Bacillus subtilis with high yield of surfactin, related enzyme mutants and preparation method thereof

By performing site-directed mutagenesis and gene editing on the surfactant synthase in Bacillus subtilis, the problem of insufficient surfactant production in existing technologies has been solved, enabling the preparation of Bacillus subtilis with high surfactant production and supporting its industrial application.

CN119662507BActive Publication Date: 2026-04-28NANJING UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202411924439.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-25
Publication Date
2026-04-28
Estimated Expiration
2044-12-25

AI Technical Summary

Technical Problem

Existing technologies have limited production of surfactants from Bacillus subtilis and require stringent preparation conditions, which restricts their widespread application.

Method used

By 3D modeling of five enzymes involved in surfactant synthesis in Bacillus subtilis, site-directed mutagenesis was performed on key amino acids around the active site, and gene editing was carried out using CRISPR technology to construct a Bacillus subtilis strain that produces high levels of surfactant.

Benefits of technology

It significantly increases the yield of surfactants, up to 9.4 g/L, supporting the industrial production and commercial application of surfactants.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119662507B_ABST
    Figure CN119662507B_ABST
Patent Text Reader

Abstract

The application discloses a bacillus subtilis with high yield of surfactin, related enzyme mutants and a preparation method thereof. The bacillus subtilis is obtained by genetic modification method, can produce surfactin with a highest yield of 9.4 g / L, and the application also provides key enzyme mutants involved in synthesis of surfactin in the bacillus subtilis, including biotin carboxylase IdeHA mutant, biotin carboxylase accBC mutant, enoyl reductase fabI mutant, malonyl transferase fabD mutant and dihydrolipoyl dehydrogenase IPdU mutant. The bacillus subtilis with high yield of surfactin and the preparation method thereof disclosed by the application are helpful to realize industrial production and commercial application of surfactin.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a microorganism and its preparation method, and more particularly to a Bacillus subtilis and its preparation method, belonging to the field of genetic engineering. Background Technology

[0002] Bacillus subtilis belongs to the genus Bacillus and has advantages such as rapid growth, low nutritional requirements, efficient secretion of many proteins and metabolites, and no toxin production. It is a non-pathogenic and safe microorganism and is widely used in aquaculture, plant disease resistance, feed production, medicine and health.

[0003] Surfactants are a class of natural surfactants, primarily synthesized by Bacillus species and widely found in nature. They mainly consist of a cyclic heptapeptide and a β-hydroxy fatty acid chain, possessing both hydrophilic and hydrophobic groups. This allows them to significantly reduce the surface and interfacial tension of liquids, enabling better mixing or emulsification of water and oil. Compared to traditional chemically synthesized surfactants, biosurfactants offer numerous advantages, including eco-friendliness and high safety, and are applied in various fields. For example, in the environmental field, they are used to clean up spilled oil and organic pollutants in soil; in the pharmaceutical and agricultural fields, they exert antibacterial, antiviral, and antitumor effects. Surfactants demonstrate enormous application potential in industry, environment, and medicine. However, the current production of surfactants mainly relies on microbial fermentation, and existing production volumes are limited, which greatly restricts their widespread application.

[0004] There are various methods to improve the ability of microorganisms to produce surfactants, including optimizing culture conditions, genetic modification, and production process optimization. Genetic modification methods include enhancing the expression of key enzymes, such as regulating the expression levels of enzymes related to surfactant production through genetic engineering. Patent application CN117187286A discloses a method for overexpressing SecA to improve surfactant production in Bacillus subtilis. This method uses genetic engineering to overexpress the secA gene, a preprotein transposase in the surfactant product secretion pathway of the Bacillus subtilis genome, enhancing surfactant transmembrane efflux and significantly increasing surfactant production. The surfactant yield of the genetically engineered bacteria obtained by this method can reach 9.9 g / L, but the wild-type strain used is limited to a specific strain, Bacillus subtilisATCC 21332, whose original surfactant yield is 6.83 g / L. Patent application CN117946952A discloses a high-surfactant-producing engineered bacterium, its construction method, and its applications. By using genetic engineering to knock out the CodY and PhoP genes, negative regulators of srfA synthase, in the Bacillus subtilis genome, and enhancing srfA synthase expression, the surfactant yield can be significantly increased. However, the highest surfactant yield obtained by this method after 48 hours of fermentation is only 4.25 g / L. In summary, currently, there are very few Bacillus subtilis strains capable of high surfactant production, and the preparation conditions are extremely demanding. Summary of the Invention

[0005] Purpose of the invention: The purpose of this invention is to provide a Bacillus subtilis strain capable of producing high levels of surfactant, and to provide related enzyme mutants involved in surfactant synthesis in Bacillus subtilis, as well as a method for preparing and applying the Bacillus subtilis strain.

[0006] Technical solution: The present invention provides a Bacillus subtilis strain with high surfactant production, comprising biotin carboxylase IdeHA, biotin carboxylase accBC, enoyl reductase fabI, malonyl transferase fabD, and dihydrolipoyl dehydrogenase IPdU, the amino acid sequences of which are shown in SEQ ID NO.1-5 in sequence;

[0007] The biotin carboxylase IdeHA has the following mutations: lysine at position 74 is mutated to asparagine, alanine at position 125 is mutated to threonine, glutamic acid at position 136 is mutated to lysine, cysteine ​​at position 145 is mutated to phenylalanine, and threonine at position 394 is mutated to asparagine.

[0008] Alternatively, the 74th lysine of the biotin carboxylase IdeHA may be mutated to asparagine, the 125th alanine to threonine, the 136th glutamic acid to lysine, the 145th cysteine ​​to phenylalanine, and the 394th threonine to asparagine; and the 409th serine of the biotin carboxylase accBC may be mutated to glycine.

[0009] Alternatively, the 74th lysine of the biotin carboxylase IdeHA may be mutated to asparagine, the 125th alanine to threonine, the 136th glutamic acid to lysine, the 145th cysteine ​​to phenylalanine, and the 394th threonine to asparagine; and the 409th serine of the biotin carboxylase accBC may be mutated to glycine; and the 263rd glycine of the enoyl reductase fabI may be mutated to cysteine.

[0010] Alternatively, the biotin carboxylase IdeHA may have its 74th lysine residue mutated to asparagine, its 125th alanine residue mutated to threonine, its 136th glutamic acid residue mutated to lysine, its 145th cysteine ​​residue mutated to phenylalanine, and its 394th threonine residue mutated to asparagine; and the biotin carboxylase accBC may have its 409th serine residue mutated to glycine; the enoyl reductase fabI may have its 263rd glycine residue mutated to cysteine; and the malonyltransferase fabD may have its 64th proline residue mutated to arginine.

[0011] Alternatively, the biotin carboxylase IdeHA may have its 74th lysine mutated to asparagine, its 125th alanine mutated to threonine, its 136th glutamic acid mutated to lysine, its 145th cysteine ​​mutated to phenylalanine, and its 394th threonine mutated to asparagine; the biotin carboxylase accBC may have its 409th serine mutated to glycine; the enoyl reductase fabI may have its 263rd glycine mutated to cysteine; the malonyl transferase fabD may have its 64th proline mutated to arginine; and the dihydrolipoyl dehydrogenase IPdU may have its 163rd valine mutated to alanine and its 287th glycine mutated to serine.

[0012] This invention uses Bacillus subtilis as the chassis cell and performs 3D modeling of five enzymes involved in surfactant synthesis. Key amino acids around the active site or at the loop position on the protein surface are selected for site-directed mutagenesis. Ultimately, five high-surfactant-producing strains were selected from hundreds of modified Bacillus subtilis strains. These five enzymes are: biotinylate carboxylase (IdeHA, SEQ ID No. 1), biotinylate carboxylase (accBC, SEQ ID No. 2), enoyl reductase (fabI, SEQ ID No. 3), malonyl transferase (fabD, SEQ ID No. 4), and dihydrolipoyl dehydrogenase (IPdU, SEQ ID No. 5). This invention improves the efficiency of fatty acid synthesis and provides high-surfactant-producing Bacillus subtilis strains by genetically engineering key enzymes involved in surfactant synthesis in Bacillus subtilis.

[0013] The present invention also provides a method for preparing the aforementioned Bacillus subtilis, comprising the following steps:

[0014] Step 1: Prepare competent Bacillus subtilis cells;

[0015] Step 2: Transform the first recombinant plasmid into the competent cells obtained in Step 1 to obtain recombinant cells; the first recombinant plasmid can express a protein with DNA double-strand excision activity;

[0016] Step 3: Construct a second recombinant plasmid; the second recombinant plasmid contains the mutation information described in claim 1;

[0017] Step 4: Construct homologous fragments; the homologous fragments contain primer sequences;

[0018] Step 5: Transform the second recombinant plasmid and the homologous fragment into the recombinant cells obtained in step 2 to obtain Bacillus subtilis as described in claim 1.

[0019] This invention utilizes CRISPR technology to gene-edit the aforementioned enzyme in Bacillus subtilis: a crRNA sequence containing the mutation site information of the enzyme is inserted into the pcrF19NM plasmid. The pHT-XCR6 plasmid carrying the Cpf1 gene, the constructed pcrF19NM plasmid, and a homologous sequence serving as a gene recombination template are sequentially transformed into competent Bacillus subtilis cells. After plasmid elimination, fermentation and surfactant assays are performed to ultimately screen out Bacillus subtilis strains that produce high levels of surfactant.

[0020] Preferably, in step 2, the first recombinant plasmid is pHT-XCR6 plasmid.

[0021] Preferably, in step 3, the second recombinant plasmid is pcrF19NM plasmid.

[0022] Furthermore, in step 2, the protein with DNA double-strand excision activity is Cpf1. In step 3, the second recombinant plasmid contains a crRNA sequence.

[0023] Furthermore, the crRNA sequence is as follows:

[0024] crRNA Name Sequence (5’-3’) IdeHA-K74 GCGAAAAAAGCAAAAGCCGACGCG IdeHA-A125 GCAATGGAGGCTGCAGGTGTC IdeHA-E136 GGCGTTTCTGAATCCCTCGGA IdeHA-C145 GAGGCAGCCTGCCGCACCGCA IdeHA-T394 AAAGGCCAAACCAGAACAGAA accBC-S409 CGCGCATTGAGCGAATTCGTC fabI-G263 GTTGATTCTGGTTTCCATATC fabD-P64 AATGCGCAGCCTGCTTTGCTT IPdU-V163 GGTCTTGAAGTGGACGGTAAG IPdU-G287 AATATCGAAGGCATCGGCCTA

[0025] Furthermore, in step 4, the primer sequence is:

[0026]

[0027]

[0028] The present invention also provides a biotin carboxylase IdeHA mutant of Bacillus subtilis, the amino acid sequence of which is shown in SEQ ID NO.6.

[0029] The present invention also provides a biotin carboxylase accBC mutant of Bacillus subtilis, the amino acid sequence of which is shown in SEQ ID NO.7.

[0030] The present invention also provides a fabI mutant of Bacillus subtilis acyl reductase, the amino acid sequence of which is shown in SEQ ID NO.8.

[0031] The present invention also provides a malonyltransferase fabD mutant of Bacillus subtilis, the amino acid sequence of which is shown in SEQ ID NO.9.

[0032] The present invention also provides a Bacillus subtilis dihydrolipoyl dehydrogenase IPdU mutant, the amino acid sequence of which is shown in SEQ ID NO.10.

[0033] The present invention also provides an application of the aforementioned Bacillus subtilis in the production of surfactants.

[0034] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: 1. The Bacillus subtilis provided by the present invention can produce high levels of surfactants, up to 9.4 g / L, and also provides a preparation method and application of the Bacillus subtilis, which helps to realize the industrial production and commercial application of surfactants; 2. The biotin carboxylase IdeHA mutant, biotin carboxylase accBC mutant, enoyl reductase fabI mutant, malonyl transferase fabD mutant and dihydrolipoyl dehydrogenase IPdU mutant provided by the present invention help Bacillus subtilis produce high levels of surfactants. Attached Figure Description

[0035] Figure 1 This is a schematic diagram of the protein structure of biotin carboxylase IdeHA.

[0036] Figure 2 This is a schematic diagram of the protein structure of biotin carboxylase accBC.

[0037] Figure 3 This is a schematic diagram of the protein structure of enoyl reductase fabI.

[0038] Figure 4 This is a schematic diagram of the protein structure of malonyltransferase fabD.

[0039] Figure 5 This is a schematic diagram of the protein structure of dihydrolipoic acid dehydrogenase IPdU.

[0040] Figure 6 The chromatogram of surfactant in the Bacillus subtilis CY-5 fermentation broth provided in Example 5 of the present invention is shown. Detailed Implementation

[0041] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0042] The wild-type Bacillus subtilis, plasmid pHT-XCR6, and pcrF19NM plasmid used in the examples were all preserved in our laboratory. Unless otherwise specified, all other materials used were commercially available.

[0043] Example 1: A Bacillus subtilis strain with high surfactant production

[0044] In this embodiment, Bacillus subtilis carrying the biotin carboxylase IdeHA mutant was first constructed using the preparation methods in steps 1-5, and then strains with high surfactant production were screened using steps 6-8.

[0045] Step 1. Prepare Bacillus subtilis competent cells

[0046] Wild-type Bacillus subtilis was spread on LB solid medium and incubated overnight at 37°C. Single colonies were picked and inoculated into 4 mL of LB liquid medium and incubated at 37°C and 140 rpm for 6 h. The cells were washed three times with sterile 10% glycerol solution, and finally resuspended in 0.2 mL of 10% glycerol and aliquoted for storage at -80°C for later use.

[0047] Step 2. Prepare Bacillus subtilis competent cells with plasmid pHT-XCR6

[0048] Approximately 10 ng of plasmid pHT-XCR6 was added to 0.1 mL of Bacillus subtilis competent cells. The cells were incubated on ice for 5 min in a pre-chilled electroporation cuvette, followed by one electroporation at 2.0 kV. After recovery and culture in 1 mL of LB medium for 2 h, the cells were spread onto LB solid medium containing 50 μg / mL chloramphenicol and cultured overnight at 37°C. Competent Bacillus subtilis cells carrying plasmid pHT-XCR6 were obtained and stored at -80°C for later use.

[0049] Step 3. Construct pcrF19NM plasmid

[0050] The pcrF19NM plasmid contains information on the mutation site of biotin carboxylase IdeHA and is inserted between DR2 elements. The crRNA sequences with targeting functions are shown in Table 1.

[0051] Table 1. crRNA sequence of biotinylate carboxylase IdeHA gene editing

[0052] crRNA Name Sequence (5’-3’) IdeHA-K74 GCGAAAAAAGCAAAAGCCGACGCG IdeHA-A125 GCAATGGAGGCTGCAGGTGTC IdeHA-E136 GGCGTTTCTGAATCCCTCGGA IdeHA-C145 GAGGCAGCCTGCCGCACCGCA IdeHA-T394 AAAGGCCAAACCAGAACAGAA

[0053] Step 4. Construct homologous fragments

[0054] Homologous fragments were constructed using a complementary primer annealing procedure, and the primer sequences used are shown in Table 2.

[0055] Table 2 Primer sequences for constructing homologous fragments of biotinylate IdeHA gene editing

[0056] Primer Name Sequence (5’-3’) IdeHA-K74-F AAAAAAGCAAACGCCGACGCGATCCACCCGGGATATG IdeHA-K74-R CGCGTCGGCGTTTGCTTTTTTCGCCGTCTTTATG IdeHA-A125-F GCAATGGAGACGGCAGGTGTCCCTGTGGTGCCGGGC IdeHA-A125-R GACACCTGCCGTCTCCATTGCTTTTCGCGCTTCAATTTTG IdeHA-E136-F GGCGTTTCTNNKTCCCTCGGAGATATAGAGGCAGCC IdeHA-E136-R TCCGAGGGAMNNAGAAACGCCCGGCACCACAGGGAC IdeHA-C145-F GAGGCAGCCNNKCGCACCGCAAGTCAAATCGGCTATC IdeHA-C145-R TGCGGTGCGMNNGGCTGCCTCTATATCTCCGAGGG IdeHA-T394-F AAAGGCCAANNKAGAACAGAAGCAATTGAAAAACTAG IdeHA-T394-R TTCTGTTCTMNNTTGGCCTTTGACAATCATCTTAG

[0057] In this context, "F" represents the upstream primer, "R" represents the downstream primer, and the underlined sequence represents the mutation site.

[0058] The annealing PCR system is shown in Table 3, and the procedure is shown in Table 4.

[0059] Table 3 Annealing PCR System

[0060] Composition volume 10 pmol / μL upstream primer 5μL 10 pmol / μL downstream primer 5μL

[0061] Table 4 Annealing PCR Procedure

[0062]

[0063] The resulting PCR product is the homologous fragment.

[0064] Step 5. Transform pcrF19NM plasmid and homologous fragment

[0065] Following the experimental procedure in step two above, the pcrF19NM plasmid and homologous fragment were transformed into competent Bacillus subtilis cells carrying plasmid pHT-XCR6, and plated on LB solid medium supplemented with 50 μg / mL chloramphenicol, 50 μg / mL kanamycin, and 3% xylose, and incubated overnight at 30°C. Single colonies that grow can then be used for liquid culture and fermentation verification.

[0066] Step 6. Bacillus subtilis culture and fermentation to produce surfactants

[0067] Forty-eight single colonies of Bacillus subtilis were picked from the plate and inoculated into 10 mL test tubes containing 3 mL of LB liquid medium. The culture was incubated overnight at 37°C and 200 rpm to obtain the primary seed culture. One mL of the primary seed culture was added to a 250 mL Erlenmeyer flask containing 30 mL of LB liquid medium and incubated at 37°C and 200 rpm for 16 h to obtain the secondary seed culture. Five mL of the secondary seed culture was added to a 2 L Erlenmeyer flask containing 1 L of fermentation medium and incubated at 37°C and 200 rpm for 48 h. The 1 L fermentation medium consisted of: 40 g soluble starch, 7 g sodium nitrate, 1 g potassium dihydrogen phosphate, 1 g yeast extract, 0.5 g magnesium sulfate, 0.5 g potassium chloride, 0.28 g ferrous sulfate heptahydrate, 1.7 mg manganese sulfate, and 0.16 mg copper sulfate pentahydrate.

[0068] Step 7. Surfactant content produced by Bacillus subtilis fermentation

[0069] Centrifuge the Bacillus subtilis fermentation broth, collect 1 mL of supernatant, and centrifuge at 12000 rpm for 3 min. Take 200 μL of the supernatant, add 3-10 times the appropriate amount of methanol, shake thoroughly, and centrifuge at 12000 rpm for 10 min. Filter the supernatant through a membrane to obtain the sample to be tested. Use an Agilent 1260 high-performance liquid chromatograph as the detection tool, with an Amethyst C18-H column (5 μm, 250 × 4.6 mm). The mobile phase is 90% methanol and 10% water, with 0.05% trifluoroacetic acid added, at a flow rate of 0.8 mL / min. Injection volume is 20 μL. Detection wavelength is 214 nm. Surfactant standards were prepared in gradient concentrations to create a standard curve, thereby calculating the surfactant content in the fermentation broth sample. Among the 48 Bacillus subtilis strains selected in step 6, the strain with the highest increase in surfactant production was designated as CY-1, and its surfactant production is shown in Table 13.

[0070] Step 8. Genome sequencing of the dominant strain

[0071] Genomic DNA of CY-1 was extracted using a Gram-positive bacteria genomic DNA extraction kit (Beijing Solarbio). The biotinylate carboxylase IdeHA gene on the genome was sequenced. The mutant sequence of CY-1 biotinylate carboxylase IdeHA is shown in SEQ ID No. 6, where lysine at position 74 is mutated to asparagine, alanine at position 125 to threonine, glutamic acid at position 136 to lysine, cysteine ​​at position 145 to phenylalanine, and threonine at position 394 to asparagine. The positions of these mutation sites in the 3D structure of the enzyme are shown below. Figure 1 As shown.

[0072] Example 2: A Bacillus subtilis strain with high surfactant production

[0073] Similar to Example 1, this example first constructs Bacillus subtilis carrying biotin carboxylase IdeHA mutant and biotin carboxylase accBC mutant through the preparation method in steps 1-5, and then screens out strains with high surfactant production through steps 6-8.

[0074] Step 1. Prepare Bacillus subtilis competent cells

[0075] This step is basically the same as step 1 of Example 1, except that the wild-type Bacillus subtilis used in Example 1 is replaced with the high-yielding strain CY-1 screened in Example 1.

[0076] Step 2. Prepare Bacillus subtilis competent cells with plasmid pHT-XCR6

[0077] This step is the same as step 2 in Example 1.

[0078] Step 3. Construct pcrF19NM plasmid

[0079] This step is basically the same as step 3 in Example 1, except that the crRNA sequence is changed to that shown in Table 5.

[0080] Table 5. crRNA sequence of biotinylate carboxylase accBC gene editing

[0081] crRNA name Sequence (5'-3') accBC-S409 CGCGCATTGAGCGAATTCGTC

[0082] Step 4. Construct homologous fragments

[0083] This step is basically the same as step 4 in Example 1, except that the primer sequences for constructing homologous fragments are changed as shown in Table 6.

[0084] Table 6 Primer sequences for constructing homologous fragments of biotinylate carboxylase (accBC) gene editing.

[0085] Primer name Sequence (5'-3') accBC-S409-F CGCGCATTGGGCGAATTCGTCATCGAAGGCATTGAG accBC-S409-R GACGAATTCGCCCAATGCGCGCTTCATGCGGGCAATC

[0086] Step 5. Transform pcrF19NM plasmid and homologous fragment

[0087] This step is basically the same as step 5 in Example 1, except that 48 single colonies are picked instead of 192 single colonies.

[0088] Step 6. Bacillus subtilis culture and fermentation to produce surfactants

[0089] This step is the same as step 6 in Example 1.

[0090] Step 7. Surfactant content produced by Bacillus subtilis fermentation

[0091] This step is the same as step 7 in Example 1. Among the 192 Bacillus subtilis strains selected in step 6, the strain with the highest increase in surfactant production is CY-2, and its surfactant production is shown in Table 13.

[0092] Step 8. Genome sequencing of the dominant strain

[0093] This step is essentially the same as step 8 of Example 1, except that the sequenced gene is the biotinylate carboxylase accBC gene of the CY-2 genome. The CY-2 biotinylate carboxylase accBC mutation involves a change from serine to glycine at position 409, as shown in SEQ ID No. 7. The location of this mutation site in the 3D structure of the protein is shown below. Figure 2 As shown.

[0094] Example 3: A Bacillus subtilis strain with high surfactant production

[0095] Similar to Example 1, this example first constructs Bacillus subtilis carrying biotin carboxylase IdeHA and accBC mutants and enoyl reductase fabI mutants through the preparation methods in steps 1-5, and then screens out strains with high surfactant production through steps 6-8.

[0096] Step 1. Prepare Bacillus subtilis competent cells

[0097] This step is basically the same as step 1 of Example 1, except that the wild-type Bacillus subtilis is replaced with the high-yielding strain CY-2 selected in Example 2.

[0098] Step 2. Prepare Bacillus subtilis competent cells with plasmid pHT-XCR6

[0099] This step is the same as step 2 in Example 1.

[0100] Step 3. Construct pcrF19NM plasmid

[0101] This step is basically the same as step 3 in Example 1, except that the crRNA sequence is changed to that shown in Table 7.

[0102] Table 7. CroRNA sequence edited from the acyl reductase fabI gene.

[0103] crRNA name Sequence (5'-3') fabI-G263 GTTGATTCTGGTTTCCATATC

[0104] Step 4. Construct homologous fragments

[0105] This step is basically the same as step 4 in Example 1, except that the primer sequences for constructing homologous fragments are changed as shown in Table 8.

[0106] Table 8 Primer sequences for constructing homologous fragments of acyl reductase fabI gene editing.

[0107] Primer name Sequence (5'-3') fabI-G263-F GTTGATTCTNNKTTCCATATCACTGCCCGCTAAG fabI-G263-R GATATGGAAMNNAGAATCAACGTGAAGATTTTCACC

[0108] Step 5. Transform pcrF19NM plasmid and homologous fragment

[0109] This step is basically the same as step 5 in Example 1, except that 48 single colonies are picked instead of 96 single colonies.

[0110] Step 6. Bacillus subtilis culture and fermentation to produce surfactants

[0111] This step is the same as step 6 in Example 1.

[0112] Step 7. Surfactant content produced by Bacillus subtilis fermentation

[0113] This step is the same as step 7 in Example 1. Among the 96 Bacillus subtilis strains selected in step 6, the strain with the highest increase in surfactant production is CY-3, and its surfactant production is shown in Table 13.

[0114] Step 8. Genome sequencing of the dominant strain

[0115] This step is essentially the same as step 8 of Example 1, except that the sequenced gene is the enoyl reductase fabI gene of the CY-2 genome. The CY-3 enoyl reductase fabI is mutated by changing glycine to cysteine ​​at position 263, as shown in SEQ ID No. 8. The location of the mutation site in the 3D structure of the protein is shown below. Figure 3 As shown.

[0116] Example 4: A Bacillus subtilis strain with high surfactant production

[0117] Similar to Example 1, this example first constructs Bacillus subtilis carrying biotin carboxylase IdeHA and accBC mutants, enoyl reductase fabI mutants and malonyl transferase fabD through the preparation methods in steps 1-5, and then screens out strains with high surfactant production through steps 6-8.

[0118] Step 1. Prepare Bacillus subtilis competent cells

[0119] This step is basically the same as step 1 of Example 1, except that the wild-type Bacillus subtilis is replaced by strain CY-3, which was selected in Example 3 to show the greatest increase in surfactant production.

[0120] Step 2. Prepare Bacillus subtilis competent cells with plasmid pHT-XCR6

[0121] This step is the same as step 2 in Example 1.

[0122] Step 3. Construct pcrF19NM plasmid

[0123] This step is basically the same as step 3 in Example 1, except that the crRNA sequence is changed to that shown in Table 9.

[0124] Table 9. crRNA sequence for malonyltransferase fabD gene editing

[0125] crRNA name Sequence (5'-3') fabD-P64 AATGCGCAGCCTGCTTTGCTT

[0126] Step 4. Construct homologous fragments

[0127] This step is basically the same as step 4 of Example 1, except that the primer sequences for constructing homologous fragments are changed as shown in Table 10.

[0128] Table 10 Primer sequences for constructing homologous fragments of malonyltransferase fabD gene editing.

[0129] Primer name Sequence (5'-3') fabD-P64-F AATCGCAGNNKGCTTTGCTTACGACAAGCATCGCTG fabD-P64-R AAGCAAAGCMNNCTGCGCATTGTATGTAAGTGTTAATTC

[0130] Step 5. Transform pcrF19NM plasmid and homologous fragment

[0131] This step is basically the same as step 5 in Example 1, except that 48 single colonies are picked instead of 96 single colonies.

[0132] Step 6. Bacillus subtilis culture and fermentation to produce surfactants

[0133] This step is the same as step 6 in Example 1.

[0134] Step 7. Surfactant content produced by Bacillus subtilis fermentation

[0135] This step is the same as step 7 in Example 1. Among the 96 Bacillus subtilis strains selected in step 6, the strain with the highest increase in surfactant production is CY-4, and its surfactant production is shown in Table 13.

[0136] Step 8. Genome sequencing of the dominant strain

[0137] This step is essentially the same as step 8 of Example 1, except that the sequenced gene is the malonyltransferase fabD gene of the CY-2 genome. The mutation of the CY-4 malonyltransferase fabD involves a mutation of amino acid proline at position 64 to arginine, as shown in SEQ ID No. 9. The location of the mutation site in the 3D structure of the protein is as follows... Figure 4 As shown.

[0138] Example 5: A Bacillus subtilis strain with high surfactant production

[0139] Similar to Example 1, this example first constructs Bacillus subtilis with mutants of biotin carboxylase IdeHA and accBC, enoyl reductase fabI, malonyl transferase fabD, and dihydrolipoyl dehydrogenase IPdU through the preparation methods in steps 1-5, and then selects strains with high surfactant production through steps 6-8.

[0140] Step 1. Prepare Bacillus subtilis competent cells

[0141] This step is basically the same as step 1 of Example 1, except that the wild-type Bacillus subtilis is replaced by strain CY-4, which was selected in Example 4 to show the highest increase in surfactant production.

[0142] Step 2. Prepare Bacillus subtilis competent cells with plasmid pHT-XCR6

[0143] This step is the same as step 2 in Example 1.

[0144] Step 3. Construct pcrF19NM plasmid

[0145] This step is basically the same as step 3 in Example 1, except that the crRNA sequence is changed to that shown in Table 11.

[0146] Table 11. crRNA sequences edited from the dihydrolipoyl dehydrogenase (IPdU) gene.

[0147] crRNA name Sequence (5'-3') IPdU-V163 GGTCTTGAAGTGGACGGTAAG IPdU-G287 AATATCGAAGGCATCGGCCTA

[0148] Step 4. Construct homologous fragments

[0149] This step is basically the same as step 4 of Example 1, except that the primer sequences for constructing homologous fragments are changed as shown in Table 12.

[0150] Table 12 Primer sequences for constructing homologous fragments of dihydrolipoyl dehydrogenase (IPdU) gene editing.

[0151] Primer name Sequence (5'-3') IPdU-V163-F GGTCTTGAANNKGACGGTAAGTCTGTACTGACTTCAGATG IPdU-V163-R CTTACCGTCMNNTTCAAGACCCGGAAGCATTCTCGGTCTTG IPdU-G287-F AATATCGAANNKATCGGCCTAGAGAACACCGATATTG IPdU-G287-R TAGGCCGATMNNTTCGATATTTGCCTGTCTGCCGATG

[0152] Step 5. Transform pcrF19NM plasmid and homologous fragment

[0153] This step is basically the same as step 5 in Example 1, except that 48 single colonies are picked instead of 96 single colonies.

[0154] Step 6. Bacillus subtilis culture and fermentation to produce surfactants

[0155] This step is the same as step 6 in Example 1.

[0156] Step 7. Surfactant content produced by Bacillus subtilis fermentation

[0157] This step is the same as step 7 in Example 1. Among the 96 Bacillus subtilis strains selected in step 6, the strain with the highest increase in surfactant production is CY-5, and its surfactant production is shown in Table 13. Figure 6 Chromatograms of surfactant in standard and CY-5 fermentation broth.

[0158] Step 8. Genome sequencing of the dominant strain

[0159] This step is essentially the same as step 8 of Example 1, except that the sequenced gene is the dihydrolipoyl octanoyl dehydrogenase IPdU gene of the CY-2 genome. The mutation of the CY-5 dihydrolipoyl octanoyl dehydrogenase IPdU involves a mutation of amino acid valine at position 163 to alanine and amino acid glycine at position 287 to serine, as shown in SEQ ID No. 10. The location of the mutation sites in the 3D structure of the protein is shown below. Figure 5 As shown.

[0160] The surfactant content of wild-type Bacillus subtilis and strains CY-1, CY-2, CY-3, CY-4, and CY-5 is shown in Table 13. The surfactant yield of these five Bacillus subtilis strains was significantly increased compared to wild-type Bacillus subtilis, with the highest increase being 15.7 times.

[0161] Table 13 Surfactant yield of different strains of Bacillus subtilis

[0162]

[0163]

Claims

1. A Bacillus subtilis strain, characterized in that, The mutants include biotin carboxylase IdeHA, biotin carboxylase accBC, enoyl reductase fabI, malonyl transferase fabD, and dihydrolipoyl dehydrogenase IPdU, whose amino acid sequences are shown in SEQ ID NO. 6-10.

2. The application of Bacillus subtilis as described in claim 1 in the production of surfactants.

Citation Information

Patent Citations

  • Method for improving production of surfactin of bacillus subtilis by over-expressing SecA

    CN117187286A

  • High-yield surfactin engineering bacterium as well as construction method and application thereof

    CN117946952A

  • Genetically engineered bacterium with high lipopeptide production and construction method and application thereof

    CN109097315A