Application of SLC35E2B in treatment of obesity

Abstract

The invention discloses application of SLC35E2B in treatment of obesity, and belongs to the technical field of biology. According to the invention, an animal model with obesity and / or related to obesity is constructed by knocking out a mouse animal model through the constructed SLC35E2B gene, changing the expression of the SLC35E2B gene in an animal body, and / or changing the level or activity of SLC35E2B protein; by means of molecular biology, enzyme immunoassay, immunohistochemical staining, oil red staining and the like, the application of the SLC35E2B gene in constructing an obesity model is researched.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to application of SLC35E2B in treating obesity. Background Art

[0002] The solute carrier 35 (SLC35) family is the 35th member of the SLC family. It was first discovered in mouse liver and is divided into 7 subtypes (AG). It is a hydrophobic protein composed of 300 to 400 amino acids and belongs to the type III transmembrane transporter molecule. Most members of SLC35 are located on the Golgi complex membrane, and a small part is located on the cell membrane. SLC35 is considered to be a key regulator in the glycosylation pathway. Its main function is to transport the corresponding monosaccharide nucleotides in the cell, participate in sugar metabolism, and ensure the smooth progress of the glycosylation process.

[0003] Obesity is a chronic metabolic disease caused by the interaction of multiple factors, including genetic factors and environmental factors. It is becoming increasingly prevalent worldwide and is considered to be the main environmental factor leading to the onset of inflammatory skin diseases. The mouse models currently used to study obesity include β-less mice, high-fat diet-induced models, monogenic obese mice, polygenic obese mice, and genetically modified mouse models. Each model has its own specific uses and advantages, providing an important tool for studying the pathogenesis, preventive measures, and potential treatments of obesity. Gene-edited mouse models have higher phenotypic stability and play an important role in the study of the mechanisms of obesity and other metabolic diseases and in drug development and evaluation.

[0004] Human gene data show that about 20% of the human genome is related to diseases, and more than 50% of SLC family members are related to human diseases. Solute carrier transporters are associated with a variety of metabolic diseases and are expressed in large quantities in the liver. They are involved in the transport of a variety of nutrients and metabolites, regulating nutrient supply, metabolic conversion, energy balance and oxidative stress, and regulating the physiological functions of the liver. Some SLC transporters have become new targets for drug development. At present, 13 subfamilies in the SLC family show strong evidence of being associated with metabolic diseases, among which SLC5, SLC6, SLC13, SLC25, and SLC30 are associated with the onset of obesity, and SLC35D, SLC25A24, and SLC43A3 cause obesity by acting on adipocytes. In the SLC35 family, SLC35C1 knockout mice have slow growth and weight gain after birth. Studies on SLC35C1 knockout mice have found that the fucosylation modification regulated by this gene affects growth and development, leukocyte recruitment, lymphocyte homeostasis regulation, and lung development. Mice with recessive mutations in the SLC35D3 gene show multiple features of metabolic syndrome, including late-onset obesity, hyperlipidemia, hyperglycemia, and hyperinsulinemia. Currently, there are few studies on SLC35E2B, and its function is still unclear. Therefore, the purpose of this study is to provide an application of the SLC35E2B gene in constructing an obesity model, and at the same time provide a new theoretical basis for guiding the treatment of obesity-related diseases. Summary of the invention

[0005] The first object of the present invention is to provide a method for constructing a SLC35E2B gene knockout mouse animal model.

[0006] The second object of the present invention is to provide use of SLC35E2B in treating obesity.

[0007] To achieve the above object, the present invention adopts the following technical solution:

[0008] The method for constructing the SLC35E2B gene knockout mouse animal model provided by the present invention is constructed based on CRISPR / Cas9 gene knockout technology and comprises the following steps:

[0009] (1) A pair of specific target gRNAs 1 and 2 for the gene to be knocked out in SLC35E2B mice were determined based on the SLC35E2B gene sequence, and transcribed into mRNA in vitro with Cas9 nuclease;

[0010] (2) A pair of specific target gRNA1, gRNA2 and mRNA are microinjected into mouse fertilized eggs, and the microinjected fertilized eggs are transplanted into the oviduct of surrogate mother mice;

[0011] (3) After the mice are produced, they are continued to be subcultured and genotyped to obtain a stable genetic SLC35E2B gene knockout mouse animal model;

[0012] Among them, the target sequence of the gRNA1 is shown as SEQ ID NO: 1, and the target sequence of the gRNA2 is shown as SEQ ID NO: 2.

[0013] Preferably, in step (3), the fertilized eggs after microinjection are transplanted into the oviduct of a surrogate mother mouse to produce mice, namely F0 generation mice; DNA from the tails of the F0 generation mice is extracted, PCR amplified and the products are sequenced, the positive mice are mated with wild-type mice of the opposite sex to obtain F1 generation heterozygous mice, and the F1 generation heterozygous mice are hybridized to obtain F2 generation homozygous mice, until a stably inherited SLC35E2B gene knockout mouse animal model is obtained; wherein, if there is a 680 bp band, it is a positive homozygous; if there are two 931 bp and 680 bp bands, it is a positive heterozygous; if there is a 931 bp band, it is a wild-type control.

[0014] The present invention also provides a SLC35E2B gene knockout mouse animal model, which is obtained by the above-mentioned method for constructing the SLC35E2B gene knockout mouse animal model.

[0015] The present invention also provides an application of the SLC35E2B gene in constructing an obesity model, which is constructed based on CRISPR / Cas9 gene knockout technology and includes the following steps:

[0016] (1) Detected the SLC35E2B gene expression in liver and fat of 12-week-old OB and DIO obese mice;

[0017] (2) Observe the morphology and growth curve of SLC35E2B knockout mice, measure the liver and fat weights of 4-week-old, 8-week-old, and 12-week-old male mice and C57 male mice of the same age; observe the liver cell size, adipocyte morphology, serum lipid metabolism indexes, and lipid metabolism gene expression;

[0018] (3) SLC35E2B knockout mice and C57 male mice of the same age were fed with ordinary diet or high-fat diet for 4 / 8 weeks, respectively. The morphology and growth curve of the mice were observed, and the liver and fat weights of the mice were recorded after 4 / 8 weeks of feeding.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] (1) The present invention designs specific target gRNA1 and gRNA2 of the SLC35E2B mouse gene to be knocked out based on CRISPR / Cas9 gene knockout technology, and successfully constructs an SLC35E2B gene knockout mouse animal model. It is identified that exon2-9 of the SLC35E2B gene is knocked out, providing the main animal experimental materials for constructing an obesity model.

[0021] (2) The present invention constructs an animal model of obesity and / or obesity-related by constructing an SLC35E2B gene knockout mouse model, changing the expression of the SLC35E2B gene in the animal, and / or changing the level or activity of the SLC35E2B protein, and uses molecular biology, enzyme immunoassay technology, immunohistochemical staining, oil red staining and other means to study the application and method of the SLC35E2B gene in constructing an obesity model.

[0022] The above and other features, aspects and advantages of the present invention will be more readily understood with reference to the following detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Other features, objects and advantages of the present invention will become more apparent from the detailed description of non-limiting embodiments made with reference to the following drawings:

[0024] Figure 1 is a flow chart of the method for constructing an SLC35E2B gene knockout mouse animal model in the embodiment;

[0025] Figure 2 is a non-target gRNA analysis primer; wherein: (a) a non-target analysis sequence of gRNA1; (b) a non-target analysis sequence of gRNA2;

[0026] Figure 3 This is a flowchart for studying the SLC35E2B gene in building an obesity model;

[0027] Figure 4 is the quantitative PCR of SLC35E2B mRNA in liver and fat of DIO obese mice and OB obese mice, n = 8 mice in each group, C57BL / 6 wild-type mice were used as controls;

[0028] Figure 5 Figures 1 and 2 are the body shape (A), body weight (B) and growth curve (C) of mice from 4 to 12 weeks old. Ko represents SLC35E2B knockout mice, and wt represents C57BL / 6 wild-type mice. There are 8 mice in each group.

[0029] Figure 6HE staining of liver (A), subcutaneous fat (B), visceral fat (C), brown fat (D) and oil red staining of liver (E) of 4-week-old, 8-week-old and 12-week-old mice. Ko represents SLC35E2B gene knockout mice, and wt represents C57BL / 6 wild-type mice. There are n=8 mice in each group.

[0030] Figure 7 Figure 3. Liver cholesterol TC and triglyceride TG levels (A), serum cholesterol TC, triglyceride TG, low-density lipoprotein LDL, high-density lipoprotein HDL levels (B), and quantitative PCR of lipid metabolism gene mRNA in liver, subcutaneous fat, visceral fat, and brown fat of KO and WT mice at the ages of 4, 8, and 12 weeks. Each group of mice had n=8 mice, and C57BL / 6 wild-type mice were used as controls.

[0031] Figure 8 Figure 1 shows the body shape (A), body weight (B) and growth curve (C) of mice fed a high-fat diet for 4 / 8 weeks. Ko represents SLC35E2B knockout mice, and wt represents C57BL / 6 wild-type mice. There are 8 mice in each group. DETAILED DESCRIPTION

[0032] In order to make the purpose, technical solution and advantages of the embodiment of the present invention clearer, the technical solution of the embodiment of the present invention will be clearly and completely described below in conjunction with the accompanying drawings of the embodiment of the present invention. Obviously, the described embodiment is a part of the embodiment of the present invention, not all of the embodiments. Based on the described embodiment of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0033] The basic information of knocking out the SLC35E2B gene in the following examples is as follows: knockout gene name (Ensembl): ENSMUSG00000042202, knockout gene GenBank code: NM_177186.4; number of exons of the knockout gene: 8, exons 2-9 targeted by the knockout; number of gRNAs constructed: 1 pair; microco-injection: Cas9 mRNA and gRNA generated by in vitro transcription were microco-injected into mouse fertilized eggs.

[0034] Example 1

[0035] like Figure 1 and 2 As shown, the SLC35E2B gene knockout mouse animal model was constructed based on CRISPR / Cas9 gene knockout technology. The steps are as follows:

[0036] (1) Based on the SLC35E2B gene sequence (GenBank code: NM_177186.4), a pair of specific target sites of the SLC35E2B mouse gene to be knocked out were determined:

[0037] Pair1: gRNA1: ggaccaactagctcacttag (SEQ ID NO: 1);

[0038] gRNA2:acagcaactcgggttgatcc (SEQ ID NO: 2);

[0039] The amplification primer sequences were designed based on a pair of specific targets as follows:

[0040] SLC35E2B-pair1-F: gagggtttctgtggaaggtatggag (SEQ ID NO: 3);

[0041] SLC35E2B-pair1-R: attagagatttgctggccaacttccc (SEQ ID NO: 4);

[0042] PCR amplification was performed according to the PCR reaction system and reaction conditions shown in Table 1, and transcribed into mRNA in vitro with Cas9 nuclease;

[0043] (2) A pair of specific target gRNA1, gRNA2 and mRNA are microinjected into mouse fertilized eggs, and the microinjected fertilized eggs are transplanted into the oviduct of surrogate mother mice;

[0044] (3) The fertilized eggs after microinjection are transplanted into the oviduct of a surrogate mother mouse to produce mice, namely F0 generation mice; DNA from the tail of the F0 generation mice is extracted, PCR amplified and the product is sequenced, the positive mice are mated with wild-type mice of the opposite sex to obtain F1 generation heterozygous mice, and the F1 generation heterozygous mice are hybridized to obtain F2 generation homozygous mice, until a stable inherited SLC35E2B gene knockout mouse animal model is obtained, wherein the genotype is identified according to the following gene identification primers:

[0045] Mouse SLC352B-F: gagggtttctgtggaaggtatggag (SEQ ID NO: 5);

[0046] Mouse SLC352B-R: attagagatttgctgccaacttccc (SEQ ID NO: 6);

[0047] Mouse SLC352B-Wt / He-F: gctgagaccctggatggacaaca (SEQ ID NO: 7);

[0048] If there is one 680bp band, it is a positive homozygote; if there are two 931bp and 680bp bands, it is a positive heterozygote; if there is one 931bp band, it is a wild-type control. The statistical results are shown in Table 2.

[0049] Table 1

[0050]

[0051] Table 2

[0052] Ear tag number genotype gender Date of Birth 1520 Homozygous ♂ 2018.3.20 1521 Homozygous ♀ 2018.3.17

[0053] Example 2

[0054] like Figure 3 As shown, based on the SLC35E2B gene knockout mouse animal model constructed in Example 1, the application of the SLC35E2B gene in constructing an obesity model was further studied, and the method steps were as follows:

[0055] (1) Eight 12-week-old DIO obese mice and eight OB obese mice were selected, and the liver and adipose tissues were collected to measure the relative expression of SLC35E2B mRNA. C57BL / 6 wild-type mice were used as controls. Figure 4 shown.

[0056] (2) Homozygous SLC35E2B knockout mice were selected after genetic identification, and C57BL / 6 wild-type male mice of the same age were housed in SPF-grade laminar flow animal rooms, respectively. They were provided with high-temperature and high-pressure sterilized animal feed and sterile water, and were allowed to eat and drink freely. The indoor temperature was 20-26°C; the daily temperature difference was ≤4°C; the relative humidity was 40%-70%, and the lighting was half-cycle during the day and night. Eight mice were selected at 4 weeks of age, 8 weeks of age, and 12 weeks of age, and their weight and body shape were recorded. Figure 5 shown.

[0057] (3) The liver, subcutaneous fat, visceral fat, and brown fat of 4-week-old, 8-week-old, and 12-week-old SLC35E2B knockout male mice and C57BL / 6 wild-type male mice were selected for paraffin and frozen sections. HE and oil red staining were used to observe the size of adipocytes and the content of lipid droplets in the liver. Figure 6 shown.

[0058] (4) Liver tissue, adipose tissue, and serum were collected from 4-week-old, 8-week-old, and 12-week-old SLC35E2B knockout male mice (KO) and C57BL / 6 wild-type male mice (WT). The ELISA method was used to determine the levels of cholesterol and triglyceride in the liver, and the levels of cholesterol, triglyceride, low-density lipoprotein, and high-density lipoprotein in the serum; the RT-PCR method was used to determine the relative mRNA expression of lipid metabolism genes in the liver, subcutaneous fat, visceral fat, and brown fat. Figure 7 shown.

[0059] (5) Select 6-week-old pure SLC35E2B gene knockout male mice and 16 C57BL / 6 wild-type male mice of the same age (according to weight monitoring, there was no difference in weight between the two groups of mice at 6 weeks of age, so the high-fat diet was started at 6 weeks of age, and they were all breast-fed before 6 weeks of age). They were divided into a normal feed group and a high-fat diet group, 8 mice each, and were raised for 4 weeks and 8 weeks, respectively. The weight and body shape were recorded. Figure 8 shown.

[0060] It can be seen from this that the effect of high-fat diet on body weight in SLC35E2B gene knockout male mice is significantly lower than that in wild-type male mice.

Claims

1. Use of SLC35E2B in the preparation of drugs for preventing and / or treating obesity.

2. The use according to claim 1, characterized in that The drug is a substance that inhibits the expression of SLC35E2B, or a substance that inhibits the transcription of SLC35E2B mRNA, or a substance that inhibits the activity of SLC35E2B protein.

3. The use as claimed in claim 1, characterized in that The obesity is physiological obesity caused by a high-fat diet.

4. A drug for preventing and / or treating obesity, characterized in that: These include substances that inhibit the expression of SLC35E2B, substances that inhibit the transcription of SLC35E2B mRNA, or substances that inhibit the activity of SLC35E2B protein.

5. The drug according to claim 4, characterized in that The obesity is physiological obesity caused by a high-fat diet.

Images