Application of slcpk7 gene in regulating tomato resistance to fusarium wilt

By regulating the SlCPK7 gene in tomatoes using CRISPR/Cas9 gene editing technology, callose accumulation was enhanced, solving the problem of insufficient resistance to Fusarium wilt in tomatoes and achieving efficient breeding of disease-resistant varieties.

CN119614596BActive Publication Date: 2025-12-19ZHEJIANG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411786680.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-06
Publication Date
2025-12-19
Estimated Expiration
2044-12-06

AI Technical Summary

Technical Problem

Existing technologies have not yet demonstrated the regulatory role of CPK proteins in tomato resistance to Fusarium oxysporum tomato-specific Fol, leading to insufficient resistance of tomato plants to Fusarium wilt.

Method used

By silencing or upregulating the expression of the SlCPK7 gene in tomatoes using CRISPR/Cas9 gene editing technology, callose accumulation can be regulated, thereby enhancing the resistance of tomatoes to Fusarium wilt.

Benefits of technology

It significantly improved the resistance of tomato plants to Fusarium wilt, provided a theoretical basis for breeding Fusarium wilt-resistant varieties, reduced pesticide use, and ensured food safety.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119614596B_ABST
    Figure CN119614596B_ABST
Patent Text Reader

Abstract

The application discloses application of SlCPK7 gene in regulating tomato resistance to fusarium wilt, and belongs to the technical field of genetic engineering. The nucleotide sequence of a protein coding region of the SlCPK7 gene is shown in SEQ ID NO. 1. The application discloses, for the first time, a positive regulation effect of the SlCPK7 gene on the tomato resistance to fusarium wilt, and can be used for creating and breeding a tomato variety resistant to fusarium wilt, and has very important practical values for researching and developing an environment-friendly fusarium wilt prevention and treatment technology, reducing pesticide use, and guaranteeing food safety and the like.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of genetic engineering, in particular to the application of SlCPK7 gene in regulating tomato resistance to fusarium wilt. BACKGROUND

[0002] Tomato (Solanum lycopersicum L.) is one of the most important horticultural crops in the world, with the largest cultivation area and yield in the world. Tomato fusarium wilt is an important soil-borne disease encountered in the production process of tomato, which can cause large-scale yield reduction of tomato, and can even cause the destruction of the field and the loss of yield. Fusarium oxysporum f. sp. lycopersici (Fol) is the pathogenic fungus of tomato fusarium wilt (Zhou, et al. Cross-kingdom synthetic microbiota supports tomato suppression of Fusarium wilt disease. Nature Communications 2022. 13(1): 7890.), and the dormant spores of Fol can survive in the soil indefinitely (Noor, et al. Combating Fusarium Infection Using Bacillus-Based Antimicrobials. Microorganisms, 2017, 5(4): 75.). After recognizing the plant root system, the dormant spores will germinate and adhere to the root hair surface for mycelial propagation to gradually invade the plant vascular bundle and block the plant sieve tube, resulting in water transport obstruction of the infected plant, causing severe water stress of the plant and the occurrence of plant wilting (Vivek Kumar, et al. Role of fusaric acid in the development of 'Fusarium wilt' symptoms in tomato: Physiological, biochemical and proteomic perspectives. Plant Physiology Biochemistry, 2017, 118: 320-332).

[0003] When subjected to external stress, the concentration of calcium ions in plants changes, producing calcium signals (Luan, et al. Calcium signaling mechanisms across kingdoms. Annual Review of Cell and Developmental Biology, 2021, 37:311-340). Various types of calcium sensor proteins are involved in recognizing characteristic calcium signals and activating cellular immune responses. Among them, the CPK protein family as an important calcium sensor protein plays an important function in the response of plants to external stress (Yip Delormel, et al. Properties and functions of calcium-dependent protein kinases and their relatives in Arabidopsis thaliana. Newphytologist, 2019, 224(2):585-604.).

[0004] In the study of biological stress: silencing Arabidopsis thaliana CPK4, CPK5, CPK6 and CPK11 will cause Arabidopsis thaliana to be more susceptible to infection of L. digitatum (Sun, et al. TOUCH 3 and CALMODULIN 1 / 4 / 6 cooperate with calcium-dependent protein kinases to trigger calcium-dependent activation of CAM-BINDING PROTEIN 60-LIKE G and regulate fungal resistance in plants. The Plant Cell, 2022, 34(10):4088-4104); Tobacco NtCDPK2 protein is involved in regulating resistance to leaf blight caused by X. campestis (Romeis, et al. Calcium-dependent protein kinases play an essential role in a plant defence response. The EMBO Journal, 2001, 20:5556-5567). There is no research that CPK protein is involved in regulating the resistance of tomato to Fol. SUMMARY

[0005] The purpose of the present application is to provide a gene that can regulate the disease resistance of tomato under the condition of infection of the pathogen of Fusarium wilt, and apply it to the breeding of new varieties of tomato resistant to Fusarium wilt.

[0006] To achieve the above object, the application adopts the following technical solutions.

[0007] The application provides application of SlCPK7 gene in regulation of tomato resistance to fusarium wilt, and the protein coded by the SlCPK7 gene is a calcium-dependent protein kinase, the nucleotide sequence of the protein coding region is shown as SEQ ID NO. 1, the length is 1524 bp, the coded protein is composed of 507 amino acids, and the amino acid sequence is shown as SEQ ID NO. 2. The whole gene DNA sequence is shown as SEQ ID NO. 3.

[0008] The application edits the CPK7 gene (Solyc06g065380) in the tomato by using the CRISPR / Cas9 gene editing technology, silences the expression of the protein coded by the tomato CPK7 gene, and obtains the tomato cpk7 mutant. Compared with the wild type plant, the tomato cpk7 mutant is more serious after inoculation with the same concentration of fusarium wilt pathogen Fol, and it is indicated that the SlCPK7 gene positively regulates the resistance of the tomato plant to fusarium wilt.

[0009] Further, the application includes: using a biological technical means to make the SlCPK7 gene in the tomato plant up-regulated to improve the resistance to fusarium wilt. The biological technical means can adopt, but is not limited to, transgenic technology.

[0010] Further, the fusarium wilt is a disease caused by Fusarium oxysporum f.sp. lycopersici (Fol).

[0011] Further, the SlCPK7 gene plays a disease-resistant function by promoting the accumulation of callose in the plant.

[0012] The research of the application shows that under the condition of fusarium wilt pathogen infection, the callose content in the tomato plant is significantly improved; compared with the wild type, the callose content in the tomato cpk7 mutant is significantly reduced. The accumulation of callose in the plant can effectively hinder the invasion of the pathogen and play a disease-resistant function, and the above results show that the SlCPK7 gene is involved in the regulation of callose accumulation.

[0013] Further, the variety of the tomato is Condine Red.

[0014] The application also provides a cultivation method for enhancing the resistance of the tomato to fusarium wilt, and the method comprises the following steps: cloning the SlCPK7 gene fragment with the nucleotide sequence shown as SEQ ID NO. 1 into an overexpression vector to construct a recombinant plasmid, and then transferring the target fragment in the recombinant plasmid into a receptor tissue by using the agrobacterium-mediated technology, and cultivating and screening to obtain a transgenic tomato plant with enhanced resistance to fusarium wilt.

[0015] The application has the beneficial effects:

[0016] The application first discloses the regulation of SlCPK7 gene in tomato resistance to fusarium wilt, analyzes the response mechanism of tomato in defense against fusarium wilt pathogen, and provides a more perfect theoretical basis for improving the resistance of tomato to fusarium wilt pathogen by comprehensively using physiological and biochemical and genetic engineering methods. The achievement can be used for creating and breeding tomato fusarium wilt resistant varieties, and has very important practical value for developing environment-friendly fusarium wilt prevention and control technology, reducing pesticide use and ensuring food safety. BRIEF DESCRIPTION OF DRAWINGS

[0017] Figure 1 The gene editing site of the T1 generation mutant plant obtained in Example 2; compared with the wild type tomato not subjected to gene editing, the gene editing mutant has base deletion at the position of sgRNA. Hereinafter, the wild type tomato not subjected to gene editing is referred to as control. Cpk7#6 has 11 base deletions compared with the control, and cpk7#14 has 7 base deletions compared with the control, both of which form a stop codon in advance in the translation region, causing premature termination of translation.

[0018] Figure 2 It is a plant phenotype diagram of the above ground part of the tomato cpk7 mutant and the wild type plant inoculated with Fol 7d in Example 4; the higher the wilting degree of the plant, the higher the degree of Fol infection.

[0019] Figure 3 It is a plant phenotype diagram of the stem base and main root of the tomato cpk7 mutant and the wild type plant inoculated with Fol 7d in Example 4; the higher the browning degree of the plant stem, the higher the degree of Fol infection.

[0020] Figure 4 It is a disease index statistics of the tomato cpk7 mutant and the wild type plant inoculated with Fol 7d in Example 4, wherein the higher the disease index, the higher the degree of Fol infection.

[0021] Figure 5 It is a photograph of stem section asbestos blue staining of the tomato cpk7 mutant and the wild type plant in Example 5, wherein the deeper the color of the stem section, the higher the degree of tomato blockage by Fol.

[0022] Figure 6 It is the stem callose content of the tomato cpk7 mutant and the wild type plant after inoculation, and different lowercase letters represent significant differences between different treatment groups at the 5% level. DETAILED DESCRIPTION

[0023] The application will be further described in connection with the following specific examples. The following examples are only used to illustrate the application, and are not used to limit the application. Any modification or replacement of the method, step or condition of the application, without departing from the spirit and essence of the application, shall fall within the scope of the application.

[0024] The test methods used in the following examples are conventional methods unless otherwise specified; the materials, reagents, etc. used are commercially available reagents and materials unless otherwise specified.

[0025] The tomato variety used in the following examples is the conventional variety Condine Red. The Fol strain is provided by Zhejiang Academy of Agricultural Sciences.

[0026] The nucleotide sequence is written from left to right as 5' end to 3' end.

[0027] Example 1: Construction of CRISPR / Cas9 vector containing specific sgRNA

[0028] The DNA sequence of the CPK7 (Solyc06g065380) gene was found on the Sol Genomics Network website https: / / solgenomics.net / , the sequence is shown as SEQ ID NO. 3, input into the http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR website and the http: / / skl.scau.edu.cn / targetdesign / website, respectively, with score score and Potential off-target sites score as the screening criteria, and the base sequence with GC content > 40% and sequence position earlier was selected as the target point, and two target points were constructed on the same vector.

[0029] The 20bp base sequence before the PAM structure is GCTGCATCGTCCACAAGCCA and GCTGCTCCAGACAAACCTTT.

[0030] The CRISPR primer was designed as follows:

[0031] The first pair of CRISPR forward primers: gcGGTCTCTATTGaacaaagcaccagtggtctagtg;

[0032] The first pair of CRISPR reverse primers:

[0033] gcGGTCTCTTGGCTTGTGGACGATGCAGCtgcaccagccgggaatcg;

[0034] CRISPR second pair of forward primers:

[0035] gcGGTCTCTGCCAgttttagagctagaaatagcaagttaa;

[0036] CRISPR second pair of reverse primers:

[0037] gcGGTCTCTAAACAAAGGTTTGTCTGGAGCAGCtgcaccagccgggaatcg;

[0038] The above primers were respectively subjected to PCR amplification with pBAtC-tRNA plasmid as a template, and the product was purified by a common DNA purification kit, and then the amplified fragment was connected with pHEE401 plasmid by using Bsa I enzyme, and the product was transformed into E. coli at 42°C and plated, and the resistance was kanamycin.

[0039] A single clone was selected, and PCR verification was performed by using a verification primer M13-F: TGTAAAACGACGGCCAGT and a general reverse primer M13-R: GGTATTGGTTTATCTCATCGGAACTGCA designed for the pHEE401 vector.

[0040] The bacterial liquid with correct band size was sent to a sequencing company for sequencing, and the sequencing result showed that the vector contained two sgRNA sequences. The plasmid was extracted and introduced into Agrobacterium GV3101 by heat shock, and after 48h of culture at 28°C, the plaque was selected for bacterial liquid PCR verification, and the Agrobacterium strain that could be used for genetic transformation was obtained.

[0041] Example 2: Preparation and identification of tomato cpk7 mutant material

[0042] The disinfected tomato seeds were sowed in a sowing medium, and the cotyledons were cut after 10d. The final plasmid prepared in Example 1 was transformed into the cotyledon by Agrobacterium infection method, and the T0 generation of gene edited tomato was obtained by using the totipotency of plant cells.

[0043] T0 generation of gene edited tomato seedling detection: The genomic DNA of the T0 generation plant was extracted by using the CTAB method, and the following primers were designed for PCR amplification and sequencing verification at about 100-250bp before and after the DNA sequence containing the sgRNA:

[0044] Pre-mature seedling primer: ATGGCACAAGTTGTAGCAAA;

[0045] Post-mature seedling primer: TTATTGGTTGGTCCAACGTA;

[0046] The obtained PCR product was sent to a sequencing company for sequencing. The sequencing results were compared with the original sequence of the gene segment using Snapgene software. Plants with sgRNA sequences and single-peak sequencing results were selected for self-crossing and breeding to obtain T0 generation seeds.

[0047] The T0 generation seeds were planted in a growth chamber to obtain T1 generation plants. The sgRNA sequence base editing of the T1 generation plants was detected using the same method described above. Meanwhile, the DNA of the T1 generation plants was subjected to PCR amplification using Cas9 gene primers to detect whether it contained the Cas9 sequence. The T1 generation plants with sgRNA variation and without Cas9 protein were selected as two lines of gene editing plants, designated as cpk7#6 and cpk7#14, respectively, and the gene editing sites thereof are shown in Figure 1

[0048] cpk7#6 had 11 bp deletion compared with the control plant, and cpk7#14 had 7 bp deletion compared with the control plant. The T1 generation seeds of the two lines were sown to obtain T2 generation plants without exogenous Cas9 and with stable inheritance of sgRNA variation.

[0049] The following examples were all carried out using the T2 generation plants of the two homozygous lines as materials.

[0050] Example 3: Study on the resistance of tomato cpk7 mutants to fusarium wilt

[0051] 1. Preparation of Fol liquid

[0052] The stored Fol was cultured in 200 mL potato dextrose broth (PDB) at 28°C in a 200 rpm / min shaker for 3 days, and the excess mycelium was filtered with single-layer gauze. The bacterial liquid was diluted with sterile water to a suspension of 2.5-5 x 10 6 spores / mL.

[0053] 2. Inoculation of tomato plants with Fol

[0054] Three-week-old tomato cpk7 mutants and wild-type plants with consistent and robust growth were selected and the root soil was washed with tap water. The obtained naturally wounded seedlings were placed in the spore suspension and placed on a slow horizontal shaker, and the negative control was tap water. After 1 h of root immersion, the excess bacterial liquid was washed with tap water, and the tomato plants were sown in a medium of grass charcoal: vermiculite: perlite = 1:1:1.

[0055] 3. Disease index statistics of tomato cpk7 mutants and wild-type plants

[0056] After the tomato plants were infected, the disease index statistics indicators were as follows: ​

[0057] 0: No symptom on rhizome.

[0058] 1: The main root and lateral root are moderately brown, but no rotten condition appears. The stem base begins to appear brown sporadic spots, and the overall growth of the plant is good.

[0059] 2: The main root is brown, the stem base brown scar is enlarged, and the plant sub-leaf begins to turn yellow, and new lateral roots can be found.

[0060] 3: The main root is mostly withered, and new lateral roots appear; the stem brown scar is linear, spreading to the first and second leaves of the plant; the first and second leaves of the plant turn yellow, and the size no longer grows; the plant remains upright, and part of the plant leaves remain normal.

[0061] 4: The main root is severely dried, brown, and almost no lateral root or lateral root is completely brown; the stem brown scar completely expands to the whole stem, and the stem is constricted into a line; the upper leaf and plant growth point are severely dehydrated and withered; the plant is dead.

[0062] According to the disease index statistical standard, the disease index statistics were started 3 days after inoculation. The plants treated with sterile water were used as negative control, and after the difference between the mutant plants and the wild type was significant, the average values obtained after determination were taken to take photos of the overall phenotype and root phenotype of the plants, as shown in Figure 2 , Figure 3 The disease index statistical results are shown in Figure 4 .

[0063] Through the phenotype and disease index statistics of the tomato cpk7 mutant and wild type plants after inoculation, it was found that the tomato cpk7 mutant and wild type plants began to show disease phenotype 3 days after inoculation with Fol, and the disease degree of the tomato cpk7 mutant was significantly higher than that of the wild type tomato, indicating that CPK7 positively regulates the resistance of tomato to Fol.

[0064] Example 4: Asbestos blue staining of stem sections of tomato cpk7 mutant and wild type plants

[0065] The asbestos blue staining solution can stain the mycelium and sporulation structure of Fol into bright blue and the background into dull blue. This method can directly observe whether the phenotype difference of tomato plants is caused by Fol infection.

[0066] After 7 days of inoculation, the representative cpk7 mutant material and wild type tomato stems were taken, and a thin slice was cut out with a blade, and 1 drop of asbestos blue staining solution was dropped. The stem section phenotype was observed under a microscope. The deeper the color of the phloem and vascular bundle, the deeper the degree of Fol infection.

[0067] The results are shown in Figure 5As shown, compared with wild type plants, the stem section of tomato cpk7 mutant was darker after calcofluor white staining, and all phloem was stained, indicating that Fol completely blocked the stem of cpk7 mutant and the degree of Fol infection was higher.

[0068] Example 5: Determination of callose content in stems of tomato cpk7 mutant and wild type plants

[0069] In plant stems, callose plays an important role in plant disease resistance. Callose accumulation can effectively hinder the invasion of pathogenic bacteria and play a role in disease resistance. Using the principle of specific binding of aniline blue to plant callose and excitation of fluorescence at a specific wavelength, the plant callose content can be quantitatively detected.

[0070] Determination of callose content in stems of tomato cpk7 mutant and wild type plants before and after infection using callose content determination kit from Suzhou Keming Biotechnology Co., Ltd.

[0071] According to the kit instruction, the samples to be tested and the standard samples were prepared, and the standard curve was determined using the enzyme label instrument. Then, according to the standard curve, the callose content in the stems of the materials before and after infection was calculated.

[0072] The results are shown in Figure 6 As shown, compared with wild type plants, the accumulation of callose in the stems of cpk7 mutant materials was significantly reduced, indicating that cpk7 mutant had reduced resistance to Fol.

Claims

1. SlCPK7 Use of a gene in modulating resistance to fusarium wilt in tomato, characterized in that, SlCPK7 The protein sequence encoded by the gene is shown as SEQ ID NO. 2, SlCPK7 The gene positively regulates the resistance of tomato plants to fusarium wilt; silencing expression SlCPK7 The gene, after which the resistance of the plant to fusarium wilt is reduced.

2. Use according to claim 1, wherein SlCPK7 The nucleotide sequence of the protein coding region of the gene is shown in SEQ ID NO.

1.

3. The use according to claim 1, wherein The variety of said tomato is Condine Red.