Dehalococcoides strain and application thereof in repairing halogenated hydrocarbon pollution

Abstract

The present application relates to the field of environmental bioremediation, and discloses a dehalobacter and application of the dehalobacter in remediation of chlorophenol halogenated hydrocarbon pollutants. The dehalobacter is Co4CP (Dehalobacter sp. strain Co4CP), and the strain has been preserved in the China General Microbiological Culture Collection Center (CGMCC) on February 24, 2024, located at No. 1, Xibahe Road, Hua-yuan District, Beijing, China, and the Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101, with a preservation number of CGMCC 41183. The strain provides an important strain resource for in-situ remediation of chlorophenol contaminated sites.

Description

Technical Field

[0001] This invention relates to the field of environmental bioremediation, specifically to a dehalogenated bacillus strain and its application in the remediation of chlorophenol-based halogenated hydrocarbon pollutants. Background Technology

[0002] Chlorophenols are a class of aromatic halogenated hydrocarbons, classified into monochlorinated and polychlorinated types based on the number of chlorine atoms substituted on their benzene rings. Since the 1920s, chlorophenols have been widely used as a key industrial raw material and intermediate in various industries, including papermaking, petrochemicals, pharmaceuticals, wood preservation, and flame retardants. However, the environmental pollution caused by chlorophenols is becoming increasingly serious, with widespread detection in surface water, soil, and sediments, posing a significant environmental hazard.

[0003] The degradation and transformation of chlorophenols directly affect their environmental risks, ecotoxicity, and environmental fate; therefore, related research has always been a hot topic in environmental science. Under anaerobic conditions, the degradation of chlorophenols is usually constrained by both microbial metabolic capacity and environmental conditions, resulting in slow and often incomplete degradation rates. This leads to the long-term accumulation of chlorophenols in deep soil layers, sediments, and groundwater, forming persistent pollution. Therefore, achieving the complete degradation of chlorophenols remains a major technical challenge.

[0004] Due to the electronegativity of the chlorine atom on the benzene ring, chlorophenols are more prone to reductive dechlorination reactions involving the breaking of the C-Cl bond in anaerobic environments. Organohalogenating bacteria are the core microorganisms driving this reductive dechlorination process and are widely distributed in various anaerobic environments. These bacteria utilize halogenated organic compounds (such as chlorophenols) as electron acceptors to achieve reductive dechlorination reactions during metabolism, degrading high-risk, persistent halogenated compounds into non-toxic or more easily degradable products. Studies have shown that polychlorinated compounds such as trichlorophenol, tetrachlorophenol, and pentachlorophenol are easily converted into hypochlorous or monochlorophenols through reductive dechlorination in anaerobic environments. However, the resulting monochlorophenols (such as 4-chlorophenol) still possess high toxicity and are difficult to degrade deeply through reductive dechlorination. Therefore, discovering and identifying organohalogenating bacteria capable of completely removing chlorinated substituents and thus driving further degradation of phenols is of significant research value and practical importance for overcoming the technical bottlenecks in the degradation of chlorophenols. Summary of the Invention

[0005] The purpose of this invention is to provide a dehalogenated bacillus and its application in the degradation of chlorophenol pollutants.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0007] A strain of dehalobacter, Dehalobacter sp. strain Co4CP, was deposited on February 24, 2024, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, 100101, China, accession number CGMCCNo.41183, and classified as Dehalobacter sp.

[0008] The 16S rRNA gene sequence of the Co4CP strain has a 99.7% similarity to that of the dehalogenated bacterium TCP1 strain, thus identifying the Co4CP strain as a dehalogenated bacterium.

[0009] An application of the aforementioned dehalogenated Bacillus, specifically the application of the Co4CP strain in the dechlorination and degradation of halogenated hydrocarbon contaminants.

[0010] The halogenated hydrocarbon is one or more of 2,4,6-trichlorophenol, 2,4-dichlorophenol, and 4-chlorophenol.

[0011] A microbial agent for degrading halogenated hydrocarbon pollutants, the microbial agent containing the aforementioned dehalogenated bacillus Co4CP strain.

[0012] The bacterial agent is one or more of the following: culture, suspension, concentrate, and separation liquid of the bacterial strain.

[0013] The application of a microbial agent for degrading halogenated hydrocarbon pollutants, specifically the application of the microbial agent in the degradation of chlorophenolic halogenated hydrocarbon pollutants.

[0014] A method for degrading chlorophenol pollutants involves inoculating the aforementioned dehalogenated Bacillus Co4CP strain into an anaerobic environment to be treated, adding a carbon source and an electron donor, thereby degrading chlorophenol pollutants in the environment.

[0015] The carbon source is lactic acid and / or acetic acid, and the electron donor is hydrogen or a material that can be fermented to produce a carbon source and an electron donor, such as waste vegetable oil.

[0016] The chlorophenol is one or more of 2,4,6-trichlorophenol, 2,4-dichlorophenol, and 4-chlorophenol.

[0017] Advantages of this invention:

[0018] The Co4CP strain obtained in this invention is an indigenous dehalogenated bacillus strain screened from polluted river sediment.

[0019] The Co4CP strain was identified as belonging to the dehalogenated bacterium species by comparing its 16S rRNA gene sequence with that of the TCP1 strain, showing a similarity of 99.7%.

[0020] The Co4CP strain can degrade 2,4,6-trichlorophenol, 2,4-dichlorophenol, and 4-chlorophenol into phenol under growth conditions of 37°C and pH 7.2. The degradation ability of the Co4CP strain provides an important microbial resource for the in-situ remediation of sites contaminated with chlorophenol. Attached image description:

[0021] Figure 1 This is a scanning electron microscope image of the Co4CP strain cell morphology provided in an embodiment of the present invention.

[0022] Figure 2 The degradation curve of 2,4,6-trichlorophenol by the Co4CP strain provided in the embodiments of the present invention;

[0023] Figure 3 The degradation curve of 4-chlorophenol by the Co4CP strain provided in the embodiments of the present invention. Detailed implementation method:

[0024] The technical solution of the present invention will be further explained below with reference to specific embodiments, but it should not be construed as a limitation of the present invention.

[0025] Example 1: Isolation, purification and identification of strains

[0026] (1) Prepare the basic culture medium:

[0027] The anaerobic inorganic salt culture medium consists of: NaCl 1.0 g / L, MgCl2·6H2O 0.5 g / L, KH2PO4 0.2 g / L, NH4Cl 0.3 g / L, KCl 0.3 g / L, CaCl2·2H2O 0.015 g / L, FeCl2·4H2O 1.5 mg / L, CoCl2·6H2O 190 μg / L, MnCl2·4H2O 100 μg / L, ZnCl2 70 μg / L, H3BO3 6 μg / L, Na2MoO4·2H2O 36 μg / L, NiCl2·6H2O 24 μg / L, CuCl2·2H2O 2 μg / L, Na2SeO3·5H2O 6 μg / L, and Na2WO4·2H2O. Add 8 μg / L resazu indicator 0.025% (w / v), L-cysteine ​​24 mg / L, dithiothreitol 38.5 mg / L, and NaHCO3 2.52 g / L (30 mM) to adjust the pH to 7.2-7.3. After autoclaving at 121℃ for 15 minutes, add compound vitamins. The final concentrations of various vitamins in the culture medium are as follows: biotin 20 μg / L, folic acid 20 μg / L, pyridoxine hydrochloride 100 μg / L, riboflavin 50 μg / L, thiamine 50 μg / L, pantothenic acid 50 μg / L, nicotinic acid 50 μg / L, vitamin B12 50 μg / L, para-aminobenzoic acid 50 μg / L, and lipoic acid 50 μg / L.

[0028] (2) Enrichment of dehalogenated bacteria:

[0029] Dispense 80 mL of the anaerobic inorganic salt culture medium prepared in step (1) into a 120 mL serum bottle, add 5 mM sodium acetate as a carbon source, 10 mL of hydrogen (413.2 μmol) as an electron donor, and 0.1 mM 2,4,6-trichlorophenol as an electron acceptor. The headspace gas is N2 / CO2 (80 / 20, v / v). In an anaerobic glove box, inoculate 3 mL of sediment mud suspension (collected from Xihe, Shenyang, Liaoning) and seal the serum bottle with a blue rubber stopper and aluminum cap to establish an enrichment culture system. Incubate at 37°C in the dark, monitor the phenol formation process using liquid chromatography, calculate the mass balance, and after 2,4,6-trichlorophenol is completely converted to phenol, repeatedly transfer the culture to the enrichment system prepared in step (2) at an inoculation rate of 3% (v / v), for a total of 5 transfers.

[0030] (3) Isolation of dehalogenated bacteria:

[0031] Dispense 9 mL of the inorganic salt culture medium described in step (1) into a 20 mL culture flask. The headspace gas is N2 / CO2 (80 / 20, v / v). Transfer 1 mL of the enriched culture of the 2,4,6-trichlorophenol-reducing anaerobic degrading bacteria from the 120 mL serum bottle in step (2) into the culture flask to establish a 10 mL culture. -1 Dilute bottles, and so on, repeat the above 10-fold serial dilution operation until a 10-fold serial dilution is established. -10 Dilution bottle. Wait 10... -10 After the 2,4,6-trichlorophenol in the diluted culture medium was completely degraded to phenol, about 2.5 mL of the culture medium was transferred to the inorganic salt medium described in (1). The same carbon source, electron donor, and electron acceptor as in the (2) culture system were added, and the culture was incubated at 37°C in the dark. The phenol formation process was monitored by liquid chromatography, and the 2,4,6-trichlorophenol degrading bacteria were isolated and purified.

[0032] (4) Identification of strains:

[0033] The 2,4,6-trichlorophenol-degrading strains obtained through the above process are rod-shaped (see above). Figure 1 The genome was extracted using a soil genomic DNA extraction kit. PCR amplification was performed using universal primers 27F (5'-AGAGTTTGATCCTGGCTCAG-3') and 1492R (5'-GGTTACCTTGTTACGACTT-3') for the bacterial 16S rRNA gene. The amplified products were then submitted to a sequencing company for sequencing.

[0034] The 16S rRNA gene sequence is as follows:

[0035] AGCATTGTCGGCGTGCTACACATGCAGTCGAACGGAGCTACGCCTGA

[0036] CACCGAGTGCTTTGCACATAGATATGTGGAGCAAGCGAGTGCGCGAA

[0037] CGAAGAGAGCGCACCACGCATTAAATAAGTGCCAACACATATTGAGTA

[0038] TGAAGGAAAAGCACTGGGTGTCAGGTGGAGCTTAGTGGCGAACGGG

[0039] TGAGTAACGCGTGGGTAACCTGCCCTTAAGACCGGGACAACAGCTGG

[0040] AAACGGCTGCTAATACCGGATGTATTGTCCGAGAGGCATCTCTTGGAG

[0041] AAGAAAGCTGGCCTCTGAAAATGCTAGCGCTTAGGGATGGACCCGCG

[0042] TCTGATTAGCTAGTTGGTGGGGTAAAGGCCTACCAAGGCGACGATCA

[0043] GTAGCCGGCCTGAGAGGGTAAACGGCCACACTGGGACTGAGACACG

[0044] GCCCAGACTCCTACGGGAGGCAGCAGTGGGGAATCTTCCGCAATGGA

[0045] CGAAAGTCTGACGGAGCAACGCCGCGTGTATGAAGAAGGCCTTCGGG

[0046] TTGTAAAATACTGTTGTTAGGGAAGAACGGCTTAAGTGTGAATAATGC

[0047] TTGAGATTGACGGTACCTAACGAGGAAGCCCCGGCTAACTACGTGCC

[0048] AGCAGCCGCGGTAATACGTAGGGGGCAAGCGTTGTCCGGAATCATTG

[0049] GGCGTAAAGGGCGCGTAGGCGGCTATATAAGTCTGATGTGAAAGTGC

[0050] GGAGCTTAACTCCGTAAAGCATTGGAAACTGTATGGCTTGAGGACAG

[0051] GAGAGGAAAGTGGAATTCCACGTGTAGCGGTGAAATGCGTAGAGATG

[0052] TGGAGGAACACCAGTGGCGAAGGCGACTTTCTGGACTGTAACTGACG

[0053] CTGAGGCGCGAAAGCGTGGGGAGCGAACAGGATTAGATACCCTGGTA

[0054] GTCCACGCCGTAAACGATGAATGCTAGGTGTAGAGGGTATCGACCCCT

[0055] TCTGTGCCGCAGTTAACACAATAAGCATTCCGCCTGGGGAGTACGGCC

[0056] GCAAGGTTGAAACTCAAAGGAATTGACGGGGGCCCGCACAAGCGGT

[0057] GGAGCATGTGGTTTAATTCGACGCAACGCGAAGAACCTTACCAAGGC

[0058] TTGACATCCAACTAATCCCGTAGAGATATGGGAGTGCCCTTCGGGGAA

[0059] AGTTGAGACAGGTGGTGCATGGTTGTCGTCAGCTCGTGTCGTGAGAT

[0060] GTTGGGTTAAGTCCCGCAACGAGCGCAACCCCTATATTTAGTTGCTAA

[0061] CAGGTAAAGCTGAGAACTCTAGATAGACTGCCGGTGACAAACCGGAG

[0062] GAAGGTGGGGATGACGTCAAATCATCATGCCCCTTATGTCTTGGGCTA

[0063] CACACGTGCTACAATGGACGGTACAGACGGAAGCGAAGCCGCGAGG

[0064] TGAAGCAAATCCGAGAAAGCCGTTCTCAGTTCGGATTGCAGGCTGCA

[0065] ACTCGCCTGCATGAAGTCGGAATCGCTAGTAATCGCAGGTCAGCACA

[0066] CTGCGGTGAATACGTTCCCGG

[0067] BLAST search of the 16S rRNA gene sequence of this strain showed that it shared 99.7% species homology with TCP1 strain from the genus *Dehalobacterium*. This strain was classified as *Dehalobacterium* and named Co4CP. It is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, 100101, China, accession number CGMCC No. 41183.

[0068] Example 2: Identification of the degradation performance of Co4CP strain on 2,4,6-trichlorophenol

[0069] Take 80 mL of the anaerobic inorganic salt basal culture medium described in step (1) of Example 1 above, and add 5 mM sodium acetate as a carbon source, 10 mL of hydrogen gas (413.2 μmol) as an electron donor, and 0.1 mM 2,4,6-trichlorophenol as an electron acceptor. The headspace gas is N2 / CO2 (80 / 20, v / v). Inoculate pure Co4CP bacteria at 3% (v / v). Incubate at 37℃ in the dark and monitor the phenol formation process using liquid chromatography. The liquid chromatography detection conditions are as follows: use an Agilent Zorbax eclipseXDB-C18 liquid chromatography column (4.6 mm × 250 mm, 5 μm), mobile phase A is acetonitrile, mobile phase B is 2% acetic acid aqueous solution, the volume ratio of mobile phase A to B is 55:45, and the flow rate is 1.0 mL·min. -1 The column temperature was 35℃, the diode array detector (DAD) detection wavelength was set to 282nm, the injection volume was 20μL, and the monitoring time was 10min. The full wavelength scan range of the DAD detector was 200–400nm. The degradation of 2,4,6-trichlorophenol was detected based on the measured concentrations of 2,4,6-trichlorophenol, the intermediate product 2,4-dichlorophenol, 4-chlorophenol, and the final product phenol (see [reference]). Figure 2 Analysis showed that the Co4CP strain could degrade 0.1 mM 2,4,6-trichlorophenol into phenol in a cycle of approximately 190-220 days.

[0070] Example 3: Identification of the degradation performance of Co4CP strain on 4-chlorophenol

[0071] Take 80 mL of the anaerobic inorganic salt basal culture medium described in step (1) of Example 1 above, and add 5 mM sodium acetate as a carbon source, 10 mL of hydrogen gas (413.2 μmol) as an electron donor, and 0.1 mM 4-chlorophenol as an electron acceptor. The headspace gas is N2 / CO2 (80 / 20, v / v). Inoculate pure Co4CP bacteria at 3% (v / v). Incubate at 37°C in the dark and monitor the phenol formation process using liquid chromatography. The liquid chromatography detection conditions are the same as in Example 2. The degradation of 4-chlorophenol is detected based on the measured concentration values ​​of 4-chlorophenol and phenol (see Example 2). Figure 3 Analysis showed that the Co4CP strain could degrade 0.1 mM 4-chlorophenol into phenol in approximately 45 days.

[0072] In summary, the dehalogenating bacillus Co4CP strain provided by this invention can completely convert 0.1 mM 2,4,6-trichlorophenol into phenol within approximately 200-300 days. 2,4-Dichlorophenol is an intermediate product, and the generated 2,4-dichlorophenol is rapidly further degraded into 4-chlorophenol, indicating that the Co4CP strain has the ability to degrade 2,4-dichlorophenol. The dehalogenating bacillus Co4CP strain can completely convert 0.1 mM 4-chlorophenol into phenol within 45 days, demonstrating a relatively fast degradation rate.

[0073] The bacterial agent was prepared according to the above description, for example, by adding a carbon source, electron donor, and electron acceptor to an inorganic salt culture medium, and inoculating the *Dehalobacillus co4CP* strain at 37°C in the dark; wherein the carbon source was acetic acid and the electron donor was hydrogen gas; 5 mM sodium acetate and 10 mL hydrogen gas (413.2 μmol) were added to every 80 mL of inorganic salt culture medium, and the inoculum was transferred at a rate of 3% (v / v); the resulting culture was centrifuged, the precipitate was collected, and resuspended to obtain a resuspension; the liquid phase was the separation liquid; the culture was concentrated to obtain a concentrate, which is the bacterial agent. Its application in the environment or soil shows good prospects for the bioremediation of sites contaminated with chlorophenol.

[0074] The above-described embodiments are preferred application examples of this invention, but do not constitute any limitation on this invention. In practical applications, without departing from the scope of the technical solution of this invention, some modifications or alterations can be made to the disclosed technical content to create equivalent embodiments.

Claims

1. A strain of dehalogenated bacillus, characterized in that: Dehalogenated bacteria ( Dehalobacter The strain (sp.) Co4CP was deposited on February 24, 2024, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, 100101, China, accession number: CGMCCNo.41183.

2. An application of the dehalogenated Bacillus as described in claim 1, characterized in that: Application of the dehalogenated Bacillus Co4CP strain in the dechlorination and degradation of halogenated hydrocarbon pollutants.

3. The application of the dehalogenated Bacillus according to claim 2, characterized in that: The halogenated hydrocarbon is one or more of 2,4,6-trichlorophenol, 2,4-dichlorophenol, and 4-chlorophenol.

4. A bacterial agent for degrading halogenated hydrocarbon pollutants, characterized in that: The bacterial agent contains the dehalogenated Bacillus Co4CP strain as described in claim 1.

5. The microbial agent for degrading pollutants according to claim 4, characterized in that: The bacterial agent is one or more of the strain's culture, bacterial suspension, or concentrate.

6. The application of the bacterial agent for degrading halogenated hydrocarbon pollutants as described in claim 4, characterized in that: The application of the bacterial agent in the degradation of chlorophenol-based halogenated hydrocarbon pollutants.

7. A method for degrading chlorophenol pollutants, characterized in that: By inoculating the dehalogenated Bacillus Co4CP strain of claim 1 into the anaerobic environment to be treated, and by adding a carbon source and an electron donor, chlorophenol pollutants in the environment can be degraded.

8. The method for degrading chlorophenol pollutants according to claim 7, characterized in that: The chlorophenol is one or more of 2,4,6-trichlorophenol, 2,4-dichlorophenol, and 4-chlorophenol.

Images