Immunostimulatory compositions

Abstract

The present invention relates to immunostimulatory compositions. The present disclosure relates to immunostimulatory compositions effective to elicit an immune response in avian species. More specifically, these immunostimulatory compositions comprise an immunomodulator composition and an immunostimulatory oligonucleotide that stimulates toll-like receptor 21 when administered.

Description

This application is a divisional application of Chinese patent application 201880089491.8 “Immunostimulatory composition” filed on December 7, 2018.

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to and the benefit of European Patent Application Nos. EP17207740.6, EP17207746.3 and EP17207750.5, each filed on December 15, 2017, the disclosures of which are incorporated herein by reference in their entirety.

[0002] Sequence Listing This application contains a sequence listing that has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. The ASCII copy, created on November 30, 2018, is named BHC_168027_SL.txt and is 92,167 bytes in size. Technical Field

[0003] Compositions and methods for stimulating toll-like receptor protein 21 (TLR21) are provided. More specifically, disclosed herein are immunostimulatory oligonucleotides and compositions, methods of making immunostimulatory oligonucleotides and compositions, and methods of stimulating TLR21. Background Art The vertebrate immune system has evolved molecular mechanisms to recognize invading pathogens and initiate cell signaling pathways to actively fight infection. Some molecular mechanisms are specific to particular microorganisms and involve biomolecules, such as antibodies, that recognize surface antigens of a single pathogen species. Unfortunately, pathogen-specific defense mechanisms are not completely effective, as some animals do not develop any acquired resistance until after infection has begun, and in some cases, the pathogen has evolved covert means for evading the vertebrate's acquired defenses.

[0005] Vertebrates also recognize infection more generally, and this recognition leads to nonspecific immune responses, such as a small increase in cytokine expression. This defense can be triggered when cell receptors bind pathogen-associated molecular patterns (PAMPs). This interaction between PAMP and the host's homologous receptor for PAMP can trigger an immune response. For example, toll-like receptor protein 21 (TLR21) is a chicken functional homolog of mammalian TLR9 and is able to recognize unmethylated CpG motifs, which have a higher CpG content in microorganisms than in vertebrates. Known methods utilize this nonspecific immune response pathway by administering plasmids or oligonucleotides with unmethylated CpG motifs, and have been shown to activate cell signals involved in the immune response to microbial infection by the activation of TLR21 with nucleic acids containing CpG motifs. However, immunostimulatory plasmids or oligonucleotides administered alone may not be able to trigger a response sufficient to resist infection.

[0006] Large-scale animal producers are in urgent need of alternatives to antibiotic treatment of infections. Consumers are pressuring these producers to seek antibiotic-free animal products, and at the same time, the increasing incidence of infections caused by antibiotic-resistant pathogens is illustrating the dangers of prophylactic administration of antibiotics to large populations. Similarly, antibiotic resistance is becoming a national emergency in human health care. Hospitals and doctors' offices are becoming the starting point for the emergence of drug-resistant bacteria such as multi-resistant Staphylococcus aureus (MRSA).

[0007] Therefore, there is a need for immunostimulatory compositions and methods for eliciting nonspecific immune responses against pathogens. The disclosed methods and compositions address these and other important needs. Summary of the invention Disclosed herein are immunostimulatory compositions comprising: an immunomodulatory composition comprising a nucleic acid plasmid and a liposome delivery vehicle; and an immunostimulatory oligonucleotide having at least one CpG motif and a guanine nucleotide-rich sequence at or near the 5' end of the immunostimulatory oligonucleotide.

[0009] Also disclosed herein is a method for preparing an immunostimulatory composition comprising: combining an immunomodulatory composition comprising a nucleic acid plasmid and an immunostimulatory oligonucleotide to form an immunostimulatory composition, centrifuging the immunostimulatory composition to generate a supernatant and a precipitate; and separating the precipitate.

[0010] Further provided is a method of stimulating TLR21 comprising administering to a subject an immunostimulatory oligonucleotide and an immunomodulatory composition, wherein the immunostimulatory oligonucleotide comprises at least one CpG motif and a guanine nucleotide-rich sequence at or near the 5' end of the immunostimulatory oligonucleotide, and wherein the immunomodulatory composition comprises a non-coding nucleic acid plasmid and a cationic lipid delivery vehicle.

[0011] Also disclosed are methods of eliciting an immune response in a subject by administering to the subject an immunostimulatory oligonucleotide and an immunomodulatory composition or an immunostimulatory composition comprising the immunostimulatory oligonucleotide and the immunomodulatory composition, wherein the immunostimulatory oligonucleotide has at least one CpG motif and a guanine nucleotide-rich sequence at or near the 5' end of the immunostimulatory oligonucleotide, and wherein the immunomodulatory composition comprises a non-coding nucleic acid plasmid and a cationic lipid delivery vehicle. BRIEF DESCRIPTION OF THE DRAWINGS The summary, as well as the following detailed description, will be further understood when read in conjunction with the accompanying drawings. For the purpose of illustrating the disclosed compositions and methods, exemplary embodiments of the compositions and methods are shown in the accompanying drawings; however, the compositions and methods are not limited to the specific embodiments disclosed. In the drawings: Figure 1 Illustrated is the chemical structure of a cholesteryl moiety attached to a tetraethylene glycol linker.

[0013] Figure 2A and 2B The immunogenicity of immunostimulatory plasmid DNA, plasmid DNA complexed with cationic liposomes, and immunostimulatory oligonucleotides was compared. Figure 2A The immunogenicity of immunostimulatory plasmid DNA ("pDNA") and pDNA complexed with cationic liposomes ("pDNA-F") were compared. Figure 2B The immunogenicity of pDNA, pDNA-F and the immunostimulatory oligonucleotide GCGT3-TG4T modified with a 5'-cholesterol group ("5Chol-GCGT3-TG4T") were compared.

[0014] Figure 3A and 3B The immunogenicity of immunostimulatory plasmid DNA, immunostimulatory plasmid DNA complexed with cationic liposomes, immunostimulatory oligonucleotides and combinations thereof were compared. Figure 3AThe immunogenicity of pDNA, pDNA-F, 5Chol-GCGT3-TG4T, pDNA combined with 5'Chol-GCGT3-TG4T ("pDNA-5Chol-GCGT3-TG4T"), and pDNA-F combined with 5Chol-GCGT3-TG4T ("pDNA-F-5Chol-GCGT3-TG4T") were compared, wherein the immunostimulatory oligonucleotides were at nM concentrations and pDNA and pDNA-F were at μg / ml concentrations. Figure 3B Depicted are the differences in immunogenicity between pDNA, pDNA-F, 5Chol-GCGT3-TG4T, pDNA combined with 5'Chol-GCGT3-TG4T ("pDNA-5Chol-GCGT3-TG4T"), and pDNA-F combined with 5Chol-GCGT3-TG4T ("pDNA-F-5Chol-GCGT3-TG4T"), wherein the immunostimulatory oligonucleotides are at pM concentrations and pDNA and pDNA-F are at ng / ml concentrations.

[0015] Figure 4 The ability of the pDNA-F fraction to stimulate a TLR21-mediated immune response in HEK293-bsd-cTLR21 cells was illustrated. Specifically, the immunogenicity of pDNA-F stored at 4°C was compared with the immunogenicity of pDNA-F obtained in the pellet ("pDNA-F pellet") and supernatant ("pDNA-F supernatant") of the centrifuged sample.

[0016] Figure 5A and 5B The ability of pDNA-F-5Chol-GCGT3-TG4T and 5Chol-GCGT3-TG4T to generate TLR21-mediated immune responses in HEK293-bsd-cTLR21 cells at high and low concentrations, respectively, is depicted.

[0017] Fig. 6A and 6B The ability of high and low concentrations of pDNA-F-5Chol-GCGT3-TG4T to generate a TLR21-mediated immune response in HEK293-bsd-cTLR21 cells was compared with the ability of 5Chol-GCGT3-TG4T obtained in the pellet ("pDNA-F 5Chol pellet") and supernatant ("pDNA-F 5Chol Uberstand") of centrifuged pDNA-F samples, respectively.

[0018] Fig. 7A and 7BThe ability of high and low concentrations of 5Chol-GCGT3-TG4T to generate a TLR21-mediated immune response in HEK293-bsd-cTLR21 cells was compared with that of 5Chol-GCGT3-TG4T obtained in the pellet ("5Chol pellet") and supernatant ("5Chol Uberstand") of centrifuged pDNA-F samples, respectively.

[0019] Fig. 8A and 8B The ability of high and low concentrations of 5Chol-GCGT3-TG4T ("5Chol-GCGT3-TG4T4°C") to generate TLR21-mediated immune responses in HEK293-bsd-cTLR21 cells and the ability of pDNA-F combined with 5Chol-GCGT3-TG4T ("pDNA-F / 5-Chol-GCGT3-TG4T") were compared, respectively.

[0020] Fig.9A and 9B The ability of high and low concentrations of pDNA-F combined with 5Chol-GCGT3-TG4T ("pDNA-F / 5-Chol-GCGT3-TG4T") to generate a TLR21-mediated immune response in HEK293-bsd-cTLR21 cells was compared with the ability of pDNA-F combined with 5Chol-GCGT3-TG4T obtained in the pellet ("pDNA-F / 5-Chol-GCGT3-TG4T pellet") and supernatant ("pDNA-F / 5-Chol-GCGT3-TG4T supernatant") of centrifuged pDNA-F samples, respectively.

[0021] Fig. 10A and 10B The ability of high and low concentrations of pDNA-F combined with 5Chol-GCGT3-TG4T ("pDNA-F-5-Chol-GCGT3-TG4T") to generate a TLR21-mediated immune response in HEK293-bsd-cTLR21 cells was compared with the ability of pDNA-F and the immunostimulatory oligonucleotide 5-Chol-GCGT3-TG4T, respectively.

[0022] Fig.11A and 11BThe ability of high and low concentrations of pDNA-F combined with 5Chol-GCGT3-TG4T ("pDNA-F-5-Chol-GCGT3-TG4T") to generate a TLR21-mediated immune response in HEK293-bsd-cTLR21 cells was compared with the ability of pDNA-F combined with 5Chol-GCGT3-TG4T obtained in the pellet ("pDNA-F-5-Chol-GCGT3-TG4T pellet") and supernatant ("pDNA-F-5-Chol-GCGT3-TG4T") of centrifuged pDNA-F samples, respectively.

[0023] Fig. 12A and 12B High and low concentrations of pDNA-F, the immunostimulatory oligonucleotide GCGT3-TG4T, and pDNA-F complexed with GCGT3-TG4T ("pDNA-F-GCGT3-TG4T") were compared for their ability to generate a TLR21-mediated immune response in HEK293-bsd-cTLR21 cells.

[0024] Fig.13A and 13B The ability of high and low concentrations of pDNA-F combined with the immunostimulatory oligonucleotide GCGT3-TG4T ("pDNA-F-GCGT3-TG4T") to generate a TLR21-mediated immune response in HEK293-bsd-cTLR21 cells was compared with the ability of pDNA-F combined with the immunostimulatory oligonucleotide GCGT3-TG4T obtained in the pellet ("pDNA-F-GCGT3-TG4T pellet") and supernatant ("pDNA-F-GCGT3-TG4T supernatant") of centrifuged pDNA-F samples, respectively.

[0025] Fig.14 Depicted are the mean hemagglutination inhibition (HI) titers (Log2) (with standard deviation) results for ODN1 (GCGT3-TG4T-5Chol) at day 14 (upper panel) and day 21 (lower panel) post vaccination (pv). Asterisks indicate the level of significance (*=significant to ****=highly significant).

[0026] Fig.15 The mean HI titer (Log2) (with standard deviation) results for ODN1 (GCGT3-TG4T-5Chol) over the entire study period are depicted.

[0027] Fig.16Depicted are the mean HI titer (Log2) (with standard deviation) results for ODN2 (GCGT3-TG4T) at day 14 (upper panel) and day 21 (lower panel) post vaccination. Asterisks indicate the level of significance (* = significant to **** = highly significant).

[0028] Fig.17 The mean HI titer (Log2) (with standard deviation) results for ODN2 (GCGT3-TG4T) over the entire study period are depicted.

[0029] Fig.18 Depicted are the mean HI titer (Log2) (with standard deviation) results for ODN3 (2006-PTO) at day 14 (upper panel) and day 21 (lower panel) post vaccination. Asterisks indicate the level of significance (* = significant to **** = highly significant).

[0030] Fig.19 The mean HI titer (Log2) (with standard deviation) results for ODN3 (2006-PTO) over the entire study period are depicted.

[0031] Fig. 20 Depicted are the mean HI titer (Log2) (with standard deviation) results for positive and negative control test articles at day 14 (upper panel) and day 21 (lower panel) post vaccination. Asterisks indicate the level of significance (* = significant to **** = highly significant).

[0032] Fig.21 The mean HI titer (Log2) (with standard deviation) results for the positive and negative control test articles over the entire study period are depicted.

[0033] Fig. 22 Results are depicted for mean HI titer (Log2) (with standard deviation) at optimal concentrations of ODN over the entire study period compared to NDV vaccine alone.

[0034] Fig.23 Depicted are the mean HI titer (Log2) (with standard deviation) results at optimal concentrations of ODN at pv day 14 (upper panel) and day 21 (lower panel) compared to NDV vaccine alone.

[0035] DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS The disclosed compositions and methods may be more readily understood by reference to the following detailed description taken in conjunction with the accompanying drawings, which form a part of the present disclosure. It should be understood that the disclosed compositions and methods are not limited to the specific compositions and methods described and / or shown herein, and that the terminology used herein is for the purpose of describing specific embodiments by way of example only, and is not intended to limit the claimed compositions and methods.

[0036] Unless specifically stated otherwise, any description of possible mechanisms or modes of action or reasons for improvement is intended to be illustrative only, and the disclosed compositions and methods should not be bound by the correctness or incorrectness of any such suggested mechanisms or modes of action or reasons for improvement.

[0037] Throughout this text, descriptions refer to compositions and methods of using the compositions. Where the disclosure describes or claims a feature or embodiment related to a composition, such feature or embodiment also applies to the method of using the composition. Likewise, where the disclosure describes or claims a feature or embodiment related to a method of using a composition, such feature or embodiment also applies to the composition.

[0038] When expressing a range of values, another embodiment includes from one specific value and / or to another specific value. In addition, reference to a value stated in a range includes each and every value within that range. All ranges are inclusive and combinable. When a value is expressed as an approximation by using the antecedent "about", it is understood that the specific value forms another embodiment. Reference to a specific numerical value includes at least that specific value unless the context clearly indicates otherwise.

[0039] It should be understood that certain features of the disclosed compositions and methods described herein in the context of separate embodiments for clarity may also be provided in combination in a single embodiment. Conversely, various features of the disclosed compositions and methods described in the context of a single embodiment for clarity may also be provided separately or in any sub-combination.

[0040] As used herein, the singular form "a," "an," and "the" include plural forms.

[0041] As used herein, "co-administration" refers to the combined administration of an immunomodulatory composition with an immunostimulatory oligonucleotide to obtain a desired immunostimulatory effect. The immunomodulatory composition and the immunostimulatory oligonucleotide can be co-administered as separate compositions or together as a single composition. If the immunomodulatory composition and the immunostimulatory oligonucleotide are separate compositions, they can be co-administered simultaneously or sequentially in any order. For sequential co-administration, there may be a delay of one minute, one hour, or even one or more days between the administration of the immunomodulatory composition and the immunostimulatory oligonucleotide.

[0042] As used herein, "fusing" refers to the creation of a chemical bond between two chemically reactive species. In the context of the present disclosure, fusing most often refers to the incorporation of a specific element into an oligonucleotide. For example, a series of thymine nucleotides can be fused to the 3' end of an oligonucleotide.

[0043] As used herein, a "G-quadruplex sequence" refers to a stretch of continuous guanine residues near the 5' end of an oligonucleotide that enables the oligonucleotide to interact with other G-quadruplex sequences to form a G-quadruplex. The G-quadruplex enhances the immunostimulatory properties of nucleic acids. For example, oligonucleotides comprising a G-quadruplex sequence can interact to produce a G-quadruplex. A G-quadruplex sequence occurring in the promoter region of a gene can form a quaternary structure that is involved in regulating the expression of the gene. Although the G-quadruplex sequence is not limited to any particular sequence, an example of a G-quadruplex sequence is TGGGGT.

[0044] As used herein, "G-wire sequence," "G wire sequence," "Gwire sequence," and related terms refer to a plurality of at least four consecutive guanine nucleotides, most often two. A plurality of guanine nucleotides located at or near the 5' end of an oligonucleotide is separated by two or more non-guanine nucleotides (i.e., thymine). G-wire sequences are capable of interacting with other G-wire sequences to form G-wire structures. G-wire structures can enhance the immunostimulatory properties of nucleic acids. Exemplary G-wire sequences are GGGGTTGGGG (SEQ ID NO: 257) or GGGGTTGGGGTTTT (SEQ ID NO: 258).

[0045] As used herein, the terms "guanine nucleotide-enriched sequence", "guanine-rich sequence", etc. refer to a sequence comprising a stretch of consecutive guanine nucleotides, typically 4 to 6 guanine nucleotides, or a region of a nucleic acid, typically at or near the 5' end of an oligonucleotide having more guanine nucleotides than adenine, cytosine, or thymine nucleotides. Guanine-enriched sequences as disclosed herein can enhance the immunostimulatory properties of oligonucleotides. G-quadruplex and G-line sequences are two types of guanine nucleotide-enriched sequences.

[0046] As used herein, the term "immunomodulatory composition" refers to a composition comprising at least an immunogenic nucleic acid plasmid and a liposome delivery vehicle. In some aspects of the currently disclosed compositions and methods, the nucleic acid plasmid may not encode a specific immunogen and may be immunogenic based on the inherent properties of the nucleic acid plasmid. In some aspects, the liposome delivery vehicle is cationic.

[0047] "Immunogenic nucleic acid plasmid" is a nucleic acid plasmid that triggers an immune response when detected by the vertebrate immune system. Some immunogenic nucleic acid plasmids contain an increased percentage of CpG dinucleotide motifs compared to naturally occurring nucleic acid plasmid sequences in certain vertebrate organisms. Without being bound by theory, it is believed that there are increased CpG dinucleotide motifs in nucleic acids of bacterial origin, and therefore, such CpG-rich nucleic acids appear to be foreign to host immune defense. Immunogenic nucleic acid plasmids can contain non-naturally occurring nucleotides and nucleotide derivatives.

[0048] As used herein, "immunostimulatory composition" refers to a composition comprising an immunomodulatory composition and an immunostimulatory oligonucleotide. In some aspects, the immunostimulatory oligonucleotide and the immunomodulatory composition constitute a single formulation, which is an immunostimulatory composition. In some aspects, the immunostimulatory oligonucleotide can be physically associated with the liposome delivery vehicle of the immunomodulatory composition.

[0049] As used herein, "insertion" refers to the addition of a specific nucleotide at a specific position during the synthesis of an oligonucleotide.

[0050] As used herein, "parallel orientation" refers to directional interactions between different oligonucleotides. For example, individual oligonucleotides oriented in the same 5' to 3' direction are in parallel orientation.

[0051] As used herein, "percent identity" and similar terms are used to describe sequence relationships between two or more nucleic acids, polynucleotides, proteins or polypeptides, and are to be understood in the context of and in conjunction with the following terms: (a) a reference sequence, (b) a comparison window, (c) sequence identity, and (d) percentage of sequence identity.

[0052] (a) A "reference sequence" is a defined sequence that is used as a basis for sequence comparison. A reference sequence can be a subset or the entirety of a specified sequence; for example, a segment of a full-length cDNA or gene sequence, or a complete cDNA or gene sequence.

[0053] (b) "Comparison window" includes reference to a continuous and specified segment of a polynucleotide sequence, wherein the polynucleotide sequence can be compared to a reference sequence, and the portion of the polynucleotide sequence in the comparison window can contain additions, substitutions or deletions (i.e., gaps) compared to the reference sequence (which does not contain additions, substitutions or deletions) for optimal alignment of the two sequences. It is understood by those skilled in the art that in order to avoid misleadingly high similarities to a reference sequence due to the inclusion of gaps in the polynucleotide sequence, gap penalties are usually introduced and subtracted from the number of matches.

[0054] (c) Sequence alignment methods for comparison are well known in the art. Optimal alignment of sequences for comparison can be performed by the local homology algorithm of Smith and Waterman, Adv. Appl. Math., 2:482, 1981; by the homology alignment algorithm of Needleman and Wunsch, J. Mol. Biol., 48:443, 1970; by the similarity search method of Pearson and Lipman, Proc. Natl. Acad. Sci. USA, 8:2444, 1988; by computerized implementations of these algorithms, including but not limited to: CLUSTAL in the PC / Gene program of Intelligenetics, Mountain View, Calif., Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 7Science Dr., Madison, Wis., USA; the CLUSTAL program is fully described by Higgins and Sharp, Gene, 73:237-244, 1988; Corpet, et al., Nucleic Acids Research, 16:881-90, 1988; Huang, et al., Computer Applications in the Biosciences, 8:1-6, 1992; and Pearson, et al., Methods in Molecular Biology, 24:7-331, 1994. The BLAST program family that can be used for database similarity searches includes: BLASTN for nucleotide query sequences against nucleotide database sequences; BLASTX for nucleotide query sequences against protein database sequences; TBLASTN for protein query sequences against nucleotide database sequences; and TBLASTX for nucleotide query sequences against nucleotide database sequences. See, Current Protocols in Molecular Biology, Chapter 19, Ausubel, et al., eds., Greene Publishing and Wiley-Interscience, New York, 1995. New versions of the above-described procedures, or new procedures together, will undoubtedly become available in the future and can be used with the present disclosure.

[0055] (d) "Percent identity" means a value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may contain additions, substitutions or deletions (i.e., gaps) compared to a reference sequence (which does not contain additions, substitutions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions where the same nucleic acid base appears in the two sequences to produce the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity.

[0056] A "therapeutically effective amount" refers to the amount of an immunomodulatory composition and / or an immunostimulatory oligonucleotide or immunostimulatory composition that is required to treat a subject.

[0057] "Synergistically effective amount" refers to the amount of the immunomodulatory composition and the immunostimulatory oligonucleotide that provides a synergistic or greater than additive effect in the treated subject. As used herein, the term "subject" means any animal, but particularly avian species. "Avian species" includes, but is not limited to, chickens, domestic turkeys, waterfowl, and any other food source of avian species.

[0058] As used herein, "treat," "treat," "treat," and like terms refer to reducing the severity and / or frequency of symptoms of infection, eliminating symptoms and / or the underlying causes of the symptoms, reducing the frequency or likelihood of symptoms and / or their underlying causes, and / or ameliorating or remedying damage caused directly or indirectly by an infectious pathogen.

[0059] Various terms relating to various aspects of the specification are used throughout the specification and claims. Such terms are given their ordinary meanings in the art unless otherwise indicated. Other specifically defined terms will be interpreted in a manner consistent with the definitions provided herein.

[0060] Provided herein are immunostimulatory compositions comprising: an immunomodulatory composition comprising a nucleic acid plasmid and a liposome delivery vehicle, and an immunostimulatory oligonucleotide having at least one CpG motif and a guanine nucleotide-rich sequence at or near the 5' end of the immunostimulatory oligonucleotide.

[0061] Immunostimulatory oligonucleotides as described herein can interact with TLR21 to induce an immune response. The immunostimulatory oligonucleotides include at least one unmethylated dinucleotide CpG motif that interacts with a pathogen recognition receptor expressed in a host organism. The immunostimulatory oligonucleotides also have sequences enriched in guanine nucleotides. These sequences can promote the folding of DNA chains into quaternary structures, or promote the aggregation of one or more immunostimulatory oligonucleotides with enhanced guanine sequences. Guanine-enriched sequences do not have to consist only of guanine nucleotides, but they must be enriched. As described above and throughout these disclosures, guanine-enriched sequences exemplified are generally located at or near the end of the oligonucleotide (within four nucleotides). Additional manipulation of oligonucleotide sequences and structures can further enhance the ability of the immunostimulatory oligonucleotides to stimulate TLR21. Therefore, one embodiment of the present disclosure includes an immunostimulatory composition comprising at least one immunostimulatory oligonucleotide, the immunostimulatory oligonucleotide comprising at least one CpG motif and a sequence enriched in guanine at or within four nucleotides starting at the 5' end of the immunostimulatory oligonucleotide.

[0062] In some aspects of the present disclosure, adding guanine nucleotide extensions to the 5' end of a CpG-containing immunostimulatory oligonucleotide can significantly improve the immunogenicity of the immunostimulatory oligonucleotide. Not only does the position of the guanine-enriched sequence in the immunostimulatory oligonucleotide affect the enhancement of TLR21 activation, but the content of the sequence also has an effect. For this reason, in some aspects of the present disclosure, the guanine-enriched sequence contains multiple continuous guanine nucleotides.

[0063] In some embodiments, the guanine-enriched sequence comprises a first plurality of continuous guanine nucleotides. In some aspects, the first plurality of guanine nucleotides comprises two to eight guanine nucleotides. In some aspects, the first plurality of guanine nucleotides comprises two guanine nucleotides. In some aspects, the first plurality of guanine nucleotides comprises three guanine nucleotides. In some aspects, the first plurality of guanine nucleotides comprises four guanine nucleotides. In some aspects, the first plurality of guanine nucleotides comprises five guanine nucleotides. In some aspects, the first plurality of guanine nucleotides comprises six guanine nucleotides. In some aspects, the first plurality of guanine nucleotides comprises seven guanine nucleotides. In some aspects, the first plurality of guanine nucleotides comprises eight guanine nucleotides. In other aspects, the first plurality of guanine nucleotides comprises more than eight guanine nucleotides.

[0064] In some embodiments of the invention, the oligonucleotide comprises SEQ ID NO: 16, 17, 18, 19, 20, 21, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 77, 78, 81, 82, 85, 86, 89, 90, 92, 93, 96, 97, 100, 102, 104, 106, 108, or 143. In other embodiments, the guanine-rich sequence comprises TTAGGG, TTAGGGTTAGGG (SEQ ID NO: 261), TTTTGGGG, GGGGTTTT, GGGGTTTTGGGG (SEQ ID NO: 262), TTAGGG, TTAGGGTTAGGGTTTT (SEQ ID NO: 263), TGTGGGTGTGTGTGGG (SEQ ID NO: 269), GGAGG, TGGAGGC or TGGAGGCTGGAGGC (SEQ ID NO: 264). In other embodiments, the oligonucleotide comprises SEQ ID NO: 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 124, 125, 126, 127, 129, 130, 131, 134, 136, 137 or 138.

[0065] The single extension of guanine nucleotide is not the only 5' modification that can enhance TLR21 stimulation. For example, adenine, cytosine and thymine enriched sequences can also be added to the 5' end of the oligonucleotide with CpG motif, and lead to enhanced TLR21 stimulation, although less than the TLR21 stimulation caused by the guanine-enriched sequence at the 5' end of the oligonucleotide. Although the single multiple guanine residues at the 5' end of the oligonucleotide can induce TLR21 stimulation, the extra multiple guanine nucleotides in the guanine-enriched sequence can further enhance the stimulation properties of the oligonucleotide. Therefore, in some aspects, the oligonucleotide of the present disclosure is included in the second multiple guanine nucleotides between the first multiple guanine nucleotides and the at least one CpG motif.

[0066] In some aspects, a plurality of guanine nucleotides comprise a G-quadruplex sequence. In some embodiments, the first plurality of guanine nucleotides, the second plurality of guanine nucleotides or both comprise a G-quadruplex sequence. The G-quadruplex sequence as defined above also allows interactions between oligonucleotides. Without being bound by theory, the interaction of the 5' end of the oligonucleotide allows the concentration of the CpG dinucleotide motif and the corresponding increased chance of TRL21 identification. In some embodiments, the immunostimulatory composition further comprises at least one additional oligonucleotide with a G-quadruplex sequence, wherein the oligonucleotide and the at least one additional oligonucleotide have parallel orientation in a quaternary structure. In some aspects, the G-quadruplex sequence comprises TGGGGT.

[0067] Another guanine-rich sequence that can be added at or near the 5' end of an oligonucleotide having a CpG motif is a G-line sequence. In some aspects of the present disclosure, the first and second plurality of guanine nucleotides comprise a G-line sequence. In some aspects, the G-line sequence comprises SEQ ID NO: 257 or 258. In other aspects, the G-line sequence comprises SEQ ID NO: 141, 142, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203 or GCGT-G line 3. The two plurality of guanine nucleotides can be separated by a non-guanine nucleotide, a nucleotide analog, or any other spacer or linker. For example, in some aspects of the present disclosure, the first plurality of guanine nucleotides and the second plurality of guanine nucleotides are separated by at least one nucleotide. As used herein, the term "spacer" refers to a chemical bond between similar nucleotide motifs, i.e., between two CpG motifs or between two guanine nucleotide-enriched sequence motifs, and the term "joint" refers to a chemical bond between different nucleotide motifs, i.e., between a sequence of guanine nucleotide enrichment and another nucleotide motif (e.g., CpG motif). For clarity, the terms "spacer" and "joint" are used to describe the aspects of the oligonucleotide being discussed. However, it will be appreciated by those skilled in the art that the structure disclosed herein for the spacer can be interchanged with the structure disclosed herein for the joint, and vice versa.

[0068] Without being bound by any particular theory, the G-line sequence may cause the oligonucleotide to interact and aggregate with other oligonucleotides having the G-line sequence. The hypothesized conformation by aggregation of oligonucleotides having the G-line sequence is called the G-line conformation, and this aggregation of oligonucleotides and their CpG motifs may result in enhanced stimulation of TLR21.

[0069] The guanine-enriched sequence can be separated from the CpG nucleotide motif by nucleotides, nucleotide analogs or other joints. Therefore, in some embodiments of the present disclosure, the oligonucleotide further comprises a joint between the guanine-enriched sequence and at least one CpG motif downstream. As used herein, "downstream" means in the 5'→3' direction; that is, the "downstream" nucleotide or motif is the 3' nucleotide or motif of the comparison sequence element. "Upstream" means in the 3'→5' direction; that is, the "upstream" nucleotide or motif is the 5' nucleotide or motif of the comparison sequence element. The joint does not need to be directly adjacent to the guanine-enriched sequence or CpG motif; more precisely, the joint must be located between two sequence motifs, regardless of the intervening sequence between the guanine-enriched sequence and the joint and between the CpG motif and the joint. In some embodiments of the present disclosure, the joint comprises at least three nucleotides. The joint may also not contain a nitrogenous base. For example, in some aspects, the joint is hexaethylene glycol, propylene glycol, triethylene glycol or a derivative thereof. In other examples, the oligonucleotide with a linker comprises 2006-PDE5dG4-X1 or 2006-PDE5dG4-X3.

[0070] The dinucleotide CpG motif present in the oligonucleotide of the present disclosure is believed to be a PAMP recognized by TLR21 in chicken. Although even a single CpG motif can stimulate TLR21, multiple CpGs present on the oligonucleotide can increase the TLR21 signal strength of stimulation. For this reason, in some aspects of the present invention, the at least one CpG motif comprises two, three, four or five CpG motifs. In some aspects, the at least one CpG motif comprises six or more CpG motifs. In some aspects, the at least one CpG motif comprises two CpG motifs. In some aspects, the at least one CpG motif comprises three CpG motifs. In some aspects, the at least one CpG motif comprises four CpG motifs. In some embodiments, the at least one CpG motif comprises four CpG motifs.

[0071] In some embodiments of the oligonucleotide of the present disclosure, each CpG motif can be separated from other CpG motifs by at least one nucleotide or nucleotide analog. In some aspects, the at least one nucleotide is two to three thymine nucleotides. In other aspects, the at least one nucleotide is one to four nucleotides, although the number of intervening nucleotides can be different according to the sequence of intervening nucleotides. In some aspects, the oligonucleotide includes SEQ ID NO:217,218,219 or 220. Nucleotides adjacent to CpG-together with the CpG motif itself-constitute CpG sequence elements (for example, XCGX, wherein X=any nucleotides). In some aspects, the oligonucleotide of the present disclosure includes CpG sequence elements, which are GCGA, GCGG, ACGC, CCGC, GCGT, TCGC or any combination thereof.

[0072] In some embodiments of the present disclosure, the CpG motif comprises a CpG sequence element with four nucleotides. In some aspects, the oligonucleotide comprises at least two CpG sequence elements. In some aspects, the oligonucleotide comprises at least three CpG sequence elements. In some aspects, the oligonucleotide comprises at least four CpG sequence elements. In some aspects, the oligonucleotide comprises at least five CpG sequence elements. In some aspects, the oligonucleotide comprises at least six CpG sequence elements. In some aspects, the oligonucleotide comprises more than eight, ten, fifteen or even twenty CpG sequence elements.

[0073] In other embodiments of oligonucleotides disclosed herein, the CpG motifs are separated from each other CpG motif by a spacer or a combination of a spacer and at least one nucleotide. In some aspects, at least one CpG motif is separated from the closest other CpG motifs by a spacer or a combination of a spacer and at least one nucleotide, and at least two other CpG motifs are adjacent to each other. Although the separated CpG motifs can enhance the immunostimulatory ability of the designed oligonucleotides, it is admitted that CpG motifs adjacent to each other can still stimulate TLR21.

[0074] The spacer for linearly separating CpG motifs can be any connection of at least a portion of the oligonucleotide bridging between CpG motifs. The spacer can include, but is not necessarily limited to, a deoxyribose phosphate bridge, a polycarbon chain or a repeated chemical unit. A basic characteristic of a spacer is the ability to form a chemical bond with the nucleotide backbone of the oligonucleotide. Therefore, in some embodiments, the spacer is a deoxyribose phosphate bridge. In some aspects, the deoxyribose phosphate bridge can include a nitrogenous base, and in other aspects, the deoxyribose phosphate bridge is abasic. In some aspects, the oligonucleotide includes SEQ ID NO:221, which includes abasic deoxyribose phosphate bridge.

[0075] In other embodiments of the present disclosure, the spacer comprises a carbochain. The carbochain may comprise 2 to 12 carbon atoms. The glycol comprising the carbochain may be used because the terminal alcohol group may react with the terminal alcohol and / or phosphate group of the oligonucleotide. In some embodiments, the carbochain comprises two carbon atoms, and in some aspects, the carbochain is derived from ethylene glycol. In some embodiments, the oligonucleotide comprises ODN-X2, wherein X2 is ethylene glycol.

[0076] Other embodiments of the present disclosure provide a carbon chain comprising three carbon atoms. In some aspects of these embodiments, the carbon chain is derived from 1,3-propylene glycol. In some embodiments, the oligonucleotide comprises CG-Gw2X2, CG-Gw2X2-2 or ODN-X3, CG-Gw2X2-1, CG-Gw2X2-3, CG-Gw2X2-4, CG-Gw2X2-5, CG-G4T16X2-1, CG-G4T16X2-2, CG-G4T16X2-3, CG-G4T16X2-4 or CG-G4T16X2-5, wherein X2 is a three-carbon chain; 2006-PDE5dG4-X2, wherein X2 is a three-carbon chain derived from propylene glycol; or SEQ ID NO: 250, wherein X4 is a three-carbon chain derived from propylene glycol.

[0077] In other embodiments of the present disclosure, the oligonucleotide comprises a carbon chain spacer, wherein the carbon chain comprises four carbon atoms. In some aspects of these embodiments, the carbon chain is derived from 1,4-butanediol. In some embodiments, the oligonucleotide comprises ODN-X4, wherein X4 is a four-carbon chain derived from 1,4-butanediol.

[0078] In other embodiments of the present disclosure, the oligonucleotide comprises a spacer having a repeated chemical unit. For example, in some embodiments, the repeated chemical unit is ethylene glycol. The repeated chemical unit can be repeated twice to twelve times. In some embodiments, ethylene glycol is repeated six times. Therefore, in some aspects, the oligonucleotide comprises CCGC-Gw2X1, wherein X1 is a spacer derived from hexaethylene glycol.

[0079] Although the guanine nucleotide extension on the 3' end of the oligonucleotide causes little (if any) TLR21 stimulation, other nucleotide extensions can confer enhanced immunogenicity to the oligonucleotide. Specifically, in some aspects of the present disclosure, the oligonucleotide may further comprise a three thymine nucleotide 3' end. In some aspects, the oligonucleotide comprises SEQ ID NO: 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214 or 215.

[0080] For every kind of oligonucleotide disclosed herein, those skilled in the art will know that nucleotide can be substituted with nucleotide analogs.In some embodiments, the oligonucleotide comprises a phosphodiester backbone, although other embodiments of the oligonucleotide disclosed herein include a thiophosphate backbone.In some cases, the thiophosphate backbone can be manufactured more easily and cost-effectively.

[0081] In some embodiments of the invention, the oligonucleotide may include a lipid moiety that may result in an increase in the immunogenicity of the oligonucleotide. A possible explanation for the increase in immunogenicity is that the lipid moiety may function to enhance the bioavailability of the oligonucleotide. In some embodiments, the lipid moiety is at or near the 5' end of the oligonucleotide. The lipid "cap" may prevent degradation, increase solubility, improve the stability of the oligonucleotide in a pharmaceutical composition, or any combination thereof. In some aspects, the lipid moiety is a cholesterol group.

[0082] The half-maximal effective concentration (EC 50 ) to characterize the efficacy of the immunostimulatory oligonucleotides and immunostimulatory compositions, the half maximal effective concentration (EC 50 ) is a measure of the concentration necessary to induce a response that is half of the maximum response obtainable by administering the composition. The lower the concentration, the more effective the oligonucleotide. In some aspects of the present disclosure, the immunostimulatory composition may have an EC in the pM range. 50 In some aspects, the EC 50 In some aspects, the EC 50 In some aspects, the EC 50 In some aspects, the EC 50 is about 300 to 400 pM. In some aspects, the EC 50 In some aspects, the EC 50 In some aspects, the EC 50 is about 600 to 700 pM. In some aspects, the EC 50 is about 700 to 800 pM. In some aspects, the EC 50 is about 800 to 900 pM. In some aspects, the EC 50 is about 900 to 1 nM. In other aspects, the EC 50 Less than about 100 pM.

[0083] Regarding the concentration of the oligonucleotide in the immunostimulatory composition, in some aspects, the concentration of the oligonucleotide is about 0.1 to 10 nM. In some aspects, the concentration of the oligonucleotide is about 10 to 20 nM. In some aspects, the concentration of the oligonucleotide is about 20 to 30 nM. In some aspects, the concentration of the oligonucleotide is about 30 to 40 nM. In some aspects, the concentration of the oligonucleotide is about 40 to 50 nM. In some aspects, the concentration of the oligonucleotide is about 50 to 60 nM. In some aspects, the concentration of the oligonucleotide is about 60 to 70 nM. In some aspects, the concentration of the oligonucleotide is about 70 to 80 nM. In some aspects, the concentration of the oligonucleotide is about 80 to 90 nM. In some aspects, the concentration of the oligonucleotide is about 90 to 100 nM. In other aspects, the concentration of the oligonucleotide is less than about 20 nM.

[0084] In some embodiments of the present disclosure, the immunostimulatory composition may further comprise at least one additional oligonucleotide having a G-line sequence. Because the G-line sequence promotes aggregation of other oligonucleotides having the same or similar G-line sequence, one aspect of the immunostimulatory composition further comprises at least one additional oligonucleotide having a G-line sequence. In some aspects in which the immunostimulatory composition comprises a plurality of oligonucleotides having a G-line sequence, the oligonucleotides and at least one additional oligonucleotide have a G-line conformation.

[0085] According to some aspects of the present invention, the ability of oligonucleotide stimulating TLR21 can be further enhanced by inserting extra CpG motifs. In some aspects, at least one CpG motif is a plurality of CpG motifs, and a plurality of CpG motifs comprise two, three, four or five CpG motifs. The distance between the CpG motifs can affect the TLR21 stimulating properties of oligonucleotide. For this reason, some aspects of disclosed oligonucleotide provide inserting at least one Nucleotide or nucleotide analog between CpG motifs. The at least one Nucleotide can be two to three thymine nucleotides.

[0086] Other embodiments provide for including a spacer between each CpG motif. The spacer must be capable of bonding to the 3' end of an adjacent nucleotide chain and to the 5' end of another nucleotide chain. In some aspects, the spacer is a deoxyribose phosphate bridge, which may be abasic in some aspects.

[0087] In some aspects, the spacer may comprise a carbon chain. In some embodiments, the carbon chain comprises two carbon atoms. In some aspects, the carbon chain is derived from ethylene glycol. Other embodiments provide a carbon chain comprising three carbon atoms. In some aspects, the carbon chain is derived from 1,3-propylene glycol. In some embodiments, the carbon chain comprises four carbon atoms, and in some aspects, the carbon chain is derived from 1,4-butanediol. In other embodiments, the spacer comprises a repeated chemical unit. In some aspects, the repeated chemical unit is ethylene glycol, and in some aspects, the spacer is derived from hexaethylene glycol.

[0088] Representative oligonucleotides of the present disclosure are identified in Table 1. Table 1: Oligonucleotide sequences (lower case: PTO key, upper case: PDE key)

[0089] The immunogenic nucleic acid plasmids described herein are rich in CpG motifs. In some aspects, the immunogenic nucleic acid plasmids contain greater than 20% CpG motifs compared to the frequency of CpG motifs found in vertebrate nucleic acid sequences.

[0090] In some aspects, the disclosure relates to immunogenic nucleic acid plasmids that do not contain antibiotic resistance genes. In some aspects, the plasmid does not contain a nucleic acid sequence encoding a full-length or functional selectable or screenable marker. For example, the pGCMB75.6 plasmid described herein does not contain any full-length or functional selectable or screenable marker gene. The sequence of pGCMB75.6 is provided in SEQ ID NO: 265 (Table 1A). In some aspects, the plasmid described herein does not encode an immunogen.

[0091] In some aspects, the immunogenic plasmid can include a nucleic acid sequence encoding a selectable or screenable marker gene that is not an antibiotic resistance gene. For example, the pLacZMB75.6 plasmid described herein includes a LacZ gene as a screenable marker. The sequence of pLacZMB75.6 is provided in SEQ ID NO: 268. In other aspects, the plasmid will contain an antibiotic resistance gene. For example, pMB75.6 includes a nucleic acid sequence encoding resistance to the antibiotic kanamycin. The sequence of pMB75.6 is provided in SEQ ID NO: 266.

[0092] It should be understood that the nucleotide sequence of the pMB75.6, pGCMB75.6 or pLacZMB75.6 plasmid can be altered to a certain extent without significantly adversely affecting its immunostimulatory properties. In some aspects, an immunogenic nucleic acid plasmid is provided, comprising or consisting of a nucleic acid sequence having at least 89% sequence identity to the sequence of pGCMB75.6 (SEQ ID NO: 265). In some aspects, the immunogenic plasmid comprises a nucleic acid sequence having at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the sequence of pGCMB75.6 (SEQ ID NO: 265). In some aspects, the immunogenic nucleic acid plasmid comprises the sequence of pGCMB75.6 (SEQ ID NO: 265).

[0093] In some aspects, an immunogenic nucleic acid plasmid is provided, comprising a nucleic acid sequence having at least 84% sequence identity to the sequence of pLacZMB75.6 (SEQ ID NO: 268). In some aspects, the immunogenic plasmid comprises a nucleic acid sequence having at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the sequence of pLacZMB75.6 (SEQ ID NO: 268), or consists of. In some aspects, the immunogenic nucleic acid comprises a plasmid having the sequence of pLacZMB75.6 (SEQ ID NO: 268).

[0094] In some aspects, an immunogenic nucleic acid plasmid is provided, comprising a nucleic acid sequence having at least 80% sequence identity to the sequence of SEQ ID NO: 266. In some aspects, the immunogenic plasmid comprises or consists of a nucleic acid sequence having at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the sequence of SEQ ID NO: 266. In some aspects, the immunogenic nucleic acid plasmid comprises the sequence of SEQ ID NO: 266.

[0095] In some aspects, an immunogenic nucleic acid plasmid is provided, comprising a nucleic acid sequence with at least 80% sequence identity to the sequence (SEQ ID NO: 267) of pMB75.6_AscI. In some aspects, the immunogenic plasmid comprises a nucleic acid sequence with at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the sequence of SEQ ID NO: 267, or consists of it. In some aspects, the immunogenic nucleic acid plasmid comprises the sequence of SEQ ID NO: 267. Table 1A: Plasmid sequences

[0096] Further provided herein are immunogenic nucleic acids or immunogenic plasmids capable of stimulating an immune response, comprising nucleic acid sequences that hybridize to SEQ ID NO:265, SEQ ID NO:266, SEQ ID NO:267 or SEQ ID NO:268 under high stringency conditions. Suitable nucleic acid sequences include those that are homologous, substantially similar or identical to the nucleic acids described herein. In some aspects, homologous nucleic acid sequences will have at least about 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% percent identity with SEQ ID NO:265 or a corresponding complementary sequence. In other aspects, the homologous nucleic acid sequence will have at least about 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence similarity to SEQ ID NO:268 or a corresponding complementary sequence. In other aspects, the homologous nucleic acid sequence will have at least about 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence similarity to SEQ ID NO:266 or a corresponding complementary sequence. In other aspects, the homologous nucleic acid sequence will have at least about 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence similarity with SEQ ID NO:267 or the corresponding complementary sequence. Many algorithms known in the art can be used, such as Altschul, SF, et al., BLAST described in J.Mol.Biol.215:403-10,1990, to calculate sequence similarity. The nucleic acid can be different from the above-mentioned nucleic acid sequence due to the degeneracy of the genetic code. Typically, the reference sequence will be 18 nucleotides, more typically 30 or more nucleotides, and the entire nucleic acid sequence of the composition can be included for comparison purposes.

[0097] Nucleic acids that can hybridize to SEQ ID NO: 265, SEQ ID NO: 266, SEQ ID NO: 267, or SEQ ID NO: 268 are contemplated herein. Stringent hybridization conditions include conditions such as: hybridization at 50°C or higher and 0.1X SSC (15mM sodium chloride / 1.5mM sodium citrate). Another example is incubation overnight at 42°C in a solution of 50% formamide, 5X SSC (150mM NaCl, 15mM trisodium citrate), 50mM sodium phosphate (pH 7.6), 5X Denhardt's solution, 10% dextran sulfate, and 20μg / ml denatured, sheared salmon sperm DNA, followed by washing in 0.1X SSC at about 65°C. Exemplary stringent hybridization conditions are hybridization conditions that are at least about 80%, 85%, 90%, or 95% as stringent as the above-mentioned specific conditions. Other stringent hybridization conditions are known in the art and can also be used to identify homologs of the nucleic acids of the disclosure (Current Protocols in Molecular Biology, Unit 6, pub. John Wiley & Sons, NY 1989).

[0098] It should be understood that the nucleotide sequence of the immunogenic nucleic acid plasmid can be changed to a certain extent without significantly adversely affecting its immunogenic properties. The nucleic acid sequence of such variant nucleic acid plasmid molecules will generally differ by one or more nucleotides. The sequence changes may be substitutions, insertions, deletions, or a combination thereof. The techniques for mutagenizing cloned genes are known in the art. Methods for site-specific mutagenesis can be found in Gustin et al., Biotechniques 14:22, 1993; Barany, Gene 37:111-23, 1985; Colicelli et al., Mol. Gen. Genet. 199:537-9, 1985; and Sambrook et al., Molecular Cloning: A Laboratory Manual, CSH Press 1989, pp.15.3-15.108 and are all incorporated herein by reference. In summary, the present invention relates to nucleic acid plasmid molecules and variants or mutants thereof that can stimulate an innate immune response in a subject. In addition, the present invention encompasses intermediate RNAs encoded by the nucleic acid, and any resulting amino acid sequences encoded by the nucleic acid plasmids described herein.

[0099] In some aspects, in the case where the nucleotide sequence of the immunogenic nucleic acid plasmid is different from the sequence provided in SEQ ID NO: 265, 266, 267 or 268, the CpG dinucleotides in the immunogenic nucleic acid plasmid are preferably kept intact. Alternatively, if the nucleotide sequence of the immunogenic plasmid is changed so that the CpG dinucleotides are eliminated, the sequence of the immunogenic nucleic acid plasmid can be changed at another position so that the total number of CpG dinucleotides in the nucleic acid plasmid remains the same. Additional CpG dinucleotides other than those already present in the immunogenic nucleic acid plasmid can also be introduced. Therefore, for example, the immunogenic nucleic acid plasmid described herein comprises at least about 200, at least about 220, at least about 240, at least about 260, at least about 270, at least about 275, at least about 280, at least about 283, at least about 285 or at least about 288 CpG dinucleotides. In some embodiments, the immunogenic nucleic acid plasmid can comprise 283 CpG dinucleotides. In some embodiments, CpG dinucleotides other than those already present in the nucleotide sequence of pGCMB75.6 or pLacZMB75.6 are introduced into the plasmid.

[0100] In some aspects, when the nucleotide sequence of the immunogenic nucleic acid plasmid is different from the sequence provided herein, the CpG motif type in the immunogenic nucleic acid is changed to adjust the activation of the resulting cytoplasmic nucleic acid monitoring molecule (i.e., TLR21 and / or TLR9). For example, the number of immunostimulatory CpG motifs can be increased to enhance the activation of at least one cytoplasmic nucleic acid monitoring molecule in response to the immunogenic nucleic acid plasmid. Alternatively, the number of non-immunostimulatory CpG motifs can be increased to reduce the activation of at least one cytoplasmic nucleic acid monitoring molecule. In some aspects, the number of stimulating and non-stimulating CpG motifs can be modified to enhance the activation of at least one cytoplasmic nucleic acid monitoring molecule, and to reduce the activation of at least one cytoplasmic nucleic acid monitoring molecule.

[0101] Suitable immunogenic nucleic acid plasmid molecules include any of the immunogenic coding and non-coding nucleic acids described herein. The coding nucleic acid sequence encodes at least a portion of a protein or peptide, while the non-coding sequence does not encode any portion of a protein or peptide. According to the present invention, a "non-coding" nucleic acid may include a regulatory region of a transcription unit, such as a promoter region. The term "empty vector" may be used interchangeably with the term "non-coding", and refers in particular to a nucleic acid sequence in which there is no protein coding portion, such as a plasmid vector without a gene insert. Inducing an immune response does not require expression of a protein encoded by a nucleic acid plasmid described herein; therefore, the plasmid does not need to contain any coding sequence operably connected to a transcription control sequence. However, further advantages (i.e., antigen specificity and enhanced immunity) may be obtained by including at least one nucleic acid sequence (DNA or RNA) encoding an immunogen and / or cytokine in an immunomodulatory composition. Such nucleic acid sequences encoding immunogens and / or cytokines may be included in immunogenic nucleic acid plasmids described herein, or may be included in separate nucleic acids (e.g., separate plasmids) in a composition.

[0102] In some embodiments of the immunomodulatory compositions described herein, the immunomodulatory compositions comprise a liposomal delivery vehicle and at least one immunogenic nucleic acid plasmid described herein. Suitable immunomodulatory compositions are described in U.S. Patent Application Publication Nos. 2012 / 0064151A1 and 2013 / 0295167A1, the contents of both of which are incorporated herein by reference in their entirety.

[0103] Suitable liposome delivery vehicles include lipid compositions that can deliver nucleic acid molecules to tissues for the treatment of subjects. In some embodiments, liposome delivery vehicles may be able to maintain stable enough long time in subjects to deliver nucleic acid molecules and / or biological agents. For example, the liposome delivery vehicle is stable in recipient subjects for at least about five minutes, at least about 1 hour or at least about 24 hours.

[0104] As described herein, liposome delivery vehicles include lipid compositions that can fuse with the plasma membrane of cells to deliver nucleic acid molecules to cells. In some aspects, when the nucleic acid molecule encodes one or more proteins, the nucleic acid: liposome complex has a transfection efficiency of at least about 1 picogram (pg) of expressed protein / milligram (mg) of total tissue protein / microgram (μg) of nucleic acid delivered. For example, nucleic acid: The transfection efficiency of the liposome complex can be at least about 10pg of expressed protein / mg of total tissue protein / μg of nucleic acid delivered; or at least about 50pg of expressed protein / mg of total tissue protein / μg of nucleic acid delivered. The transfection efficiency of the complex can be as low as 1 femtogram (fg) of expressed protein / mg of total tissue protein / μg of nucleic acid delivered, wherein the above amount is more preferred.

[0105] In some embodiments, the liposome delivery vehicle of the present invention has a diameter of about 100 to 500 nanometers (nm). For example, the diameter of the liposome delivery vehicle can be about 150 to 450 nm or about 200 to 400 nm.

[0106] Suitable liposomes include any liposomes, such as those commonly used in gene delivery methods known to those skilled in the art. In some embodiments, the liposome delivery vehicle comprises multilamellar vesicles (MLV) lipids, extruded lipids, or both. In some aspects, the liposome delivery vehicle is cationic. Methods for preparing MLVs are well known in the art. In some aspects, the liposome delivery vehicle includes liposomes (i.e., cationic liposomes) composed of polycationic lipids and / or liposomes with a cholesterol backbone conjugated to polyethylene glycol. Exemplary cationic liposome compositions include, but are not limited to, N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA) and cholesterol, N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP) and cholesterol, 1-[2-(oleoyloxy)ethyl]-2-oleyl-3-(2-hydroxyethyl)imidazolinium chloride (DOTIM) and cholesterol, and dimethyldioctadecylammonium bromide (DDAB) and cholesterol, and combinations thereof. In some aspects, the liposome delivery vehicle comprises a lipid pair selected from the group consisting of: N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA) and cholesterol; N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP) and cholesterol; 1-[2-(oleoyloxy)ethyl]-2-oleyl-3-(2-hydroxyethyl)imidazolinium chloride (DOTIM) and cholesterol; and dimethyldioctadecyl ammonium bromide (DDAB) and cholesterol. In some aspects, the liposome composition used as a delivery vehicle comprises DOTIM and cholesterol.

[0107] The compound of liposome and immunogenic nucleic acid plasmid as described herein can be realized using the method of standard in the art or as described in U.S. Patent No. 6,693,086 (its content is incorporated herein by reference in its entirety). Suitable concentrations of nucleic acid plasmids added to liposomes include concentrations effective for delivering sufficient amounts of immunogenic nucleic acid plasmids to subjects so as to induce systemic immune responses. For example, about 0.1 μg to about 10 μg of immunogenic nucleic acid plasmids can be combined with about 8 nmol liposomes, about 0.5 μg to about 5 μg of immunogenic nucleic acid plasmids can be combined with about 8 nmol liposomes, or about 1.0 μg of immunogenic nucleic acid plasmids can be combined with about 8 nmol liposomes. The ratio of immunogenic nucleic acid plasmid to lipid in the composition (μg immunogenic nucleic acid plasmid: nmol lipid) can be at least about 1:1 immunogenic nucleic acid plasmid by weight: lipid (e.g., 1 μg immunogenic nucleic acid plasmid: 1 nmol lipid). For example, the ratio of immunogenic nucleic acid plasmid to lipid can be at least about 1:5, at least about 1:10 or at least about 1:20. The ratios represented herein are based on the amount of lipid in the composition, rather than the total amount of lipid in the composition. The ratio of immunogenic nucleic acid plasmid to lipid in the composition of the present invention is suitably about 1:1 to about 1:80 immunogenic nucleic acid plasmid: lipid (by weight); about 1:2 to about 1:40 immunogenic nucleic acid plasmid: lipid (by weight); about 1:3 to about 1:30 immunogenic nucleic acid plasmid: lipid (by weight); or about 1:6 to about 1:15 immunogenic nucleic acid plasmid: lipid (by weight).

[0108] The concentration of the immunomodulatory composition, if increased to above a threshold, can be cytotoxic. For this reason, the concentration of the immunomodulatory composition as expected in the present disclosure is non-cytotoxic, that is, at a level below the threshold. "Cytotoxicity" as used herein refers to abnormal cell states, such as failure to grow vigorously, growth retardation, irregular microscopic appearance and / or decreased immune responsiveness. In some aspects, the concentration of the immunomodulatory composition is about 0.1 to about 250ng / ml. In some aspects, the concentration is about 0.1 to about 200ng / ml. In some aspects, the concentration of the immunomodulatory composition is about 0.1 to about 150ng / ml. In other aspects, the concentration of the immunomodulatory composition is about 0.1 to about 100ng / ml. In other aspects, the concentration of the immunomodulatory complex is about 0.1 to about 50ng / ml. In other aspects, the concentration of the immunomodulatory composition is about 1 to about 250ng / ml. In some aspects, the concentration of the immunomodulatory composition is about 10 to about 250ng / ml. In some aspects, the concentration of the immunomodulatory composition is about 50 to about 250 ng / ml. In some aspects, the concentration of the immunomodulatory composition is about 100 to about 250 ng / ml. In some aspects, the concentration of the immunomodulatory composition is about 150 to about 250 ng / ml. In other aspects, the concentration of the immunomodulatory composition is about 200 to about 250 ng / ml. In some embodiments, the concentration of the immunomodulatory composition is about or less than 120 ng / ml. In some aspects, the concentration of the immunomodulatory composition is non-cytotoxic.

[0109] Further provided herein is a pharmaceutical composition comprising an immunostimulatory composition as described above and a pharmaceutically acceptable carrier. The immunomodulatory composition can be administered before, simultaneously or after the immunostimulatory oligonucleotide. The pharmaceutical carrier for a single immunomodulatory composition and an immunostimulatory oligonucleotide can be but need not be the same carrier. The pharmaceutically acceptable carrier adapts the composition to be administered by a route selected from the following: intravenous, intramuscular, intramammary, intradermal, intraperitoneal, subcutaneous, by spraying, by aerosol, in ovo, mucosal, transdermal, by immersion, oral, intraocular, intratracheal, intranasal, lung, rectal or other means known to those skilled in the art. One or more pharmaceutically acceptable carriers can be a diluent, adjuvant, excipient or vehicle administered together with the immunostimulatory composition or the immunostimulatory composition and the immunostimulatory oligonucleotide. Such vehicles can be liquids, such as water and oils, including those of petroleum, animal, plant or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, etc. For example, 0.4% saline and 0.3% glycine can be used. These solutions are sterile and generally free of particulate matter. They can be sterilized by conventional well-known sterilization techniques (e.g., filtration). The composition may contain pharmaceutically acceptable auxiliary substances required for approximate physiological conditions, such as pH adjustment and buffers, stabilizers, thickeners, lubricants and colorants, etc. The concentration of the molecule of the present invention in such a pharmaceutical preparation can vary widely, i.e., by weight from less than about 0.5%, generally to at least about 1% to up to 15 or 20%, and will be selected mainly based on the required dosage, fluid volume, viscosity, etc. according to the selected specific mode of administration. Other human proteins, such as suitable vehicles and preparations of human serum albumin, are included, for example, as described in, for example, Remington: The Science and Practice of Pharmacy, 21st edition, Troy, DB compiled, Lipincott Williams and Wilkins, Philadelphia, PA 2006, Part 5, Pharmaceutical Manufacturing 691-1092 pages, (especially referring to pages 958-989).

[0110] Also provided herein is a method for preparing the above-described immunostimulatory composition, comprising: combining the immunomodulatory agent composition and the immunostimulatory oligonucleotide to form an immunostimulatory composition; centrifuging the immunostimulatory composition to generate a supernatant and a precipitate; and separating the precipitate.

[0111] Centrifugal immunostimulatory composition will cause the sedimentation of immunostimulatory composition. Separation of precipitation can be achieved by pouring out supernatant, sucking out supernatant or removing supernatant by other means, as long as a part of precipitation is retained. It is also expected that some precipitation will be lost during the removal of supernatant. Similarly, even after centrifugation, some immunostimulatory compositions may also remain in the supernatant. In this case, the supernatant can retain immunostimulatory properties. If immunostimulatory activity is retained in the supernatant due to the presence of immunostimulatory composition, but it is expected that there is almost all immunostimulatory composition in the precipitation, a higher centrifugal speed should be used. For example, if the supernatant contains immunostimulatory composition after centrifugation at 8,000rpm, then increasing centrifugation to 14,000rpm may reduce the remaining immunostimulatory composition.

[0112] Also provided herein are methods for stimulating toll-like receptor 21 (TLR21), comprising administering an immunostimulatory oligonucleotide and an immunomodulatory composition, wherein the immunostimulatory oligonucleotide comprises at least one CpG motif and a guanine nucleotide-rich sequence at or near the 5' end of the immunostimulatory oligonucleotide, and wherein the immunomodulatory composition comprises a non-coding nucleic acid plasmid and a cationic lipid delivery vehicle.

[0113] The immunostimulatory oligonucleotide and the immunomodulator composition can be administered by a route selected from the following: intravenous, intramuscular, intramammary, intradermal, intraperitoneal, subcutaneous, by spray, by aerosol, intraocular, mucosal, transdermal, by immersion, oral, intraocular, intratracheal, intranasal, pulmonary, rectal or other means known to those skilled in the art. In some aspects, the immunostimulator composition and the immunostimulatory oligonucleotide are present in a synergistic effective amount. The administration of the immunostimulatory composition and the immunomodulator composition can be sequential or simultaneous.

[0114] When higher than 250 μ g / ml, the concentration of the immunomodulator composition can be cytotoxic, and this cytotoxicity can far offset any immunostimulatory effect of the immunomodulator. In some aspects of the present disclosure, the concentration of the immunomodulator is about 200 μ g / ml. In the case of applying the immunostimulatory oligonucleotide, no cytotoxicity level is observed in the range of 10 μ M or below. The recipient can tolerate even higher concentrations of immunostimulatory oligonucleotides. In some aspects of the present disclosure, the concentration of the immunostimulatory oligonucleotide is about 10 μ M to 0.5 μ M. In some aspects, the concentration of the immunostimulatory oligonucleotide is about 2 μ M, and in some aspects, the concentration of the immunomodulator composition is greater than the concentration of the immunostimulatory oligonucleotide. Because cytotoxicity is a limiting factor for applying the immunomodulator composition, in some aspects, the immunomodulator composition is present in a non-cytotoxic amount.

[0115] In each aspect of the methods presented herein, the immunomodulator composition and the immunostimulatory oligonucleotide can be any embodiment or aspect as described above.

[0116] Also provided are methods for eliciting an immune response in a subject comprising administering any embodiment of the immunostimulatory composition described herein.Any embodiments included in the present disclosure include methods for eliciting an immune response in a subject comprising administering an immunostimulatory oligonucleotide and an immunomodulator composition described herein. DETAILED DESCRIPTION This application also relates to the following implementation schemes: 1. An immunostimulatory composition comprising: a) an immunomodulatory composition comprising a nucleic acid plasmid and a liposome delivery vehicle; and b) an immunostimulatory oligonucleotide having at least one CpG motif and a guanine nucleotide-rich sequence at or near the 5' end of the immunostimulatory oligonucleotide. 2. The immunostimulatory composition of embodiment 1, wherein the immunomodulatory agent composition and the immunostimulatory oligonucleotide are present in synergistically effective amounts. 3. The immunostimulatory composition of embodiment 1 or 2, wherein the immunostimulatory oligonucleotide comprises a ligand for a cytoplasmic nucleic acid surveillance molecule. 4. The immunostimulatory composition of embodiment 3, wherein the immune cytoplasmic nucleic acid surveillance molecule is a toll-like receptor (TLR). 5. The immunostimulatory composition of embodiment 3 or 4, wherein the cytoplasmic nucleic acid surveillance molecule is TLR21. 6. The immunostimulatory composition of any one of the preceding embodiments, wherein the nucleic acid plasmid concentration of the immunomodulator composition is greater than the concentration of the immunostimulatory oligonucleotide. 7. The immunostimulatory composition according to any one of the preceding embodiments, further comprising a pharmaceutical carrier. 8. The immunostimulatory composition according to any one of the preceding embodiments, wherein the liposomal delivery vehicle comprises multilamellar vesicle lipids, extruded lipids, or both. 9. The immunostimulatory composition according to any one of the preceding embodiments, wherein the liposomal delivery vehicle is cationic. 10. The immunostimulatory composition of embodiment 8, wherein the cationic liposome delivery vehicle comprises a lipid pair selected from the group consisting of: N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA) and cholesterol; N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP) and cholesterol; 1-[2-(oleoyloxy)ethyl]-2-oleyl-3-(2-hydroxyethyl)imidazolinium chloride (DOTIM) and cholesterol; and dimethyldioctadecylammonium bromide (DDAB) and cholesterol. 11. The immunostimulatory composition according to any of the preceding embodiments, wherein the nucleic acid plasmid is non-coding. 12. The immunostimulatory composition of any one of embodiments 1-11, wherein the nucleic acid plasmid has at least 75% sequence identity with SEQ ID NO.265. 13. The immunostimulatory composition of any one of embodiments 1-11, wherein the nucleic acid plasmid has at least 75% sequence identity with SEQ ID NO.266. 14. The immunostimulatory composition of any one of embodiments 1-11, wherein the nucleic acid plasmid has at least 75% sequence identity to SEQ ID NO:268. 15. The immunostimulatory composition according to any one of the preceding embodiments, wherein the guanine nucleotide-rich sequence comprises a first plurality of guanine nucleotides. 16. The immunostimulatory composition of embodiment 15, wherein the first plurality of guanine nucleotides comprises three to eight guanine nucleotides. 17. The immunostimulatory composition of embodiment 15 or 16, wherein the immunostimulatory oligonucleotide comprises SEQ ID NO: 16, 17, 18, 19, 20, 21, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 77, 78, 81, 82, 85, 86, 89, 90, 92, 93, 96, 97, 100, 102, 104, 106, 108, 143, or 1. 18. The immunostimulatory composition of embodiment 15 or 16, further comprising a second plurality of guanine nucleotides downstream of the first plurality of guanine nucleotides. 19. The immunostimulatory composition of embodiment 18, wherein the immunostimulatory oligonucleotide comprises SEQ ID NO: 141, 142, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203 or GCGT-3. 20. The immunostimulatory composition of embodiment 18 or 19, wherein said first plurality of guanine nucleotides and said second plurality of guanine nucleotides are separated by at least two nucleotides. 21. The immunostimulatory composition of any one of embodiments 15 to 20, wherein said first plurality of guanine nucleotides and said at least one CpG motif are separated by at least 3 nucleotides. 22. The immunostimulatory composition of embodiments 15 to 21, wherein the first plurality of guanine nucleotides and the at least one CpG motif are separated by hexaethylene glycol, tetraethylene glycol, propylene glycol or a derivative thereof. 23. The immunostimulatory composition of embodiment 22, wherein the structure of hexaethylene glycol is: 24. The immunostimulatory composition of any of the preceding embodiments, wherein the immunostimulatory oligonucleotide further comprises a plurality of CpG motifs, each CpG motif in the plurality of CpG motifs being separated from other CpG motifs in the plurality of CpG motifs by a spacer. 25. The immunostimulatory composition of embodiment 24, wherein the spacer comprises at least one nucleotide or a nucleotide analog. 26. The immunostimulatory composition of embodiment 25, wherein the spacer comprises a deoxyribose phosphate bridge. 27. The immunostimulatory composition of embodiment 26, wherein the deoxyribose phosphate bridge is abasic. 28. The immunostimulatory composition of embodiment 25, wherein the spacer comprises a carbon chain. 29. The immunostimulatory composition of embodiment 28, wherein the carbon chain is derived from 1,3-propanediol. 30. The immunostimulatory composition of embodiment 25, wherein the spacer comprises repeating chemical units. 31. The immunostimulatory composition of embodiment 30, wherein the repeating chemical unit is ethylene glycol. 32. The immunostimulatory composition of any one of embodiments 1-31, wherein the immunostimulatory oligonucleotide further comprises a phosphorothioate backbone. 33. The immunostimulatory composition according to any one of the preceding embodiments, wherein the immunostimulatory oligonucleotide comprises a lipid portion. 34. The immunostimulatory composition of embodiment 33, wherein the lipid moiety is a cholesterol group. 35. The immunostimulatory composition of any one of embodiments 33 to 34, wherein the lipid moiety is at or near the 5' end of the immunostimulatory oligonucleotide. 36. The immunostimulatory composition according to any of the preceding embodiments, comprising a CpG sequence element at the 5' end, the 3' end or both. 37. The immunostimulatory composition of embodiment 36, which has at least two CpG sequence elements. 38. The immunostimulatory composition of embodiment 36 or 37, wherein the CpG sequence element is GCGA, GCGG, ACGC, CCGC, GCGT or TCGC. 39. A method for preparing the immunostimulatory composition of any one of the preceding embodiments, comprising: combining the immunomodulatory agent composition and the immunostimulatory oligonucleotide to form an immunostimulatory composition; centrifuging the immunostimulatory composition to generate a supernatant and a precipitate; and The precipitate was isolated. 40. A method for stimulating toll-like receptor 21 (TLR21), comprising: An immunostimulatory oligonucleotide and an immunomodulatory agent composition are administered, wherein the immunostimulatory oligonucleotide has at least one CpG motif and a guanine nucleotide-rich sequence at or near the 5' end of the immunostimulatory oligonucleotide, and wherein the immunomodulatory agent composition comprises a non-coding nucleic acid plasmid and a lipid delivery vehicle. 41. The method of embodiment 40, wherein the immunomodulator composition and the immunostimulatory oligonucleotide are present in synergistically effective amounts. 42. The method of embodiment 40 or 41, wherein the immunostimulatory oligonucleotide comprises a ligand for TLR21. 43. A method of eliciting an immune response in a subject, comprising administering to the subject the immunostimulatory composition of any one of embodiments 1 to 38. 44. An immunostimulatory composition comprising: a. Nucleic acid plasmids and liposome delivery vehicles; and b. An immunostimulatory oligonucleotide comprising SEQ ID NO: 1. 45. The immunostimulatory composition of embodiment 44, wherein the nucleic acid plasmid has at least 75% sequence identity with a sequence selected from SEQ ID NO:265, SEQ ID NO:266, and SEQ ID NO:268. 46. ​​The immunostimulatory composition of any one of embodiments 44-45, wherein the immunostimulatory oligonucleotide further comprises a 5' cholesterol group modification. 47. The immunostimulatory composition of embodiment 46, wherein the 5' cholesterol group modification comprises a triethylene glycol linker. Example

[0117] The following examples are provided to further describe some of the embodiments disclosed herein. The examples are intended to illustrate, but not to limit, the disclosed embodiments.

[0118] The immunomodulator composition used in the following examples is a composition comprising a cationic lipid (DOTIM and cholesterol) and a non-coding DNA (pMB75.6) (SEQ ID NO: 266). The cationic lipid component is [1-[2-[9-(Z)-octadecenoyloxy]]-2-[8](Z)-heptadecene]-3-[hydroxyethyl]imidazolinium chloride (DOTIM) and synthetic neutral lipid cholesterol, which are formulated to produce liposomes with a diameter of approximately 200nm (see, U.S. Patent No. 6,693,086). The non-coding DNA component is a non-coding DNA plasmid (pMB75.6) (SEQ ID NO: 266) of 4292 base pairs produced in Escherichia coli, which is negatively charged and associates with positively charged (cationic) liposomes (see, U.S. Patent No. 6,693,086). In the embodiments, the term "immunostimulatory nucleic acid plasmid" refers to pMB75.6.

[0119] Example 1: Combine TLR21-active oligodeoxynucleotides with immunomodulator compositions to explore the activity of immunomodulator compositions on TLR21. Specifically, HEK293-NFκB-bsd-cTLR21 cells were seeded at 10,000 cells / well into 45 μl growth medium in 384-well plates. These cells were exposed to oligonucleotides dissolved in growth medium and incubated at 37 ° C for 3-4 days. 10 μl of culture supernatant per well was transferred to a 384-well plate, and 90 μl of 50 mM NaHCO3 / Na2CO3, 2 mM MgCl2, 5 mM p-nitrophenyl phosphate (pNP) pH 9.6 was added, and the reaction rate was determined by kinetically measuring the time change of the optical density at 405 nM (mOD405 nm / min).

[0120] The immunostimulatory nucleic acid plasmid alone proved to be inactive in the concentration range considered (2 μg / ml and lower), while the liposome-formulated immunostimulatory nucleic acid plasmid (pDNA-F) showed a weak, but clear signal with a bell-shaped curve, indicating its interaction with TLR21 ( Figure 2A ). However, compared to 5-Chol-GCGT3-TG4T (SEQ ID NO: 1), an oligonucleotide ligand optimized for interaction with this receptor, the TLR21-stimulatory activity was reduced by several orders of magnitude ( Figure 2A and 2B ).

[0121] Table 2: ODN sequences

[0122] The activity of the immunomodulator composition pDNA-F on TLR21 suggests that this receptor may indeed be a component of the in vivo effects of the immunomodulator composition, but because the immunomodulator composition is a rather weak ligand for TLR21, this receptor may not be the sole and dominant cognate receptor.

[0123] Example 2: Combination of 5-Chol-GCGT3-TG4T with immunostimulatory nucleic acid plasmids and immunomodulator compositions A 200 μg / ml solution of the individual immunostimulatory nucleic acid plasmids and immunomodulator compositions and a 2 μM solution of 5-Chol-GCGT3-TG4T were prepared and incubated at 4°C for 2 h. Subsequently, serial 1:2 dilutions were prepared from the solution and administered to HEK293-bsd-cTLR21 cells starting at 20 nM plasmid concentration (and 2 μg / ml plasmid concentration) according to the protocol in Example 1 and compared with samples containing only 5-Chol-GCGT3-TG4T. All samples showed strong TLR21 stimulatory activity, with the only sample showing a slightly higher peak and an EC of 2.44 pM. 50 ( Figure 3A , Table 3). In addition to showing a slightly lower V max The combination of 5-Chol-GCGT3-TG4T and an immunostimulatory nucleic acid plasmid (which itself has no activity at all) resulted in EC 50 The change is small ( Figure 3A , Table 3). In contrast, samples containing liposomes (immunostimulatory oligonucleotide 5-Chol-GCGT3-TG4T and immunomodulatory agent composition) showed a decrease in activity maximum and strong signal at higher concentrations ( Figure 3A However, a closer examination of low concentrations (pM) revealed a defined activity plateau, where the calculated EC 50 1.04pM( Figure 3B , Table 3). Within this concentration range, the immunomodulator composition is also completely inactive ( Figure 3B ), and does not itself lead to a lower EC 50 .

[0124] Table 3: Half maximal effective concentration (EC 50 ) and the maximum signal speed (V max )

[0125] The results showed that the combination of TLR21-stimulatory ODN 5-Chol-GCGT3-TG4T and non-cytotoxic concentrations of immunostimulatory nucleic acid plasmids or immunomodulatory agent compositions produced an active mixture. 50 , the combination of TLR21-stimulatory ODN 5-Chol-GCGT3-TG4T and the immunomodulator composition is synergistic.

[0126] Example 3: Centrifugal Immunomodulator Compositions and TLR21 Activity The immunomodulator composition solution at a plasmid concentration of 200 μg / ml was centrifuged at 14,000 rpm at 4°C for 2 hours in an Eppendorf table centrifuge. For comparison, the uncentrifuged aliquots were stored at 4°C for 2 hours. The supernatant was removed and stored while the precipitate was resuspended in an equal volume. Titrations starting with 2 mg / ml plasmid content were prepared for TLR21 determinations, as described in Example 1, because it had been previously determined that the immunomodulator composition had some weak TLR21 stimulating activity (see Example 1).

[0127] Centrifugation of the immunomodulator composition produced a pellet that was difficult to resuspend with a pipette. All TLR21 stimulating activity of the immunomodulator composition was found in the pellet after centrifugation, and the supernatant had no TLR21 activity ( Figure 4 Compared with liposomes stored at 4 °C, resuspended liposomes showed a higher EC for TLR21 stimulation. 50 This effect may be due to changes in the liposomes after centrifugation (e.g., incomplete resuspension / dispersion).

[0128] Example 4: Combination of 5-Chol-GCGT3-TG4T and an immunomodulatory agent composition An immunomodulator composition / 5-Chol-GCGT3-TG4T solution with a 200 μg / ml plasmid concentration and 2 μM 5-Chol-GCGT3-TG4T was prepared. A 2 μM solution of 5-Chol-GCGT3-TG4T was also prepared. Two samples were incubated at 4°C for 2 hours. 100 μl aliquots of these solutions were centrifuged at 14,000 rpm at 4°C for 2 hours in an Eppendorf table centrifuge for use in Example 5, and the remainder of the incubation was stored at 4°C for analysis according to this Example 4. Both samples showed potent TLR21 stimulating activity, but the immunomodulator composition / 5-Chol-GCGT3-TG4T combination showed a strongly reduced signal at higher concentrations ( Figure 5A), which may be the result of the cytotoxicity of the immunomodulator composition. When considering the immunomodulator composition components of the sample at low toxic concentrations, the respective V max The values ​​are similar ( Figure 5B , Table 4). However, the calculated EC of the combined immunomodulator composition / 5-Chol-GCGT3-TG4T 50 The calculated EC of 5-Chol-GCGT3-TG4T alone 50 4 times lower ( Figure 5B , Table 4).

[0129] Table 4: Half maximal effective concentration (EC 50 ) and the maximum signal speed (V max )

[0130] Example 5: Immunomodulator composition / 5-Chol-GCGT3-TG4T and centrifugation of 5-Chol-GCGT3-TG4T Immunomodulator composition / 5-Chol-GCGT3-TG4T solution with 200 μg / ml plasmid concentration and 2 μM 5-Chol-GCGT3-TG4T was prepared. A 2 μM solution of 5-Chol-GCGT3-TG4T was also prepared. Two samples were incubated at 4°C for 2 hours. 100 μl aliquots of these solutions were centrifuged at 14,000 rpm at 4°C for 2 hours in an Eppendorf table centrifuge. The supernatant was removed and stored, while the pellet was resuspended in 100 μl. Subsequently, serial 1:2 dilutions were prepared from these solutions and applied to HEK293-bsd-cTLR21 cells starting at 20 nM plasmid concentration (and 2 μg / ml plasmid concentration) and compared to samples containing 5-Chol-GCGT3-TG4T alone.

[0131] Centrifugation of the immunomodulator composition / 5-Chol-GCGT3-TG4T combination produced a clearly visible precipitate, whereas no visible precipitate was observed for 5-Chol-GCGT3-TG4T. The immunomodulator composition / 5-Chol-GCGT3-TG4T combination precipitate ("pDNA-F 5Chol precipitate") was difficult to resuspend, but contained virtually all stimulatory activity in the TLR21 assay as described in Example 1 ( Fig. 6A and 6B ), where only trace amounts ( Figure 6B , Table 4), although EC 50The results showed that after mixing with the immunomodulator composition, 5-Chol-GCGT3-TG4T was physically associated with the liposome fraction in quantity. 5-Chol-GCGT3-TG4T alone, when centrifuged, remained almost exclusively (estimated 99%, Table 4) in the supernatant, as expected from a soluble compound ( Fig. 7A and 7B ).

[0132] Example 6: Combination of 5-Chol-GCGT3-TG4T and Immunomodulator Compositions An immunostimulatory composition having a 200 μg / ml plasmid concentration and 2 μM 5-Chol-GCGT3-TG4T was prepared. A 2 μM solution of 5-Chol-GCGT3-TG4T was also prepared. Two samples were incubated at 4°C for 2 hours. 100 μl aliquots of these solutions were centrifuged at 14,000 rpm at 4°C for 2 hours in an Eppendorf table centrifuge for use in Example 7, while the remainder of the incubation was stored at 4°C for analysis according to this Example 6. The supernatant was removed and stored, while the pellet was resuspended in 200 μl. Subsequently, serial 1:2 dilutions were made from these solutions and applied to HEK293-bsd-cTLR21 cells for TLR21 analysis according to the protocol in Example 1. The starting plasmid concentration was 20 nM (and 2 μg / ml plasmid concentration), and samples containing only 5-Chol-GCGT3-TG4T were compared.

[0133] Both samples ("5-Chol-GCGT3-TG4T" and "pDNA-F / 5-Chol-GCGT3-TG4T") showed potent TLR21 stimulating activity, but the immunomodulator composition / 5-Chol-GCGT3-TG4T combination ("pDNA-F / 5-Chol-GCGT3-TG4T") showed strongly reduced signals at higher concentrations ( Fig. 8A ), which may be the result of the cytotoxicity of the immunomodulator composition. When considering the stimulatory activity of samples containing the immunomodulator composition at low toxic concentrations, the respective V max The values ​​are very similar ( Figure 8B , Table 5). However, the calculated EC of the combined immunomodulator composition / 5-Chol-GCGT3-TG4T 50 The calculated EC of 5-Chol-GCGT3-TG4T alone (“5-Chol-GCGT3-TG4T”) 50 2 times lower ( Figure 8B , Table 5).

[0134] Table 5: Half maximal effective concentration (EC 50 ) and the maximum signal speed (V max )

[0135] Example 7: Centrifugation of immunomodulator composition / 5-Chol-GCGT3-TG4T and 5-Chol-GCGT3-TG4T Centrifugation of the immunomodulator composition / 5-Chol-GCGT3-TG4T combination produced a clearly visible precipitate, whereas no visible precipitate was observed for 5-Chol-GCGT3-TG4T. The immunomodulator composition / 5-Chol-GCGT3-TG4T combination precipitate was difficult to resuspend, but in the TLR21 assay as described in Example 1, it ("pDNA-F / 5-Chol-GCGT3-TG4T precipitate") contained virtually all stimulatory activity ( Fig. 9B ), although EC 50 higher than the original sample (Table 5), where only trace amounts ( Fig. 9B , Table 5). The results indicate that after mixing with the immunomodulator composition, 5-Chol-GCGT3-TG4T physically associates with the liposome fraction. Both fractions were compared with the uncentrifuged immunomodulator composition / 5-Chol-GCGT3-TG4T ("pDNA-F / 5-Chol-GCGT3-TG4T").

[0136] Example 8: Combination of 5-Chol-GCGT3-TG4T and an immunomodulatory agent composition Prepare an immunomodulator composition solution of 200 μg / ml plasmid concentration and 2 μM 5-Chol-GCGT3-TG4T. Also prepare a 2 μM 5-Chol-GCGT3-TG4T sample. Two samples were incubated at 4 ° C for 2 hours. 100 μl aliquots of these solutions were centrifuged at 14,000 rpm for 2 hours at 4 ° C in an Eppendorf table centrifuge for use in Example 9, and the remainder of the incubation was stored at 4 ° C for analysis according to this Example 8. Take out and store the supernatant while the precipitate is resuspended in 100 μl. Subsequently, a continuous 1:2 dilution was prepared from these solutions, and according to the scheme of Example 1, 20 nM plasmid concentration (and 2 μg / ml plasmid concentration) was used to start HEK293-bsd-cTLR21 cells, and compared with samples containing only 5-Chol-GCGT3-TG4T.

[0137] Both samples showed potent TLR21 stimulating activity, but the 5-Chol-GCGT3-TG4T / immunomodulator composition combination ("pDNA-F / 5-Chol-GCGT3-TG4T") showed a strongly reduced signal at higher concentrations ( Fig. 10A ), similar to the signal of the immunomodulator itself ("pDNA-F") and may be the result of immunomodulator composition cytotoxicity. The immunostimulatory oligonucleotide ("5-Chol-GCGT3-TG4T") showed greater stimulatory activity at higher concentrations than any sample containing the immunomodulator composition. When considering the stimulatory activity of the immunomodulator composition components of the samples at low toxic concentrations, the respective V max The values ​​are very similar ( Fig. 10B , Table 6). However, the calculated EC of the combined immunomodulator composition / 5-Chol-GCGT3-TG4T ("pDNA-F / 5-Chol-GCGT3-TG4T") 50 The calculated EC of 5-Chol-GCGT3-TG4T alone (“5-Chol-GCGT3-TG4T”) 50 4 times lower ( Fig. 10B , Table 6). The immunomodulator combination alone ("Bay 98-F") showed only minimal activity, and its additive effect could not explain the increased activity of the immunomodulator combination / 5-Chol-GCGT3-TG4T compared to 5-Chol-GCGT3-TG4T alone.

[0138] Table 6: Half maximal effective concentration (EC 50 ) and the maximum signal speed (V max ):

[0139] Example 9: Centrifugation of Immunomodulator Composition Centrifugation of the immunomodulator composition / 5-Chol-GCGT3-TG4T combination produced a clearly visible precipitate, whereas no visible precipitate was observed for 5-Chol-GCGT3-TG4T. The immunomodulator composition / 5-Chol-GCGT3-TG4T combination precipitate ("pDNA-F / 5-Chol-GCGT3-TG4T precipitate") was difficult to resuspend, but contained >95% stimulatory activity in the TLR21 assay as described in Example 1 ( Fig. 11B ), although EC 50 higher than the original sample, where only a small portion (<5%) was detected in the supernatant (“pDNA-F / 5-Chol-GCGT3-TG4T supernatant”) ( Fig. 11B, Table 6), and at low immunomodulator composition concentrations ("pDNA-F / 5-Chol-GCGT3-TG4T"), it was only slightly less than the uncentrifuged sample. This result indicates that after mixing with the immunomodulator composition, 5-Chol-GCGT3-TG4T physically associates with the liposome fraction in quantity.

[0140] Example 10: Combination of GCGT3-TG4T and an immunomodulatory agent composition An immunomodulator composition solution was prepared at a 200 μg / ml plasmid concentration and 2 μM GCGT3-TG4T (SEQ ID NO: 252; the oligonucleotide sequence is the same as 5-Chol-GCGT3-TG4T (SEQ ID NO: 1), but without the cholesterol group modification). In addition, a 2 μM GCGT3-TG4T sample was prepared, and both samples were incubated at 4°C for 2 hours. 100 μl aliquots of these solutions were centrifuged at 14,000 rpm for 2 hours at 4°C in an Eppendorf table centrifuge for use in Example 11, while the remainder of the incubation was stored at 4°C for analysis according to this Example 10. The supernatant was removed and stored, while the pellet was resuspended in 100 μl. Subsequently, serial 1:2 dilutions were prepared from these solutions and applied to HEK293-bsd-cTLR21 cells starting at 20 nM plasmid concentration (and 2 μg / ml plasmid concentration) according to the protocol in Example 1 and compared to samples containing GCGT3-TG4T alone.

[0141] Both samples showed potent TLR21 stimulating activity, but the GCGT3-TG4T / immunomodulator composition combination ("pDNA-F / 5-Chol-GCGT3-TG4T") showed a strongly reduced signal at higher concentrations ( Fig. 12A ), which may be the result of the cytotoxicity of the immunomodulator composition. When considering the stimulatory activity of the immunomodulator composition components of the sample at low toxic concentrations, the respective V max The values ​​are very similar ( Fig. 12B , Table 7). However, the calculated EC of the combined immunomodulator composition / GCGT3-TG4T 50 The calculated EC of GCGT3-TG4T alone 50 More than 4-fold lower (Table 7). The immunomodulator combination alone ("pDNA-F") showed only minimal activity, and its additive effect could not explain the increased activity of the immunomodulator combination / GCGT3-TG4T compared to GCGT3-TG4T alone.

[0142] Table 7: Half maximal effective concentration (EC 50 ) and the maximum signal speed (Vmax )

[0143] Example 11: Centrifugation of immunomodulator composition / GCGT3-TG4T Centrifugation of the immunomodulator composition / GCGT3-TG4T combination produced a clearly visible pellet. The immunomodulator composition / GCGT3-TG4T combination pellet was difficult to resuspend, but contained >3-fold more stimulatory activity (pDNA-F / GCGT3-TG4T pellet) than the supernatant (pDNA-F / GCGT3-TG4T supernatant) in the TLR21 assay as described in Example 1. Fig. 13B ), although EC 50 Higher than the original sample (“pDNA-F / GCGT3-TG4T”) ( Fig. 13B , Table 7). This result indicates that GCGT3-TG4T physically associates with the liposome fraction in quantity after mixing with the immunomodulator composition, although perhaps not as effectively as the cholesteryl-derivatized 5-Chol-GCGT3-TG4T.

[0144] Those skilled in the art will appreciate that various changes and modifications may be made to the preferred embodiments of the present invention, and such changes and modifications may be made without departing from the spirit of the present invention. Therefore, the appended claims are intended to cover all such equivalent changes that fall within the true spirit and scope of the present invention.

[0145] The disclosures of each patent, patent application, and publication cited or described in this document are hereby incorporated by reference in their entirety.

[0146] Example 12: In vivo study of the efficacy of immunostimulants in the Newcastle disease vaccination model in chickens To determine the suitability and efficacy of ODN1, ODN2 and ODN3 as immunostimulants, each was tested at three different concentrations.

[0147] Study the following immunostimulants: ODN1: [CholTEG]-TGGGGTTTTTTTTGCGTTTTTGCGTTTTTGCGTTTT ("5Chol-GCGT3-TG4T") (SEQ ID NO: 1) ([CholTEG] = 5'-triethylene glycol linked cholesterol group modification), ODN2: TGGGGTTTTTTTTGCGTTTTTGCGTTTTTGCGTTTT ("GCGT3-TG4T") (SEQ ID NO: 252), ODN3:tcgtcgttttgtcgttttgtcgtt("2006-PTO") (SEQ ID NO: 3).

[0148] According to Table 9, every kind of immunostimulant is added in the oil emulsion of the inactivated Newcastle disease virus (NDV) containing suboptimal concentration.For the preparation of suboptimal NDV vaccine, NDV antigen batch is diluted 50 times in NDV-negative allantoic fluid (AF).In SPF chicken (Leghorn), the effect of Newcastle disease vaccine combination of ODN1, ODN2 and ODN3 and suboptimal dose is tested.Measure serological response and compare it with similar suboptimal NDV vaccine without immunostimulant.Measure antibody titer at different time points after vaccination, whether to cause earlier immune response to study the interpolation of immunostimulant.In order to determine the optimal dose of three kinds of ODN, three different doses of 100ng, 1000ng and 5000ng are supplemented to suboptimal NDV vaccine, produce 9 immunostimulant groups respectively. In addition to these 9 immunostimulant groups, 5 control groups were incorporated into this study, which consisted of: a suboptimal NDV vaccine group without immunostimulants, an undiluted NDV vaccine group, a negative control group (a combination of immunostimulants and adjuvants), and two positive control groups with two different concentrations of polyinosinic:polycytidylic acid (poly I:C) (Table 8).

[0149] The following parameters were tested: health of the chickens (data not shown) and serology as determined by hemagglutination inhibition (HI).

[0150] Table 8: Study design <![CDATA[ Test Items / Control Item]]> Test Group Number (n) <![CDATA[ Suboptimal NDV+ODN1 100ng ]]> T01 10 <![CDATA[ Suboptimal NDV+ODN1 1000ng ]]> T02 10 <![CDATA[ Suboptimal NDV+ODN1 5000ng ]]> T03 10 <![CDATA[ Suboptimal NDV+ODN2 100ng ]]> T04 10 <![CDATA[ Suboptimal NDV+ODN2 1000ng ]]> T05 10 <![CDATA[ Suboptimal NDV+ODN2 5000ng ]]> T06 10 <![CDATA[ Suboptimal NDV+ODN3 100ng ]]> T07 10 <![CDATA[ Suboptimal NDV+ODN3 1000ng ]]> T08 10 <![CDATA[ Suboptimal NDV+ODN3 5000ng ]]> T09 10 Suboptimal NDV T10 10 Optimal NDV (undiluted vaccine) T11 10 ODN1 5000ng+adjuvant* T12a 3 ODN2 5000ng+adjuvant* T12b 3 ODN3 5000ng+adjuvant* T12c 3 Adjuvant alone (tstimune)* T12d 1 Suboptimal NDV + 10 μg poly I:C T13 9 Suboptimal NDV + 100 μg poly I:C T14 9 *For each immunostimulant combined with adjuvant (Stimune), 3 animals were assigned as controls. One animal received adjuvant only. All animals arrived at 3 weeks of age. All animals were vaccinated at 5 weeks of age. All vaccinations were given on day 0 by intramuscular injection. Blood sampling / serology analysis was performed on days 0 (before vaccination), 7, 14, and 21. Clinical scoring was performed daily for all animals.

[0151] According to the study design, the birds included in treatment groups T01-T14 received either the test article or the control item. In groups T13 and T14, nine birds per group were vaccinated instead of ten due to the loss of two animals before the start of the study.

[0152] Chickens assigned to treatment groups T01, T02, T03, T04, T05, T06, T07, T08 and T09 were vaccinated with a suboptimal NDV suspension containing one of three different immunostimulants (ODN), each at three different concentrations (100, 1000, 5000 ng / dose). To prepare water-in-oil emulsions, NDV antigen suspensions and immunostimulants (aqueous phase) were formulated with adjuvant Stimune (oil phase) at a ratio of 4:5 (Table 9).

[0153] Table 9: Preparation of test articles and controls.

[0154] Chickens assigned to the control group of T10 were vaccinated with a suboptimal NDV suspension without immunostimulants in an adjuvant (Stimune) (ratio 4:5).

[0155] Chickens assigned to the control group of T11 were vaccinated with an undiluted NDV suspension without immunostimulants in adjuvant (Stimune) (ratio 4:5).

[0156] Chickens assigned to the T12 group were vaccinated with Immunostimulant 1 (3 birds), Immunostimulant 2 (3 birds) and Immunostimulant 3 (3 birds) in adjuvant (Stimune) at a ratio of 4:5. One bird was vaccinated with dilution buffer (proprietary) in adjuvant (Stimune).

[0157] Chickens assigned to the control groups of T13 (n=9) and T14 (n=9) were vaccinated with a suboptimal NDV suspension (ratio 4:5) of NDV combined with two concentrations (10,000 ng and 100 μg) of poly I:C in adjuvant (Stimune).

[0158] Administration of test article or control The inactivated NDV strain Ulster suspension stored at -70°C was thawed and diluted 50 times in negative allantoic fluid to produce a suboptimal vaccine dose. Immunostimulants were added according to the study design. According to the vaccination preparation scheme shown in Table 9, the resulting aqueous phase was mixed with Stimune at a ratio of 4:5. During preparation, all vaccine components except the Stimune adjuvant were placed in thawing ice. The prepared vaccine was directly injected (0.5ml, intramuscular injection) after preparation.

[0159] General health was monitored daily by experienced biotechnologists from the day of arrival until the end of the study.

[0160] Serum blood collection Blood samples were collected from all chickens for serological analysis on day 0 (before vaccination), day 7, day 14 and day 21 of the study. Blood samples were labeled with the study number, unique sample identifier and date of collection. Serum was divided into two approximate 0.5 ml aliquots according to the volume of blood drawn and stored at -20 ± 5°C.

[0161] Hemagglutination inhibition (HI) assay In brief, the diluted serum series was incubated at room temperature for 60 minutes with 8 HAU (hemagglutination units) of NDV strain Ulster. Before each assay, the HAU was titrated. Thereafter, chicken erythrocytes were added and agglutination was scored after incubation at 4°C for 45 minutes. Negative control serum and three positive control serums with low, medium and high antibody titers were included in each assay.

[0162] HI titer results were expressed as the reciprocal of the highest serum dilution that completely inhibited agglutination, which was logarithmically converted to a final Log2 titer.

[0163] statistics Logarithmically transformed HI results were summarized for each animal (see Tables 62-65). The mean and standard deviation of antibody titers were calculated for each treatment group. Statistical analysis was performed using the nonparametric Mann-Whitney t-test.

[0164] result No clinical signs or adverse events related to vaccination were observed in any group and all birds appeared healthy throughout the study period.

[0165] However, two birds were scored as having minor injuries due to pecking behavior, which began 6 days before the start of the study. On the day of vaccination, these birds were assigned to poly I:C groups T13 (#11658) and T14 (#11676). Recovery occurred within one week after vaccination.

[0166] ODN1,GCGT3-TG4T-5Chol Individual HI results expressed as Log2 titers for the 100 ng, 1000 ng and 5000 ng ODN1 dose groups are indicated in Table 10. Compared to the mean titer of the diluted NDV vaccine group, Fig.14 (14th and 21st days after vaccination (pv)) and Fig.15 The mean HI titers and standard deviations of these groups are indicated in (all data).

[0167] Compared with the diluted NDV vaccine (mean HI titer: 4.8Log2 / SD 1.0), the GCGT3-TG4T-5Chol group showed significantly higher HI titers. At pv day 14, all three doses were like this; 100ng: mean HI titer 6.2Log2 / SD1.4 (p=0.0214), 1000ng: mean HI titer 6.9Log2 / SD 1.1 (p=0.0003) and 5000ng: mean HI 5.9Log2 / SD 0.7 (p=0.0243).

[0168] However, at pv day 21, no significant differences were observed for all concentrations when compared to NDV vaccine; HI titer 6.2Log2 / SD 1.0; 100ng: mean HI titer 6.9Log2 / SD 0.8 (p=0.1995); 1000ng: mean HI titer 7.3Log2 / SD 0.9 (p=0.0527); and 5000ng: mean HI 6.7Log2 / SD 0.9 (p=0.4523), although the 1000ng concentration was very close to significance ( Fig.14 ). Table 10:

[0169] ODN2,GCGT3-TG4T Individual HI results expressed as Log2 titers for the 100 ng, 1000 ng and 5000 ng ODN1 dose groups are indicated in Table 11. Compared to the mean titer of the diluted NDV vaccine group, Fig.16 (pv day 14 and day 21) and Fig.17 The mean HI titers and standard deviations of these groups are indicated in (all data).

[0170] Compared with diluted NDV vaccine (average HI titer: 4.8Log2 / SD 1.0), ODN2, GCGT3-TG4T group showed significantly higher HI titer. At the 14th day after vaccination, this was true for all three vaccines; 100ng: average HI titer 7.1Log2 / SD 1.2 (p=0.0003), 1000ng: average HI titer 6.4Log2 / SD 0.7 (p=0.0027) and 5000ng: average HI titer 6.1Log2 / SD 1.1 (p=0.0236). At the 21st day, when compared with NDV vaccine (HI titer 6.2Log2 / SD 1.0), significant differences were observed only at the 100ng dosage, where the average HI titer was 7.6Log2 / SD 0.8 (p=0.0083). The average HI titers of 1000ng and 5000ng were 7.1Log2 / 0.6 (p=0.0696) and 7.2Log2 / SD 1.0 (p=0.0956), respectively. Fig.16 ). Table 11:

[0171] ODN3,2006-PTO Individual HI results expressed as Log2 titers for the measured 100 ng, 1000 ng and 5000 ng ODN1 dose groups are indicated in Table 12. During the three replicate HI assays, an abnormal result was observed for animal 11570 on day 21, which was most likely caused by a pipetting error (not enough AF was added), and therefore this result was omitted from the final analysis (highlighted in Table 12). Therefore, for this animal and day, the average HI titer was based on the two replicate measurements.

[0172] Compared with the mean titer of the diluted NDV vaccine group, Fig.18 (pv day 14 and day 21) and Fig.19 The mean HI titers and standard deviations of these groups are indicated in (all data).

[0173] Compared with the diluted NDV vaccine (mean HI titer: 4.8Log2 / SD 1.0), the ODN3, 2006-PTO group showed significantly higher HI titers. At day 14 after vaccination, this was true for both vaccines; 1000ng: mean HI titer: 6.3Log2 / SD 1.2 (p=0.0081) and 5000ng: mean HI titer: 6.2Log2 / SD 0.8 (p=0.0059). The mean HI titer for the 100ng dose was 5.3Log2 / SD 0.5 (p=0.2090). At pv day 21, significant differences were only measured at 5000ng: mean HI titer 7.3Log2 / SD 0.6 (p=0.0296). No significant differences were observed at the 100 ng and 1000 ng doses when compared to the NDV vaccine; HI titer 6.2 Log2 / SD 1.0, where the mean HI titers were 6.6 Log2 / SD 0.5 (p=0.7183) and 6.8 Log2 / SD 1.1 (p=0.1685), respectively ( Fig.18 ). Table 12:

[0174] Control group Individual HI results expressed as Log2 titers for the 10 μg and 100 μg poly I:C dose groups, diluted and undiluted NDV vaccines, and the negative control group are indicated in Table 13. Compared to the mean titer of the diluted NDV vaccine group, Fig. 20 (pv day 14 and day 21) and Fig.21 The mean HI titers and standard deviations of these groups are indicated in (all data).

[0175] When compared to the NDV vaccine (6.2Log2 / SD 1.0), for the poly I:C positive control group, significantly higher HI titers were observed only at the 100μg dose: HI titer 7.5Log2 / SD 0.4 on day 21 (p=0.0053). The average HI titers on pv day 14 for the 10μg and 100μg dose groups were 5.8Log2 / SD 1.3 (p=0.1859) and 5.5Log2 / SD 0.8 (p=0.1609), respectively. The average HI titer for the 10μg dose group on pv day 21 was 6.4Log2 / SD 1.3 (p=0.7273). At days 14 and 21 after vaccination, significant differences (p<0.0001) were observed between the undiluted NDV vaccine (8.3 / SD 0.5 and 8.5Log2 / SD 0.7) and the negative control group compared with the diluted NDV group (4.8 / SD 1.0 and 6.2Log2 / SD 1.0, respectively) ( Fig. 20). Table 13:

[0176] Conclusion The aim was to investigate the adjuvant activity of three different immunostimulants. This was tested by measuring serological responses after vaccination with an oil emulsion vaccine containing suboptimal concentrations of inactivated NDV and different concentrations of one of the three different immunostimulants.

[0177] Study the following immunostimulants: ODN1: [CholTEG]-TGGGGTTTTTTTTGCGTTTTTGCGTTTTTGCGTTTT ("GCGT3-TG4T-5Chol") (SEQ ID NO: 1) ([CholTEG] = 5'-triethylene glycol linked cholesterol group modification), ODN2: TGGGGTTTTTTTTGCGTTTTTGCGTTTTTGCGTTTT ("GCGT3-TG4T") (SEQ ID NO: 252), ODN3:tcgtcgttttgtcgttttgtcgtt("2006-PTO") (SEQ ID NO: 3).

[0178] The backbones of ODN1 and ODN2 immunizations are phosphodiester linked, while the backbone of ODN3 is phosphorothioate linked. The efficacy of each ODN was determined at three different doses (100 ng, 1000 ng and 5000 ng) supplemented to the suboptimal NDV vaccine.

[0179] Serological responses were measured on days 0 (pre-vaccination), 7, 14 and 21 after vaccination to investigate whether the addition of these immunostimulants could also result in an earlier immune response. Antibody levels against NDV were not detected on days 0 and 7 after vaccination (pv), except for one animal (#11618) in the undiluted NDV vaccine group on day 7.

[0180] Serological responses expressed as Log2HI titers showed significant differences between undiluted and suboptimal NDV vaccines at pv days 14 and 21 (p<0.0001), indicating that a 50-fold dilution factor was sufficient to produce a suboptimal vaccine dose.

[0181] The negative control group remained negative throughout the study, indicating that the immunostimulant without the NDV vaccine did not result in a nonspecific immune response.

[0182] On day 21, the positive control poly I:C 100 μg dose group showed significantly higher HI titers compared to the non-NDV vaccine treated group (p=0.0053), indicating that this dose group served as an effective positive control group.

[0183] For all three doses, at pv day 14, the GCGT3-TG4T-5Chol (ODN1) group showed significantly higher HI titers compared to the diluted NDV vaccine; 100ng (p = 0.0214), 1000ng (p = 0.0003) and 5000ng (p = 0.0243). However, at pv day 21, no significant differences were observed.

[0184] For all three doses, at pv day 14, the GCGT3-TG4T (ODN2) group showed significantly higher HI titers compared to the diluted NDV vaccine; 100ng (p = 0.0003), 1000ng (p = 0.0027) and 5000ng (p = 0.0236). At day 21, significant differences were only measured in the 100ng dose group (p = 0.0083).

[0185] For both doses, at pv day 14, the 2006-PTO (ODN3) group showed significantly higher HI titers compared to the diluted NDV vaccine; 1000ng (p=0.0081) and 5000ng (p=0.0059). At pv day 21, significant differences were measured only in the 5000ng dose group (p=0.0296).

[0186] In summary, the highest mean HI titers of 7.1Log2 (pv day 14) and 7.6Log2 (pv day 21) were observed in the 100ng GCGT3-TG4T (ODN2) dose group, indicating that the titers increased by 2.3Log2 and 1.4Log2 on pv day 14 and day 21, respectively, when compared with those without NDV vaccine treatment.

[0187] The titers of the 1000ng GCGT3-TG4T-5Chol (ODN1) dose group at pv day 14 and day 21 (6.9Log2 and 7.3Log2) were almost similar to those of the ODN2 group, respectively. No significant difference was observed between the ODN1 and ODN2 groups at pv day 14 (p=0.7513).

[0188] At pv day 14 and day 21, the titers of the 5000ng 2006-PTO (ODN3) dose group were 6.2Log2 and 7.3Log2, respectively. At pv day 14, the ODN3 group was significantly different from both the ODN1 and ODN2 groups (p=0.0300)( Fig. 22 and Fig.23 ).

[0189] At pv day 21, no significant differences were shown among all ODN groups.

[0190] Therefore, these results indicate that all ODNs were able to significantly increase serological responses, especially at day 14 after vaccination, also suggesting an early onset of immunity.

[0191] Implementation For further illustration, additional non-limiting embodiments of the present disclosure are set forth below.

[0192] For example, embodiment 1 is an immunostimulatory composition comprising: An immunomodulatory composition comprising a nucleic acid plasmid and a liposome delivery vehicle; and An immunostimulatory oligonucleotide having at least one CpG motif and a guanine nucleotide-rich sequence at or near the 5' end of the immunostimulatory oligonucleotide.

[0193] Embodiment 2 is the immunostimulatory composition of embodiment 1, wherein said immunomodulator composition and said immunostimulatory oligonucleotide are present in synergistically effective amounts.

[0194] Embodiment 3 is the immunostimulatory composition of embodiment 1 or 2, wherein the immunostimulatory oligonucleotide comprises a ligand for a cytoplasmic nucleic acid surveillance molecule.

[0195] Embodiment 4 is the immunostimulatory composition of embodiment 3, wherein the immune cytoplasmic nucleic acid surveillance molecule is a toll-like receptor (TLR).

[0196] Embodiment 5 is the immunostimulatory composition of embodiment 3 or 4, wherein the cytoplasmic nucleic acid surveillance molecule is TLR21.

[0197] Embodiment 6 is the immunostimulatory composition of any one of the preceding embodiments, wherein the immunomodulator composition has a nucleic acid concentration of about 200 μg / ml.

[0198] Embodiment 7 is the immunostimulatory composition of any one of the preceding embodiments, wherein the concentration of said immunostimulatory oligonucleotide is between about 10 μM and 0.5 μM.

[0199] Embodiment 8 is the immunostimulatory composition of embodiment 7, wherein the concentration of said immunostimulatory oligonucleotide is about 2 μM.

[0200] Embodiment 9 is the immunostimulatory composition of any one of the preceding embodiments, wherein the concentration of the nucleic acid plasmid of the immunomodulator composition is greater than the concentration of the immunostimulatory oligonucleotide.

[0201] Embodiment 10 is the immunostimulatory composition of any one of the preceding embodiments, wherein the immunomodulator composition is present in a non-cytotoxic amount.

[0202] Embodiment 11 is the immunostimulatory composition of any one of the preceding embodiments, further comprising a pharmaceutical carrier.

[0203] Embodiment 12 is the immunostimulatory composition of any one of the preceding embodiments, wherein the liposomal delivery vehicle comprises multilamellar vesicle lipids, extruded lipids, or both.

[0204] Embodiment 13 is the immunostimulatory composition of any one of the preceding embodiments, wherein the liposomal delivery vehicle is cationic.

[0205] Embodiment 14 is the immunostimulatory composition of embodiment 13, wherein the cationic liposome delivery vehicle comprises a lipid pair selected from the group consisting of: N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA) and cholesterol; N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP) and cholesterol; 1-[2-(oleoyloxy)ethyl]-2-oleyl-3-(2-hydroxyethyl)imidazolinium chloride (DOTIM) and cholesterol; and dimethyldioctadecylammonium bromide (DDAB) and cholesterol.

[0206] Embodiment 15 is the immunostimulatory composition of any one of the preceding embodiments, wherein the nucleic acid plasmid is non-coding.

[0207] Embodiment 16 is the immunostimulatory composition of any one of the preceding embodiments, wherein the nucleic acid plasmid is of bacterial origin.

[0208] Embodiment 17 is the immunostimulatory composition of any one of the preceding embodiments, wherein the nucleic acid plasmid is immunogenic.

[0209] Embodiment 18 is the immunostimulatory composition of any one of embodiments 1-17, wherein the nucleic acid plasmid has at least 75% sequence identity to SEQ ID NO.265.

[0210] Embodiment 19 is the immunostimulatory composition of any one of embodiments 1-17, wherein the nucleic acid plasmid has at least 75% sequence identity to SEQ ID NO.266.

[0211] Embodiment 20 is the immunostimulatory composition of any one of embodiments 1-17, wherein the nucleic acid plasmid has at least 75% sequence identity to SEQ ID NO:268.

[0212] Embodiment 21 is the immunostimulatory composition of any one of the preceding embodiments, wherein the guanine nucleotide-rich sequence comprises a first plurality of guanine nucleotides.

[0213] Embodiment 22 is the immunostimulatory composition of embodiment 21, wherein said first plurality of guanine nucleotides comprises three to eight guanine nucleotides.

[0214] Embodiment 23 is the immunostimulatory composition of embodiment 21 or 22, wherein the immunostimulatory oligonucleotide comprises SEQ ID NO: 16, 17, 18, 19, 20, 21, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 77, 78, 81, 82, 85, 86, 89, 90, 92, 93, 96, 97, 100, 102, 104, 106, 108, 143, or 1.

[0215] Embodiment 24 is the immunostimulatory composition of embodiment 21 or 22, further comprising a second plurality of guanine nucleotides downstream of the first plurality of guanine nucleotides.

[0216] Embodiment 25 is the immunostimulatory composition of embodiment 24, wherein the immunostimulatory oligonucleotide comprises SEQ ID NO: 141, 142, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203 or GCGT-3.

[0217] Embodiment 26 is the immunostimulatory composition of embodiment 24 or 25, wherein said first plurality of guanine nucleotides and said second plurality of guanine nucleotides are separated by at least two nucleotides.

[0218] Embodiment 27 is the immunostimulatory composition of any one of embodiments 21 to 26, wherein said first plurality of guanine nucleotides and said at least one CpG motif are separated by at least 3 nucleotides.

[0219] Embodiment 28 is the immunostimulatory composition of embodiments 21 to 27, wherein said first plurality of guanine nucleotides and said at least one CpG motif are separated by hexaethylene glycol, tetraethylene glycol, propylene glycol or a derivative thereof.

[0220] Embodiment 29 is the immunostimulatory composition of embodiment 28, wherein the structure of the hexaethylene glycol is:

[0221] Embodiment 30 is the immunostimulatory composition of any one of the preceding embodiments, wherein the immunostimulatory oligonucleotide further comprises a plurality of CpG motifs, each CpG motif in the plurality of CpG motifs being separated from other CpG motifs in the plurality of CpG motifs by a spacer.

[0222] Embodiment 31 is the immunostimulatory composition of embodiment 30, wherein the spacer comprises at least one nucleotide or nucleotide analog.

[0223] Embodiment 32 is the immunostimulatory composition of embodiment 31, wherein the spacer comprises a deoxyribose phosphate bridge.

[0224] Embodiment 33 is the immunostimulatory composition of embodiment 32, wherein the deoxyribose phosphate bridge is abasic.

[0225] Embodiment 34 is the immunostimulatory composition of embodiment 31, wherein the spacer comprises a carbon chain.

[0226] Embodiment 35 is the immunostimulatory composition of embodiment 34, wherein the carbon chain is derived from 1,3-propanediol.

[0227] Embodiment 36 is the immunostimulatory composition of embodiment 31, wherein the spacer comprises repeating chemical units.

[0228] Embodiment 37 is the immunostimulatory composition of embodiment 36, wherein the repeating chemical unit is ethylene glycol.

[0229] Embodiment 38 is the immunostimulatory composition of any one of the preceding embodiments, wherein said immunostimulatory oligonucleotide comprises at least one nucleotide analog.

[0230] Embodiment 39 is the immunostimulatory composition of any one of the preceding embodiments, wherein said immunostimulatory oligonucleotide further comprises a phosphodiester backbone.

[0231] Embodiment 40 is the immunostimulatory composition of any one of embodiments 1-38, wherein said immunostimulatory oligonucleotide further comprises a phosphorothioate backbone.

[0232] Embodiment 41 is the immunostimulatory composition of any one of the preceding embodiments, wherein said immunostimulatory oligonucleotide comprises a lipid moiety.

[0233] Embodiment 42 is the immunostimulatory composition of embodiment 41, wherein the lipid moiety is a cholesterol group.

[0234] Embodiment 43 is the immunostimulatory composition of any one of embodiments 41 to 42, wherein the lipid moiety is at or near the 5' end of the immunostimulatory oligonucleotide.

[0235] Embodiment 44 is the immunostimulatory composition of any one of the preceding embodiments, comprising a CpG sequence element at the 5' end, the 3' end, or both.

[0236] Embodiment 45 is the immunostimulatory composition of embodiment 44, which has at least two CpG sequence elements.

[0237] Embodiment 46 is the immunostimulatory composition of embodiment 44 or 45, wherein the CpG sequence element is GCGA, GCGG, ACGC, CCGC, GCGT or TCGC.

[0238] Embodiment 47 is a method of preparing the immunostimulatory composition of any of the preceding claims, comprising: combining the immunomodulator composition and the immunostimulatory oligonucleotide to form an immunostimulatory composition; centrifuging the immunostimulatory composition to generate a supernatant and a precipitate; and The precipitate was isolated.

[0239] Embodiment 48 is a method for stimulating toll-like receptor 21 (TLR21), comprising: An immunostimulatory oligonucleotide and an immunomodulatory agent composition are administered, wherein the immunostimulatory oligonucleotide has at least one CpG motif and a guanine nucleotide-rich sequence at or near the 5' end of the immunostimulatory oligonucleotide, and wherein the immunomodulatory agent composition comprises a non-coding nucleic acid plasmid and a lipid delivery vehicle.

[0240] Embodiment 49 is the method of embodiment 48, wherein the immunomodulator composition and the immunostimulatory oligonucleotide are present in synergistically effective amounts.

[0241] Embodiment 50 is the method of embodiment 48 or 49, wherein the immunostimulatory oligonucleotide comprises a ligand for TLR21.

[0242] Embodiment 51 is the method of any one of embodiments 48 to 50, wherein the nucleic acid plasmid concentration of the immunomodulator composition is about 200 μg / ml.

[0243] Embodiment 52 is the method of any one of embodiments 48 to 51, wherein the concentration of the immunostimulatory oligonucleotide is between about 10 μM and 0.5 μM.

[0244] Embodiment 53 is the method of embodiment 52, wherein the concentration of the immunostimulatory oligonucleotide is about 2 μM.

[0245] Embodiment 54 is the method of any one of embodiments 48 to 53, wherein the concentration of the nucleic acid plasmid of the immunomodulator composition is greater than the concentration of the immunostimulatory oligonucleotide.

[0246] Embodiment 55 is the method of any one of embodiments 48 to 54, wherein the immunomodulator composition is present in a non-cytotoxic amount.

[0247] Embodiment 56 is the method of any one of embodiments 48 to 55, wherein the immunomodulator composition further comprises a pharmaceutical carrier.

[0248] Embodiment 57 is the method of any one of embodiments 48 to 56, wherein the liposomal delivery vehicle comprises multilamellar vesicle lipids, extruded lipids, or both.

[0249] Embodiment 58 is the method of any one of embodiments 48 to 57, wherein the liposomal delivery vehicle is cationic.

[0250] Embodiment 59 is a method of embodiment 58, wherein the cationic liposome delivery vehicle comprises a lipid pair selected from the following: N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA) and cholesterol; N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP) and cholesterol; 1-[2-(oleoyloxy)ethyl]-2-oleyl-3-(2-hydroxyethyl)imidazolinium chloride (DOTIM) and cholesterol; and dimethyldioctadecylammonium bromide (DDAB) and cholesterol.

[0251] Embodiment 60 is the method of any one of embodiments 48 to 59, wherein the nucleic acid plasmid is non-coding.

[0252] Embodiment 61 is the method of any one of embodiments 48 to 60, wherein the nucleic acid plasmid is of bacterial origin.

[0253] Embodiment 62 is the method of any one of embodiments 48 to 61, wherein the nucleic acid plasmid is immunogenic.

[0254] Embodiment 63 is the method of any one of embodiments 48 to 62, wherein the nucleic acid plasmid has at least 75% sequence identity to SEQ ID NO:265.

[0255] Embodiment 64 is the method of any one of embodiments 48 to 62, wherein the nucleic acid plasmid has at least 75% sequence identity to SEQ ID NO:266.

[0256] Embodiment 65 is the method of any one of embodiments 48 to 62, wherein the nucleic acid plasmid has at least 75% sequence identity to SEQ ID NO:268.

[0257] Embodiment 66 is the method of any one of embodiments 48 to 65, wherein the guanine nucleotide-enriched sequence comprises a first plurality of guanine nucleotides.

[0258] Embodiment 67 is the method of embodiment 66, wherein the first plurality of guanine nucleotides comprises three to eight guanine nucleotides.

[0259] Embodiment 68 is the method of embodiment 66 or 67, wherein the immunostimulatory oligonucleotide comprises SEQ ID NO: 1, 16, 17, 18, 19, 20, 21, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 77, 78, 81, 82, 85, 86, 89, 90, 92, 93, 96, 97, 100, 102, 104, 106, 108, or 143.

[0260] Embodiment 69 is the method of any one of embodiments 48-68, wherein the immunostimulatory oligonucleotide further comprises a second plurality of guanine nucleotides downstream of the first plurality of guanine nucleotides.

[0261] Embodiment 70 is the method of embodiment 69, wherein the immunostimulatory oligonucleotide comprises SEQ ID NO: 141, 142, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203 or GCGT-3.

[0262] Embodiment 71 is the method of embodiment 69 or 70, wherein the first plurality of guanine nucleotides, the second plurality of guanine nucleotides, or both promote the formation of a quaternary structure in vitro, in vivo, or both.

[0263] Embodiment 72 is the method of embodiment 70 or 71, wherein the first and second plurality of guanine nucleotides promote formation of a quaternary structure having a G-line conformation.

[0264] Embodiment 73 is the method of any one of embodiments 70 to 72, wherein the first plurality of guanine nucleotides and the second plurality of guanine nucleotides are separated by at least two nucleotides.

[0265] Embodiment 74 is the method of any one of embodiments 67 to 73, wherein said first plurality of guanine nucleotides and said at least one CpG motif are separated by at least 3 nucleotides.

[0266] Embodiment 75 is the method of any one of embodiments 67 to 73, wherein the first plurality of guanine nucleotides and the at least one CpG motif are separated by hexaethylene glycol.

[0267] Embodiment 76 is the method of embodiment 75, wherein the structure of the hexaethylene glycol is:

[0268] Embodiment 77 is the method of any one of embodiments 48 to 76, wherein the immunostimulatory oligonucleotide further comprises a plurality of CpG motifs, each CpG motif in the plurality of CpG motifs being separated by a spacer.

[0269] Embodiment 78 is the method of embodiment 77, wherein the spacer comprises at least one nucleotide or nucleotide derivative.

[0270] Embodiment 79 is the method of embodiment 78, wherein the spacer is a deoxyribose phosphate bridge.

[0271] Embodiment 80 is the method of embodiment 79, wherein the deoxyribose phosphate bridge is abasic.

[0272] Embodiment 81 is the method of embodiment 78, wherein the spacer comprises a carbon chain.

[0273] Embodiment 82 is the method of embodiment 81, wherein the carbon chain is derived from 1,3-propanediol.

[0274] Embodiment 83 is the method of embodiment 78, wherein the spacer comprises a repeating chemical unit.

[0275] Embodiment 84 is the method of embodiment 83, wherein the repeating chemical unit is ethylene glycol.

[0276] Embodiment 85 is the method of any one of embodiments 48 to 84, wherein the immunomodulator composition, the immunostimulatory oligonucleotide, or both further comprises at least one nucleotide analog.

[0277] Embodiment 86 is the method of any one of embodiments 48 to 85, wherein the immunostimulatory oligonucleotide comprises a phosphodiester backbone.

[0278] Embodiment 87 is the method of any one of embodiments 48 to 85, wherein the immunostimulatory oligonucleotide comprises a phosphorothioate backbone.

[0279] Embodiment 88 is the method of any one of embodiments 48 to 87, wherein the immunostimulatory oligonucleotide further comprises a lipid moiety.

[0280] Embodiment 89 is the method of embodiment 88, wherein the lipid moiety enhances the bioavailability of the immunostimulatory oligonucleotide.

[0281] Embodiment 90 is the method of embodiment 88 or 89, wherein the lipid moiety is a cholesterol group.

[0282] Embodiment 91 is the method of any one of embodiments 88 to 90, wherein the lipid moiety is at or near the 5' end of the immunostimulatory oligonucleotide.

[0283] Embodiment 92 is the method of any one of embodiments 48 to 91, comprising a CpG sequence element at the 5' end, the 3' end, or both.

[0284] Embodiment 93 is the method of embodiment 92, which has at least two CpG sequence elements.

[0285] Embodiment 94 is the method of embodiment 92 or 93, wherein the CpG sequence element is GCGA, GCGG, ACGC, CCGC, GCGT or TCGC.

[0286] Embodiment 95 is the method of any one of embodiments 48 to 94, wherein said immunomodulator composition and said immunostimulatory oligonucleotide are administered simultaneously.

[0287] Embodiment 96 is a method of eliciting an immune response in a subject, comprising administering to the subject the immunostimulatory composition of any one of embodiments 1 to 46.

[0288] Embodiment 97 is an immunostimulatory composition comprising: Nucleic acid plasmids and liposome delivery vehicles; and An immunostimulatory oligonucleotide comprising SEQ ID NO:1.

[0289] Embodiment 98 is the immunostimulatory composition of embodiment 97, wherein the nucleic acid plasmid has at least 75% sequence identity to SEQ ID NO:265.

[0290] Embodiment 99 is the immunostimulatory composition of embodiment 97, wherein the nucleic acid plasmid has at least 75% sequence identity to SEQ ID NO:266.

[0291] Embodiment 100 is the immunostimulatory composition of embodiment 97, wherein the nucleic acid plasmid has at least 75% sequence identity to SEQ ID NO:268.

[0292] Embodiment 101 is the immunostimulatory composition of any one of embodiments 97-100, wherein the liposomal delivery vehicle comprises multilamellar vesicle lipids, extruded lipids, or both.

[0293] Embodiment 102 is the immunostimulatory composition of embodiment 101, wherein the liposomal delivery vehicle is cationic.

[0294] Embodiment 103 is the immunostimulatory composition of embodiment 102, wherein the cationic liposome delivery vehicle comprises a lipid pair selected from the group consisting of: N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA) and cholesterol; N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP) and cholesterol; 1-[2-(oleoyloxy)ethyl]-2-oleyl-3-(2-hydroxyethyl)imidazolinium chloride (DOTIM) and cholesterol; and dimethyldioctadecylammonium bromide (DDAB) and cholesterol.

[0295] Embodiment 104 is the immunostimulatory composition of any one of embodiments 97-103, wherein said immunostimulatory oligonucleotide further comprises a 5' cholesterol group modification.

[0296] Embodiment 105 is the immunostimulatory composition of embodiment 104, wherein the 5' cholesterol group modification comprises a triethylene glycol linker.

[0297] When introducing elements of the present disclosure or preferred embodiments thereof, the articles "a", "an", "the" and "said" mean that there are one or more of the elements. The terms "comprising", "including" and "having" are intended to be inclusive and mean that there may be additional elements besides the listed elements.

[0298] In view of the above, it will be seen that the several objects of the disclosure are achieved and other advantageous results attained.

[0299] As various changes could be made in the above products and methods without departing from the scope of the present disclosure, it is intended that all matter contained in the above description shall be interpreted as illustrative and not in a limiting sense.

Claims

1. An immunostimulatory composition comprising: a) an immunomodulatory composition comprising a nucleic acid plasmid and a liposome delivery vehicle; and b) an immunostimulatory oligonucleotide having at least one CpG motif and a guanine nucleotide-rich sequence at or near the 5' end of the immunostimulatory oligonucleotide.

2. The immunostimulatory composition of claim 1, wherein the immunomodulatory agent composition and the immunostimulatory oligonucleotide are present in synergistically effective amounts.

3. The immunostimulatory composition of claim 1 or 2, wherein the immunostimulatory oligonucleotide comprises a ligand for a cytoplasmic nucleic acid surveillance molecule.

4. The immunostimulatory composition of claim 3, wherein the immune cytoplasmic nucleic acid surveillance molecule is a toll-like receptor (TLR).

5. The immunostimulatory composition of claim 3 or 4, wherein the cytoplasmic nucleic acid surveillance molecule is TLR21.

6. The immunostimulatory composition of any one of the preceding claims, wherein the nucleic acid plasmid concentration of the immunomodulator composition is greater than the concentration of the immunostimulatory oligonucleotide.

7. The immunostimulatory composition of any of the preceding claims, further comprising a pharmaceutical carrier.

8. The immunostimulatory composition of any one of the preceding claims, wherein the liposomal delivery vehicle comprises multilamellar vesicle lipids, extruded lipids, or both.

9. The immunostimulatory composition of any one of the preceding claims, wherein the liposomal delivery vehicle is cationic.

10. The immunostimulatory composition of claim 8, wherein the cationic liposome delivery vehicle comprises a lipid pair selected from the group consisting of: N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA) and cholesterol; N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP) and cholesterol; 1-[2-(oleoyloxy)ethyl]-2-oleyl-3-(2-hydroxyethyl)imidazolinium chloride (DOTIM) and cholesterol; and dimethyldioctadecyl ammonium bromide (DDAB) and cholesterol.

Images