Antibodies, antibody pairs, and kits targeting human S100A7 protein and their uses

Abstract

This invention belongs to the field of antibody preparation technology, and particularly relates to antibodies, antibody pairs, and kits targeting human S100A7 protein, as well as their uses. The antibodies are either a first antibody or a second antibody. The amino acid sequences of the light chain CDR1-3 of the first antibody are shown in SEQ ID NO. 3-5, and the amino acid sequences of the heavy chain CDR1-3 are shown in SEQ ID NO. 8-10, respectively. The amino acid sequences of the light chain CDR1-3 of the second antibody are shown in SEQ ID NO. 13-15, and the amino acid sequences of the heavy chain CDR1-3 are shown in SEQ ID NO. 18-20, respectively. This invention provides a pair of highly specific and highly affinity anti-human S100A7 protein antibodies. The double-antibody sandwich enzyme-linked immunosorbent assay (ELISA) system developed based on the aforementioned antibodies exhibits advantages such as high specificity, wide linear range, high sensitivity, high accuracy, and good reliability in detecting human S100A7.

Description

Technical Field

[0001] This invention relates to the field of antibody preparation technology, and in particular to antibodies, antibody pairs, and kits targeting human S100A7 protein, as well as their uses. Background Technology

[0002] S100A7 (S100 calcium binding protein A7) belongs to the S100 superfamily of calcium-binding proteins. Originally isolated from abnormally proliferating keratinocytes in psoriasis, it is also known as Psoriasin (S100A7). With a molecular weight of approximately 11 kDa, it contains two EF-hand domains responsible for binding calcium ions, thus influencing protein conformation and function, and participating in various important intracellular and extracellular life activities. Studies have shown that S100A7 plays a crucial role in skin barrier function and immune defense, particularly during epidermal differentiation and maturation. It helps maintain skin integrity and barrier function by regulating the proliferation and differentiation of keratinocytes. Furthermore, S100A7 possesses antibacterial activity, inhibiting the growth of certain bacteria and protecting the skin from infection; this antibacterial effect makes it significant in the skin's innate immune defense. In addition, S100A7 is involved in tumorigenesis and development; its expression level is significantly increased in various cancers and is closely related to cancer cell proliferation, migration, and invasion. For example, upregulation of S100A7 expression has been observed in psoriasis, in situ and invasive breast cancer, squamous cell carcinoma of the head and neck, squamous cell carcinoma of the bladder, and lung cancer. This secretion and expression characteristic of S100A7 is considered one of the biomarkers of psoriasis and is used as a candidate biomarker for the early diagnosis and prognosis of certain malignant tumors.

[0003] To investigate the role of S100A7 in physiological and pathological processes, various detection methods have been widely used. Among them, enzyme-linked immunosorbent assay (ELISA) is a commonly used method for the quantitative detection of S100A7, suitable for cell culture supernatants, serum, or tissue extracts. To improve the specificity and sensitivity of ELISA detection methods, it is necessary to develop high-performance anti-human S100A7 monoclonal antibodies. However, currently commercially available anti-human S100A7 ELISA kits all use mouse anti-human S100A7 monoclonal antibodies, which have low affinity and specificity, poor detection sensitivity, and are prone to false positive or false negative results, thus requiring improved reliability of the test results. Furthermore, the mouse monoclonal antibodies used rely on traditional hybridoma methods for development and production, and the preparation process is more complex than that of recombinant monoclonal antibodies, also exhibiting significant batch-to-batch variability. Therefore, ELISA kits developed using mouse monoclonal antibodies face challenges such as poor stability, low sensitivity, and low reliability of results. Summary of the Invention

[0004] To address the aforementioned problems in existing technologies, this invention provides two monoclonal antibodies against human S100A7 protein and antibody pairs thereof, as well as a kit containing the aforementioned antibodies or antibody pairs and their uses. The antibodies provided by this invention exhibit high specificity and affinity for human S100A7 protein, and when used in developing a double-antibody sandwich enzyme-linked immunosorbent assay (ELISA) system for detecting human S100A7 protein, they offer advantages such as high specificity, wide linear range, high sensitivity, and good accuracy and reliability.

[0005] To achieve the above objectives, the present invention is specifically implemented through the following technical solutions:

[0006] The first aspect of this invention provides an antibody against human S100A7 protein, which is a first antibody or a second antibody, wherein: the amino acid sequences of the complementarity-determining regions CDR1-3 on the light chain variable region of the first antibody are shown in SEQ ID NO. 3-5, and the amino acid sequences of the complementarity-determining regions CDR1-3 on the heavy chain variable region are shown in SEQ ID NO. 8-10; the amino acid sequences of the complementarity-determining regions CDR1-3 on the light chain variable region of the second antibody are shown in SEQ ID NO. 13-15, and the amino acid sequences of the complementarity-determining regions CDR1-3 on the heavy chain variable region are shown in SEQ ID NO. 18-20.

[0007] Further, the amino acid sequence of the light chain variable region of the first antibody is shown in SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.7; the amino acid sequence of the light chain variable region of the second antibody is shown in SEQ ID NO.12, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.17.

[0008] Further, the amino acid sequence of the first antibody light chain is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.6; the amino acid sequence of the second antibody light chain is shown in SEQ ID NO.11, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.16.

[0009] Further, the first antibody or the second antibody is a full-length antibody or the antigen-binding region of the full-length antibody; the antigen-binding region is selected from at least one of the Fab fragment, F(ab)2 fragment, Fv fragment, (Fv)2 fragment, scFv fragment and sc(Fv)2 fragment.

[0010] A second aspect of the present invention provides a nucleic acid molecule encoding a first antibody or a second antibody as described above.

[0011] Further, the nucleic acid sequence of the light chain variable region of the first antibody is as shown in SEQ ID NO.22 or its complementary sequence, and the nucleic acid sequence of the heavy chain variable region is as shown in SEQ ID NO.24 or its complementary sequence. The nucleic acid sequence of the light chain variable region of the second antibody is as shown in SEQ ID NO.26 or its complementary sequence, and the nucleic acid sequence of the heavy chain variable region is as shown in SEQ ID NO.28 or its complementary sequence.

[0012] Further, the nucleic acid sequence of the first antibody light chain is as shown in SEQ ID NO.21 or its complementary sequence, and the nucleic acid sequence of the heavy chain is as shown in SEQ ID NO.23 or its complementary sequence. The nucleic acid sequence of the second antibody light chain is as shown in SEQ ID NO.25 or its complementary sequence, and the nucleic acid sequence of the heavy chain is as shown in SEQ ID NO.27 or its complementary sequence.

[0013] A third aspect of the present invention provides an antibody pair against human S100A7 protein, comprising a first antibody and a second antibody as described above.

[0014] A fourth aspect of the present invention provides a kit for detecting human S100A7 protein, the kit comprising an antibody against human S100A7 protein as described above or an antibody pair against human S100A7 protein as described above.

[0015] Furthermore, the kit is a double-antibody sandwich enzyme-linked immunosorbent assay kit, which includes a first antibody and a second antibody, wherein the first antibody serves as a capture antibody and the second antibody serves as a detection antibody and is conjugated with a detection label.

[0016] The advantages and positive effects of this invention are as follows: This invention provides a pair of highly specific and highly affinity monoclonal antibodies against human S100A7 protein, with affinity constants in the nM range. Furthermore, the two monoclonal antibodies bind to different antigenic epitopes of human S100A7 protein. Therefore, based on the aforementioned antibodies, a double-antibody sandwich enzyme-linked immunosorbent assay (ELISA) system targeting human S100A7 protein has been developed. When used to detect human S100A7 protein, it exhibits advantages such as high specificity, wide linear range, high sensitivity, good accuracy, and high reliability. The detection limit is as low as 162.44 pg / mL, showing promising application prospects in the field of efficient detection of S100A7 protein in biological samples such as human serum, urine, cells, and tissues. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 The vector map used to construct the rabbit monoclonal antibody expression vector in Example 1 of this invention, from left to right, is the pRB322 vector map carrying the light chain constant region and the heavy chain constant region;

[0019] Figure 2 This is an affinity curve of monoclonal antibody A binding to human S100A7 protein in Example 1 of the present invention;

[0020] Figure 3 This is an affinity curve of monoclonal antibody B binding to human S100A7 protein in Example 1 of the present invention;

[0021] Figure 4 This is a graph showing the antigenic epitope curves of monoclonal antibodies A and B recognizing human S100A7 protein in Example 1 of the present invention.

[0022] Figure 5 This is the standard curve of the human S100A7 protein double antibody sandwich enzyme-linked immunosorbent assay system established based on monoclonal antibodies A and B in Example 2 of the present invention. Detailed Implementation

[0023] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. The embodiments described herein are for illustrative purposes only and are not intended to limit the invention.

[0024] Based on the information contained herein, various changes to the precise description of the invention can be readily made by those skilled in the art without departing from the spirit and scope of the appended claims. It should be understood that the scope of the invention is not limited to the defined processes, properties, or components, as these embodiments and other descriptions are merely illustrative of specific aspects of the invention. In fact, various modifications to embodiments of the invention that will be apparent to those skilled in the art or related fields are covered within the scope of the appended claims.

[0025] To better understand the invention and not to limit its scope, all figures and other numerical values ​​used in this invention to indicate amounts, percentages, or other quantities should, in all cases, be understood to be modified by the word "approximately." Therefore, unless specifically stated otherwise, the numerical parameters listed in the specification and appended claims are approximate values ​​and may vary depending on the desired properties being sought. Each numerical parameter should at least be considered as obtained based on reported significant figures and through conventional rounding methods.

[0026] Additionally, it should be noted that, unless otherwise defined, the scientific and technical terms used in the context of this invention should have the meanings commonly understood by those skilled in the art.

[0027] The terms “including,” “contains,” “includes,” “has,” and similar words are non-restrictive and can include other steps and other components that do not affect the result.

[0028] The term “and / or” should be considered as a specific disclosure of each of the two specified features or components, with or without the other. For example, “A and / or B” is considered to include (i) A, (ii) B, and (iii) A and B.

[0029] The terms “first” and “second” are used to distinguish similar objects, not necessarily to describe a specific order or sequence. It should be understood that such usage can be interchanged where appropriate.

[0030] The terms "rabbit monoclonal antibody," "rabbit-derived antibody," and "rabbit monoclonal antibody," etc., have the same meaning and, unless otherwise specified, refer to rabbit-derived antibodies that specifically bind to the human S100A7 protein. The modifier "rabbit" indicates that the antibody's complementarity-determining region (CDR) is derived from a rabbit immunoglobulin sequence. The terms "human S100A7," "Human S100A7," and "Human Psoriasin," etc., have the same meaning and can be used interchangeably.

[0031] An antibody is an immunoglobulin molecule that specifically binds to a target antigen or epitope through at least one antigen recognition site located in the variable region of the immunoglobulin molecule. In this invention, the term "antibody" is to be interpreted in the broadest sense and includes various antibody structures, including but not limited to so-called full-length antibodies, antibody fragments, and their genetic or chemical modifications, provided they exhibit the desired antigen-binding activity. An antibody fragment may be one or more portions or fragments of a full-length antibody, retaining the antibody's ability to specifically bind to a target antigen.

[0032] A typical antibody molecule (full-length antibody) consists of two identical light chains (L) and two identical heavy chains (H). Light chains can be classified into two types: κ chains and λ chains; heavy chains can be classified into five types: μ, δ, γ, α, and ε chains, with antibodies defined as IgM, IgD, IgG, IgA, and IgE, respectively. The amino acid sequences near the N-terminus of both the heavy and light chains vary considerably, while the amino acid sequences of other parts are relatively constant. The regions with significant amino acid sequence variation near the N-terminus in both the light and heavy chains are called variable regions (V), and the regions with relatively stable amino acid sequences near the C-terminus are called constant regions (C). The variable regions of the heavy chain (VH) and light chain (VL) are usually the most variable parts of the antibody and contain antigen recognition sites. The VH and VL regions can be further subdivided into hypervariable regions (HVR) and framework regions (FR). The hypervariable region, also known as the complementarity-determining region (CDR), is a ring structure. Heavy chain CDRs and light chain CDRs are tightly joined together by the FR region and cooperate to form a surface that is complementary to the three-dimensional structure of the target antigen or epitope, determining the antibody's specificity and serving as the site for antibody recognition and antigen binding. The FR regions are the more conserved parts of the VH and VL, generally exhibiting a β-sheet configuration, linked by three CDRs forming a connecting loop. Each VH and VL typically consists of three CDRs and four FRs, arranged in the following order from the amino terminus to the carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

[0033] CDRs and FRs can be identified according to Kabat definitions, Chothia definitions, the sum of Kabat and Chothia definitions, AbM definitions, contact definitions, IMGT unique numbering definitions and / or conformational definitions, or any CDR determination method known in the art. As used in this invention, they are defined by the Kabat numbering system.

[0034] The light chain constant region (CL) and heavy chain constant region (CH) do not directly participate in antibody-antigen binding, but they exhibit different effector functions, such as involvement in antibody-dependent cytotoxicity. The CL lengths of different Ig types (κ or λ) are generally consistent, but the CH lengths differ among Ig classes. For example, IgG, IgA, and IgD include CH1, CH2, and CH3, while IgM and IgE include CH1, CH2, CH3, and CH4. The amino acid sequences of the antibody heavy and light chain constant regions are well-known in the art and can be obtained by searching the IMGT database.

[0035] Full-length antibodies are the most complete antibody molecular structures, with a typical Y-type molecular structure. Therefore, in the context of this invention, "full-length antibody," "complete antibody," and "Y-type antibody" have the same meaning and can be used interchangeably.

[0036] An antibody fragment is one or more portions or segments of a full-length antibody that substantially retain the same biological function or activity as the full-length form. Specifically, an antibody fragment includes at least the same CDR region as the full-length antibody, and more preferably the same variable region, thereby retaining complete antigen recognition and binding sites, enabling it to bind to the same antigens, especially the same epitopes, as the full-length antibody. Typical examples of antibody fragments include Fab, F(ab)2, Fab', F(ab')2, Fv, (Fv)2, scFv, and sc(Fv)2, which can be obtained using conventional techniques in the art.

[0037] (i) Fab: An antigen-binding fragment (Fab) is a monovalent fragment consisting of a complete light chain (variable and constant regions) and a portion of a heavy chain (variable and first constant region). Fragments such as Fab, F(ab')2, and Fab' can be obtained by protease cleavage of a full-length antibody. For example, under the action of papain, IgG can be degraded into two Fab fragments and one Fc fragment; under the action of pepsin, IgG can be degraded into one F(ab')2 fragment and one pFc' fragment. The F(ab')2 fragment is further reduced to form two Fab' fragments. Because Fab possesses an antigen-binding region and a portion of a constant region, it not only has antibody-antigen affinity and excellent tissue penetration like scFv, but also has a more stable structure.

[0038] (ii)F(ab)2: Contains a bivalent segment consisting of two Fabs connected by a disulfide bridge in the hinge region.

[0039] (iii) Fv: The variable fragment (Fv) is located at the N-terminus of the antibody Fab fragment. It contains only the variable region and consists of a variable region of one light chain and one heavy chain. It is a non-covalently bound dimer of VH and VL (VH-VL dimer). The three CDRs of each variable region interact to form an antigen-binding site on the surface of the VH-VL dimer, which has the ability to recognize and bind antigens, although the affinity is lower than that of the intact antibody.

[0040] (iv)(Fv)2: Consists of two Fv segments covalently linked together.

[0041] (v)scFv: A single-chain variable fragment (scFv) is an Fv fragment composed of a single polypeptide chain, consisting of a heavy chain variable region (VH) and a light chain variable region (VL) linked by a flexible linker (typically composed of 10-25 amino acids). It retains the original antibody's specificity for binding to the antigen. The linker in this invention is not particularly limited as long as it does not interfere with the expression of the antibody variable regions linked to its two ends. Compared to full-length antibodies, scFv has a smaller molecular weight, thus exhibiting higher penetration and lower immune side effects.

[0042] The (vi)sc(Fv)2 segment is formed by connecting two heavy chain variable regions and two light chain variable regions through a joint, etc.

[0043] In some embodiments, the full-length sequence of the antibody or antibody fragment of the present invention may include a complementarity-determining region (CDR) and a framework region (FR) derived from a rabbit immunoglobulin sequence. In other embodiments, the antibody may contain amino acid residues encoded by a non-rabbit immunoglobulin sequence, such as humanized antibodies, chimeric antibodies, etc., to reduce the body's rejection response while maintaining the desired specificity and affinity. The term "chimeric antibody" refers to an antibody in which a portion is derived from a specific source or species, while the remainder is derived from a different source or species. The term "humanized antibody" is a chimeric antibody containing the CDR region of a non-human antibody, such as a rabbit antibody, and a FR region derived from a human antibody. In some cases, the variable region of the non-human antibody binds to the constant region of a human antibody, such as in human-rabbit chimeric antibodies; in other cases, the CDR region of the non-human antibody binds to both the FR region and the constant region derived from a human antibody sequence, i.e., grafting the CDR region of the non-human antibody onto a human antibody framework (FR) sequence derived from the FR sequence of one or more other human antibody variable regions. In this invention, the CDR region in the chimeric antibody or humanized antibody is derived from the rabbit CDR region.

[0044] The terms "monoclonal antibody" or similar terms are used interchangeably and refer to a homogeneous group of antibodies, meaning that the individual antibodies constituting the group are identical except for a small number of naturally occurring mutations and / or post-translational modifications (e.g., isomerization, amidation). A "monoclonal antibody" is highly specific, exhibiting a single binding specificity and affinity for the same or substantially identical epitopes on an antigen. The modifier "monoclonal" indicates that the antibody is obtained from a substantially homogeneous group of antibodies and should not be interpreted as limiting the source or method of preparation of the antibody. This antibody can be prepared by a variety of methods, including but not limited to hybridoma, phage display, yeast display, recombinant DNA, single-cell screening, or single-cell sequencing.

[0045] The term “specific binding” is a well-known term in the art. A molecule exhibits “specific binding” if it reacts more frequently, more rapidly, for a longer duration, and / or with greater affinity for a particular target antigen or epitope than it reacts with other target antigens or epitopes. “Specific binding”, or “preferred binding”, does not necessarily require (although may include) exclusive binding.

[0046] To make the above-mentioned objectives and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below.

[0047] This invention provides an antibody targeting human S100A7 protein. The antibody is either a first antibody or a second antibody. The antibody includes a light chain variable region and a heavy chain variable region. Both the light chain variable region and the heavy chain variable region include three complementarity-determining regions (CDRs), named CDR1, CDR2, and CDR3, respectively. Specifically: the amino acid sequences of CDR1, CDR2, and CDR3 on the light chain variable region of the first antibody are shown in SEQ ID NO. 3, SEQ ID NO. 4, and SEQ ID NO. 5, respectively; the amino acid sequences of CDR1, CDR2, and CDR3 on the heavy chain variable region are shown in SEQ ID NO. 8, SEQ ID NO. 9, and SEQ ID NO. 10, respectively; the amino acid sequences of CDR1, CDR2, and CDR3 on the light chain variable region of the second antibody are shown in SEQ ID NO. 13, SEQ ID NO. 14, and SEQ ID NO. 15, respectively; the amino acid sequences of CDR1, CDR2, and CDR3 on the heavy chain variable region are shown in SEQ ID NO. 10, respectively. As shown in NO.18, SEQ ID NO.19 and SEQ ID NO.20.

[0048] This invention uses human S100A7 protein (from ABclonal, catalog number RP01795) as an immunogen. Through B-cell labeling and sorting technology, B lymphocytes capable of recognizing human S100A7 protein are directly enriched and isolated from the spleen of immunized rabbits, significantly improving the efficiency of antigen-specific B-cell screening. Furthermore, the isolated B lymphocytes are cultured as single cells, directly yielding monoclonal antibodies, eliminating the cumbersome subcloning steps required in hybridoma technology. Subsequently, recombinant expression technology is used to obtain a large number of monoclonal antibody strains, offering advantages such as a simple production process and good batch stability.

[0049] Regarding antigen recognition, the two monoclonal antibodies provided by this invention can recognize and bind to human S100A7 protein, exhibiting advantages such as high specificity and high affinity. Specifically, the affinity constant K of the first and second antibodies... DThe concentrations are 0.518 nM and 3.03 nM, respectively, suitable for the high sensitivity and specificity requirements of immunodiagnostic reagents for antibody raw materials. Furthermore, the two antibodies of this invention bind to different antigenic epitopes of the human S100A7 protein. The double-antibody sandwich enzyme-linked immunosorbent assay (ELISA) detection system developed using these antibodies has advantages such as high specificity, wide linear range, high sensitivity, and good accuracy and reliability. Using the first antibody as the capture antibody and the biotin-labeled second antibody as the detection antibody, the human S100A7 protein is quantitatively detected, with a detection limit as low as 162.44 pg / mL. The established method can be used for the efficient detection of low concentrations of human S100A7 protein and has promising applications in the detection of S100A7 protein in human serum, urine, cells, tissues, and other biological samples.

[0050] Optionally, both the light chain variable region and the heavy chain variable region include four frame regions (FRs), which are arranged in an alternating sequence with three core parameters (CDRs) to form the variable region. The amino acid sequence of the first antibody light chain variable region (VL) is shown in SEQ ID NO. 2, and the amino acid sequence of the heavy chain variable region (VH) is shown in SEQ ID NO. 7. The amino acid sequence of the second antibody light chain variable region (VL) is shown in SEQ ID NO. 12, and the amino acid sequence of the heavy chain variable region (VH) is shown in SEQ ID NO. 17.

[0051] Optionally, the rabbit monoclonal antibody of the present invention further includes a light chain constant region and a heavy chain constant region, wherein CL and VL constitute the light chain, and CH and VH constitute the heavy chain. The constant regions of the antibody are typically obtained by querying the IMGT online database.

[0052] Specifically, the amino acid sequence of the first antibody light chain (FL) is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain (FH) is shown in SEQ ID NO.6. The amino acid sequence of the second antibody light chain (FL) is shown in SEQ ID NO.11, and the amino acid sequence of the heavy chain (FH) is shown in SEQ ID NO.16. The constant regions of the light chains of both the first and second antibodies are κ chains, and the constant regions of the heavy chains are both IgG type.

[0053] It should be noted that the monoclonal antibody of the present invention can be a full-length antibody (having a typical Y-shaped molecular structure) or its antigen-binding region; the antigen-binding region refers to a polypeptide that substantially retains the same biological function or activity as the full-length antibody. Specifically, the antigen-binding region includes the CDR region as described above, and more preferably has the variable region as described above, thereby retaining an intact antigen recognition and binding site, capable of binding to the same antigen as the full-length antibody, especially to the same epitope. Optionally, the antigen-binding region is selected from at least one of Fab, F(ab)2, Fab', F(ab')2, Fv, (Fv)2, scFv, and sc(Fv)2. These antigen-binding regions can be obtained using conventional techniques in the art.

[0054] Another embodiment of the present invention provides a nucleic acid molecule, a recombinant vector containing the aforementioned nucleic acid molecule, or a host cell containing the aforementioned nucleic acid molecule, wherein the nucleic acid molecule encodes a first antibody and / or a second antibody as described above.

[0055] Nucleic acid molecules can be in the form of DNA (such as cDNA, genomic DNA, or synthetic DNA) or RNA (such as mRNA or synthetic RNA). DNA can be single-stranded or double-stranded, and can be a coding strand or a non-coding strand.

[0056] The sequence of a nucleic acid molecule can be derived from the antibody AA sequence using conventional methods such as codon coding rules. The full-length sequence of a nucleic acid molecule or its fragments can usually be obtained using PCR amplification, recombination, or artificial synthesis.

[0057] For example, the nucleic acid sequence of the light chain variable region of the first antibody is shown in SEQ ID NO.22 or its complementary sequence, and the nucleic acid sequence of the heavy chain variable region is shown in SEQ ID NO.24 or its complementary sequence. The nucleic acid sequence of the light chain variable region of the second antibody is shown in SEQ ID NO.26 or its complementary sequence, and the nucleic acid sequence of the heavy chain variable region is shown in SEQ ID NO.28 or its complementary sequence.

[0058] For example, the nucleic acid sequence of the first antibody light chain is as shown in SEQ ID NO.21 or its complementary sequence, and the nucleic acid sequence of the heavy chain is as shown in SEQ ID NO.23 or its complementary sequence. The nucleic acid sequence of the second antibody light chain is as shown in SEQ ID NO.25 or its complementary sequence, and the nucleic acid sequence of the heavy chain is as shown in SEQ ID NO.27 or its complementary sequence.

[0059] The original vector used to construct the recombinant vector can be any vector conventional in the art, as long as it can contain the nucleic acid molecule. Typical vectors include plasmids (such as pBR322, pUC series, pET series, pGEX series), viral vectors, bacteriophages (such as λgt4λB, λ-Charon, λΔz1, and M13), viscera, and mini-chromosomes. The vector can be a cloning vector (i.e., used to transfer nucleic acid molecules into a host and multiply them in host cells) or an expression vector (i.e., containing the necessary genetic elements to allow the nucleic acid molecule inserted into the vector to be expressed in the host cell). The nucleic acid molecule is inserted into a suitable vector to form a cloning vector or expression vector carrying the nucleic acid molecule, which is then introduced into a host cell and cultured under specific conditions to express and obtain an antibody. This is a well-known technique in the art and will not be described in detail here.

[0060] The nucleic acid molecules encoding the antibodies FL and FH of this invention can be inserted into two vectors, which can be introduced into the same or different host cells. When the heavy and light chains are expressed in different host cells, each chain can be isolated from the host cell expressing it, and the isolated heavy and light chains can be mixed and incubated under suitable conditions to form antibodies. In other embodiments, the nucleic acid molecules encoding antibodies FL and FH can also be cloned into a single vector, with each nucleic acid sequence ligated downstream of a suitable promoter; for example, each nucleic acid sequence encoding the heavy and light chains can be operatively ligated to different promoters, or the nucleic acid sequences encoding the heavy and light chains can be operatively ligated to a single promoter, such that both the heavy and light chains can be expressed by the same promoter. The choice of expression vector / promoter depends on the type of host cell used to produce the antibodies.

[0061] Recombinant vector transfection or transformation into host cells is performed using conventional techniques. When the host is a prokaryote such as *E. coli*, competent cells capable of absorbing DNA are harvested after the exponential growth phase and treated with CaCl2 or MgCl2; alternatively, microinjection, electroporation, or liposome packaging can be used. When the host is a eukaryote, the following DNA transfection methods can be used to achieve gene delivery: calcium phosphate coprecipitation, microinjection, electroporation, liposome packaging, or particle bombardment.

[0062] The host cell can be a prokaryotic or eukaryotic cell. Examples of prokaryotic host cells that can be used in this invention include, but are not limited to, *Escherichia coli* (e.g., DH5α, JM109, BL21, W3110), *Bacillus* spp. (e.g., *Bacillus subtilis*, *Bacillus thuringiensis*), *Enterobacterium* strains (e.g., *Salmonella typhimurium*, *Serratia marcescens*), and *Pseudomonas* spp. Examples of eukaryotic host cells that can be used for transformation include, but are not limited to, yeast, insect cells, and animal cells, such as Drosophila S2 or Sf9 cells, mammalian CHO, CHO DG44, CHO-S, COS-7, 293 series cells, HepG2, Huh7, 3T3, RIN, MDCK, and HEK293 cell lines. After obtaining host cells transfected or transformed with the recombinant vector described above, they can be cultured under suitable conditions to express antibodies, which can then be isolated to obtain purified antibodies.

[0063] In this invention, the recombinant vector is transfected or transformed into host cells using conventional techniques. When the host is a prokaryote such as *Escherichia coli*, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with CaCl2 or MgCl2. If necessary, microinjection, electroporation, or liposome packaging can also be used. When the host is a eukaryote, the following DNA transfection methods can be used: calcium phosphate coprecipitation, as well as microinjection, electroporation, and liposome packaging.

[0064] Preferably, the recombinant vector is the expression vector pBR322, and the host cell is human renal epithelial (293F) cells.

[0065] Another embodiment of the present invention provides an antibody pair against human S100A7 protein, which consists of a first antibody and a second antibody as described above.

[0066] The first and second antibodies provided by this invention recognize and bind to different epitopes of human S100A7, and can be used to develop bispecific antibody sandwich ELISA systems or kits with paired antibodies. When detecting human S100A7, they have advantages such as high specificity, low detection limit, and wide linear range.

[0067] Another embodiment of the present invention provides the use of the antibody or antibody pair against human S100A7 protein as described above in the preparation of a kit for detecting human S100A7 protein.

[0068] The advantages of the antibody or antibody pair targeting human S100A7 protein in the preparation of a kit for detecting human S100A7 protein are the same as the advantages of the antibody targeting human S100A7 protein over the prior art as described above, and will not be repeated here.

[0069] Based on the same inventive concept described above, embodiments of the present invention also provide a kit for detecting human S100A7 protein, the kit comprising the first antibody and / or the second antibody as described above.

[0070] It is important to emphasize that the primary and secondary antibodies can be used individually, together, or in pairs. During detection, whether used separately or together, the primary and / or secondary antibodies serve as the primary antibody or capture antibody. The sample to be tested is contacted with the capture antibody, and then the antibody is detected. In some embodiments, the capture antibody can be conjugated (covalently or non-covalently) to a detection label, and qualitative or quantitative detection of the S100A7 protein is achieved by analyzing changes in a recognizable signal generated by the detection label. In other embodiments, the primary antibody against human S100A7 protein is not labeled; instead, the detection label is conjugated to a secondary antibody (as the detection antibody) that can bind to the capture antibody, or other molecules. For example, if the anti-human S100A7 protein antibody is a rabbit-derived IgG antibody, then the secondary antibody can be an anti-rabbit IgG antibody, thereby generating a change in a recognizable signal through conjugation of the detection-labeled secondary antibody. When used in pairs, one of the primary and secondary antibodies serves as the primary antibody or capture antibody, and the other as the secondary antibody or detection antibody.

[0071] The detection methods described above employ conventional immunological approaches, including but not limited to: enzyme-linked immunosorbent assay (ELISA), enzyme-linked immunospot assay (ELISPOT), immunohistochemistry (IHC), immunofluorescence assay (IF), Western blotting (WB), and flow cytometry (FC). The detection targets include recombinantly expressed human S100A7 protein and naturally secreted or expressed human S100A7 protein from cells or tissues. Detection samples include, but are not limited to, serum, plasma, urine, cells or cell culture medium, tissue or tissue homogenate, etc.

[0072] Preferably, the detection kit is a double-antibody sandwich enzyme-linked immunosorbent assay kit, comprising a first antibody and a second antibody, wherein the first antibody serves as a capture antibody (or primary antibody), the second antibody serves as a detection antibody (or secondary antibody), and the second antibody is conjugated with a detection marker.

[0073] The detection markers used to generate identifiable signal changes include, but are not limited to: biotin, fluorescent dyes (such as umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazineamine fluorescein, dansyl chloride), fluorescent proteins (such as isophycocyanin, phycoerythrin, PerCP and phycocyanin), enzymes (such as alkaline phosphatase, acid phosphatase, β-galactosidase, glucose oxidase, horseradish peroxidase, acetylcholinesterase, avidin), colloidal gold, colored magnetic beads, latex particles, radionuclides, detection antibodies or combinations thereof.

[0074] The present invention will be further illustrated below with reference to specific embodiments. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions, such as those described in *Molecular Cloning: A Laboratory Manual (Fourth Edition)* published by Cold Spring Harbor Laboratory, or generally under the conditions recommended by the manufacturer.

[0075] Example 1: Screening and preparation of rabbit monoclonal antibodies A and B for recognizing human S100A7 protein

[0076] This embodiment utilizes B-cell labeling and sorting technology to directly enrich and isolate B lymphocytes capable of recognizing human S100A7 protein from the spleens of New Zealand white rabbits immunized with the S100A7 antigen protein. This significantly improves the efficiency of antigen-specific B lymphocyte screening. The B lymphocytes are then cultured as single cells to directly obtain monoclonal antibodies, eliminating the cumbersome subcloning steps required in hybridoma technology. Finally, large-scale production of rabbit-derived monoclonal antibodies is achieved through recombinant expression technology. Specifically, naturally paired antibody heavy chain variable region (VH) and light chain variable region (VL) genes are obtained from antigen-specific B lymphocytes via PCR amplification. These genes are then loaded into expression vectors containing the heavy and light chain constant regions, respectively. The vectors are transfected into host cells and cultured. Target antibodies A and B are isolated and purified from the cell culture supernatant. Antibody sequencing was performed by Kingcare Biotechnology Co., Ltd., and the amino acid (AA) sequence and gene (DNA) sequence are shown in Tables 1-2. For ease of description, the light chain complementarity determination regions 1-3 are denoted as LCDR1, LCDR2, and LCDR3, respectively, and the heavy chain complementarity determination regions 1-3 are denoted as HCDR1, HCDR2, and HCDR3, respectively.

[0077] Table 1. Sequence information of monoclonal antibody A in this embodiment.

[0078]

[0079] Table 2. Sequence information of monoclonal antibody B in this embodiment.

[0080]

[0081] The preparation methods for rabbit-derived monoclonal antibodies A and B specifically include the following steps:

[0082] 1. Animal Immunization: New Zealand white rabbits were immunized with Human S100A7 protein (from ABclonal, catalog number RP01795). Each rabbit received 200 μg of immunogen. Before the first immunization, the immunogen was mixed with an equal volume of complete Freund's adjuvant to prepare an emulsion, which was injected subcutaneously at multiple sites on the abdomen and back of the rabbits. Three weeks later, 100 μg of immunogen was mixed with an equal volume of incomplete Freund's adjuvant to prepare an emulsion, which was also injected subcutaneously at multiple sites on the abdomen and back of the rabbits. Two booster immunizations were performed. After the three immunizations, rabbit serum samples were collected, diluted, and the titer against Human S100A7 was determined by ELISA. Rabbits with high serum titers were given a booster immunization with 200 μg of immunogen injected subcutaneously at multiple sites. Three days later, the animals were sacrificed and their spleens were harvested.

[0083] 2. Isolation and sorting of B lymphocytes from the spleen: B lymphocytes from the spleen were isolated using conventional methods and sorted to obtain antigen-specific B lymphocytes. For relevant methods, please refer to the patents "Method for efficiently isolating single antigen-specific B lymphocytes from spleen cells (Publication No.: CN110016462A, Publication Date: 2019-07-16)" and "An in vitro culture system for B lymphocytes and its application (Publication No.: CN111518765A, Publication Date: 2020-08-11)".

[0084] 3. Cloning of rabbit monoclonal antibody genes: Positive clones were identified by antigen-coated ELISA using the supernatant of cultured B lymphocytes. Cells of positive clones were collected, lysed, and processed according to Quick-RNA sequencing. TM RNA was extracted using the MicroPrep kit instructions (purchased from ZYMO, catalog number R1051) and reverse transcribed into cDNA. Using cDNA as a template, PCR was employed to amplify the naturally paired rabbit monoclonal antibody light chain variable region (VL) and heavy chain variable region (VH) from the corresponding positive clones' cDNA. The PCR reaction mixture consisted of 4 μL cDNA, 1 μL forward primer (10 mM), 1 μL reverse primer (10 mM), 12.5 μL 2×Gloria HiFi (from ABclonal, catalog number RK20717), and 6.5 μL H2O. The PCR amplification program was as follows: 98℃ pre-denaturation for 30 s, followed by 40 cycles of 98℃ for 10 s, 64℃ for 30 s, and 72℃ for 30 s, with a final incubation at 72℃ for 5 min. The resulting reaction solution was stored at 4℃. The primer sequences (5'-3') for amplifying the VL and VH genes are shown below, where F and R represent the forward and reverse primers, respectively:

[0085] VL-F: tgaattcgagctcggtacccATGGACACGAGGGCCCCCAC (see SEQ ID NO. 29);

[0086] VL-R: cacacacgatggtgactgTTCCAGTTGCCACCTGATCAG (see SEQ ID NO. 30);

[0087] VH-F: tgaattcgagctcggtacccATGGAGACTGGGCTGCGCTG (see SEQ ID NO. 31);

[0088] VH-R: gtagcctttgaccaggcagcCCAGGGTCACCGTGGAGCTG (see SEQ ID NO. 32).

[0089] The amplification products were sequenced to obtain the variable region of the antibody and its encoding gene sequence; the heavy chain constant region (CH) was obtained by searching for rabbit-derived IgG gamma C reign in the IMGT online database (www.imgt.org), and the light chain constant region (CL) was obtained by searching for rabbit-derived IgG Kappa C reign.

[0090] 4. Production and purification of rabbit monoclonal antibodies: To obtain multiple rabbit monoclonal antibodies recognizing recombinant Human S100A7 protein, the CL and CH genes were inserted into the mammalian expression vector pBR322. The resulting vector map is shown in [reference needed]. Figure 1 In this model, pBR322 origin and f1origin are replication promoters, Ampcillin is the resistance gene, CMVpromoter is the transcription promoter, SV40 PAterminator is the tailing signal, the light chain constant is the nucleotide sequence of CL (left figure), and the heavy chain constant is the nucleotide sequence of CH (right figure). The amplified VL and VH genes were then ligated to the expression vector pBR322 carrying the CL and CH genes, linearized with XbaI and NheI restriction endonucleases respectively, via homologous recombination to obtain complete light and heavy chain gene expression vectors. Sequencing confirmed the successful vector construction.

[0091] To achieve antibody secretory expression, signal peptide sequences are typically added to the anterior ends of the VL and VH genes. These signal peptides can be commonly used antibody expression signal peptides in the field, such as those found in patents "Rabbit Monoclonal Antibody Against Human Interferon α2 and Its Application (Publication No.: CN116063487A, Publication Date: 2023-05-05)" and "High Affinity Human IL-5 Rabbit Monoclonal Antibody and Its Application (Publication No.: CN115819578A, Publication Date: 2023-03-21)". In these patents, the VL gene has the signal peptide "MDTRAPTQLLGLLLLWLPGATF" or "MDTRAPTQLLGLLLLWLPGARC", and the VH gene has the signal peptide "METGLRWLLLVAVLKGVQC". Of course, those skilled in the art can replace the signal peptide with other ones after obtaining the antibody sequence of this invention for antibody expression. Therefore, the signal peptide sequence is not shown in Tables 1-2 of this embodiment.

[0092] The gene encoding the signal peptide “MDTRAPTQLLGLLLLWLPGATF” can be atggacacgagggcccccactcagctgctgggacttctgctgctttggctgcctggcgccacgttc; the gene encoding the signal peptide “MDTRAPTQLLGLLLLWLPGARC” can be atggacacgagggcccccactcagctgctgggtctcctgctgctgtggttgcccggagcaagatgc; and the gene encoding the signal peptide “METGLRWLLLVAVLKGVQC” can be atggagactgggctgcgctggcttctcctggtagcggtgctgaag ggggttcaatgc or atggagactgggctgcgctggcttctcctggtggcagtactcaaaggtgttcagtgt.

[0093] Expression vectors containing both the light chain (FL) and heavy chain (FH) genes were successfully constructed and transfected into 293F cells. After transfection and culturing for 72-96 hours, recombinant rabbit monoclonal antibodies recognizing Human S100A7 were obtained from the culture supernatant. The recombinant rabbit monoclonal antibody recognizing Human S100A7 protein was purified from the culture supernatant using Protein A affinity gel resin (purchased from Tiandi Renhe, catalog number SA023100). The antibody purity was verified to be >95% by 12% SDS-PAGE gel electrophoresis. The purified antibody was aliquoted and stored at -20°C for later use.

[0094] 1.5 Antibody performance testing: After obtaining multiple recombinant expression antibodies, the antibodies were identified by affinity and antigen recognition epitopes to obtain the target antibody strains A and B of this invention.

[0095] 1) Identification of antibody affinity: Antigen-antibody binding curves were determined using a Gator biomolecular interaction analyzer from Probe Life to identify antibody affinity. First, the antigen protein Human S100A7 was immobilized onto an HFC (Anti-HIgG FC) probe (purchased from Gator Bio, catalog number 160003) at a concentration of 3 μg / mL. Then, the immobilized probe was placed in an antibody solution to test antibody binding to the antigen. The concentration of antibody A was 3.3 μg / mL, and the concentration of antibody B was 5.23 μg / mL. Once antigen-antibody binding reached saturation, the probe was transferred to a dissociation system to complete the dissociation process. The affinity curves for antibodies A and B are shown below. Figure 2-3 In the figure, the vertical axis represents the change in the thickness of the conjugate after the probe binds to the antibody and protein, and the horizontal axis represents the binding time. The dark gray curve is the real-time binding numerical curve, and the light gray curve is the fitted average curve. The affinity constants calculated by curve fitting are shown in Table 3, where the dissociation coefficient K... off A constant characterizing the rate of antibody-antigen dissociation, the binding coefficient K. on The affinity constant K is a constant characterizing the rate at which an antibody binds to its target. D For K off / K on The ratio of antibody to antigen represents the dissociation equilibrium constant between the antibody and the antigen.

[0096] Table 3. Results of affinity-related parameters for monoclonal antibodies A and B.

[0097] Monoclonal antibodies <![CDATA[K off (1 / s)]]> <![CDATA[K on (1 / Ms)]]> <![CDATA[K D (M)]]> A <![CDATA[1.14×10 -4 ]]> <![CDATA[2.20×10 5 ]]> <![CDATA[5.18×10 -10 ]]> B <![CDATA[8.19×10 -4 ]]> <![CDATA[2.70×10 5 ]]> <![CDATA[3.03×10 -9 ]]>

[0098] Table 3 shows the affinity constants K for antibodies A and B against human S100A7. D The concentrations were 0.518 nM and 3.03 nM, respectively, indicating that rabbit monoclonal antibodies A and B have high affinity for recombinant Human S100A7.

[0099] 2) Identification of antigenic epitopes: The obtained antibodies were tested for antigenic epitopes by performing pairing reactions using a Gator biomolecular interaction analyzer from Probe Life. First, the antigen protein was immobilized onto a Human S100A7 protein and then onto an HFC (Anti-HIgG FC) probe at a concentration of 3 μg / mL. The immobilized probe was then sequentially placed into solutions of antibodies A and B, allowing antibody strains A and B to bind to S100A7 protein until saturation. The binding characteristics of different antibodies on the antigen were analyzed to determine the recognition epitopes of antibody strains A and B. The results are shown in [Figure number missing]. Figure 4 The vertical axis represents the change in the thickness of the conjugate after the probe binds to the antibody and protein, and the horizontal axis represents the binding time.

[0100] from Figure 4 As can be seen, the probe immobilized with Human S100A7 can clearly bind antibody A, which serves as the second antibody, after binding to B. At this time, the shift value is 0.203. This shows that the two antibodies bind to different epitopes on the Human S100A7 protein. Therefore, the two can be used as paired antibodies for double antibody sandwich enzyme-linked immunosorbent assay.

[0101] Example 2: Establishment of a double-antibody sandwich enzyme-linked immunosorbent assay (ELISA) system based on antibodies A and B and its analytical sensitivity.

[0102] Biotin labeling of antibody B: Antibody B was prepared into a 1 mg / mL solution. NHS-LC-biotin (N-succinimino-6-biotin aminocaproic acid, purchased from Thermo) was prepared into a 60 mg / mL solution using dimethyl sulfoxide (DMSO). 200 μL of the 1 mg / mL antibody B solution was added to 10 μL of the 60 mg / mL NHS-LC-biotin solution. After mixing, the solution was incubated at room temperature for 30 min. Then, 50 μg of 500 mM Tris-HCl (pH 9.0) was added to terminate the reaction. Finally, a large amount of 1×PBS buffer (pH 7.4) was added, and the solution was centrifuged using a centrifuge column with an exclusion limit of 30 kDa to remove excess biotin molecules and equilibrate the buffer system, yielding biotin-labeled antibody B (B-biotin).

[0103] A double-antibody sandwich enzyme-linked immunosorbent assay (ELISA) was established using antibody A as the capture antibody and antibody B-biotin as the detection antibody. The steps are as follows: 1) Coating with capture antibody A: Antibody A was diluted to 4 μg / mL with 1×PBS and added to a 96-well microplate at 100 μL / well. The plate was covered with a cover film and incubated at 4℃ for 16-20 h; 2) Washing: After incubation, the liquid in the wells was discarded, and the plate was washed once with 1×PBST. 300 μL of sample was added, and the plate was allowed to stand for 40 s before discarding the liquid in the wells; 3) Blocking: Blocking buffer (1×PBS containing 2% BSA, 5% sucrose, 0.05% Tween 20 and 0.1% Proclin 300, pH 10) was prepared. 7.2) Add 200 μL / well to the plate wells, cover with the cover film, and block at 37℃ for 2 h. After blocking, discard the blocking solution, pat the plate dry, and then dry it in a 37℃ oven for 0.5-2 h. 4) Add antigen protein: Add recombinant Human S100A7 protein (purchased from RD, catalog number 9085-SA) to dilution buffer (1×PBS containing 2% BSA, 0.05% Tween 20 and 0.1% Proclin 300, pH 10). 7.2) Dilute to concentrations of 6000, 3000, 1500, 550, 375, 187.5, 93.75, and 0 pg / mL, then add 100 μL / well sequentially to each well of the ELISA plate, cover with the cover film, and incubate at 37°C for 2 hours; 5) Wash the plate: Same as step 2); 6) Add detection antibody B: Dilute biotin-labeled antibody B (B-biotin) to 0.05 μg / mL, then add 100 μL / well sequentially to each well of the ELISA plate, cover with the cover film, and incubate at 37°C for 1 hour; 7) Wash the plate: Same as step 2); 8) Add SA-HRP: Add 100×SA-HRP (horseradish peroxidase-labeled streptavidin) to each well. The concentrated solution (purchased from Wuhan Sanying Biotechnology Co., Ltd., catalog number SA00001-0) was diluted 100-fold and added to each well at a rate of 100 μL. The plate was then covered with a cover film and incubated at 37°C for 0.5 h. 9) Washing: Same as step 2). 10) Adding TMB chromogenic solution: 3,3',5,5'-tetramethylbenzidine (TMB) chromogenic solution (purchased from Sizhengbai, catalog number 4ATMB1000) was added to each well at a rate of 100 μL. The plate was then covered with a cover film and incubated at 37°C for 15 min. 11) Reading: After incubation, the plate was removed, and 50 μL of stop solution (1 mol / L hydrochloric acid) was added to each well. The plate was then immediately read using a microplate reader.

[0104] With Human S100A7 protein concentration as the x-axis, the corrected absorbance value Y1 (Y1 = OD) 450nm -OD 630nm Plot a graph with the vertical axis as the ordinate, see... Figure 5The results showed that antibody A, as the capture antibody, and antibody B, as the detection antibody, demonstrated good linearity in the ELISA detection of human S100A7, resulting in good accuracy of the detection results.

[0105] The absorbance of the average absorbance of the 16 blank wells (without dilution of standard protein) and twice the standard deviation was used as the absorbance value for sensitivity. Substituting this value into the standard curve yielded the concentration, which was then used as the sensitivity of the detection system (see Table 4). The results showed that the detection limit of the double-antibody sandwich ELISA detection system of this invention was as low as 162.44 pg / mL, exhibiting high sensitivity.

[0106] Table 4. Sensitivity of the double-antibody sandwich enzyme-linked immunosorbent assay (ELISA) based on antibodies A and B.

[0107]

[0108] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. An antibody targeting human S100A7 protein, characterized in that, The antibody is either a primary antibody or a secondary antibody, wherein: The amino acid sequences of the complementarity-determining regions CDR1, CDR2 and CDR3 on the variable region of the first antibody light chain are shown in SEQ ID NO. 3-5, and the amino acid sequences of the complementarity-determining regions CDR1, CDR2 and CDR3 on the variable region of the heavy chain are shown in SEQ ID NO. 8-10, respectively. The amino acid sequences of the complementarity-determining regions CDR1, CDR2 and CDR3 on the variable region of the light chain of the second antibody are shown in SEQ ID NO. 13-15, and the amino acid sequences of the complementarity-determining regions CDR1, CDR2 and CDR3 on the variable region of the heavy chain are shown in SEQ ID NO. 18-20, respectively.

2. The antibody against human S100A7 protein according to claim 1, characterized in that, The amino acid sequence of the light chain variable region of the first antibody is shown in SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.7; The amino acid sequence of the light chain variable region of the second antibody is shown in SEQ ID NO.12, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.

17.

3. The antibody against human S100A7 protein according to claim 2, characterized in that, The amino acid sequence of the light chain of the first antibody is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.6; The amino acid sequence of the light chain of the second antibody is shown in SEQ ID NO.11, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.

16.

4. The antibody against human S100A7 protein according to claim 1, characterized in that, The first antibody or the second antibody is a full-length antibody or the antigen-binding region of the full-length antibody; The antigen-binding region is selected from at least one of the following fragments: Fab fragment, F(ab)2 fragment, Fv fragment, (Fv)2 fragment, scFv fragment, and sc(Fv)2 fragment.

5. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the first antibody or the second antibody as described in any one of claims 1-4.

6. The nucleic acid molecule according to claim 5, characterized in that, The nucleic acid sequence of the light chain variable region of the first antibody is shown in SEQ ID NO.22, and the nucleic acid sequence of the heavy chain variable region is shown in SEQ ID NO.24; The nucleic acid sequence of the light chain variable region of the second antibody is shown in SEQ ID NO.26, and the nucleic acid sequence of the heavy chain variable region is shown in SEQ ID NO.

28.

7. The nucleic acid molecule according to claim 6, characterized in that, The nucleic acid sequence of the light chain of the first antibody is shown in SEQ ID NO.21, and the nucleic acid sequence of the heavy chain is shown in SEQ ID NO.23; The nucleic acid sequence of the light chain of the second antibody is shown in SEQ ID NO.25, and the nucleic acid sequence of the heavy chain is shown in SEQ ID NO.

27.

8. An antibody pair targeting human S100A7 protein, characterized in that, It consists of the first antibody and the second antibody as described in any one of claims 1-4.

9. A kit for detecting human S100A7 protein, characterized in that, The kit includes an antibody against human S100A7 protein as described in any one of claims 1-4 or an antibody pair against human S100A7 protein as described in claim 8.

10. The kit for detecting human S100A7 protein according to claim 9, characterized in that, The kit is a double-antibody sandwich enzyme-linked immunosorbent assay kit, which includes a first antibody and a second antibody. The first antibody is a capture antibody, and the second antibody is a detection antibody and is conjugated with a detection label.

Images