombinant plasmid evenly with 200 μL of the above-mentioned competent cells, resuscitate at 37 °C with shaking (200 rpm) for 30 min, then spread on the corresponding resistant medium and culture overnight at 37 °C. The single colonies grown overnight are the engineered strains containing alginate lyase and its mutants.

[0044] Example 3 Fermentation verification and stability analysis

[0045] Inoculate the above-mentioned engineered strain into 5 mL of LB medium (0.5% yeast extract powder, 1% tryptone, 1% sodium chloride), culture at 37 °C with shaking at 220 rpm for about 6 - 8 h, and then transfer it to 50 mL of liquid fermentation medium (0.5% yeast extract powder, 0.5% tryptone, 1% glucose, K 2 HPO 4 1.8%). After flask shaking fermentation at 37 °C with shaking at 220 rpm for 72 h, centrifuge at 5000 g for 10 min to collect the supernatant, and thus obtain the fermentation supernatant containing alginate lyase and its mutants.

[0046] After incubating the fermentation supernatant of the engineered Bacillus subtilis strain expressing recombinant alginate lyase AH1 and its mutants constructed above at 45 °C for 20 min, measure the alginate lyase activity respectively. Calculate the residual enzyme activity rate with the initial enzyme activity as 100%. The results are shown in Table 1.

[0047] Residual enzyme activity rate: It refers to the catalytic ability that the enzyme still retains after being treated under specific conditions, usually expressed as a percentage. Generally speaking, the higher the residual enzyme activity rate, the more stable the enzyme.

[0048] Calculation formula: Residual enzyme activity rate (%) = enzyme activity after treatment / initial enzyme activity × 100%.

[0049] Table 1 Residual enzyme activity rates of alginate lyase and its mutants

[0050] Alginate lyase Residual enzyme activity rate Wild-type AH1 27.2% A17S single-point mutant 82.5%

[0051] It can be seen from the data in Table 1 that compared with the wild-type alginate lyase AH1, after the A17S single-point mutant provided by the present invention is treated at 45 °C for 20 min, the residual enzyme activity rate is increased by 55.3%, and the stability is significantly improved, achieving an unexpected technical effect.

[0052] In summary, the stability of the alginate lyase mutant provided by the present invention is significantly improved, and it can be widely used in the field of seaweed processing, effectively improving the enzymatic hydrolysis efficiency of seaweeds such as Sargassum and Ascophyllum nodosum, and having a broad market prospect.

Claims

1. An alginate lyase mutant, characterized in that: The mutant is an alginate lyase with an amino acid sequence of SEQ ID NO: 1, in which the 17th amino acid is mutated from Ala to Ser.

2. A DNA molecule encoding the alginate lyase mutant according to claim 1.

3. A recombinant expression plasmid comprising the DNA molecule of claim 2.

4. A host cell, characterized in that The host cell comprises the recombinant expression plasmid according to claim 3.

5. The host cell according to claim 4, characterized in that The host cell is Bacillus subtilis ( Bacillus subtilis ).