Nitrogen-containing heterocyclic compound as well as crystal form and application thereof

Abstract

The invention relates to a nitrogen-containing heterocyclic compound as well as a crystal form and application thereof. Specifically, the invention provides a compound shown as a formula I or pharmaceutically acceptable salt thereof. The compound disclosed by the invention has a remarkable and excellent precise treatment effect on tumors with low expression, no expression, low activity or no activity of mitochondrial membrane permeability conversion pores, low expression, no expression, low activity or no activity of peptidyl prolyl isomerase F, low expression or no expression of NNMT genes and / or high expression of DNMT1. # imgabs0 #

Description

Technical Field

[0001] The present invention relates to the field of medicine, and in particular to a nitrogen-containing heterocyclic compound and a crystal form and use thereof. Background Art

[0002] Tumors are common diseases that seriously endanger human health, and the mortality rate of malignant tumors has been on the rise. Due to the heterogeneity of tumors, if the same treatment method or the same drug is used simply based on its origin or pathological characteristics, it is easy to cause improper treatment, which will waste patients' precious treatment time and opportunities. Therefore, it is very necessary to adopt precision treatment for different tumor conditions. With the development of biological technology, tumors are constantly classified at the molecular level of genes, proteins, etc., and more and more changes in tumor-related genes, protein expression and activity have been discovered. Changes in tumor-related genes, protein expression and activity play an important role in the development of malignant tumors. The discovery and application of biomarkers will provide precise guidance for the application of related drugs, making precise treatment of tumors possible, thereby achieving targeted drug administration, significantly improving the effect of tumor treatment, reducing drug dosage and reducing toxic side effects.

[0003] Therefore, there is an urgent need in this field to develop a drug that can provide precise treatment for tumors. Summary of the invention

[0004] The present invention provides a compound, which has an excellent precision treatment effect on tumors with low expression, no expression, low activity or no activity of mitochondrial membrane permeability transition pore, low expression, no expression, low activity or no activity of peptidyl prolyl isomerase F, low expression or no expression of NNMT gene, and / or high expression of DNMT1.

[0005] In a first aspect, the present invention provides a compound of formula I, or a pharmaceutically acceptable salt thereof;

[0006]

[0007] In another preferred embodiment, the pharmaceutically acceptable salt of the compound of formula I includes a salt formed by the compound of formula I and hydrochloric acid, mucic acid, D-glucuronic acid, hydrobromic acid, hydrofluoric acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, trifluoroacetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenesulfonic acid, benzenesulfonic acid, trifluoromethanesulfonic acid, aspartic acid or glutamic acid.

[0008] In another preferred embodiment, the pharmaceutically acceptable compound of formula I is a phosphate salt of the compound of formula I.

[0009] In a second aspect, the present invention provides a crystalline form B of a compound of formula I;

[0010]

[0011] In another preferred embodiment, the X-ray powder diffraction pattern of the crystalline form B of the compound of formula I includes one or more (such as 2 or 3) 2θ values ​​selected from the following group: 13.03±0.2°, 17.52±0.2°, 22.69±0.2.

[0012] In another preferred example, the X-ray powder diffraction pattern of the crystalline form B of the compound of formula I includes one or more (such as 2, 3 or more) 2θ values ​​selected from the following group: 13.03±0.2°, 16.18±0.2°, 17.52±0.2°, 22.69±0.2.

[0013] In another preferred embodiment, the X-ray powder diffraction pattern of the crystalline form B of the compound of formula I includes one or more (such as 2, 3 or more) 2θ values ​​selected from the following group: 8.38±0.2°, 8.75±0.2°, 13.03±0.2°, 16.18±0.2°, 17.52±0.2°, 17.78±0.2°, 21.31±0.2°, 22.69±0.2.

[0014] In another preferred embodiment, the X-ray powder diffraction pattern of the crystalline form B of the compound of formula I includes one or more (such as 2, 3 or more) 2θ values ​​selected from the following group: 8.38±0.2°, 8.75±0.2°, 13.03±0.2°, 13.52±0.2°, 16.18±0.2°, 17.52±0.2°, 17.78±0.2°, 18.93±0.2°, 19.84±0.2°, 20.07±0.2°, 21.31±0.2°, 22.69±0.2°, and 23.24±0.2°.

[0015] In another preferred embodiment, the X-ray powder diffraction pattern of the crystalline form B of the compound of formula I includes one or more (such as 2, 3 or more) 2θ values ​​selected from the following group: 8.38±0.2°, 8.75±0.2°, 9.54±0.2°, 13.03±0.2°, 13.52±0.2°, 16.18±0.2°, 17.52±0.2°, 17.78± 0.2°, 18.93±0.2°, 19.84±0.2°, 20.07±0.2°, 21.31±0.2°, 21.91±0.2°, 22.69±0.2°, 23.24±0.2°, 23.77±0.2°, 24.36±0.2°, 24.87±0.2°, 25.86±0.2°, 26.40±0.2°.

[0016] In another preferred embodiment, the X-ray powder diffraction pattern of the crystalline form B of the compound of formula I includes one or more (such as 2, 3 or more) 2θ values ​​selected from the following group: 3.21±0.2°, 8.38±0.2°, 8.75±0.2°, 9.54±0.2°, 10.00±0.2°, 13.03±0.2°, 13.52±0.2°, 16.18±0.2°, 16.78±0.2°, 17.52±0.2°, 17.78±0.2°, 18.93±0.2°, 19.84±0.2°, 2 0.07±0.2°, 21.31±0.2°, 21.91±0.2°, 22.69±0.2°, 23.24±0.2°, 23.77±0.2°, 24.36±0.2°, 24.87±0.2°, 25.86±0.2°, 26.40±0.2°, 27.32±0.2°, 28.01±0.2°, 28.68±0.2°, 29.99±0.2°, 31.45±0.2°, 34.07±0.2°, 35.21±0.2°, 38.85±0.2°.

[0017] In another preferred embodiment, the X-ray powder diffraction pattern of the crystalline form B of the compound of formula I includes one or more (such as 2, 3 or more) 2θ values ​​selected from the following group: 3.21±0.1°, 8.38±0.1°, 8.75±0.1°, 9.54±0.1°, 10.00±0.1°, 13.03±0.1°, 13.52±0.1°, 16.18±0.1°, 16.78±0.1°, 17.52±0.1°, 17.78±0.1°, 18.93±0.1°, 19.84±0.1°, 2 0.07±0.1°, 21.31±0.1°, 21.91±0.1°, 22.69±0.1°, 23.24±0.1°, 23.77±0.1°, 24.36±0.1°, 24.87±0.1°, 25.86±0.1°, 26.40±0.1°, 27.32±0.1°, 28.01±0.1°, 28.68±0.1°, 29.99±0.1°, 31.45±0.1°, 34.07±0.1°, 35.21±0.1°, 38.85±0.1°.

[0018] In another preferred embodiment, the 2θ values ​​in the X-ray powder diffraction pattern of the crystalline form B of the compound of formula I include: 3.21±0.2°, 8.38±0.2°, 8.75±0.2°, 9.54±0.2°, 10.00±0.2°, 13.03±0.2°, 13.52±0.2°, 16.18±0.2°, 16.78±0.2°, 17.52±0.2°, 17.78±0.2°, 18.93±0.2°, 19.84±0.2°, 20.07±0.2°, 21. 31±0.2°, 21.91±0.2°, 22.69±0.2°, 23.24±0.2°, 23.77±0.2°, 24.36±0.2°, 24.87±0.2°, 25.86±0.2°, 26.40±0.2°, 27.32±0.2°, 28.01±0.2°, 28.68±0.2°, 29.99±0.2°, 31.45±0.2°, 34.07±0.2°, 35.21±0.2°, 38.85±0.2°, or a combination thereof.

[0019] In another preferred embodiment, the 2θ values ​​in the X-ray powder diffraction pattern of the crystalline form B of the compound of formula I include: 3.21±0.1°, 8.38±0.1°, 8.75±0.1°, 9.54±0.1°, 10.00±0.1°, 13.03±0.1°, 13.52±0.1°, 16.18±0.1°, 16.78±0.1°, 17.52±0.1°, 17.78±0.1°, 18.93±0.1°, 19.84±0.1°, 20.07±0.1°, 21. 1°, 31±0.1°, 21.91±0.1°, 22.69±0.1°, 23.24±0.1°, 23.77±0.1°, 24.36±0.1°, 24.87±0.1°, 25.86±0.1°, 26.40±0.1°, 27.32±0.1°, 28.01±0.1°, 28.68±0.1°, 29.99±0.1°, 31.45±0.1°, 34.07±0.1°, 35.21±0.1°, 38.85±0.1°, or a combination thereof.

[0020] In another preferred embodiment, the 2θ values ​​in the X-ray powder diffraction pattern of the crystalline form B of the compound of formula I include: 3.21°, 8.38°, 8.75°, 9.54°, 10.00°, 13.03°, 13.52°, 16.18°, 16.78°, 17.52°, 17.78°, 18.93°, 19.84°, 20.07°, 21.31°, 21.91°, 22.69°, 23.24°, 23.77°, 24.36°, 24.87°, 25.86°, 26.40°, 27.32°, 28.01°, 28.68°, 29.99°, 31.45°, 34.07°, 35.21°, 38.85°, or a combination thereof.

[0021] In another preferred embodiment, the one or more are 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or all.

[0022] In another preferred embodiment, the 3 or more are 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or all.

[0023] In another preferred embodiment, the crystalline form B of the compound of formula I comprises one or more (such as 2, 3 or more) XRPD diffraction peak characteristics selected from the following group:

[0024]

[0025] In another preferred embodiment, the X-ray powder diffraction pattern of the crystalline form B of the compound of formula I is substantially as follows Figure 7 shown.

[0026] In another preferred embodiment, the X-ray powder diffraction pattern of the crystalline form B of the compound of formula I is as follows: Figure 7 shown.

[0027] In another preferred embodiment, the X-ray powder diffraction (XRPD) pattern is measured on an X-ray powder diffraction analyzer produced by PANalytacal, and the measurement parameters are as follows:

[0028]

[0029]

[0030] In another preferred embodiment, the characteristic absorption peak represented by the 2θ value of the X-ray powder diffraction pattern of the crystalline form B of the compound of formula I has a deviation of ±0.5, preferably a deviation of ±0.3, more preferably a deviation of ±0.2, and even more preferably a deviation of ±0.1.

[0031] In another preferred embodiment, the thermogravimetric analysis spectrum of Form B of the compound of Formula I loses weight by about 0.05-1.5% at 120-180°C, preferably 130-170°C, more preferably 140-160°C, more preferably 145-155°C, more preferably 148-152°C, and optimally at 150°C, preferably 0.1-1.0%, more preferably 0.2-0.8%, more preferably 0.3-0.7%, more preferably 0.4-0.6%, optimally 0.45-0.50%, and optimally 0.47%.

[0032] In another preferred embodiment, the thermogravimetric analysis spectrum (TG spectrum) of the crystalline form B of the compound of formula I is substantially as follows Figure 8 shown.

[0033] In another preferred embodiment, the thermogravimetric analysis spectrum (TG spectrum) of the crystalline form B of the compound of formula I is as follows Figure 8 shown.

[0034] In another preferred embodiment, the differential scanning calorimetry analysis spectrum (DSC diagram) of the crystalline form B of the compound of formula I has a characteristic absorption peak in the range of 90-170°C, preferably 100-160°C, preferably 110-160°C, preferably 110-160°C, more preferably 120-150°C.

[0035] In another preferred embodiment, in the differential scanning calorimetry analysis spectrum (DSC diagram) of the crystalline form B of the compound of formula I, onset is 110-160°C, preferably 110-150°C, more preferably 120-150°C, more preferably 130-150°C, more preferably 135-143°C, and most preferably 138.8°C

[0036] In another preferred embodiment, the differential scanning calorimetry analysis spectrum of the crystalline form B of the compound of formula I is substantially as follows Fig. 9 shown.

[0037] In another preferred embodiment, the differential scanning calorimetry analysis spectrum of the crystalline form B of the compound of formula I is as follows Fig. 9 shown.

[0038] In a third aspect, the present invention provides a method for preparing the crystalline form B of the compound of formula I according to the second aspect of the present invention, wherein the method comprises:

[0039] Compound a is dissolved in tetrahydrofuran, protected by nitrogen, cyclopentylmagnesium bromide is added, and the reaction is carried out at room temperature. After the reaction is complete, a saturated aqueous solution of ammonium chloride is added to quench, and the mixture is extracted with ethyl acetate. The organic phase is spin-dried, and the crude product is purified by thin layer chromatography to obtain the compound of formula I in form B;

[0040] Wherein, the structure of compound a is as follows:

[0041]

[0042] The structure of cyclopentylmagnesium bromide is as follows:

[0043]

[0044] In another preferred embodiment, the tetrahydrofuran includes anhydrous tetrahydrofuran.

[0045] In another preferred embodiment, the reaction time is 0.2-0.8h, preferably 0.3-0.7h, more preferably 0.4-0.6h, and most preferably 0.5h.

[0046] In another preferred embodiment, the weight-to-volume ratio (mg:ml) of the compound a to the tetrahydrofuran is 10-30:1, preferably 15-25:1, preferably 18-22:1, and most preferably 20:1.

[0047] In another preferred embodiment, the molar ratio of the compound a to the cyclopentylmagnesium bromide is 1:1-10, preferably 1:2-8, more preferably 1:3-7, more preferably 1:4-6, and most preferably 1:5.

[0048] In another preferred embodiment, the eluent for the thin layer chromatography includes dichloromethane and methanol.

[0049] In another preferred embodiment, the volume ratio of dichloromethane to methanol is 10-50:1, preferably 20-40:1, more preferably 25-35:1, more preferably 28-32:1, and most preferably 30:1.

[0050] In another preferred embodiment, the preparation method of the crystalline form B of the compound of formula I comprises:

[0051] 0.54 mol of compound a was dissolved in 10 ml of tetrahydrofuran, and 2.7 mmol of cyclopentylmagnesium bromide was added at 0°C under nitrogen protection. The reaction was allowed to proceed for 0.5 h at room temperature. After the reaction was complete, saturated aqueous ammonium chloride solution was added to quench the reaction. The reaction was extracted with ethyl acetate. The organic phase was dried over anhydrous sodium sulfate and then filtered. The organic phase was spin-dried and the crude product was subjected to thin layer chromatography to obtain compound a to obtain the crystalline form B of the compound of formula I.

[0052] In a fourth aspect, the present invention provides a phosphate crystal form A of a compound of formula I;

[0053]

[0054] In another preferred embodiment, the X-ray powder diffraction pattern of the phosphate form A of the compound of formula I includes one or more (such as 2 or 3) 2θ values ​​selected from the following group: 13.62±0.2°, 20.89±0.2°, 22.17±0.2°.

[0055] In another preferred embodiment, the X-ray powder diffraction pattern of the phosphate form A of the compound of formula I includes one or more (such as 2, 3 or more) 2θ values ​​selected from the following group: 7.05±0.2°, 13.62±0.2°, 14.06±0.2°, 20.89±0.2°, 21.16±0.2°, 22.17±0.2°, and 23.03±0.2°.

[0056] In another preferred embodiment, the X-ray powder diffraction pattern of the phosphate form A of the compound of formula I includes one or more (such as 2, 3 or more) 2θ values ​​selected from the following group: 7.05±0.2°, 13.62±0.2°, 14.06±0.2°, 18.30±0.2°, 20.89±0.2°, 21.16±0.2°, 22.17±0.2°, 22.71±0.2°, and 23.03±0.2°.

[0057] In another preferred embodiment, the X-ray powder diffraction pattern of the phosphate form A of the compound of formula I includes one or more (such as 2, 3 or more) 2θ values ​​selected from the following group: 7.05±0.2°, 12.56±0.2°, 13.62±0.2°, 14.06±0.2°, 15.63±0.2°, 18.30±0.2°, 20.89±0.2°, 21.16±0.2°, 22.17±0.2°, 22.71±0.2°, and 23.03±0.2°.

[0058] In another preferred embodiment, the X-ray powder diffraction pattern of the phosphate form A of the compound of formula I includes one or more (such as 2, 3 or more) 2θ values ​​selected from the following group: 7.05±0.2°, 11.67±0.2°, 12.56±0.2°, 13.62±0.2°, 14.06±0.2°, 15.35±0.2°, 15.63±0.2°, 18.30±0.2°, 18.88±0.2°, 20.89±0.2°, 21.16±0.2°, 22.17±0.2°, 22.71±0.2°, 23.03±0.2°, 24.19±0.2°, and 26.55±0.2°.

[0059] In another preferred embodiment, the X-ray powder diffraction pattern of the phosphate crystal form A of the compound of formula I includes one or more (such as 2, 3 or more) 2θ values ​​selected from the following group: 7.05±0.2°, 11.67±0.2°, 12.56±0.2°, 13.62±0.2°, 14.06±0.2°, 14.81±0.2°, 15.35±0.2°, 15.63±0.2°, 16.02±0. 2°, 18.30±0.2°, 18.88±0.2°, 19.60±0.2°, 20.89±0.2°, 21.16±0.2°, 22.17±0.2°, 22.71±0.2°, 23.03±0.2°, 23.51±0.2°, 24.19±0.2°, 25.23±0.2°, 26.55±0.2°, 27.39±0.2°, 28.93±0.2°.

[0060] In another preferred embodiment, the X-ray powder diffraction pattern of the phosphate crystal form A of the compound of formula I includes one or more (such as 2, 3 or more) 2θ values ​​selected from the following group: 7.05±0.2°, 11.67±0.2°, 12.56±0.2°, 13.62±0.2°, 14.06±0.2°, 14.81±0.2°, 15.35±0.2°, 15.63±0.2°, 16.02±0.2°, 18.30±0.2°, 19.70±0.2°, 20. 2°, 18.88±0.2°, 19.60±0.2°, 20.89±0.2°, 21.16±0.2°, 22.17±0.2°, 22.71±0.2°, 23.03±0.2°, 23.51±0.2°, 24.19±0.2°, 25.23±0.2°, 26.06±0.2°, 26.55±0.2°, 27.39±0.2°, 28.63±0.2°, 28.93±0.2°.

[0061] In another preferred embodiment, the X-ray powder diffraction pattern of the phosphate crystalline form A of the compound of formula I includes one or more (such as 2, 3 or more) 2θ values ​​selected from the following group: 7.05±0.2°, 9.78±0.2°, 11.67±0.2°, 12.18±0.2°, 12.56±0.2°, 13.62±0.2°, 14.06±0.2°, 14.81±0.2°, 15.35±0.2°, 15.63±0.2°, 16.02±0.2°, 18.30±0.2° °, 18.88±0.2°, 19.60±0.2°, 20.89±0.2°, 21.16±0.2°, 22.17±0.2°, 22.71±0.2°, 23.03±0.2°, 23.51±0.2°, 24.19±0.2°, 24.85±0.2°, 25.23±0.2°, 26.06±0.2°, 26.55±0.2°, 27.39±0.2°, 28.63±0.2°, 28.93±0.2°, 30.66±0.2°,.

[0062] In another preferred embodiment, the X-ray powder diffraction pattern of the phosphate crystalline form A of the compound of formula I includes one or more (such as 2, 3 or more) 2θ values ​​selected from the following group: 7.05±0.2°, 7.66±0.2°, 9.78±0.2°, 11.67±0.2°, 12.18±0.2°, 12.56±0.2°, 13.62±0.2°, 14.06±0.2°, 14.81±0.2°, 15.35±0.2°, 15.63±0.2°, 16.02±0.2°, 17.00±0.2°, 18.30±0.2°, 18.88±0.2°, 19.60±0.2 °, 20.13±0.2°, 20.89±0.2°, 21.16±0.2°, 22.17±0.2°, 22.71±0.2°, 23.03±0.2°, 23.51±0.2°, 24.19±0.2°, 24.85±0.2°, 25.23±0.2°, 26.06±0.2°, 26.55±0.2°, 27.39±0.2°, 28.63±0.2°, 28.93±0.2°, 30.66±0.2°, 32.30±0.2°, 33.16±0.2°, 34.76±0.2°, 36.12±0.2°, and 36.83±0.2°.

[0063] In another preferred embodiment, the X-ray powder diffraction pattern of the phosphate form A of the compound of formula I includes one or more (such as 2, 3 or more) 2θ values ​​selected from the following group: 7.05±0.1°, 7.66±0.1°, 9.78±0.1°, 11.67±0.1°, 12.18±0.1°, 12.56±0.1°, 13.62±0.1°, 14.06±0.1°, 14.81±0.1°, 15.35±0.1°, 15.63±0.1°, 16.02±0.1°, 17.00±0.1°, 18.30±0.1°, 18.88±0.1°, 19.60±0.1° °, 20.13±0.1°, 20.89±0.1°, 21.16±0.1°, 22.17±0.1°, 22.71±0.1°, 23.03±0.1°, 23.51±0.1°, 24.19±0.1°, 24.85±0.1°, 25.23±0.1°, 26.06±0.1°, 26.55±0.1°, 27.39±0.1°, 28.63±0.1°, 28.93±0.1°, 30.66±0.1°, 32.30±0.1°, 33.16±0.1°, 34.76±0.1°, 36.12±0.1°, and 36.83±0.1°.

[0064] In another preferred embodiment, the 2θ values ​​of the X-ray powder diffraction pattern of the phosphate crystalline form A of the compound of formula I include: 7.05±0.2°, 7.66±0.2°, 9.78±0.2°, 11.67±0.2°, 12.18±0.2°, 12.56±0.2°, 13.62±0.2°, 14.06±0.2°, 14.81±0.2°, 15.35±0.2°, 15.63±0.2°, 16.02±0.2°, 17.00±0.2°, 18.30±0.2°, 18.88±0.2°, 19.60±0.2°, 20.13±0.2°, 21.70±0.2°, 23. 0.89±0.2°, 21.16±0.2°, 22.17±0.2°, 22.71±0.2°, 23.03±0.2°, 23.51±0.2°, 24.19±0.2°, 24.85±0.2°, 25.23±0.2°, 26.06±0.2°, 26.55±0.2°, 27.39±0.2°, 28.63±0.2°, 28.93±0.2°, 30.66±0.2°, 32.30±0.2°, 33.16±0.2°, 34.76±0.2°, 36.12±0.2°, 36.83±0.2°, or a combination thereof.

[0065] In another preferred embodiment, the 2θ values ​​of the X-ray powder diffraction pattern of the phosphate crystalline form A of the compound of formula I include: 7.05±0.1°, 7.66±0.1°, 9.78±0.1°, 11.67±0.1°, 12.18±0.1°, 12.56±0.1°, 13.62±0.1°, 14.06±0.1°, 14.81±0.1°, 15.35±0.1°, 15.63±0.1°, 16.02±0.1°, 17.00±0.1°, 18.30±0.1°, 18.88±0.1°, 19.60±0.1°, 20.13±0.1°, 21.70±0.1°, 23. 0.89±0.1°, 21.16±0.1°, 22.17±0.1°, 22.71±0.1°, 23.03±0.1°, 23.51±0.1°, 24.19±0.1°, 24.85±0.1°, 25.23±0.1°, 26.06±0.1°, 26.55±0.1°, 27.39±0.1°, 28.63±0.1°, 28.93±0.1°, 30.66±0.1°, 32.30±0.1°, 33.16±0.1°, 34.76±0.1°, 36.12±0.1°, 36.83±0.1°, or a combination thereof.

[0066] In another preferred embodiment, the 2θ values ​​of the X-ray powder diffraction pattern of the phosphate crystal form A of the compound of formula I include: 7.05°, 7.66°, 9.78°, 11.67°, 12.18°, 12.56°, 13.62°, 14.06°, 14.81°, 15.35°, 15.63°, 16.02°, 17.00°, 18.30°, 18.88°, 19.60°, 20 .13°, 20.89°, 21.16°, 22.17°, 22.71°, 23.03°, 23.51°, 24.19°, 24.85°, 25.23°, 26.06°, 26.55°, 27.39°, 28.63°, 28.93°, 30.66°, 32.30°, 33.16°, 34.76°, 36.12°, 36.83°, or a combination thereof.

[0067] In another preferred embodiment, the one or more are 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37 or all.

[0068] In another preferred embodiment, the 3 or more are 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37 or all.

[0069] In another preferred embodiment, the phosphate crystal form A of the compound of formula I comprises one or more (such as 2, 3 or more) XRPD diffraction peak characteristics selected from the following group:

[0070]

[0071]

[0072] In another preferred embodiment, the X-ray powder diffraction pattern of the phosphate crystal form A of the compound of formula I is substantially as follows Fig.10 shown.

[0073] In another preferred embodiment, the X-ray powder diffraction pattern of the phosphate crystal form A of the compound of formula I is as follows: Fig.10 shown.

[0074] In another preferred embodiment, the characteristic absorption peak represented by the 2θ value of the X-ray powder diffraction pattern of the phosphate crystal form A of the compound of formula I has a deviation of ±0.5, preferably a deviation of ±0.3, more preferably a deviation of ±0.2, and even more preferably a deviation of ±0.1.

[0075] In another preferred embodiment, the X-ray powder diffraction (XRPD) pattern is measured on an X-ray powder diffraction analyzer produced by PANalytacal, and the measurement parameters are as follows:

[0076]

[0077] In another preferred embodiment, the thermogravimetric analysis spectrum of the phosphate form A of the compound of formula I loses weight by about 0.05-1.0% at 120-180°C, preferably 130-170°C, more preferably 140-160°C, more preferably 145-155°C, more preferably 148-152°C, and optimally at 150°C, preferably 0.1-0.8%, more preferably 0.1-0.6%, more preferably 0.1-0.5%, more preferably 0.2-0.4%, optimally 0.25-0.35%, and optimally 0.29%.

[0078] In another preferred embodiment, the thermogravimetric analysis spectrum (TG spectrum) of the phosphate crystal form A of the compound of formula I is substantially as follows Fig.11 shown.

[0079] In another preferred embodiment, the thermogravimetric analysis spectrum (TG spectrum) of the phosphate crystal form A of the compound of formula I is as follows Fig.11 shown.

[0080] In another preferred embodiment, the differential scanning calorimetry analysis spectrum (DSC diagram) of the phosphate crystal form A of the compound of formula I has a characteristic absorption peak in the range of 200-250°C, preferably 205-245°C, preferably 205-240°C, preferably 210-240°C, and more preferably 210-230°C.

[0081] In another preferred embodiment, in the differential scanning calorimetry analysis spectrum (DSC diagram) of the phosphate crystal form A of the compound of formula I, onset is 200-225°C, preferably 200-220°C, more preferably 205-220°C, more preferably 210-220°C, more preferably 210-215°C, and most preferably 213.8°C

[0082] In another preferred embodiment, the differential scanning calorimetry analysis spectrum of the phosphate crystal form A of the compound of formula I is substantially as follows Fig.12 shown.

[0083] In another preferred embodiment, the differential scanning calorimetry analysis spectrum of the phosphate crystal form A of the compound of formula I is as follows Fig.12 shown.

[0084] In another preferred embodiment, the nuclear magnetic resonance hydrogen spectrum of the phosphate crystal form A of the compound of formula I ( 1 H-NMR) spectrum is basically as Fig.13 shown.

[0085] In another preferred embodiment, the nuclear magnetic resonance hydrogen spectrum of the phosphate crystal form A of the compound of formula I ( 1 H-NMR) spectrum Fig.13 shown.

[0086] In another preferred example, in the phosphate crystal form A of the compound of formula I, the molar ratio of the compound of formula I to phosphoric acid is 1:2.

[0087] In a fifth aspect, the present invention provides a method for preparing the phosphate crystal form A of the compound of formula I according to the fourth aspect of the present invention, wherein the method comprises:

[0088] (1) mixing the compound of formula I with an organic solvent to obtain an alkaline solution;

[0089] (2) mixing H3PO4 with an organic solvent to obtain an acid solution;

[0090] (3) mixing the alkaline solution of step (1) and the acid solution of step (2), stirring, and separating to obtain the phosphate crystal form A of the compound of formula I.

[0091] In another preferred embodiment, in step (1), the weight volume ratio of the compound of formula I to the organic solvent is (mg:ml) 20-120:1, preferably 30-110:1, more preferably 40-100:1, more preferably 50-90:1, more preferably 60-80:1, more preferably 62-85:1, more preferably 66-72:1, for example 50-80:1, 55-75:1, 60-70:1, 64-68:1, 50-90:1, 60-80:1, 65-78:1, 70-75:1, 66:1 or 72:1.

[0092] In another preferred embodiment, in step (1), the organic solvent comprises isopropyl acetate.

[0093] In another preferred embodiment, in step (2), the organic solvent comprises isopropyl acetate.

[0094] In another preferred embodiment, the molar ratio of H3PO4 in step (2) to the compound of formula I in step (1) is 2-3:1, preferably 2-2.5:1, more preferably 2.1-2.6:1, for example 2.3-2.4:1, 2.3-2.6:1, 2.2:1, or 2.45:1.

[0095] In another preferred embodiment, the volume ratio of the organic solvent in step (1) to the organic solvent in step (2) is 2-15:1, preferably 2-10:1, more preferably 3-10:1, more preferably 5-9:1, for example 2-8:1, 3-7:1, 4-6:1, 7-11:1, 8-10:1, 5:1 or 9:1:1.

[0096] In another preferred embodiment, in step (3), the stirring is performed at room temperature.

[0097] In another preferred embodiment, in step (3), the stirring is carried out at 10-40°C, preferably 15-35°C, more preferably 20-30°C, more preferably 23-27°C, and most preferably 25°C.

[0098] In another preferred embodiment, in step (3), the stirring time is 10-24h, preferably 10-20h, more preferably 12-18h, for example 8-16h, 10-14h, 11-13h, 14-22h, 16-20h, 17-19h, 12h or 18h.

[0099] In another preferred embodiment, step (3) comprises the steps of:

[0100] Add seed crystals to the alkaline solution of step (1) and stir, then add the acid solution of step (2), stir, and separate to obtain the phosphate crystal form A of the compound of formula I.

[0101] In another preferred embodiment, the weight ratio of the seed crystals to the compound of formula I in step (1) is 1:130-250, preferably 1:140-220, more preferably 1:150-210, more preferably 1:160-200, more preferably 1:170-190, more preferably 1:175-185, and most preferably 1:180.

[0102] In another preferred embodiment, the seed crystals are prepared in the same manner as the phosphate form A of the compound of formula I.

[0103] In another preferred embodiment, the seed crystal is prepared by the following method, which comprises:

[0104] (1) mixing the compound of formula I with an organic solvent to obtain an alkaline solution;

[0105] (2) mixing H3PO4 with an organic solvent to obtain an acid solution;

[0106] (3) mixing the alkaline solution of step (1) and the acid solution of step (2), stirring, and separating to obtain seed crystals.

[0107] In another preferred embodiment, the preparation method of the phosphate crystal form A of the compound of formula I comprises:

[0108] (i) Preparation of Seed Crystals

[0109] (i-1) weighing 2950.2 mg of the compound of formula I and mixing it with 45 mL of isopropyl acetate (IPAc) at 25° C. to obtain an alkaline solution;

[0110] (i-2) 1067 μL of 15M H3PO4 (the molar ratio of H3PO4 to the compound of formula I in step (i-1) is 2.2:1) was measured at 25° C., and 5 mL of isopropyl acetate (IPAc) was added to dilute the mixture to obtain an acid solution;

[0111] (i-3) adding the acid solution prepared in step (i-2) to the alkali solution prepared in step (i-1) while stirring, stirring at 25° C. for 12 h to obtain a suspension, filtering the reaction solution under reduced pressure, drying the filter cake under vacuum at 25° C. for 24 h, and collecting the solid to obtain seed crystals;

[0112] (ii) Preparation of Phosphate Crystalline Form A of the Compound of Formula I

[0113] (ii-1) weighing 3591.7 mg of the compound of formula I and mixing it with 50 mL of isopropyl acetate (IPAc) at 25° C. to obtain an alkaline solution;

[0114] (ii-2) 1447 μL of 15M H3PO4 (the molar ratio of H3PO4 to the compound of formula I in step (ii-1) is 2.45:1) was measured and placed in a bottle at 25° C., and 10 mL of isopropyl acetate (IPAc) was added to dilute the mixture to obtain an acid solution;

[0115] (ii-3) To the alkaline solution prepared in step (ii-1), 20.0 mg of the seed crystals prepared in step (i) were added, and the mixture became slightly turbid after stirring at 25°C for 10 min. Then, the acid solution prepared in step (ii-2) was added dropwise at 25°C while stirring. After the addition of the acid solution was completed, the reaction solution was a light yellow suspension. After continuing to stir at 25°C for 18 h, the reaction solution was filtered under reduced pressure and washed three times with 10 mL of isopropyl acetate (IPAc). The filter cake was vacuum dried at 25°C for 24 h, and the solid was collected to obtain the phosphate crystal form A of the compound of formula I.

[0116] The sixth aspect of the present invention provides a composition, which comprises (a) a compound of formula I as described in the first aspect of the present invention, or a pharmaceutically acceptable salt thereof; or a crystalline form B of the compound of formula I as described in the second aspect of the present invention, or a phosphate crystalline form A of the compound of formula I as described in the fourth aspect of the present invention.

[0117] In another preferred embodiment, the composition is a pharmaceutical composition.

[0118] In another preferred embodiment, the composition further comprises a pharmaceutically acceptable carrier.

[0119] In another preferred embodiment, the dosage form of the composition is a solid preparation, a liquid preparation or a semisolid preparation.

[0120] In another preferred embodiment, the composition is in the form of an oral preparation, an external preparation or an injection preparation.

[0121] In another preferred embodiment, the composition is in the form of tablets, injections, infusions, ointments, gels, solutions, microspheres or films.

[0122] In the seventh aspect of the present invention, there is provided a use of a compound of formula I as described in the first aspect of the present invention, or a pharmaceutically acceptable salt thereof; or a crystalline form B of a compound of formula I as described in the second aspect of the present invention, or a phosphate crystalline form A of a compound of formula I as described in the fourth aspect of the present invention, for preparing a composition or preparation for preventing and / or treating tumors.

[0123] In another preferred embodiment, the tumor is a human tumor.

[0124] In another preferred embodiment, the tumor includes a tumor with low expression, no expression, low activity or no activity of the mitochondrial membrane permeability transition pore.

[0125] In another preferred embodiment, the tumor includes a tumor with low expression, no expression, low activity or no activity of peptidyl prolyl isomerase F.

[0126] In another preferred embodiment, the protein number of peptidyl prolyl isomerase F is UniProtKB / Swiss-Prot: P30405, and the gene number is NCBI Entrez Gene: 10105.

[0127] In another preferred example, the low expression or low activity of the mitochondrial membrane permeability transition pore refers to a ratio (H1 / H0) of the expression level or activity level H1 of the mitochondrial membrane permeability transition pore of tumor cells to the expression level or activity level H0 of the mitochondrial membrane permeability transition pore in the same type of cells or normal cells <1.0, preferably ≤0.8, more preferably ≤0.7, more preferably ≤0.6, more preferably ≤0.5, more preferably ≤0.4, more preferably ≤0.3, more preferably ≤0.2, more preferably ≤0.1, more preferably ≤0.05, more preferably ≤0.01, more preferably ≤0.005, more preferably ≤0.001, more preferably ≤0.0001, more preferably ≤0.00001, more preferably ≤0.000001, more preferably ≤0.0000001.

[0128] In another preferred embodiment, the same type of cells include the same type of tumor cells.

[0129] In another preferred embodiment, the same type of cells include the same type of tumor cells with normal expression, high expression, normal activity or high activity of mitochondrial membrane permeability transition pore.

[0130] In another preferred embodiment, the normal cells include normal tissue cells with normal expression or normal activity of mitochondrial membrane permeability transition pore.

[0131] In another preferred embodiment, the low expression or low activity of peptidyl prolyl isomerase F refers to that the ratio of the expression level or activity level C1 of peptidyl prolyl isomerase F in tumor cells to the expression level or activity level C0 of peptidyl prolyl isomerase F in the same type of cells or normal cells (C1 / C0) is <1.0, preferably ≤0.8, more preferably ≤0.7, more preferably ≤0.6, more preferably ≤0.5, more preferably ≤0.4, more preferably ≤0.3, more preferably ≤0.2, more preferably ≤0.1, more preferably ≤0.05, more preferably ≤0.01, more preferably ≤0.005, more preferably ≤0.001, more preferably ≤0.0001, more preferably ≤0.00001, more preferably ≤0.000001, more preferably ≤0.0000001.

[0132] In another preferred embodiment, the same type of cells include the same type of tumor cells.

[0133] In another preferred embodiment, the cells of the same type include tumor cells of the same type in which peptidyl prolyl isomerase F is normally expressed, highly expressed, normally active or highly active.

[0134] In another preferred embodiment, the normal cells include normal tissue cells in which peptidyl prolyl isomerase F is normally expressed or has normal activity.

[0135] In another preferred embodiment, the mitochondrial membrane permeability transition pore inhibitor is administered to make the mitochondrial membrane permeability transition pore of the tumor low-expressed, non-expressed, low-active or inactive.

[0136] In another preferred embodiment, the mitochondrial membrane permeability transition pore inhibitor includes an inhibitor that can cause low expression, no expression, low activity or no activity of the mitochondrial membrane permeability transition pore of the tumor.

[0137] In another preferred embodiment, the peptidyl prolyl isomerase F inhibitor is administered so that the peptidyl prolyl isomerase F inhibitor of the tumor is under-expressed, not expressed, has low activity or is inactive.

[0138] In another preferred embodiment, the peptidyl prolyl isomerase F inhibitor includes an inhibitor that can cause low expression, no expression, low activity or no activity of peptidyl prolyl isomerase F in tumors.

[0139] In another preferred embodiment, the inhibitor comprises a specific inhibitor.

[0140] In another preferred embodiment, the mitochondrial membrane permeability transition pore inhibitor is selected from the following group: Cyclosporin A, CyP-D protein inhibitor, peroxide scavenger, or a combination thereof.

[0141] In another preferred embodiment, the tumor includes a tumor in which the NNMT gene is lowly expressed or not expressed.

[0142] In another preferred embodiment, the tumor includes a tumor with high expression of DNMT1.

[0143] In another preferred embodiment, the NNMT gene is a human NNMT gene.

[0144] In another preferred embodiment, the tumor with low or no NNMT gene expression means that no NNMT protein can be detected by NNMT antibody in 1 μg protein extracted from the tumor, more preferably, no NNMT protein can be detected by NNMT antibody in 5 μg protein extracted from the tumor, more preferably, no NNMT protein can be detected by NNMT antibody in 10 μg protein extracted from the tumor, more preferably, no NNMT protein can be detected by NNMT antibody in 100 μg protein extracted from the tumor, and more preferably, no NNMT protein can be detected by NNMT antibody in 1000 μg protein extracted from the tumor.

[0145] In another preferred embodiment, the low expression or non-expression of the NNMT gene refers to that the ratio of the expression E1 of the NNMT gene in tumor cells to the expression E0 of the NNMT gene in the same type of cells or normal cells (E1 / E0) is <1.0, preferably ≤0.7, more preferably ≤0.6, more preferably ≤0.5, more preferably ≤0.4, more preferably ≤0.3, more preferably ≤0.2, more preferably ≤0.1, more preferably ≤0.05, more preferably ≤0.01, more preferably ≤0.005, more preferably ≤0.001, more preferably ≤0.0001, more preferably ≤0.00001, more preferably ≤0.000001, more preferably ≤0.0000001.

[0146] In another preferred embodiment, the same type of cells include the same type of tumor cells.

[0147] In another preferred embodiment, the same type of cells include the same type of tumor cells in which the NNMT gene is normally expressed or highly expressed.

[0148] In another preferred embodiment, the normal cells include normal tissue cells.

[0149] In another preferred embodiment, the tumor with high DNMT1 expression refers to a tumor in which DNMT1 protein can be detected by DNMT1 antibody detection in 20 μg protein extracted from the tumor, more preferably, DNMT1 protein can be detected by DNMT1 antibody detection in 5 μg protein extracted from the tumor, more preferably, DNMT1 protein can be detected by DNMT1 antibody detection in 1 μg protein extracted from the tumor, more preferably, DNMT1 protein can be detected by DNMT1 antibody detection in 0.2 μg protein extracted from the tumor, more preferably, DNMT1 protein can be detected by DNMT1 antibody detection in 0.05 μg protein extracted from the tumor, and more preferably, DNMT1 protein can be detected by DNMT1 antibody detection in 0.01 μg protein extracted from the tumor.

[0150] In another preferred embodiment, the tumor with high expression of DNMT1 refers to a ratio (B1 / B0) of the expression level B1 of DNMT1 in tumor cells to the expression level B0 of DNMT1 in the same type of cells or normal cells>1.0, preferably ≥1.2, preferably ≥1.5, more preferably ≥2, more preferably ≥3, more preferably ≥5, more preferably ≥8, more preferably ≥10, more preferably ≥15, more preferably ≥20, more preferably ≥30, more preferably ≥50, for example 2-50.

[0151] In another preferred embodiment, the same type of cells include the same type of tumor cells.

[0152] In another preferred embodiment, the cells of the same type include tumor cells of the same type with normal or low expression of DNMT1.

[0153] In another preferred embodiment, the normal cells include normal tissue cells.

[0154] In another preferred embodiment, the NNMT gene of the tumor is under-expressed or not expressed by administering an NNMT gene inhibitor.

[0155] In another preferred embodiment, the DNMT1 promoter is administered to achieve high expression of DNMT1 in the tumor.

[0156] In another preferred embodiment, the inhibitor comprises a specific inhibitor.

[0157] In another preferred embodiment, the promoter comprises a specific promoter.

[0158] In another preferred embodiment, the NNMT gene inhibitor includes an inhibitor that can cause low expression or no expression of the NNMT gene in a tumor.

[0159] In another preferred embodiment, the DNMT1 promoter includes a promoter capable of causing high expression of DNMT1 in tumors.

[0160] In another preferred embodiment, the tumor is selected from the group consisting of lung cancer, kidney cancer, breast cancer, colon cancer, lymphoma, leukemia, pancreatic cancer, brain tumor, liver cancer, prostate cancer, or a combination thereof.

[0161] In another preferred embodiment, the lung cancer is selected from the group consisting of non-small cell lung cancer, small cell lung cancer, or a combination thereof.

[0162] In another preferred embodiment, the lung cancer cells include NCI-H82 cells.

[0163] In another preferred embodiment, the brain tumor is selected from the group consisting of glioblastoma, glioma, medulloblastoma, neuroblastoma, or a combination thereof.

[0164] In another preferred embodiment, the brain tumor cells include Daoy cells.

[0165] In another preferred embodiment, the expression includes protein expression and / or mRNA expression.

[0166] In another preferred embodiment, the level includes protein level and / or mRNA level.

[0167] In another preferred embodiment, the composition or preparation is a pharmaceutical composition or pharmaceutical preparation.

[0168] In another preferred embodiment, the composition or preparation further comprises a pharmaceutically acceptable carrier.

[0169] In another preferred embodiment, the composition or preparation is in the form of a solid preparation, a liquid preparation or a semisolid preparation.

[0170] In another preferred embodiment, the composition or preparation is in the form of an oral preparation, an external preparation or an injection preparation.

[0171] In another preferred embodiment, the injection preparation is an intravenous injection preparation.

[0172] In an eighth aspect, the present invention provides a method for preventing and / or treating tumors, the method comprising administering to a subject in need thereof a compound of formula I as described in the first aspect of the present invention, or a pharmaceutically acceptable salt thereof; or Form B of the compound of formula I as described in the second aspect of the present invention, or Form A of the phosphate salt of the compound of formula I as described in the fourth aspect of the present invention, thereby preventing and / or treating tumors.

[0173] In another preferred embodiment, the tumor is as described in the seventh aspect of the present invention.

[0174] In another preferred embodiment, the subject is a human or non-human mammal (rodent, rabbit, monkey, livestock, dog, cat, etc.).

[0175] In another preferred embodiment, the method comprises the steps of:

[0176] First, the mitochondrial membrane permeability transition pore of the subject's tumor is low-expressed, no-expressed, low-active or no-active, peptidyl prolyl isomerase F is low-expressed, no-expressed, low-active or no-active, NNMT gene is low-expressed or no-expressed, and / or DNMT1 is highly expressed, and then the compound of formula I, or a pharmaceutically acceptable salt thereof; or the crystalline form B of the compound of formula I, or the phosphate crystalline form A of the compound of formula I is administered to prevent and / or treat tumors.

[0177] In another preferred embodiment, the method comprises the steps of:

[0178] The subject is first administered a mitochondrial membrane permeability transition pore inhibitor, a peptidyl prolyl isomerase F inhibitor, a NNMT gene inhibitor, and / or a DNMT1 promoter, so that the mitochondrial membrane permeability transition pore of the subject's tumor is low-expressed, no-expressed, low-active or no-active, the peptidyl prolyl isomerase F is low-expressed, no-expressed, low-active or no-active, the NNMT gene is low-expressed or no-expressed, and / or DNMT1 is highly expressed, and then the compound of formula I, or a pharmaceutically acceptable salt thereof; or the crystalline form B of the compound of formula I, or the phosphate crystalline form A of the compound of formula I is administered to prevent and / or treat tumors.

[0179] In another preferred embodiment, the mitochondrial membrane permeability transition pore inhibitor, peptidyl prolyl isomerase F inhibitor, NNMT gene inhibitor, and / or DNMT1 promoter are as described in the seventh aspect of the present invention.

[0180] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0181] Figure 1 The expression level of PPIF protein was determined by western blot, wherein Con shRNA is the expression level of PPIF protein in Daoy cells transfected with an empty viral vector without shRNA that specifically induces degradation of PPIF mRNA, and PPIF shRNA is the expression level of PPIF protein in Daoy cells transfected with a viral vector carrying shRNA that specifically induces degradation of PPIF mRNA.

[0182] Figure 2 It is the relative cell viability of Daoy cells with inactive mPTP and Daoy cells with active mPTP, wherein ConshRNA is the relative viability of Daoy cells transfected with an empty viral vector without shRNA that specifically induces degradation of PPIF mRNA, and PPIF shRNA is the relative viability of Daoy cells transfected with a viral vector carrying shRNA that specifically induces degradation of PPIF mRNA.

[0183] Figure 3Western Blot experiment was used to detect the expression level of NNMT protein in Con-NCI-H82 cells and ov-NNMT NCI-H82 cells, wherein Con-NCI-H82 is the expression level of NNMT protein in NCI-H82 cells transfected with an empty viral vector without NNMT gene and shRNA, serving as a control; ov-NNMT NCI-H82 is the expression level of NNMT protein in NCI-H82 cells transfected with a viral vector carrying the NNMT gene.

[0184] Figure 4 Western Blot experiment was used to detect the expression level of DNMT1 protein in Con-NCI-H82 cells and sh-DNMT1 NCI-H82 cells, wherein Con-NCI-H82 is the expression level of DNMT1 protein in NCI-H82 cells transfected with an empty viral vector without NNMT gene and shRNA, serving as a control; sh-DNMT1 NCI-H82 is the expression level of DNMT1 protein in NCI-H82 cells transfected with a viral vector carrying shRNA.

[0185] Figure 5 It is the relative cell viability of Con-NCI-H82 cells and ov-NNMT NCI-H82 cells, wherein Con-NCI-H82 is the cell viability of NCI-H82 cells transfected with an empty viral vector without NNMT gene and shRNA, serving as a control; ov-NNMT NCI-H82 is the cell viability of NCI-H82 cells transfected with a viral vector carrying the NNMT gene.

[0186] Figure 6 is the relative cell viability of Con-NCI-H82 cells and sh-DNMT1 NCI-H82 cells, wherein Con-NCI-H82 is the cell viability of NCI-H82 cells transfected with an empty viral vector without NNMT gene and shRNA, serving as a control; sh-DNMT1 NCI-H82 is the cell viability of NCI-H82 cells transfected with a viral vector carrying shRNA.

[0187] Figure 7 This is the X-ray powder diffraction (XRPD) pattern of compound SJ001 prepared in Example 1.

[0188] Figure 8 This is the thermogravimetric analysis (TGA) diagram of compound SJ001 prepared in Example 1.

[0189] Fig. 9 This is the Differential Scanning Calorimeter (DSC) diagram of compound SJ001 prepared in Example 1.

[0190] Fig.10 X-ray powder diffraction (XRPD) pattern of the phosphate crystal form A of compound SJ001 prepared in Example 9

[0191] Fig.11 Thermogravimetric analysis (TGA) diagram of the phosphate crystal form A of compound SJ001 prepared in Example 9.

[0192] Fig.12 This is a Differential Scanning Calorimeter (DSC) diagram of the phosphate crystal form A of compound SJ001 prepared in Example 9.

[0193] Fig.13 The phosphate crystal form A of compound SJ001 prepared in Example 9 1 H-NMR spectrum. DETAILED DESCRIPTION

[0194] After long and in-depth research, the inventors unexpectedly discovered for the first time that the compounds of the present invention have excellent precision treatment effects on tumor cells with low expression, no expression, low activity or no activity of mitochondrial membrane permeability transition pore, low expression, no expression, low activity or no activity of peptidyl prolyl isomerase F, low expression or no expression of NNMT gene, and / or high expression of DNMT1. The present invention also provides a crystal form of a compound of formula I and its phosphate, in particular, the phosphate crystal form A of the compound of formula I has more excellent thermal stability and solubility, and good drugability. On this basis, the inventors completed the present invention.

[0195] the term

[0196] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0197] As used herein, the terms "include", "comprises", and "comprising" are used interchangeably, and include not only open definitions, but also semi-closed and closed definitions. In other words, the terms include "consisting of", "consisting essentially of".

[0198] As used herein, the terms "cancer," "cancer," "tumor," and "neoplasm" are used interchangeably.

[0199] As used herein, the term "a cell" refers to a cell (such as a single cancer cell) or a group of cells comprising a plurality of similar cells (such as a tumor tissue).

[0200] As used herein, the term "IC50" is synonymous with "IC 50 ” can be used interchangeably and refers to the 50% inhibitory concentration, which is the concentration of the inhibitor that achieves 50% inhibition.

[0201] As used herein, the term "mitochondrial membrane permeability transition pore" is abbreviated as mPTP (mitochondria permeability transition pore).

[0202] As used herein, the term "peptidyl-prolyl isomerase F" is abbreviated as PPIF (Peptidyl-prolyl cis-transisomerase F).

[0203] As used herein, the term "NNMT" is the English name of Nicotinamide N-Methyltransferase.

[0204] As used herein, the term "DNMT1" refers to DNA methyltransferase 1.

[0205] As used herein, the term "bp" refers to base pair.

[0206] As used herein, the term "deuterated" refers to a compound or group in which one or more hydrogen atoms are replaced by deuterium. Deuterated atoms may be monosubstituted, disubstituted, polysubstituted or fully substituted.

[0207] As used herein, the term "solvate" refers to a complex in which a compound is coordinated with solvent molecules to form a specific ratio.

[0208] As used herein, the term "MS-ESI" refers to electrospray ionization mass spectrometry.

[0209] As used herein, the term “ 1 "H NMR" refers to hydrogen nuclear magnetic resonance.

[0210] In the present invention, the term "prevention" refers to a method of preventing the onset of a disease and / or its attendant symptoms or protecting a subject from acquiring a disease.

[0211] In the present invention, the term "treatment" includes delaying and stopping the progression of the disease, or eliminating the disease, and does not require 100% inhibition, elimination and reversal. In some embodiments, compared to the levels observed in the absence of the compound described in the present invention, the compound described in the present invention reduces, inhibits and / or reverses the relevant disease (such as tumor) and its complications by, for example, at least about 30%, at least about 50%, or at least about 80%, at least about 90%, or 100%.

[0212] Compound

[0213] The structure of the compound of formula I of the present invention is as follows:

[0214]

[0215] Crystal form

[0216] The present invention also provides a crystalline form B of the compound of formula I.

[0217] Specifically, the crystalline form B of the compound of formula I described in the present invention is as described above in the second aspect of the present invention.

[0218] The present invention also provides a phosphate crystal form A of the compound of formula I.

[0219] Specifically, the phosphate crystal form A of the compound of formula I described in the present invention is as described above in the fourth aspect of the present invention.

[0220] Mitochondrial permeability transition pore

[0221] In the present invention, the English name of mitochondrial membrane permeability transition pore is mitochondria permeability transition pore, abbreviated as mPTP.

[0222] Peptidylprolyl isomerase F

[0223] In the present invention, the English name of peptidyl prolyl isomerase F is Peptidyl-prolyl cis-transisomerase F, abbreviated as PPIF.

[0224] NNMT gene

[0225] In the present invention, the English name of NNMT is Nicotinamide N-Methyltransferase, and different databases have different identification numbers for the NNMT gene: HGNC: 7861; Entrez Gene: 4837; Ensembl: ENSG00000166741; OMIM: 600008; UniProtKB: P40261.

[0226] According to the human genome version GCF_000001405.25 (GRCh37.p13), the NNMT gene region is located on human chromosome 11 from bp 114,128,528 to bp 114,184,258, with a total length of 55,731 bp of DNA sequence, including the NNMT gene promoter region, NNMT gene exon region and NNMT gene intron region.

[0227] Tumor

[0228] In the present invention, the terms "tumor", "cancer", "cancer" and "neoplasm" are used interchangeably.

[0229] More specifically, the tumor described in the present invention is as described above in the seventh aspect of the present invention.

[0230] use

[0231] The compounds of the present invention have a significant and excellent precision treatment effect on tumors with low expression, no expression, low activity or no activity of mitochondrial membrane permeability transition pore, low expression, no expression, low activity or no activity of peptidyl prolyl isomerase F, low expression or no expression of NNMT gene, and / or high expression of DNMT1, that is, tumors with low expression, no expression, low activity or no activity of mitochondrial membrane permeability transition pore, low expression, no expression, low activity or no activity of peptidyl prolyl isomerase F, low expression or no expression of NNMT gene, and / or high expression of DNMT1 are highly sensitive to the compounds of the present invention, and in the process of preventing and / or treating tumors, the mitochondrial membrane permeability transition pore inhibitor, peptidyl prolyl isomerase F can be first administered to the subject. Enzyme F inhibitor, NNMT gene inhibitor, and / or DNMT1 promoter, so that the mitochondrial membrane permeability transition pore of the object's tumor is low-expressed, no-expressed, low-active or inactive, peptidyl prolyl isomerase F is low-expressed, no-expressed, low-active or inactive, NNMT gene is low-expressed or not expressed, and / or DNMT1 is highly expressed, and then the compound of the present invention is administered to prevent and / or treat the tumor, thereby significantly enhancing the therapeutic effect of the compound of the present invention on the tumor. Therefore, the present invention has developed a compound that can be used in combination with a mitochondrial membrane permeability transition pore inhibitor, a peptidyl prolyl isomerase F inhibitor, a NNMT gene inhibitor, and / or a DNMT1 promoter to significantly enhance the anti-tumor effect. The compound of the present invention can be used in combination with a mitochondrial membrane permeability transition pore inhibitor, a peptidyl prolyl isomerase F inhibitor, a NNMT gene inhibitor, and / or a DNMT1 promoter to significantly enhance the therapeutic effect of the compound of the present invention on the tumor.

[0232] Composition

[0233] The composition or preparation of the present invention is preferably a pharmaceutical composition or pharmaceutical preparation, and the composition or preparation of the present invention may include a pharmaceutically acceptable carrier.

[0234] As used herein, "pharmaceutically acceptable carrier" refers to one or more compatible solid, semisolid, liquid or gel fillers that are suitable for human or animal use and must have sufficient purity and sufficiently low toxicity. "Compatibility" refers to the components and active ingredients in the composition or preparation and the ability for them to be mixed with each other without significantly reducing the efficacy.

[0235] It should be understood that in the present invention, the pharmaceutically acceptable carrier is not particularly limited, and can be selected from materials commonly used in the art, or prepared by conventional methods, or purchased from the market. Some examples of pharmaceutically acceptable carriers include cellulose and its derivatives, gelatin, talcum powder, vegetable oil, polyols, thickeners, pH regulators, stabilizers, antioxidants, preservatives, antibacterial agents, pyrogen-free water, etc.

[0236] In a preferred embodiment of the present invention, the composition or preparation is in the form of a solid preparation, a liquid preparation or a semisolid preparation.

[0237] In a preferred embodiment of the present invention, the composition or preparation is in the form of an oral preparation, an external preparation or an injection preparation.

[0238] Typically, the composition or preparation is in the form of a tablet, injection, infusion, ointment, gel, solution, microsphere or film.

[0239] The main excellent technical effects of the present invention include:

[0240] 1. The present invention unexpectedly discovered for the first time a compound that has excellent precision therapeutic effects on tumors with low expression, no expression, low activity or no activity of the mitochondrial membrane permeability transition pore, low expression, no expression, low activity or no activity of peptidyl prolyl isomerase F, low expression or no expression of the NNMT gene, and / or high expression of DNMT1, that is, tumors with low expression, no expression, low activity or no activity of the mitochondrial membrane permeability transition pore, low expression, no expression, low activity or no activity of peptidyl prolyl isomerase F, low expression or no expression of the NNMT gene, and / or high expression of DNMT1 have high drug sensitivity to the compounds of the present invention. Therefore, the compounds described in the present invention can be used for the precision treatment of tumors with low expression, no expression, low activity or no activity of mitochondrial membrane permeability transition pore, low expression, no expression, low activity or no activity of peptidyl prolyl isomerase F, low expression or no expression of NNMT gene, and / or high expression of DNMT1, thereby improving the therapeutic effect of the compounds described in the present invention, avoiding the administration of the compounds of the present invention to tumor patients who are insensitive to them, reducing the dosage and side effects of the drugs, and improving patient compliance.

[0241] 2. The present invention also provides a crystal form of a compound of formula I and its phosphate. In particular, the phosphate crystal form A of the compound of formula I described in the present invention has more excellent thermal stability and solubility, and has significant advantages in drug formulation. For example, the excellent thermal stability of the crystal form can improve the stability of the drug during high production, transportation and storage, and reduce the cost during production, transportation and storage, thereby effectively improving the quality of the drug and ensuring the safety of medication; the excellent solubility of the crystal form can enable the drug to maintain a high-concentration solution state in the gastrointestinal tract, promote oral absorption of the drug, and improve oral bioavailability. The excellent solubility of the crystal form can also make the drug suitable for the preparation of injections, so that the therapeutic effect of the drug can be quickly exerted, etc.

[0242] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only intended to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods for which specific conditions are not specified in the following examples are usually performed under conventional conditions or under conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are calculated by weight.

[0243] Example

[0244] The English name of mitochondrial membrane permeability transition pore is mitochondria permeability transition pore, abbreviated as mPTP

[0245] The English name of peptidyl prolyl isomerase F is Peptidyl-prolyl cis-trans isomerase F, abbreviated as PPIF.

[0246] The English name of NNMT gene is Nicotinamide N-Methyltransferase.

[0247] DNMT1 refers to DNA methyltransferase 1, whose English name is DNA methyltransferase 1, NCBI entrezgene: 1786; Uniprotkb / Swiss-port: P26358.

[0248] Example 1 Synthesis of Compound SJ001

[0249] The structural formula of compound SJ001 is as follows:

[0250]

[0251] The synthesis method of compound SJ001 is as follows:

[0252]

[0253] Compound 1 (200 mg, 0.54 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and cyclopentylmagnesium bromide (2.7 mL, 2.7 mmol, 5 eq, 1 M) was slowly added dropwise at 0°C under nitrogen protection, and the mixture was reacted at room temperature for 0.5 h. The reaction was completed after LCMS monitoring, and the mixture was quenched with saturated aqueous ammonium chloride solution, extracted with ethyl acetate, and the organic phase was dried over anhydrous sodium sulfate and filtered. The organic phase was spin-dried, and the crude product was subjected to thin layer chromatography (DCM: MeOH = 30: 1) to obtain compound SJ001.

[0254] MS-ESI: theoretical value [M+H] + :406.20, measured value:406.20.

[0255] 1 H NMR (400MHz, DMSO-d6) δ7.20(s,1H),6.79(d,J=8.0Hz,1H),6.73(s,1H),6.64(d,J=8.0Hz,1H),5.96(s,2H),5.87(s, 1H), 4.51 (d, J = 8.0Hz, 1H), 3.72 (s, 6H), 3.41-3.35 (m, 2H), 2.86-2.63 (m, 2H), 2.17-2.15 (m, 1H), 1.55-1.15 (m, 8H).

[0256] Example 2 Synthesis of Compound SJ002

[0257]

[0258] The synthesis method of compound SJ002 is as follows:

[0259]

[0260] In a sealed tube, compound 1 (372 mg, 1 mmol, 1 eq) was dissolved in acetone (5 mL), 4N sodium hydroxide solution (2 mL) was added, and the mixture was reacted at room temperature for 1 h. The solid was filtered and washed with water. The crude product was flash chromatographed (dichloromethane: methanol = 50: 1) to give compound SJ002.

[0261] MS-ESI: theoretical value [M+H] + :394.16; Measured value: 394.10.

[0262] 1H NMR (400MHz, CDCl3) δ7.25 (s, 1H), 6.87-6.70 (m, 3H), 6.00 (d, J = 4.0Hz, 3H), 6.22-6.19 (m, 1H), 3.76 (d, J=4.0Hz,6H),3.27-3.18(m,2H),2.96-2.90(m,1H),2.80-2.69(m,2H),2.32-2.27(m,1H),2.03(s,3H).

[0263] Example 3 Synthesis of Compound SJ003

[0264]

[0265] The synthesis method of compound SJ003 is as follows:

[0266]

[0267] Compound 2 (1.3 g, 8.23 ​​mmol, 4.0 eq) was dissolved in tetrahydrofuran (10 mL), and isopropyl magnesium chloride solution (5 mL, 10.3 mmol, 5.0 eq, 2 M in THF) was added at 0°C. After reacting for 30 min, compound 1 (766 mg, 2.06 mmol, 1.0 eq) was added and reacted at room temperature for 1 h. The reaction solution was quenched with saturated aqueous ammonium chloride solution and extracted with ethyl acetate. The organic phase was dried over anhydrous sodium sulfate, filtered and the filtrate was dried by spin drying. The crude product was prepared using normal phase (dichloromethane / methanol = 0%-2%) to obtain compound SJ003.

[0268] MS-ESI: Theoretical value [M] + :415.16; measured value:415.10.

[0269] 1 H NMR(400MHz,DMSO-d6)δ8.44-8.42(m,2H),7.31-7.28(m,3H),6.91-6.79(m,2H),6.74(s,1H),6.00(s ,3H),5.75(s,1H),3.75(s,3H),3.61(s,3H),3.41-3.36(m,1H),2.94-2.87(m,1H),2.79-2.71(m,2H).

[0270] Example 4 Synthesis of Compound SJ004

[0271]

[0272] The synthesis method of compound SJ004 is as follows:

[0273] Step (1):

[0274]

[0275] Compound 1 (1 g, 2.69 mmol, 1.0 eq) was dissolved in tetrahydrofuran (20 mL), and cyclopentylmagnesium bromide (13.5 mL, 13.45 mmol, 5.0 eq, 1 M in THF) was added at 0°C, and the reaction was carried out at room temperature for 1 h. The reaction solution was quenched with saturated aqueous ammonium chloride solution, and the organic phase was separated by extraction with ethyl acetate. The organic phase was dried over anhydrous sodium sulfate, filtered, and the filtrate was dried by rotary evaporation. The crude product was subjected to flash chromatography (dichloromethane / methanol = 0-5%) to obtain compound 3.

[0276] Step (2):

[0277]

[0278] Compound 2 (500 mg, 1.23 mmol, 1.0 eq) was dissolved in methanol (50 mL), sodium borohydride (93 mg, 2.46 mmol, 2.0 eq) was added at 0°C, and the reaction was allowed to react at room temperature for 1 h. The reaction solution was quenched with saturated aqueous ammonium chloride solution, and the organic phase was separated by extraction with ethyl acetate. The organic phase was dried over anhydrous sodium sulfate, filtered, and the filtrate was dried by rotary evaporation. The crude product was prepared using reverse phase (acetonitrile / water + 0.1% formic acid) to obtain compound SJ004.

[0279] MS-ESI and 1 H NMR is as follows:

[0280] MS-ESI: theoretical value [M+H] + :408.21; measured value:408.00.

[0281] 1 H NMR(400MHz,DMSO-d6)δ6.93(s,1H),6.90-6.82(m,2H),6.63(s,1H),5.91 (s,2H),4.00(d,J=4.0Hz,1H),3.75(s,3H),3.70(s,3H),3.28-3.25(m,2H ),3.07-2.94(m,2H),2.74-2.71(m,1H),2.70-2.68(m,1H),2.52-2.47(m, 1H),2.44-2.40(m,1H),1.99-1.94(m,2H),1.57-1.27(m,5H),0.95(s,1H).

[0282] Example 5 Synthesis of Compound SJ005

[0283]

[0284] The synthesis method of compound SJ005 is as follows:

[0285]

[0286] Compound 1 (400 mg, 1.07 mmol, 2.0 eq) was dissolved in methanol (10 mL), and 1N sodium hydroxide solution (1 mL) was added. After reacting for 0.5 h, the solid was filtered out, and cyclohexanone (1 mL) was added to the filtrate. The reaction was carried out at room temperature for 1 h. The solid was filtered and washed with methanol, and dried to obtain compound SJ005.

[0287] MS-ESI: theoretical value [M+H] + :434.19; measured value:434.15.

[0288] 1 H NMR (400MHz, DMSO-d6) δ7.15 (s, 1H), 6.81 (d, J = 8.0Hz, 1H), 6.70 (s, 1H), 6.62 (d,J=8.0Hz,1H),5.95(s,2H),5.73(s,1H),5.57(s,1H),3.72(s,3H),3.69(s, 3H),3.23-3.18(m,1H),3.05-3.03(m,1H),2.66-2.59(m,2H),2.26-2.15(m,3H ),1.95-1.93(m,1H),1.78-1.76(m,1H),1.61-1.59(m,1H),1.48-1.35(m,3H).

[0289] Example 6

[0290] Investigate the activity of mitochondrial permeability transition pore in relevant cells

[0291] Experimental background: The mitochondrial permeability transition pore (mPTP) is a non-specific channel on the inner membrane of mitochondria that allows small molecules with a molecular weight less than 1.5KD to pass freely. Its activity is affected by peroxides (such as H2O2), pH, and calcium ions in mitochondria. The mitochondrial permeability transition pore of some cells is active, while that of others is inactive. For cells with active mitochondrial permeability transition pores, the addition of peroxides (such as H2O2) will increase the activity of their mitochondrial permeability transition pores, resulting in a decrease in mitochondrial membrane potential; while for cells with inactive mitochondrial permeability transition pores, the addition of peroxides (such as H2O2) has no significant effect on the activity of the mitochondrial permeability transition pore, and the mitochondrial membrane potential has no significant change. Based on this principle, whether the mPTP is active in a specific cell can be determined by measuring the change in the potential difference of the mitochondrial membrane under peroxide stimulation.

[0292] Experimental methods and results: Daoy cells (human medulloblastoma cells, ATCC number HTB-186) were cultured in DMEM medium containing 10% fetal bovine serum and added with P / S. 1.5 μM cyclosporin A (CsA, CsA can effectively inhibit the activity of mitochondrial membrane permeability transition pore) was added to the cell culture medium, and cells without CsA were selected as blank controls. Tetramethylrhodamine (TMRM) was used to detect the level of mitochondrial membrane potential difference. The higher the TMRM fluorescence intensity, the higher the membrane potential difference. The results are shown in Table 1:

[0293] Table 1 Relative TMRM signal intensity of Daoy cells after different treatments (%)

[0294]

[0295] Note: "+" indicates existence, "-" indicates absence.

[0296] As can be seen from Table 1, for normal Daoy cells without CsA added to the culture medium, the membrane potential decreased significantly under the action of H2O2, indicating that the mPTP in Daoy cells is active, while for Daoy cells with CsA added to the culture medium to inhibit the activity of the mitochondrial membrane permeability transition pore (mPTP), the membrane potential did not decrease after the addition of H2O2, indicating that the active mPTP was inhibited by CsA and became inactive, and in this case, H2O2 would not cause a decrease in its membrane potential. Therefore, it can be seen from Table 1 that the mitochondrial membrane permeability transition pore (mPTP) in Daoy cells is active.

[0297] Example 7

[0298] The inhibitory effects of different compounds prepared in the examples of the present invention on the viability of Daoy cells with active mPTP and Daoy cells with inactive mPTP constructed by transfecting shRNA that specifically induces degradation of PPIF mRNA were investigated.

[0299] Peptidyl-prolyl isomerase F is Peptidyl-prolyl cis-trans isomerase F, abbreviated as PPIF. The protein number is UniProtKB / Swiss-Prot: P30405, and the gene number is NCBI Entrez Gene: 10105.

[0300] 1. Construction of Daoy cells with inactive mitochondrial permeability transition pore (mPTP)

[0301] 1.1 Experimental background: The activity of mitochondrial permeability transition pore (mPTP) is regulated by the protein PPIF. When PPIF protein is inhibited, the activity of mPTP is significantly reduced. The activity of PPIF protein is restricted by the expression level of PPIF protein in cells. The expression level of PPIF protein in Daoy cells can be specifically reduced by transfecting shRNA that specifically induces the degradation of PPIF mRNA into Daoy cells, thereby constructing Daoy cells with inactive mitochondrial permeability transition pore (mPTP) (hereinafter referred to as mPTP-inactive Daoy cells).

[0302] 1.2 Experimental methods and results: Through cloning technology, a viral vector carrying shRNA that specifically induces the degradation of PPIF mRNA was obtained. The shRNA sequence carried by the viral vector (nucleotide sequence: GTTCTTCATCTGCACCATAAA (SEQ ID NO: 1)) specifically induces the degradation of PPIF mRNA. Daoy cells were transfected with the viral vector carrying shRNA that specifically induces the degradation of PPIF mRNA, and Daoy cells transfected with an empty viral vector that did not carry shRNA that specifically induces the degradation of PPIF mRNA were used as a control. The expression level of PPIF protein in Daoy cells was detected by western blot technology, and the results are as follows: Figure 1 As shown, from Figure 1 The results showed that PPIF was basically not expressed in Daoy cells transfected with shRNA that specifically induced the degradation of mPTP regulatory protein PPIF mRNA (i.e. Figure 1 In Daoy cells that were not transfected with shRNA that specifically induced the degradation of PPIF mRNA, PPIF was expressed normally (i.e. Figure 1Con shRNA was used as a control). The activity of mitochondrial membrane permeability transition pore in Daoy cells transfected with an empty viral vector without shRNA that specifically induces degradation of PPIF mRNA and Daoy cells transfected with a viral vector that specifically induces degradation of PPIF mRNA was determined according to the method of Example 6 above. Tetramethylrhodamine (TMRM) was used to detect the level of mitochondrial membrane potential difference. The higher the TMRM fluorescence intensity, the higher the membrane potential difference. The results are shown in Tables 2 and 3: Table 2 Relative TMRM signal intensity (%) of Daoy cells transfected with an empty viral vector without shRNA that specifically induces degradation of PPIF mRNA after different treatments

[0303]

[0304] Table 3 Relative TMRM signal intensity (%) of Daoy cells transfected with viral vectors carrying shRNA that specifically induces degradation of PPIF mRNA after different treatments

[0305]

[0306] As can be seen from Tables 2 and 3, the mitochondrial membrane permeability transition pore (mPTP) in Daoy cells transfected with an empty viral vector that does not carry shRNA that specifically induces degradation of PPIF mRNA is active, and the mitochondrial membrane permeability transition pore (mPTP) in Daoy cells transfected with a viral vector that carries shRNA that specifically induces degradation of PPIF mRNA is inactive. Therefore, Daoy cells with inactive mitochondrial membrane permeability transition pore (mPTP) were successfully constructed by transfecting Daoy cells with shRNA that specifically induces degradation of mPTP regulatory protein PPIF mRNA.

[0307] The Promega CellTiter-Glo kit (which reflects cell viability by detecting intracellular ATP content) was used to detect the viability of the Daoy cells with inactive mPTP constructed by transfecting the above-mentioned shRNA that specifically induces degradation of PPIF mRNA and the Daoy cells with active mPTP that were not transfected with shRNA that specifically induces degradation of PPIF mRNA. The results are shown in Figure 2 As shown, from Figure 2 It can be seen that the cell viability of Daoy cells with inactive mPTP constructed by transfecting shRNA that specifically induces degradation of PPIF mRNA is almost the same as that of Daoy cells with active mPTP that are not transfected with shRNA that specifically induces degradation of PPIF mRNA, and there is no statistically significant difference in cell viability.

[0308] 2. Investigating the correlation between the cancer cell inhibition effect of the compounds prepared in the examples of the present invention and the mPTP activity

[0309] 2.1 Experimental background: Promega CellTiter-Glo kit was used, which directly detects the intracellular ATP content to reflect cell viability, and the IC values ​​of the compounds prepared in the examples of the present invention on the mPTP-active Daoy cells that were not transfected with shRNA that specifically induces the degradation of PPIF mRNA and the mPTP-inactive Daoy cells that were transfected with shRNA that specifically induces the degradation of PPIF mRNA were detected. 50 value.

[0310] 2.2 Experimental methods and results: The mPTP-active Daoy cells not transfected with shRNA that specifically induces degradation of PPIF mRNA and the mPTP-inactive Daoy cells transfected with shRNA that specifically induces degradation of PPIF mRNA were cultured in DMEM medium containing 10% fetal bovine serum and supplemented with P / S, and the half-inhibitory dose IC values ​​of different compounds prepared in the examples on these two types of cells were determined. 50 , the experimental results are shown in Table 4:

[0311] Table 4 Inhibitory effects of different compounds prepared in the examples of the present invention on Daoy cells with active mPTP and Daoy cells with inactive mPTP (IC 50 μM)

[0312]

[0313] Note: IC 50 is the half inhibition concentration (50% inhibiting concentration), that is, the concentration of inhibitor compound required to achieve 50% inhibition effect; Daoy cells with active mPTP are Daoy cells transfected with an empty viral vector that does not carry shRNA that specifically induces degradation of PPIF mRNA; Daoy cells with inactive mPTP are Daoy cells transfected with a viral vector that carries shRNA that specifically induces degradation of PPIF mRNA.

[0314] As can be seen from Table 4, the compound SJ001 prepared in the embodiment of the present invention has a significant inhibitory effect on mPTP-inactive Daoy cells, but has a poor inhibitory effect on mPTP-active Daoy cells. Reducing the mPTP activity of Daoy cells can significantly improve the inhibitory effect of the compound SJ001 prepared in the embodiment of the present invention. Therefore, the compound SJ001 prepared in the embodiment of the present invention has a more significant inhibitory effect on mPTP-inactive Daoy cells. The mPTP-inactive Daoy cells are highly sensitive to the compound SJ001 prepared in the embodiment of the present invention. Therefore, the compound SJ001 prepared in the embodiment of the present invention has an excellent precision treatment effect on mPTP-inactive Daoy cells. As described above, when PPIF protein is inhibited, mPTP activity is significantly reduced, and inhibiting the expression level of PPIF protein can reduce the mPTP activity of Daoy cells. Therefore, the compound SJ001 prepared in the embodiment of the present invention has a more significant inhibitory effect on Daoy cells with low expression of PPIF protein, while the inhibitory effect on Daoy cells with normal expression of PPIF protein is poor, which shows that reducing the expression level of PPIF protein can significantly improve the inhibitory effect of the compound SJ001 prepared in the embodiment of the present invention. Therefore, the compound SJ001 prepared in the embodiment of the present invention has a more significant inhibitory effect on Daoy cells with low expression of PPIF protein, that is, compared with Daoy cells with normal expression of PPIF protein, Daoy cells with low expression of PPIF protein are more sensitive to the compound SJ001 prepared in the embodiment of the present invention, and the compound SJ001 prepared in the embodiment of the present invention has an excellent precision treatment effect on Daoy cells with low expression of PPIF protein.

[0315] Example 8

[0316] This example investigates the sensitivity of the expression levels of NNMT and DNMT1 in NCI-H82 cells to the different compounds prepared in the examples of the present invention.

[0317] Experimental methods and results: The NNMT gene was introduced into NCI-H82 cells via viral vectors so that NCI-H82 cells overexpressed NNMT protein, obtaining NCI-H82 cells with high expression of NNMT protein (ov-NNMT NCI-H82 cells); the expression of DNMT1 in NCI-H82 cells was knocked down by viral vector transfection of shRNA (the nucleotide sequence of shRNA is GATCCGGGATGAGTCCATCAAGGAAGATTCAAGAGATCTTCCTTGATGGACTCA TCCTTTTTTG) (SEQ ID No: 2)), obtaining NCI-H82 cells with low expression of DNMT1 protein (sh-DNMT1 NCI-H82 cells); NCI-H82 cells transfected with empty viral vectors without NNMT gene and shRNA (Con-NCI-H82 cells) were used as controls. Western Blot experiments were performed to detect the expression levels of NNMT protein and DNMT1 protein in Con-NCI-H82 cells, the expression level of NNMT protein in ov-NNMT NCI-H82 cells, and the expression level of DNMT1 protein in sh-DNMT1 NCI-H82 cells. The results are shown in Figure 3 Shown and Figure 4 As shown. Figure 3 and Figure 4 As can be seen, compared with Con-NCI-H82 cells, the NNMT protein in ov-NNMT NCI-H82 cells is highly expressed, and the DNMT1 protein expression in sh-DNMT1 NCI-H82 cells is knocked down (i.e., low expression).

[0318] The cell viability of Con-NCI-H82 cells, ov-NNMT NCI-H82 cells, and sh-DNMT1 NCI-H82 cells was detected using the Promega CellTiter-Glo kit (the kit reflects cell viability by detecting intracellular ATP content). The results are shown in Figure 5 and Figure 6 As shown. Figure 5 and Figure 6 It can be seen that the cell viabilities of Con-NCI-H82 cells, ov-NNMT NCI-H82 cells and sh-DNMT1 NCI-H82 cells are almost the same, and there is no statistically significant difference in cell viability.

[0319] The Promega CellTiter-Glo kit was used to measure the inhibitory effects (IC) of different compounds prepared in the present invention (dissolved in DMSO solvent) on Con-NCI-H82 cells, ov-NNMTNCI-H82 cells and sh-DNMT1 NCI-H82 cells by directly detecting the intracellular ATP content. 50 ), the results are shown in Table 5:

[0320] Table 5 Inhibitory effects of different compounds prepared in the examples of the present invention on Con-NCI-H82 cells, ov-NNMT NCI-H82 cells and sh-DNMT1 NCI-H82 cells (IC 50 , μM)

[0321]

[0322] Note: IC 50 is the half inhibition concentration (50% inhibiting concentration), that is, the concentration of the compound required to achieve 50% inhibition effect; Con-NCI-H82 is NCI-H82 cells transfected with an empty viral vector without NNMT gene and shRNA, serving as a control; ov-NNMT NCI-H82 is NCI-H82 cells transfected with a viral vector carrying the NNMT gene, and in the ov-NNMT NCI-H82 cells, NNMT protein is highly expressed; sh-DNMT1 NCI-H82 is NCI-H82 cells transfected with a viral vector carrying shRNA, and in the sh-DNMT1 NCI-H82 cells, the expression of DNMT1 is knocked down (i.e., low expression).

[0323] As can be seen from Table 5, this example further confirms that the compound SJ001 prepared in the example of the present invention has a significant inhibitory effect on tumor cells with low or no expression of the NNMT gene and high expression of DNMT1 by overexpressing the NNMT protein of NCI-H82 cells and knocking down the expression of DNMT1 in NCI-H82 cells, while the inhibitory effect on tumor cells with high expression of the NNMT gene and low expression of DNMT1 is poor. Reducing the NNMT gene expression of the tumor and increasing the DNMT1 expression of the tumor can significantly improve the inhibitory effect of the compound SJ001 prepared in the example of the present invention. The NNMT expression level of the tumor cells is significantly negatively correlated with the sensitivity of the compound SJ001 prepared in the example of the present invention, while the DNMT1 expression level of the tumor cells is significantly positively correlated with the sensitivity of the compound SJ001 prepared in the example of the present invention. Therefore, the compound SJ001 prepared in the embodiment of the present invention has a more significant inhibitory effect on tumor cells with low or no expression of the NNMT gene and high expression of DNMT1. Tumor cells with low or no expression of the NNMT gene and high expression of DNMT1 are highly sensitive to the compound SJ001 prepared in the embodiment of the present invention. Therefore, the compound SJ001 prepared in the embodiment of the present invention has an excellent precision treatment effect on tumor cells with low or no expression of the NNMT gene and high expression of DNMT1.

[0324] Example 9 Preparation of Phosphate Form A of Compound SJ001

[0325] 1. The preparation method of the phosphate crystal form A of compound SJ001 is as follows:

[0326] (1) Preparation of seed crystals

[0327] (1.1) 2950.2 mg of the compound SJ001 prepared in Example 1 was weighed into a 100 mL reaction kettle at 25° C., 45 mL of isopropyl acetate (IPAc) was added, and the mixture was mixed to obtain an alkaline solution.

[0328] (1.2) At 25° C., 1067 μL of 15M H 3 PO 4 (the molar ratio of H 3 PO 4 to the compound SJ001 prepared in Example 1 in step (1.1) is 2.2:1) was measured and diluted with 5 mL of isopropyl acetate (IPAc) to obtain an acid solution.

[0329] (1.3) The acid solution prepared in step (1.2) was added to the alkaline solution prepared in step (1.1) while stirring, and the suspension was obtained after stirring at 25°C for 12 hours. The reaction solution was filtered under reduced pressure, and the filter cake was vacuum dried at 25°C for 24 hours. The solid was collected to obtain seed crystals. XRPD measurement showed that the seed crystals were crystalline.

[0330] (2) Preparation of Phosphate Form A of Compound SJ001

[0331] (2.1) 3591.7 mg of the compound SJ001 prepared in Example 1 was weighed into a 100 mL reaction kettle at 25° C. 50 mL of isopropyl acetate (IPAc) was added, and the sample was dissolved after stirring to obtain an alkaline solution.

[0332] (2.2) At 25° C., 1447 μL of 15M H 3 PO 4 (the molar ratio of H 3 PO 4 to the compound SJ001 prepared in Example 1 in step (2.1) is 2.45:1) is taken into a bottle, and 10 mL of isopropyl acetate (IPAc) is added to dilute the solution to obtain an acid solution.

[0333] (2.3) To the alkaline solution prepared in step (2.1), 20.0 mg of the seed crystals prepared in step (1) were added. The mixture became slightly turbid after stirring at 25°C for 10 min. Then, the acid solution prepared in step (2.2) was added dropwise at 25°C while stirring. After the addition of the acid solution was completed, the reaction solution was a light yellow suspension. After stirring at 25°C for 18 h, the reaction solution was filtered under reduced pressure and washed three times with 10 mL of isopropyl acetate (IPAc). The filter cake was vacuum dried at 25°C for 24 h, and the solid was collected to obtain the phosphate form A (5152.3 mg) of compound SJ001.

[0334] Crystalline form identification and characterization

[0335] In the present invention, X-ray powder diffraction (XRPD), thermogravimetric analysis (TGA), differential scanning calorimetry (DSC) and nuclear magnetic resonance spectroscopy ( 1 H-NMR) was used to characterize the crystal form, and XRPD, TGA, DSC and 1 The measurement parameters of H-NMR are as follows:

[0336] 1. XRPD, TGA, DSC and 1H-NMR measurement parameters

[0337] 1.1 X-ray powder diffraction (XRPD) determination:

[0338] The X-ray powder diffraction (XRPD) pattern was measured on an X-ray powder diffraction analyzer produced by PANalytacal, and the measurement parameters are shown in Table 6.

[0339] Table 6 X-ray powder diffraction (XRPD) measurement parameters

[0340]

[0341] 1.2 Thermo Gravimetric Analysis (TGA) and Differential Scanning Calorimeter (DSC) determination:

[0342] Thermogravimetric analysis (TGA) was measured on a Discovery TA5500 thermogravimetric analyzer, and differential scanning calorimetry (DSC) was collected on a Discovery TA2500 differential scanning calorimeter. The measurement parameters of thermogravimetric analysis (TGA) and differential scanning calorimetry (DSC) are shown in Table 7 below:

[0343] Table 7 Determination parameters of thermogravimetric analysis (TGA) and differential scanning calorimetry (DSC)

[0344]

[0345] 1.3 H NMR spectroscopy ( 1 H-NMR) determination:

[0346] H NMR ( 1 H-NMR) were collected on a Bruker 400M NMR spectrometer using DMSO-d6 as solvent.

[0347] 2. Crystal form evidence and characteristic test results:

[0348] 2.1 Results of the performance and properties of compound SJ001 prepared in Example 1 of the present invention

[0349] The X-ray powder diffraction (XRPD) of the compound SJ001 prepared in Example 1 of the present invention is as follows: Figure 7 As shown, the diffraction peak list of X-ray powder diffraction (XRPD) of compound SJ001 is shown in Table 8 below:

[0350] Table 8 XRPD diffraction peak list of compound SJ001 prepared in Example 1 of the present invention

[0351]

[0352]

[0353] The results of thermogravimetric analysis (TGA) and differential scanning calorimetry (DSC) of the compound SJ001 prepared in Example 1 of the present invention are as follows: Figure 8 and Fig. 9 shown.

[0354] from Figure 8 The TGA measurement shows that the compound SJ001 prepared in Example 1 has a weight loss of 0.47% when heated to 150°C. Fig. 9 It can be seen from the DSC measurement that the compound SJ001 prepared in Example 1 has an endothermic peak at 138.8°C (starting temperature) and begins to thermally degrade.

[0355] 2.2 Crystalline Form Evidence and Characteristic Determination of Phosphate Crystalline Form A of Compound SJ001 Prepared in Example 9 of the Present Invention

[0356] The X-ray powder diffraction (XRPD) of the phosphate crystal form A of the compound SJ001 prepared in Example 9 of the present invention is as follows: Fig.10 As shown, the diffraction peak list of X-ray powder diffraction (XRPD) of phosphate crystal form A of compound SJ001 is shown in Table 9 below:

[0357] Table 9 XRPD diffraction peak list of phosphate crystal form A of compound SJ001 prepared in Example 9 of the present invention

[0358]

[0359]

[0360] The results of thermogravimetric analysis (TGA), differential scanning calorimetry (DSC) and nuclear magnetic resonance hydrogen spectrum (1H-NMR) of the phosphate crystal form A of the compound SJ001 prepared in Example 9 of the present invention are as follows: Fig.11 , Fig.12 and Fig.13 shown.

[0361] from Fig.11 It can be seen from the TGA measurement that the phosphate crystal form A of the compound SJ001 prepared in Example 9 of the present invention has a weight loss of 0.29% when heated to 150°C. Fig.12 It can be seen from the DSC measurement that the phosphate crystal form A of the compound SJ001 prepared in Example 9 of the present invention has an endothermic peak at 213.8°C (starting temperature) and begins to thermally degrade.

[0362] Weigh 2.967 mg of the phosphate form A of compound SJ001, add it to a 10 mL volumetric flask, add solvent ACN / H 2The concentration of the free base compound SJ001 was determined to be 0.1942 mg / mL by high performance liquid chromatography (HPLC), and the concentration of the phosphate ion was measured to be 91.0644 ppm by ion chromatography (IC). The molar ratio of the compound SJ001 to phosphoric acid was calculated to be 1:2 according to the formula (concentration of the free base compound SJ001 / molecular weight of the free base compound SJ001) / (concentration of the phosphate ion / molecular weight of the phosphate ion).

[0363] It can be seen from the TGA and DSC measurement results of the crystal form that the phosphate crystal form A of the compound SJ001 prepared in Example 9 of the present invention has more excellent thermal stability. The phosphate crystal form A of the compound SJ001 with excellent thermal stability has significant advantages in drug formulation, for example, it can significantly improve the stability during production, transportation and storage, and reduce the cost during production, transportation and storage, thereby effectively improving the quality of the drug and ensuring the safety of medication.

[0364] Solubility determination

[0365] 1. Preparation of biosolvent and pH buffer

[0366] 1.1 Preparation of simulated gastric fluid (SGF):

[0367] Weigh 200.3 mg NaCl and 100.2 mg Triton X-100 into a 100 mL volumetric flask, add purified water to dissolve, add 1.632 mL hydrochloric acid (1 M), adjust the pH to 1.8 with 1 M hydrochloric acid or 1 M NaOH solution, and add purified water to make up to volume to obtain simulated gastric fluid (SGF).

[0368] 1.2 Preparation of simulated fasting intestinal fluid (FaSSIF):

[0369] Weigh 340.3 mg of anhydrous NaH2PO4, 42.5 mg of NaOH, and 620.1 mg of NaCl into a 100 mL volumetric flask. Add 90 mL of purified water to dissolve, adjust the pH to 6.5 with 1 M hydrochloric acid or 1 M NaOH solution, and add purified water to make up to volume to obtain a buffer solution; weigh 220.3 mg of SIF powder into a 100 mL volumetric flask, add the buffer solution and make up to 100 mL to obtain a simulated fasting state intestinal fluid (FaSSIF).

[0370] 1.3 Preparation of simulated fed state intestinal fluid (FeSSIF):

[0371] Take 0.82 mL of glacial acetic acid, 400.1 mg of NaOH and 1183.2 mg of NaCl to a 100 mL volumetric flask, add 90 mL of purified water to dissolve, adjust the pH to 5.0 with 1 M hydrochloric acid or 1 M NaOH solution, and add purified water to make up to volume to obtain a buffer solution; weigh 1123.1 mg of SIF powder to a 100 mL volumetric flask, add the buffer solution and make up to 100 mL to obtain a simulated fed intestinal fluid (FeSSIF).

[0372] 1.4 Preparation of pH 4.0 buffer:

[0373] Weigh 56.68 mg of citric acid and 60.29 mg of sodium citrate into a 10 mL volumetric flask and add purified water to make up to volume to obtain a pH 4.0 buffer solution.

[0374] 1.5 Preparation of pH 5.0 buffer:

[0375] Weigh 33.62 mg of citric acid and 95.58 mg of sodium citrate into a 10 mL volumetric flask and add purified water to make up to volume to obtain a pH 5.0 buffer solution.

[0376] 1.6 Preparation of pH 6.0 buffer:

[0377] Weigh 11.05 mg of citric acid and 130.14 mg of sodium citrate into a 10 mL volumetric flask and add purified water to make up to volume to obtain a pH 6.0 buffer solution.

[0378] 1.7 Preparation of pH 7.4 buffer:

[0379] Weigh 139.55 mg K2HPO4 and 26.93 mg KH2PO4 into a 10-mL volumetric flask and add purified water to make up to volume to obtain a pH 7.4 buffer solution.

[0380] 2. Solubility analysis method:

[0381] The solubility was measured by Agilent 1260 high performance liquid chromatograph. The measurement parameters of high performance liquid chromatography (HPLC) are shown in Table 10:

[0382] Table 10 HPLC test conditions

[0383]

[0384]

[0385] 3. Solubility determination method and results

[0386] 3.1 Dynamic solubility determination method and results

[0387] The dynamic solubility (1, 4 and 24 h) of the phosphate crystal form A of the compound SJ001 prepared in Example 1 and the compound SJ001 prepared in Example 9 in SGF, FaSSIF and FeSSIF biosolvents was measured at a feed concentration of 5 mg / mL (calculated as the free compound SJ001) at 37°C using a rotary mixing method (25 rpm). The samples at each time point were centrifuged and filtered (0.45 μm filter head), and the concentration was determined by high performance liquid chromatography (HPLC). The dynamic solubility of the phosphate crystal form A of the compound SJ001 prepared in Example 1 and the compound SJ001 prepared in Example 9 is shown in Table 11.

[0388] Table 11 Dynamic solubility of phosphate crystal form A of compound SJ001 prepared in Example 1 and compound SJ001 prepared in Example 9

[0389]

[0390] 3.2 Equilibrium solubility determination method and results

[0391] The feed concentration was 5 mg / mL (calculated as free compound SJ001) and magnetic stirring was carried out at room temperature for 24 h (500 rpm). The samples were centrifuged and filtered (0.45 μm filter head). The equilibrium solubility of the phosphate crystal form A of the compound SJ001 prepared in Example 1 and the compound SJ001 prepared in Example 9 was determined by high performance liquid chromatography (HPLC). The results are shown in Table 12 below:

[0392] Table 12 Equilibrium solubility of phosphate crystal form A of compound SJ001 prepared in Example 1 and compound SJ001 prepared in Example 9

[0393]

[0394] Note: LOQ refers to Limit of quantitation.

[0395] It can be seen from Tables 11 and 12 that the phosphate crystal form A of compound SJ001 prepared in Example 9 of the present invention has more excellent solubility. The phosphate crystal form A of compound SJ001 with excellent solubility has significant advantages in drug formulation, for example, it can maintain a high concentration solution state in the gastrointestinal tract, thereby promoting oral absorption of the drug and improving oral bioavailability; drugs with excellent solubility can be suitable for the preparation of injections, thereby quickly exerting the therapeutic effect of the drug, etc.

[0396] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A compound of formula I, or a pharmaceutically acceptable salt thereof; 2. A crystalline form B of a compound of formula I; The X-ray powder diffraction pattern of the crystalline form B of the compound of formula I includes one or more (such as 2 or 3) 2θ values ​​selected from the following group: 13.03±0.2°, 17.52±0.2°, 22.69±0.

2.

3. The crystalline form B of the compound of formula I according to claim 1, characterized in that: The X-ray powder diffraction pattern of Form B of the compound of Formula I is substantially as shown in FIG7 .

4. A phosphate crystal form A of a compound of formula I; The X-ray powder diffraction pattern of the phosphate crystal form A of the compound of formula I includes one or more (such as 2 or 3) 2θ values ​​selected from the following group: 13.62±0.2°, 20.89±0.2°, 22.17±0.2°.

5. The phosphate crystal form A of the compound of formula I according to claim 4, characterized in that: The X-ray powder diffraction pattern of the phosphate crystal form A of the compound of formula I is substantially as shown in FIG10 .

6. A composition, characterized in that The composition comprises (a) a compound of formula I as claimed in claim 1, or a pharmaceutically acceptable salt thereof; or a crystalline form B of a compound of formula I as claimed in claim 2, or a phosphate crystalline form A of a compound of formula I as claimed in claim 4.

7. The composition according to claim 6, characterized in that The composition is a pharmaceutical composition.

8. A use of the compound of formula I according to claim 1, or a pharmaceutically acceptable salt thereof; or the crystalline form B of the compound of formula I according to claim 2, or the phosphate crystalline form A of the compound of formula I according to claim 4, characterized in that: Used for preparing a composition or preparation, wherein the composition or preparation is used for preventing and / or treating tumors.

9. The use according to claim 8, characterized in that The tumor is selected from the group consisting of lung cancer, kidney cancer, breast cancer, colon cancer, lymphoma, leukemia, pancreatic cancer, brain tumor, liver cancer, prostate cancer, or a combination thereof.

10. A method for preventing and / or treating tumors, characterized in that: The method comprises administering to a subject in need thereof a compound of formula I as claimed in claim 1, or a pharmaceutically acceptable salt thereof; or a crystalline form B of a compound of formula I as claimed in claim 2, or a phosphate crystalline form A of a compound of formula I as claimed in claim 4, thereby preventing and / or treating tumors.

Images