Dehalogenation bacillus and application thereof in repairing halohydrocarbon pollution

Abstract

The invention relates to the field of environmental bioremediation, and relates to a dehalogenation bacillus strain and application thereof in remediation of chlorinated phenol halogenated hydrocarbon pollutants. The strain is preserved in the China General Microbiological Culture Collection Center (CGMCC) on February 24, 2024, the address is Institute of Microbiology, Chinese Academy of Sciences, No.3, No.1 Yard, Beichen West Road, Chaoyang District, Beijing, the postal code is 100101, and the preservation number is CGMCC 41183. The invention further discloses a preparation method of the strain. The strain disclosed by the invention provides an important strain resource for in-situ remediation of a chlorophenol polluted site.

Description

Technical Field

[0001] The invention relates to the field of environmental bioremediation, and in particular to a dehalogenating bacterium and application thereof in remediating chlorinated phenol-type halogenated hydrocarbon pollutants. Background Art

[0002] Chlorophenol is a kind of aromatic halogenated hydrocarbon, which can be divided into monochlorinated and polychlorinated types according to the number of chlorine atoms on the benzene ring. Since the 1920s, chlorophenol has been widely used in papermaking, petrochemicals, pharmaceuticals, wood protection, flame retardants and other industries as a key industrial raw material and intermediate. However, the pollution problem of chlorophenol in the environment is becoming increasingly serious. It is widely detected in media such as surface water, soil and sediment, and has become a serious environmental hazard.

[0003] The degradation and conversion of chlorophenols directly affect their risks, ecotoxicity and environmental fate in the environment. Therefore, relevant research has always been a research hotspot in the field of environmental science. Under anaerobic conditions, the degradation of chlorophenols is usually subject to the dual constraints of microbial metabolism and environmental conditions, and the degradation rate is slow and often incomplete. Chlorophenols are accumulated over a long period of time in environments such as deep soil layers, sediments and groundwater, forming lasting pollution. Therefore, how to achieve the complete degradation of chlorophenols remains a major technical problem.

[0004] Due to the electronegativity of chlorine atoms on the benzene ring, chlorophenols are more likely to undergo reductive dechlorination reactions that break C-Cl bonds in anaerobic environments. Organohalogen-respiring bacteria are the core microorganisms that drive the reductive dechlorination process and are widely distributed in various anaerobic environments. These bacteria use halogenated organic matter (such as chlorophenols) as electron acceptors to achieve reductive dechlorination reactions during metabolism, degrading high-risk, recalcitrant halogenated compounds into non-toxic or more easily degradable products. Studies have shown that polychlorinated compounds such as trichlorophenol, tetrachlorophenol and pentachlorophenol are easily converted into low-chlorinated or monochlorophenols through reductive dechlorination in anaerobic environments, while the resulting monochlorophenols (such as 4-chlorophenol) are still highly toxic and difficult to achieve deep reductive dechlorination. Therefore, discovering and identifying organohalogen-respiring bacteria that can completely remove chlorine-substituted groups and promote further degradation of phenol has important research value and practical significance for solving the technical bottleneck in the degradation process of chlorophenols. Summary of the invention

[0005] The purpose of the present invention is to provide a dehalogenating bacterium and its application in degrading chlorinated phenol pollutants.

[0006] To achieve the above object, the technical solution adopted by the present invention is:

[0007] A strain of Dehalobacter, Dehalobacter sp. strain Co4CP, was deposited in the General Microbiology Center of China Microorganism Culture Collection (CGMCC) on February 24, 2024, address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code: 100101, Deposit number: CGMCCNo.41183, classification name: Dehalobacter sp.

[0008] The 16S rRNA gene sequence of the Co4CP strain is 99.7% similar to that of the Dehalobacterium TCP1 strain, so the Co4CP strain is identified as belonging to Dehalobacterium.

[0009] An application of the Dehalogenating Bacterium, and an application of the Co4CP strain in dechlorinating and degrading halogenated hydrocarbon pollutants.

[0010] The halogenated hydrocarbon is one or more of 2,4,6-trichlorophenol, 2,4-dichlorophenol and 4-chlorophenol.

[0011] A bacterial agent for degrading halogenated hydrocarbon pollutants, the bacterial agent containing the dehalogenating bacterium Co4CP strain.

[0012] The bacterial agent is one or more of the culture, bacterial suspension, concentrate and separation liquid of the strain.

[0013] An application of the bacterial agent for degrading halogenated hydrocarbon pollutants, wherein the bacterial agent is used in degrading chlorinated phenol-type halogenated hydrocarbon pollutants.

[0014] A method for degrading chlorinated phenol pollutants comprises the steps of inoculating the dehalogenating bacterium Co4CP strain in an anaerobic environment to be treated, adding a carbon source and an electron donor, and thus degrading the chlorinated phenol pollutants in the environment.

[0015] The carbon source is lactic acid and / or acetic acid, and the electron donor is hydrogen or a material that can be fermented to produce a carbon source and an electron donor, such as waste vegetable oil;

[0016] The chlorophenol is one or more of 2,4,6-trichlorophenol, 2,4-dichlorophenol and 4-chlorophenol.

[0017] The advantages of the present invention are:

[0018] The Co4CP strain obtained by the invention is an indigenous dehalogenating bacterium strain screened from the bottom mud of a polluted river.

[0019] The 16S rRNA gene sequence similarity comparison showed that the Co4CP strain had a similarity of 99.7% with the Dehalobacterium TCP1 strain, so the Co4CP strain was identified as Dehalobacterium.

[0020] The Co4CP strain can degrade 2,4,6-trichlorophenol, 2,4-dichlorophenol and 4-chlorophenol into phenol under the growth conditions of 37℃ and pH 7.2. The degradation ability of the Co4CP strain provides an important bacterial resource for the in-situ remediation of chlorophenol-contaminated sites. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The cell morphology of the Co4CP strain under a scanning electron microscope provided in the embodiment of the present invention;

[0022] Figure 2 The degradation curve of 2,4,6-trichlorophenol by the Co4CP strain provided in the embodiment of the present invention;

[0023] Figure 3 This is the degradation curve of 4-chlorophenol by the Co4CP strain provided in the embodiment of the present invention. DETAILED DESCRIPTION

[0024] The technical solution of the present invention is further explained below in conjunction with specific embodiments, but it should not be understood as limiting the present invention.

[0025] Example 1: Isolation, purification and identification of strains

[0026] (1) Prepare basal culture medium:

[0027] The components of anaerobic inorganic salt culture medium are: NaCl 1.0g / L, MgCl2·6H2O 0.5g / L, KH2PO40.2g / L, NH4Cl 0.3g / L, KCl 0.3g / L, CaCl2·2H2O 0.015g / L, FeCl2·4H2O1.5mg / L, CoCl2·6H2O 190μg / L, MnCl2·4H2O 100μg / L, ZnCl2 70μg / L, H3BO36μg / L, Na2MoO4·2H2O 36μg / L, NiCl2·6H2O 24μg / L, CuCl2·2H2O 2μg / L, Na2SeO3·5H2O 6μg / L, Na2WO4·2H2O 8μg / L, resazurin indicator 0.025% (w / v), L-cysteine ​​24mg / L, dithiothreitol 38.5mg / L, NaHCO3 2.52g / L (30mM), adjust the pH to 7.2-7.3. After high-pressure sterilization at 121℃ for 15 minutes, add multivitamins. The final concentrations of various vitamins in the culture medium are as follows: biotin 20μg / L, folic acid 20μg / L, pyridoxine hydrochloride 100μg / L, riboflavin 50μg / L, thiamine 50μg / L, pantothenic acid 50μg / L, niacin 50μg / L, vitamin B12 50μg / L, p-aminobenzoic acid 50μg / L, lipoic acid 50μg / L.

[0028] (2) Enrichment of Dehalobacterium:

[0029] 80 mL of the anaerobic inorganic salt medium described in step (1) above was dispensed into a 120 mL serum bottle, 5 mM sodium acetate was added as a carbon source, 10 mL of hydrogen (413.2 μmol) was added as an electron donor, and 0.1 mM 2,4,6-trichlorophenol was added as an electron acceptor, and the headspace gas was N2 / CO2 (80 / 20, v / v). In an anaerobic glove box, 3 mL of sediment slurry suspension (collected from Xihe, Shenyang, Liaoning) was inoculated and the serum bottle was sealed with a blue rubber stopper and an aluminum cap to establish an enrichment culture system. The culture was kept static at 37°C in the dark, and the phenol generation process was monitored by liquid chromatography, and the mass balance was calculated. After the 2,4,6-trichlorophenol was completely converted into phenol, the above culture was repeatedly transferred to the enrichment system prepared in step (2) at an inoculum amount of 3% (v / v), and the number of transfers was 5 times.

[0030] (3) Isolation of Dehalogenating Bacteria:

[0031] 9 mL of the inorganic salt culture medium in step (1) was dispensed into a 20 mL culture bottle, the headspace gas was N2 / CO2 (80 / 20, v / v), and 1 mL of the enriched culture solution of the 2,4,6-trichlorophenol-reducing anaerobic degrading bacteria was transferred from the 120 mL serum bottle in step (2) to the culture bottle to establish a 10 -1 Repeat the above 10-fold gradient dilution operation until a 10-fold gradient dilution is established. -10 Dilution bottle. Wait for 10 -10 After 2,4,6-trichlorophenol in the diluted culture medium is completely degraded to phenol, about 2.5 mL of the culture medium is transferred to the inorganic salt culture medium (1). The carbon source, electron donor and electron acceptor of the same culture system as (2) are added, and the culture is kept static at 37° C. in the dark, and the phenol generation process is monitored by liquid chromatography to separate and purify the 2,4,6-trichlorophenol-degrading bacteria.

[0032] (4) Identification of strains:

[0033] The 2,4,6-trichlorophenol-degrading strain obtained by the above-mentioned screening process has a rod-shaped body (see Figure 1 The genome was extracted using a soil genomic DNA extraction kit, and PCR amplification was performed using the universal primers 27F (5'-AGAGTTTGATCCTGGCTCAG-3') and 1492R (5'-GGTTACCTTGTTACGACTT-3') of the bacterial 16S rRNA gene. The amplified product was submitted to a sequencing company for sequencing.

[0034] The 16S rRNA gene sequence is:

[0035] AGCATTGTCGGCGTGCTACACATGCAGTCGAACGGAGCTACGCCTGA

[0036] CACCGAGTGCTTTGCACATAGATATGTGGAGCAAGCGAGTGCGCGAA

[0037] CGAAGAGAGCGCACCACGCATTAAATAAGTGCCAACACATATTGAGTA

[0038] TGAAGGAAAAGCACTGGGTGTCAGGTGGAGCTTAGTGGCGAACGGG

[0039] TGAGTAACGCGTGGGTAACCTGCCCTTAAGACCGGGACAACAGCTGG

[0040] AAACGGCTGCTAATACCGGATGTATTGTCCGAGAGGCATCTCTTGGAG

[0041] AAGAAAGCTGGCCTCTGAAAATGCTAGCGCTTAGGGATGGACCCGCG

[0042] TCTGATTAGCTAGTTGGTGGGGTAAAGGCCTACCAAGGCGACGATCA

[0043] GTAGCCGGCCTGAGAGGGTAAACGGCCACACTGGGACTGAGACACG

[0044] GCCCAGACTCCTACGGGAGGCAGCAGTGGGGAATCTTCCGCAATGGA

[0045] CGAAAGTCTGACGGAGCAACGCCGCGTGTATGAAGAAGGCCTTCGGG

[0046] TTGTAAAATACTGTTGTTAGGGAAGAACGGCTTAAGTGTGAATAATGC

[0047] TTGAGATTGACGGTACCTAACGAGGAAGCCCCGGCTAACTACGTGCC

[0048] AGCAGCCGCGGTAATACGTAGGGGGCAAGCGTTGTCCGGAATCATTG

[0049] GGCGTAAAGGGCGCGTAGGCGGCTATATAAGTCTGATGTGAAAGTGC

[0050] GGAGCTTAACTCCGTAAAGCATTGGAAACTGTATGGCTTGAGGACAG

[0051] GAGAGGAAAGTGGAATTCCACGTGTAGCGGTGAAATGCGTAGAGATG

[0052] TGGAGGAACACCAGTGGCGAAGGCGACTTTCTGGACTGTAACTGACG

[0053] CTGAGGCGCGAAAGCGTGGGGAGCGAACAGGATTAGATACCCTGGTA

[0054] GTCCACGCCGTAAACGATGAATGCTAGGTGTAGAGGGTATCGACCCCT

[0055] TCTGTGCCGCAGTTAACACAATAAGCATTCCGCCTGGGGAGTACGGCC

[0056] GCAAGGTTGAAACTCAAAGGAATTGACGGGGGCCCGCACAAGCGGT

[0057] GGAGCATGTGGTTTAATTCGACGCAACGCGAAGAACCTTACCAAGGC

[0058] TTGACATCCAACTAATCCCGTAGAGATATGGGAGTGCCCTTCGGGGAA

[0059] AGTTGAGACAGGTGGTGCATGGTTGTCGTCAGCTCGTGTCGTGAGAT

[0060] GTTGGGTTAAGTCCCGCAACGAGCGCAACCCCTATATTTAGTTGCTAA

[0061] CAGGTAAAGCTGAGAACTCTAGATAGACTGCCGGTGACAAACCGGAG

[0062] GAAGGTGGGGATGACGTCAAATCATCATGCCCCTTATGTCTTGGGCTA

[0063] CACACGTGCTACAATGGACGGTACAGACGGAAGCGAAGCCGCGAGG

[0064] TGAAGCAAATCCGAGAAAGCCGTTCTCAGTTCGGATTGCAGGCTGCA

[0065] ACTCGCCTGCATGAAGTCGGAATCGCTAGTAATCGCAGGTCAGCACA

[0066] CTGCGGTGAATACGTTCCCGG

[0067] The BLAST search results of the 16S rRNA gene sequence of the strain showed that the species homology with the TCP1 strain from the genus Dehalobacter was 99.7%. The strain was classified into the genus Dehalobacter and named Co4CP, and deposited in the General Microbiological Center (CGMCC) of the China Microbiological Culture Collection Administration, address: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code: 100101, Deposit Number: CGMCC No.41183.

[0068] Example 2: Identification of the degradation performance of Co4CP strain on 2,4,6-trichlorophenol

[0069] Take 80 mL of the anaerobic inorganic salt basal medium described in step (1) of the above embodiment 1, add 5 mM sodium acetate as a carbon source, 10 mL hydrogen (413.2 μmol) as an electron donor, and 0.1 mM 2,4,6-trichlorophenol as an electron acceptor. The headspace gas is N2 / CO2 (80 / 20, v / v), and the Co4CP pure bacteria are inoculated at 3% (v / v). The culture is kept in a dark place at 37°C, and the generation process of phenol is monitored by liquid chromatography. The liquid chromatography detection conditions are: using an Agilent Zorbax eclipseXDB-C18 liquid chromatography column (4.6 mm×250 mm, 5 μm), the mobile phase A is acetonitrile, the mobile phase B is a 2% acetic acid aqueous solution, the volume ratio of mobile phase A to B is 55:45, and the flow rate is 1.0 mL·min -1 , column temperature was 35°C, diode array detector (DAD) detection wavelength was set to 282nm, injection volume was 20μL, and monitoring time was 10min. The full wavelength scanning range of DAD detector was 200~400nm. The degradation of 2,4,6-trichlorophenol was detected based on the concentration values ​​of 2,4,6-trichlorophenol, intermediate product 2,4-dichlorophenol and 4-chlorophenol, and final product phenol (see Figure 2 ). The analysis results showed that the Co4CP strain could degrade 0.1mM 2,4,6-trichlorophenol into phenol in a period of about 190-220 days.

[0070] Example 3: Identification of the degradation performance of Co4CP strain on 4-chlorophenol

[0071] Take 80 mL of the anaerobic inorganic salt basal medium described in step (1) of the above Example 1, add 5 mM sodium acetate as a carbon source, 10 mL hydrogen (413.2 μmol) as an electron donor, and 0.1 mM 4-chlorophenol as an electron acceptor. The headspace gas is N2 / CO2 (80 / 20, v / v), and the Co4CP pure bacteria are inoculated at 3% (v / v). The culture is kept at 37°C in the dark, and the generation process of phenol is monitored by liquid chromatography. The liquid chromatography detection conditions are the same as those in Example 2. The degradation of 4-chlorophenol is detected based on the measured concentration values ​​of 4-chlorophenol and phenol (see Figure 3 ). The analysis results showed that the Co4CP strain could degrade 0.1 mM 4-chlorophenol into phenol in about 45 days.

[0072] In summary, the Dehalobacterium Co4CP strain provided by the present invention can completely convert 0.1mM 2,4,6-trichlorophenol into phenol in about 200-300 days, 2,4-dichlorophenol is an intermediate product, and the generated 2,4-dichlorophenol is quickly further degraded into 4-chlorophenol, indicating that the Co4CP strain has the ability to degrade 2,4-dichlorophenol. The Dehalobacterium Co4CP strain can completely convert 0.1mM 4-chlorophenol into phenol in 45 days, showing a faster degradation rate.

[0073] The strain is prepared into a bacterial agent according to the above description, for example, a carbon source, an electron donor and an electron acceptor are added to an inorganic salt culture medium, and the Dehalogenobacter Co4CP strain is inoculated and cultured at 37°C in the dark; wherein the carbon source is acetic acid and the electron donor is hydrogen; 5mM sodium acetate and 10mL hydrogen (413.2μmol) are added to each 80mL inorganic salt culture medium, and the inoculation amount is transferred at 3% (v / v); the obtained culture is centrifuged to collect the precipitate and resuspended to obtain a resuspended liquid; the liquid phase is a separation liquid; the culture is concentrated to obtain a concentrate, that is, the bacterial agent. Applying it to the environment or soil has good application prospects for the bioremediation of chlorophenol-contaminated sites.

[0074] The above-described embodiments are preferred application cases of the present invention, but do not impose any form of limitation on the present invention. In actual application, without departing from the scope of the technical solution of the present invention, the above-disclosed technical contents can be used to make slight changes or modifications to equivalent embodiments with equivalent changes.

Claims

1. A strain of Dehalobacterium, characterized in that: Dehalobacter sp. strain Co4CP, the strain was deposited in the General Microbiology Center (CGMCC) of China Microorganism Culture Collection Administration on February 24, 2024, address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code: 100101, Deposit Number: CGMCC 41183.

2. An application of the Dehalogenobacter according to claim 1, characterized in that: The Co4CP strain is used for dechlorinating and degrading halogenated hydrocarbon pollutants.

3. The use of the Dehalogenobacter according to claim 2, characterized in that: The halogenated hydrocarbon is one or more of 2,4,6-trichlorophenol, 2,4-dichlorophenol and 4-chlorophenol.

4. A bacterial agent for degrading halogenated hydrocarbon pollutants, characterized in that: The bacterial agent contains the Dehalogenobacter Co4CP strain according to claim 1.

5. The microbial agent for degrading pollutants according to claim 4, characterized in that: The bacterial agent is one or more of the culture, bacterial suspension, concentrate and separation liquid of the strain.

6. An application of the bacterial agent for degrading halogenated hydrocarbon pollutants according to claim 4, characterized in that: The bacterial agent is used in degrading chlorinated phenol-type halogenated hydrocarbon pollutants.

7. A method for degrading chlorinated phenol pollutants, characterized in that: The chlorinated phenol pollutants in the environment can be degraded by inoculating the Dehalogenobacter Co4CP strain described in claim 1 into the anaerobic environment to be treated and adding a carbon source and an electron donor.

8. The method for degrading chlorinated phenol pollutants according to claim 7, characterized in that: The chlorophenol is one or more of 2,4,6-trichlorophenol, 2,4-dichlorophenol and 4-chlorophenol.

Images