Nucleic acid detection composition, kit and method based on template specific 5-terminal sequence information

Abstract

The present invention relates to capture oligonucleotides, compositions or kits and methods for nucleic acid amplification. Specifically, the capture oligonucleotide comprises a universal sequence (U3s) and a binding capture sequence (1s) from the 5'end to the 3 'end; wherein (1) the binding capture sequence (1s) is at least partially identical to the 5'terminal sequence of the target molecule, and (2) the capture oligonucleotide further comprises a nucleic acid extension blocking modification located at the 3 'terminal of the binding capture sequence (1s), optionally, (3) the 3' terminal of the binding capture sequence (1s) has a nucleic acid analogue modification. The invention also provides a composition or a kit, a detection system and a method for nucleic acid amplification detection. The product and the method provided by the invention can realize nucleic acid detection with good specificity and high sensitivity.

Description

Technical Field

[0001] The present invention relates to the field of detection technology, and in particular to a nucleic acid detection composition, a kit and a method based on template-specific 5-end sequence information. Background Art

[0002] Nucleic acid amplification has not only promoted the development of basic theoretical research in biology, but also revolutionized analytical techniques in clinical science. The applications of these technologies include molecular cloning, nucleic acid sequencing, genotyping and mutation detection and identification, and quantitative detection of gene expression.

[0003] DNA methylation refers to the covalent bonding of a methyl group to the 5th carbon position of cytosine in the genomic CpG dinucleotide under the action of DNA methyltransferase. It can affect the expression level of genes without changing the DNA sequence, and is one of the important research contents of epigenetics. DNA methylation plays an important role in the occurrence and development of many human diseases, such as tumors, cardiovascular diseases, diabetes, etc., and is one of the hot spots in basic research and clinical application research.

[0004] Currently, the method based on bisulfite conversion is the mainstream choice for DNA methylation detection. However, since bisulfite conversion requires strict chemical conditions, it has many shortcomings: 1) Incomplete conversion can lead to false positives; 2) The conversion process can cause DNA degradation and fragmentation, resulting in reduced sensitivity; 3) Since the conversion process changes the base information in the sequence, this will cause the sequence to lose complexity and amplification preference; 4) A cumbersome desulfonation and other purification processes are required for subsequent analysis.

[0005] Therefore, developing a method that is simple, fast, highly sensitive, and highly specific for detecting trace amounts of nucleic acids and their methylation status is a pain point and difficulty that urgently needs to be addressed in this field. Summary of the invention

[0006] The present invention aims to provide a method for detecting trace nucleic acids and their methylation states, which is simple and quick to operate, highly sensitive and highly specific.

[0007] The inventors have developed a nucleic acid detection system that utilizes site-specific cutting nucleases and universal primer-based amplification, which can detect trace amounts of nucleic acid and its methylation status, and has the advantages of simple and fast operation, high sensitivity, and high specificity.

[0008] In a first aspect of the present invention, a capture oligonucleotide for nucleic acid amplification is provided, wherein the capture oligonucleotide comprises a universal sequence (3s) and a binding capture sequence (1s) from 5' to 3'; wherein,

[0009] (1) the binding capture sequence is at least partially identical to the 5' end sequence of the target molecule, and

[0010] (2) The capture oligonucleotide further comprises a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence (1s).

[0011] In another preferred embodiment, the capture oligonucleotide further comprises a nucleic acid analog modification;

[0012] Preferably, (3) the 3' end of the binding capture sequence (1s) is modified with a nucleic acid analog.

[0013] In another preferred embodiment, the capture oligonucleotide further comprises an enzyme recognition tag located at the 3' end of the universal sequence (3s) or the 5' end of the combined capture sequence (1s).

[0014] In another preferred embodiment, the universal sequence is unrelated to the target molecule sequence.

[0015] In another preferred embodiment, the universal primer is unrelated to the target molecule sequence.

[0016] In another preferred embodiment, the nucleic acid extension blocking modification is selected from the following group: Spacer, amino, C6, methyl, azide, phosphoramidite, alkyne, DBCO, biotin, digoxigenin, puromycin, methylene blue, azobenzene, locked nucleic acid, 5-nitroindole, inverted base, or a combination thereof.

[0017] In another preferred embodiment, the 3' end of the capture sequence binding of the capture oligonucleotide is modified with a nucleic acid analog.

[0018] In another preferred embodiment, the 3' end of the capture sequence binding of the capture oligonucleotide contains a nucleic acid extension blocking modification and the 3' end has a nucleic acid analog modification.

[0019] In another preferred embodiment, the binding capture sequence of the capture oligonucleotide is complementary to the 3' terminal sequence of the target molecule.

[0020] In another preferred embodiment, the nucleic acid analog modification is selected from the following group: peptide nucleic acid, locked nucleic acid, transposed base, Spacer, 2'-O, 4'-C-methylated bridging RNA, 2'-methoxy modified base, 2'-O-methyl RNA, deoxyuridine (2'-deoxyuridine), 2-fluoro RNA, 2'-fluoro RNA, or a combination thereof.

[0021] In another preferred embodiment, the target molecule is a target molecule with a clear 5' end sequence.

[0022] In another preferred embodiment, the target molecule is a target molecule with clear sequences at the 3' and 5' ends. Preferably, the target molecule is a cleavage product of a site-specific cutting nuclease. More preferably, the target molecule is a target molecule with clear sequences at both ends due to cleavage by a site-specific cutting nuclease.

[0023] In another preferred embodiment, the site-specific cutting nuclease is an exonuclease and / or an endonuclease.

[0024] In another preferred embodiment, the site-specific cutting nuclease is selected from the following group: AP exonuclease, AP lyase, uracil-DNA glycosylase (UDG), endonuclease (e.g., nucleic acid restriction endonuclease, such as MspⅠ, Xmal, etc.), methylation-dependent nucleic acid restriction endonuclease, methylation-sensitive nucleic acid restriction endonuclease, nickase, giant nuclease, zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), CRISPR-Cas system, mismatch repair enzyme, or a combination thereof.

[0025] In another preferred embodiment, the endonuclease is selected from the group consisting of a methylation-dependent restriction endonuclease, a methylation-sensitive restriction endonuclease, a nickase, a CRISPR-Cas system, a mismatch repair enzyme, or a combination thereof.

[0026] In another preferred embodiment, the CRISPR-Cas system comprises a guiding short RNA that matches the target DNA fragment and an endonuclease that can recognize and cut a specific sequence, such as a CRISPR-Cas system based on Cas9, Cas12 or Cas13.

[0027] In another preferred embodiment, the methylation-dependent restriction endonuclease is selected from the group consisting of Gla I, FspE I, MspJI and LpnPI, or a combination thereof.

[0028] In a second aspect of the present invention, a composition or a kit for nucleic acid amplification is provided, wherein the composition or the kit comprises the capture oligonucleotide according to the first aspect of the present invention.

[0029] In another preferred embodiment, the composition or kit comprises a capture oligonucleotide and a universal primer, wherein the capture oligonucleotide comprises a universal sequence and a binding capture sequence from 5' to 3', wherein:

[0030] (1) the binding capture sequence is at least partially identical to the target molecule, and

[0031] (2) The capture oligonucleotide further comprises a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence.

[0032] In another preferred embodiment, the composition or kit comprises a capture oligonucleotide and a universal primer, wherein the capture oligonucleotide comprises a universal sequence and a binding capture sequence from 5' to 3', wherein:

[0033] (1) the binding capture sequence is at least partially identical to the target molecule,

[0034] (2) the capture oligonucleotide further comprises a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence, and

[0035] (4) The capture oligonucleotide further includes an enzyme recognition tag located at the 3' end of the universal sequence or at the 5' end of the capture sequence.

[0036] In another preferred embodiment, the capture oligonucleotide 3' end has a nucleic acid extension blocking modification selected from one or more of the following: Spacer, amino, C6, methyl, azide, phosphoramidite, alkyne, DBCO, biotin, digoxigenin, puromycin, methylene blue, azobenzene, locked nucleic acid, 5-nitroindole, inverted base, or a combination thereof.

[0037] In another preferred embodiment, the capture oligonucleotide is modified with a nucleic acid analog, and the nucleic acid analog includes one or more selected from the following: peptide nucleic acid, locked nucleic acid, transposed base, Spacer, 2'-O, 4'-C-methylated bridging RNA, 2'-methoxy modified base, 2'-O-methyl RNA, deoxyuridine (2'-deoxyuridine), 2-fluoro RNA, 2'-fluoro RNA, or a combination thereof.

[0038] In another preferred embodiment, the composition or kit further comprises a target molecule pre-sequence pretreatment reagent.

[0039] In another preferred embodiment, the pretreatment reagent comprises a methylation-dependent restriction endonuclease, a methylation-sensitive restriction endonuclease, a nicking enzyme, a CRISPR-Cas system, a mismatch repair enzyme, or a combination thereof.

[0040] In another preferred embodiment, the target molecule pretreatment reagent includes a site-specific cutting nuclease.

[0041] In another preferred embodiment, the composition or kit further comprises a target-specific primer.

[0042] In another preferred embodiment, the composition or kit further comprises a universal primer.

[0043] In another preferred embodiment, the composition or kit further comprises a universal primer, and the universal primer is unrelated to the target molecule sequence.

[0044] In another preferred embodiment, the composition or kit further comprises a detection probe.

[0045] In another preferred embodiment, the universal primer (3s) comprises a sequence identical or partially identical to the 5' end of the capture oligonucleotide.

[0046] In another preferred embodiment, the kit further comprises a site-specific cutting nuclease; preferably an exonuclease and / or an endonuclease.

[0047] In another preferred embodiment, the site-specific cutting nuclease is an exonuclease and / or an endonuclease.

[0048] In another preferred embodiment, the site-specific cutting nuclease is selected from the following group: AP exonuclease, AP lyase, uracil-DNA glycosylase (UDG), endonuclease (e.g., nucleic acid restriction endonuclease, such as MspⅠ, Xmal, etc.), methylation-dependent nucleic acid restriction endonuclease, methylation-sensitive nucleic acid restriction endonuclease, nickase, giant nuclease, zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), CRISPR-Cas system, mismatch repair enzyme, or a combination thereof.

[0049] In another preferred embodiment, the endonuclease is selected from the group consisting of a methylation-dependent restriction endonuclease, a methylation-sensitive restriction endonuclease, a nickase, a CRISPR-Cas system, a mismatch repair enzyme, or a combination thereof.

[0050] In another preferred embodiment, the CRISPR-Cas system comprises a guiding short RNA that matches the target DNA fragment and an endonuclease that can recognize and cut a specific sequence, such as a CRISPR-Cas system based on Cas9, Cas12 or Cas13.

[0051] In another preferred embodiment, the methylation-dependent restriction endonuclease is selected from the following group: GlaI, FspEI, MspJI, LpnPI, or a combination thereof.

[0052] In another preferred embodiment, the composition or kit further comprises a probe.

[0053] In another preferred embodiment, the probe is labeled with a fluorescent group and / or a quencher group.

[0054] In another preferred embodiment, the fluorescent group is selected from the following group: FAM, VIC, JOE, TET, CY3, CY5, ROX, TexasRed, LC RED460, or a combination thereof; the quenching group is selected from the following group: BHQ1, BHQ2, BHQ3, Dabcy1, Tamra, or a combination thereof.

[0055] In another preferred embodiment, the probes include specific probes and universal probes.

[0056] In another preferred embodiment, the composition further comprises DNA polymerase, dNTP, Mg 2+ , or a combination thereof.

[0057] In another preferred embodiment, the composition further comprises an enzyme digestion buffer and / or a PCR buffer.

[0058] In the third aspect of the present invention, a nucleic acid detection system is provided, the system comprising the capture oligonucleotide described in the first aspect of the present invention or the composition or kit described in the second aspect of the present invention.

[0059] In another preferred embodiment, the detection system further includes universal primers, specific primers and probes.

[0060] In another preferred embodiment, the detection system further comprises Taq polymerase, dNTP, MgCl2 and PCR buffer.

[0061] In another preferred embodiment, the detection system further comprises 1-100 nM of the capture oligonucleotide described in the first aspect of the present invention, 1-5 U (preferably 1-2 U) of Taq polymerase, 50-500 μM (preferably 100-300 μM) of dNTP, 1-5 mM (preferably 1-3 mM) of MgCl2 and PCR buffer.

[0062] In another preferred embodiment, the system further comprises 100-800 nM (preferably 100-400 nM) universal primers.

[0063] In another preferred embodiment, the system further comprises 100-600 nM (preferably 100-300 nM) probe.

[0064] In another preferred embodiment, the universal primers and probes are as described in the second aspect of the present invention.

[0065] In another preferred embodiment, the system further comprises 1-20U (preferably 5-15U) of site-specific cutting nuclease; preferably exonuclease and / or endonuclease.

[0066] In another preferred embodiment, the endonuclease is a restriction endonuclease.

[0067] In another preferred embodiment, the endonuclease is selected from any one or more of a methylation-dependent restriction endonuclease, a methylation-sensitive restriction endonuclease, a nickase, a CRISPR-Cas system or a mismatch repair enzyme.

[0068] In another preferred embodiment, the methylation-dependent restriction endonuclease includes any one or two or more selected from Gla I, FspEI, MspJI and LpnPI.

[0069] In a fourth aspect of the present invention, a method for nucleic acid amplification or detection is provided, the method comprising the step of using a capture oligonucleotide to bind to an extension product of a target-specific primer, the capture oligonucleotide being as described in the first aspect of the present invention.

[0070] In another preferred embodiment, the method comprises the steps of using a target-specific primer to bind to a target molecule and extend the target molecule, and using a capture oligonucleotide to bind to an extension product of the target-specific primer and extend the target molecule.

[0071] In another preferred embodiment, the method comprises the steps of:

[0072] (a) using a target-specific primer to bind to a target molecule and extend it (i.e., the target-specific primer binds to the target molecule and extends it);

[0073] (b) using a capture oligonucleotide to bind to and extend the extension product of the target-specific primer (i.e., the extension product of the target-specific primer binds to and extends the capture oligonucleotide);

[0074] (c) exponential amplification based on target-specific primers and universal primers;

[0075] Wherein, the capture oligonucleotide is the capture oligonucleotide described in the first aspect of the present invention.

[0076] In another preferred embodiment, the nucleic acid amplification or detection method is a nucleic acid amplification or detection method for non-diagnostic purposes.

[0077] In another preferred example, the method further comprises (d) using a probe and detecting a probe signal.

[0078] In another preferred embodiment, the capture oligonucleotide includes a universal sequence (3s) and a binding capture sequence (1s) from 5' to 3', wherein:

[0079] (1) the binding capture sequence is at least partially identical to the 5' end sequence of the target molecule, and

[0080] (2) the capture oligonucleotide further comprises a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence (1s),

[0081] Optionally,

[0082] (3) The 3' end of the binding capture sequence (1s) is modified with a nucleic acid analog.

[0083] In another preferred embodiment, the method comprises:

[0084] (a1) The target-specific primer binds to the target molecule with a clear 5' end sequence and is extended under the action of a DNA polymerase, and finally terminates at the 5' end of the target molecule to obtain an extension product of the target-specific primer;

[0085] (b1) The extension product of the target-specific primer is complementary to the capture oligonucleotide and extended using the capture oligonucleotide as a template, and a sequence complementary to the universal sequence (universal primer 3s) is added to the 3' end of the extension product of the target-specific primer to obtain a final amplification product with the complementary sequence 3a of the target-specific primer 2a and the universal primer as the end respectively;

[0086] (c1) Target-specific primers and universal primers perform exponential amplification using the final amplification product as a template.

[0087] In another preferred embodiment, the method further comprises (d1) using a probe and detecting a probe signal.

[0088] In another preferred embodiment, the universal primer is unrelated to the target molecule sequence.

[0089] In another preferred embodiment, the universal primer comprises a sequence identical or partially identical to the 5' end of the capture oligonucleotide.

[0090] In another preferred embodiment, the target molecule is a target molecule with a clear 5' end sequence.

[0091] In another preferred embodiment, the target molecule is a cleavage product of a site-specific cutting nuclease, and the 5' end sequence of the target molecule is clear.

[0092] In another preferred embodiment, the target molecule with a clear 5' end sequence is a DNA cleavage product of a site-specific cutting nuclease, preferably a target molecule with clear sequences at both ends due to cleavage by a site-specific cutting nuclease.

[0093] In another preferred embodiment, the site-specific cutting nuclease is an exonuclease and / or an endonuclease.

[0094] In another preferred embodiment, the endonuclease is a restriction endonuclease.

[0095] In another preferred embodiment, the endonuclease is selected from any one or more of a methylation-dependent restriction endonuclease, a methylation-sensitive restriction endonuclease, a nickase, a CRISPR-Cas system or a mismatch repair enzyme.

[0096] In another preferred embodiment, the methylation-dependent restriction endonuclease includes any one or two or more selected from Gla I, FspEI, MspJI and LpnPI.

[0097] In the fifth aspect of the present invention, provided is the use of the capture oligonucleotide described in the first aspect of the present invention, the composition or kit described in the second aspect of the present invention, and the nucleic acid detection system described in the third aspect of the present invention in the preparation of nucleic acid detection products.

[0098] In another preferred example, the nucleic acid detection product is a DNA methylation detection product.

[0099] In another preferred embodiment, the product is selected from a kit, a device, and a computer-readable medium.

[0100] It is to be understood that the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the present disclosure. BRIEF DESCRIPTION OF THE DRAWINGS

[0101] The accompanying drawings herein are incorporated into and constitute a part of the specification, illustrate embodiments consistent with the present invention, and together with the specification are used to explain the principles of the present invention. Obviously, the accompanying drawings described below are only some embodiments of the present invention, and for those of ordinary skill in the art, other accompanying drawings can be obtained based on these accompanying drawings without creative work.

[0102] Figure 1 (A) The amplification principle involved in the present invention; (B) The amplification result when the capture oligonucleotide does not contain the enzyme recognition tag.

[0103] Figure 2 The results of the DNA methylation detection of human Septine 9 gene based on the present invention are shown. 1. 2000 copies / reaction; 2. 200 copies / reaction; 3. 20 copies / reaction; 4. Negative control.

[0104] Figure 3 Shows the addition of a universal probe sequence to the capture oligonucleotide for DNA methylation detection of human Septine9 gene. 1. 2000 copies / reaction; 2. 200 copies / reaction; 3. 20 copies / reaction; 4. Negative control.

[0105] Figure 4 The results of LINE-1 gene unmethylation based on methylation-sensitive restriction endonuclease treatment are shown.

[0106] Figure 5 The m6A modification detection on RNA according to the present invention is shown. The target molecule concentrations of 1 / 2 / 3 / 4 are 2000 copies / reaction, 200 copies / reaction, 20 copies / reaction, and negative control, respectively. DETAILED DESCRIPTION

[0107] Example embodiments will now be described more fully with reference to the accompanying drawings. However, example embodiments can be implemented in many forms and should not be construed as limited to the embodiments set forth herein; rather, these embodiments are provided so that the present invention will be comprehensive and complete and fully convey the concept of the example embodiments to those skilled in the art.

[0108] Unless otherwise defined, all terms and phrases used herein include the meanings that the terms and phrases have in the art, unless explicitly stated to the contrary or clearly apparent from the context in which the terms and phrases are used. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, specific methods and materials are now described.

[0109] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a preferred technical solution.

[0110] After extensive and in-depth research, the inventors unexpectedly discovered for the first time that a target-specific primer is first used to bind to and extend the target molecule, and then the specific primer extension product is bound to and extended with the capture oligonucleotide, and then combined with linear amplification of universal primers, as well as exponential amplification based on specific primers and universal primers. Based on this, the present invention was completed.

[0111] Capture oligonucleotides

[0112] The present invention provides a capture oligonucleotide for nucleic acid amplification, wherein the capture oligonucleotide comprises a universal sequence (3s) and a binding capture sequence (1s) from the 5' end to the 3' end; wherein:

[0113] (1) the binding capture sequence (1s) is at least partially identical to the 5' end sequence of the target molecule, and

[0114] (2) The capture oligonucleotide further comprises a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence (1s).

[0115] Typically, the capture oligonucleotides of the present invention further include nucleic acid analog modifications;

[0116] Preferably, (3) the 3' end of the binding capture sequence (1s) is modified with a nucleic acid analog.

[0117] In a preferred embodiment of the present invention, the capture oligonucleotide includes a universal sequence and a binding capture sequence from 5' to 3', wherein the binding capture sequence is at least partially identical to the target molecule, the capture oligonucleotide also includes a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence, and the universal primer is unrelated to the target molecule sequence.

[0118] The complementarity described herein includes complete complementarity and partial complementarity. Generally, for the nucleic acid chain that needs to be extended, its 3' end sequence is at least 90% complementary on the corresponding complementary chain, for example, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, or completely complementary, as long as it does not affect the extension of the nucleic acid chain. For example, in the complementarity of the specific primer extension product and the binding capture sequence of the capture oligonucleotide, the specific primer extension product is the nucleic acid chain that needs to be extended, and its 3' end sequence is at least 90% complementary or completely complementary to the binding capture sequence (that is, the 3' end nucleic acid of the specific primer extension product has a matching base on the capture oligonucleotide).

[0119] The target-specific primer extension product with clear 3' end sequence information is complementary to the capture sequence of the capture oligonucleotide, and then the capture oligonucleotide is extended as a template, and the complementary chain of the universal primer sequence (3s) is added to its 3' end (such as Figure 1 As shown). In order to prevent the capture oligonucleotide itself from being extended, the capture oligonucleotide may also optionally include a nucleic acid extension blocking modification. The nucleic acid extension blocking modification is usually located at the 3' end of the binding capture sequence. The nucleic acid extension blocking modification has a substance that can block the extension of DNA polymerase, so that the capture oligonucleotide will not extend to the 3' end, thereby forming a complementary chain of the target molecule to affect the subsequent binding and extension of the capture oligonucleotide. The modification that can block the extension of DNA polymerase includes: Spacer, thio group, sulfhydryl, amino or uracil base; typically, the modification that can block the extension of DNA polymerase includes Spacer, amino, C6, methyl, azide, phosphoramidite, alkyne, DBCO, biotin, digoxigenin, puromycin, methylene blue, azobenzene, locked nucleic acid, 5-nitroindole, inverted base, or a combination thereof.

[0120] In an embodiment of the present invention, the capture oligonucleotide with the nucleic acid extension modification is modified at the Spacer binding capture sequence. In order to further enhance the effect of nucleic acid extension blocking, the 3' end of the capture oligonucleotide binding capture sequence may also include a nucleic acid analog modification. The nucleic acid analog includes one or more selected from the following: peptide nucleic acid, locked nucleic acid, transposed base, Spacer, 2'-O, 4'-C-methylated bridging RNA, 2'-methoxy modified base, 2'-O-methyl RNA, deoxyuridine, 2-fluoro RNA, or 2'-fluoro RNA.

[0121] In the present invention, the universal sequence is an artificially synthesized sequence. Therefore, when detecting different target molecules, it is only necessary to design the binding capture sequence of the capture oligonucleotide according to the target molecule, and the universal sequence can remain unchanged. The length or base ratio of the universal sequence (universal primer) can be conventionally adjusted according to the composition, length, required specificity, etc. of the sequence to be amplified.

[0122] Target molecule

[0123] In the present invention, the target molecule can be a target molecule with clear 5' terminal sequence information (i.e., clear sequence), or a target molecule with clear 5' terminal sequence information after being treated by a biological method. The types of nucleic acid sequences with clear 5' terminal sequence information include normal nucleic acid sequences, nucleic acid sequences with modifications, single nucleotide mutations, sequence transpositions, sequence deletions, sequence recombination, and other different types.

[0124] Target molecules with clear sequence information at their 3' and 5' ends, such as mature microRNA, microRNA precursor, cfDNA, etc.

[0125] The target molecule intermediate with clear sequence information at the 3' end and 5' end can be obtained by cutting or blocking by biological methods, including products cut by site-specific cutting nucleases, such as AP exonuclease, AP lyase, uracil-DNA glycosylase (UDG), nucleic acid restriction endonuclease, methylation-dependent nucleic acid restriction endonuclease, methylation-sensitive nucleic acid restriction endonuclease, nickase, giant nuclease, zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), CRISPR-Cas system, mismatch repair enzyme, etc. Methylation-dependent restriction endonucleases such as GlaI, FspEI, MspJI and LpnPI; methylation-sensitive restriction endonucleases such as HpaⅡ, SmaⅠ, etc.; restriction endonucleases such as MspⅠ, Xmal, etc.; CRISPR-Cas system includes a guide short RNA matching the target DNA fragment and an endonuclease that can recognize and cut a specific sequence, such as a CRISPR-Cas system based on Cas9, Cas12 or Cas13.

[0126] Composition, kit

[0127] The present invention provides a composition or a kit for nucleic acid amplification, wherein the composition or the kit comprises the capture oligonucleotide described above in the present invention.

[0128] Typically, the present invention also provides a composition or kit comprising the capture oligonucleotide described in any embodiment of the present invention, for amplifying or detecting nucleic acids. Exemplary capture oligonucleotides are shown in SEQ ID NO: 1, SEQ ID NO: 6, SEQ ID NO: 8 or SEQ ID NO: 12. Exemplary modified capture oligonucleotides are shown in SEQ ID NO: 1, SEQ ID NO: 6, SEQ ID NO: 8 or SEQ ID NO: 12. The kit also includes a reagent for generating a target molecule with clear 5' terminal sequence information (e.g., a target molecule pre-sequence pretreatment reagent), such as the above-mentioned site-specific cutting nuclease. The kit also includes a DNA polymerase, dNTP, Mg 2+ , enzyme digestion buffer, PCR buffer, or any one or more thereof.

[0129] In addition, the kit also includes a universal primer. Specifically, the kit also includes a universal primer as described above. An exemplary universal primer is shown in SEQ ID NO:2.

[0130] When detecting different target molecules, it is only necessary to design the binding capture sequence portion of the specific capture oligonucleotide according to the target molecule, while the universal primer can remain unchanged.

[0131] In order to detect nucleic acids, the kit may further include a probe. In some embodiments, the probe is labeled with a fluorescent group and / or a quencher group. Typically, the fluorescent group is labeled at the 5' end of the detection probe, and the quencher group is labeled at the 3' end of the detection probe. The fluorescent group includes any one or more of FAM, VIC, JOE, TET, CY3, CY5, ROX, Texas Red, or LC RED460; the quencher group includes any one or more of BHQ1, BHQ2, BHQ3, Dabcy1, or Tamra. Exemplary probes are shown in SEQ ID NO: 4 or 7 or 10.

[0132] Nucleic acid amplification or detection methods

[0133] The present invention provides a method for nucleic acid amplification or detection, which comprises the step of using a capture oligonucleotide to bind to an extension product of a target-specific primer, wherein the capture oligonucleotide is as described in the first aspect of the present invention.

[0134] Typically, the nucleic acid amplification or detection method is a nucleic acid amplification or detection method for non-diagnostic purposes.

[0135] Typically, the method comprises the steps of:

[0136] (a) using a target-specific primer to bind to a target molecule and extend it (i.e., the target-specific primer binds to the target molecule and extends it);

[0137] (b) using a capture oligonucleotide to bind to and extend the extension product of the target-specific primer (i.e., the extension product of the target-specific primer binds to and extends the capture oligonucleotide);

[0138] (c) exponential amplification based on target-specific primers and universal primers;

[0139] Wherein, the capture oligonucleotide includes a universal sequence (3s) and a binding capture sequence (1s) from the 5' end to the 3' end; wherein,

[0140] (1) the binding capture sequence (1s) is at least partially identical to the 5' end sequence of the target molecule, and

[0141] (2) the capture oligonucleotide further comprises a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence (1s),

[0142] Optionally,

[0143] (3) the 3' end of the binding capture sequence (1s) is modified with a nucleic acid analog;

[0144] The universal primer has nothing to do with the target molecule sequence.

[0145] In a preferred embodiment of the present invention, the nucleic acid detection method is a nucleic acid detection method for non-diagnostic purposes.

[0146] In a preferred embodiment of the present invention, the method comprises the steps of:

[0147] (a) using a target-specific primer to bind to a target molecule and extend it (i.e. using a target-specific primer to bind to a target molecule and extend it);

[0148] (b) using a capture oligonucleotide to bind to and extend the extension product of the target-specific primer (ie, the extension product of the target-specific primer binds to and extends the capture oligonucleotide); and

[0149] (c) Exponential amplification based on target-specific primers and universal primers.

[0150] Specifically, the method comprises the steps of:

[0151] (a1) The target-specific primer binds to the target molecule with a clear 5' end sequence and is extended under the action of a DNA polymerase, and finally terminates at the 5' end of the target molecule to obtain an extension product of the target-specific primer;

[0152] (b1) The extension product of the target-specific primer is complementary to the capture oligonucleotide and extended using the capture oligonucleotide as a template, and a sequence complementary to the universal sequence (universal primer 3s) is added to the 3' end of the extension product of the target-specific primer to obtain a final amplification product with the complementary sequence 3a of the target-specific primer 2a and the universal primer as the end respectively;

[0153] (c1) Target-specific primers and universal primers perform exponential amplification using the final amplification product as a template.

[0154] The amplification optionally further comprises the use of a probe.

[0155] Testing system

[0156] The present invention provides a nucleic acid detection system, which comprises the capture oligonucleotide described in the first aspect of the present invention or the composition or kit described in the second aspect of the present invention, Taq polymerase, dNTP, MgCl2 and PCR buffer.

[0157] Typically, the detection system further includes primers (target-specific primers, universal primers) and / or probes (specific probes, universal probes).

[0158] Methylation detection system

[0159] In a specific embodiment, the present invention relates to a methylation detection system, which mainly comprises two parts: methylation-dependent restriction endonuclease treatment and / or methylation-sensitive restriction endonuclease treatment, and fluorescent PCR technology based on capture oligonucleotides and / or universal primer amplification. The methylation detection system involves treating the target gene sequence with methylation-dependent restriction endonucleases and / or methylation-sensitive restriction endonucleases for enzyme digestion; and involves fluorescent PCR amplification of the enzyme digestion products of methylation-dependent restriction endonucleases and / or methylation-sensitive restriction endonucleases. Preferably, the methylation detection system includes capture oligonucleotides, probes and universal primers, and the above components are as described elsewhere herein.

[0160] The capture oligonucleotide involved in the methylation detection system includes a universal sequence and a binding capture sequence from 5' to 3', wherein the binding capture sequence is at least partially identical to the target molecule, and the capture oligonucleotide also includes a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence, and the universal primer is unrelated to the target molecule sequence.

[0161] In a preferred embodiment of the present invention, in the methylation detection system, the capture oligonucleotide involved has a nucleic acid analog modification at the 3' end of the binding capture sequence.

[0162] Preferably, the nucleic acid analogs include any one or a combination of at least two of peptide nucleic acid, locked nucleic acid, transposed base, spacer, 2'-O, 4'-C-methylated bridging RNA, 2'-methoxy modified base, 2'-O-methyl RNA, deoxyuridine (2'-deoxyuridine), 2-fluoro RNA or 2'-fluoro RNA. The above preferred nucleic acid analogs are modified on the 3' end sequence of the capture oligonucleotide binding capture sequence.

[0163] In an embodiment of the present invention, the probes (including specific probes and universal probes) involved in the methylation detection system are respectively labeled with a fluorescent detection group and a quenching group at both ends.

[0164] Preferred fluorescent detection groups are selected from the group consisting of FAM, VIC, JOE, TET, CY3, CY5, ROX, Texas Red, LCRED460, or combinations thereof.

[0165] Preferred quenching groups are selected from the group consisting of BHQ1, BHQ2, BHQ3, Dabcy1, Tamra, or a combination thereof.

[0166] The present invention provides a method for the above-mentioned fluorescence PCR amplification detection, which comprises the step of using a capture oligonucleotide to bind to the extension product of a target-specific primer.

[0167] Specifically, the method includes the steps of using a target-specific primer to bind to a target molecule and extend it (i.e., using a target-specific primer to bind to and extend the target molecule), using a capture oligonucleotide to bind to and extend the extension product of the target-specific primer (i.e., the extension product of the specific primer binds to and extends the capture oligonucleotide), and exponential amplification based on specific primers and universal primers.

[0168] Specifically, the method includes: (1) a target-specific primer binds to a target molecule with a clear 5' terminal sequence, and is extended under the action of a DNA polymerase, and finally terminates at the 5' terminal of the target molecule; (2) the extension product of the target-specific primer is complementary to a capture oligonucleotide, and is extended using the capture oligonucleotide as a template, and a sequence complementary to a universal sequence (universal primer 3s) is added to the 3' terminal of the extension product of the target-specific primer to obtain a final amplification product with the complementary sequences of the target-specific primer and the universal primer as the terminal, respectively; (3) the target-specific primer and the universal primer perform exponential amplification using the final amplification product as a template. The amplification optionally further includes the use of a probe.

[0169] In a specific embodiment of the present invention, the methylation sites in the sequence of Septine 9 gene as described in SEQ ID NO: 5 are detected by the following method:

[0170] The target-specific primer shown in SEQ ID NO:3 is contacted with the cfDNA digested with GlaI, SEQ ID NO:3 is complementary to the target molecule 1 shown in SEQ ID NO:15, and is extended under the action of DNA polymerase, and finally terminated at the 5' end of the target molecule to obtain the extension product of the target-specific primer; the extension product of the target-specific primer is complementary to the capture oligonucleotide shown in SEQ ID NO:1 or 6 or 8 or 12, and is extended using the capture oligonucleotide as a template, and a sequence complementary to the universal sequence is added to the 3' end of the extension product of the target-specific primer to obtain a final amplification product with the complementary sequence of the target-specific primer and the universal sequence as the end respectively; finally, the universal primer shown in SEQ ID NO:2 and the target-specific primer shown in SEQ ID NO:3 or 9 or 13 and the probe shown in SEQ ID NO:4 or 7 or 10 are used to amplify and detect the probe signal.

[0171] The main advantages of the present invention include:

[0172] Compared with the existing methylation detection technology based on bisulfite conversion, the present invention has the following beneficial effects:

[0173] (1) The methylation detection technology of the present invention does not require complicated chemical treatment, purification and other processes. In the scheme of the present invention, only the 5' end mediated by the methylation site can trigger amplification, thereby improving the specificity of amplification.

[0174] (2) The capture oligonucleotides and universal primers in the present invention are specially designed. When the target molecule exists in the environment, the extension reaction mediated by the capture oligonucleotide can be triggered, and the signal can be amplified through subsequent exponential amplification to meet the sensitivity requirements for DNA methylation detection.

[0175] Compared with the existing methylation-dependent restriction endonuclease technology (ZL 202111389443.0 and Nucleic Acids Res. 2013; 41(1): e15.), the present invention has the following beneficial effects:

[0176] (1) The amplification method described in the present invention only requires a simple-designed specific capture oligonucleotide with a nucleic acid extension blocking modification at the 3' end and a universal primer to detect methylation. Compared with the comparative document (ZL 202111389443.0), this unique design structure requires 3 or 4 fragments with different functions and modifications for the capture oligonucleotide involved in the comparative document; while the capture oligonucleotide involved in the present invention only includes a universal sequence and a binding capture sequence from the 5' to the 3' end, and no connector modification is required in the middle. This design not only makes the design of the capture oligonucleotide simpler, but also makes the corresponding amplification process and principle simpler and clearer. It avoids the step of forming a complete hairpin structure extension product required in the amplification process in the comparative document, and also avoids the process of USER enzyme treatment required during the amplification process, thereby improving the amplification efficiency.

[0177] (2) Compared with the reference document (Nucleic Acids Res. 2013; 41(1): e15.), the present invention not only avoids the effect that the reference document requires multiple cycles to perform a round of amplification, but also can directly utilize the high efficiency of specific primer extension and the specificity of the specific extension product produced thereby, thereby improving the efficiency of amplification and the sensitivity of detection; in addition, the application of universal primers reduces the need for helpers compared with the reference document, and can make the amplification process more efficiently enter the exponential amplification stage, thereby improving the overall amplification efficiency.

[0178] (3) When the present invention performs methylation detection on different target molecules, it is only necessary to design the binding capture sequence portion of the specific capture oligonucleotide according to the target molecule, while keeping the universal primer portion unchanged, thereby reducing the interference between multiple primers that is prone to occur during the amplification of multiple target molecules and improving the sensitivity of the reaction, thereby realizing methylation detection of multiple target molecules.

[0179] The detection method, detection system and kit provided by the invention are further described below in conjunction with specific embodiments.

[0180] It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention. The experimental methods in the following examples that do not specify detailed conditions are usually based on conventional conditions such as the conditions described in "Molecular Cloning Laboratory Guide" by Sambrook.J, USA (Huang Peitang, etc., Beijing: Science Press, 2002), or according to the conditions recommended by the manufacturer (e.g., product instructions). Unless otherwise specified, percentages and parts are calculated by weight. The experimental materials and reagents used in the following examples can be obtained from commercial channels or can be prepared according to literature methods unless otherwise specified.

[0181] Example 1: DNA methylation detection of human Septine 9 gene based on the amplification principle of the capture oligonucleotide designed by the present invention

[0182] (1) Obtain methylated Jurka genomic DNA and sequence to identify the methylation status of the Septine 9 gene.

[0183] (2) By ultrasonic treatment of methylated Jurka genomic DNA, fragmented DNA with a fragment size of about 150 bp was obtained.

[0184] (3) The DNA treated with ultrasonic fragments was digested with methylation-dependent restriction endonuclease GlaI. The reaction system was: 1× digestion buffer, 10 U GlaI, extracted DNA, and a total volume of 10 μL. The reaction conditions were incubation at 37°C for 1 hour. After the digestion reaction was completed, the system was heated to 85°C and incubated for 10 minutes to heat inactivate GlaI.

[0185] (4) Septine 9 gene capture oligonucleotide and universal primers were added to the above enzyme digestion system for amplification. The reaction system was: ultrasonic fragmented DNA after digestion, 5 nM capture oligonucleotide, 0.5 U Taq DNA polymerase, 200 μM dNTPs, 2.5 mM MgCl2 and 1X PCR buffer, with a final volume of 20 μl; the PCR reaction program was pre-denaturation at 95°C for 3 min; 94°C for 10 s, 66°C for 90 s, 5 cycles; 95°C for 10 s, 65°C for 20 s, 40 cycles; real-time fluorescence PCR was performed on a ROCHE instrument (480) and the corresponding fluorescence values ​​were collected.

[0186] The combinations of capture oligonucleotides, specific primers, universal primers, and specific probes used include:

[0187] Capture oligonucleotide (2' methoxy modified bases in italics)

[0188]

[0189] Universal primer

[0190] ACGCTCACGCTCGCTGCTAC(SEQ ID NO:2)

[0191] Target-specific primers

[0192] GCGACCCGCTGCCCAC (SEQ ID NO: 3)

[0193] Specific probe

[0194] 5'FAM-ACCAGCCATCATGTCGGAC-MGB(SEQ ID NO:4)

[0195] The partial sequence of human Septine 9 gene is as follows: / / indicates the restriction site, and the CG before and after it indicates the methylation site.

[0196] ATCCCATCCAGCTGCGC / / GTTGACCGCGGGGTCCGACATGATGGCTGGTGGGCAGCGGGTCGC / / GCGGAGGGC (SEQ ID NO: 5, wherein positions 18 to 62 are the target molecule 1 sequence, and the target molecule 1 sequence number is SEQ ID NO: 15)

[0197] The 3' end of the capture oligonucleotide has Spacer C3 to block extension. Figure 1 This indicates that the present invention has good specificity for methylation detection of Septine 9 gene.

[0198] Example 2: Sensitive detection of DNA methylation of human Septine 9 gene based on the amplification principle of the capture oligonucleotide designed by the present invention

[0199] (1) Obtain methylated Jurka genomic DNA and sequence to identify the methylation status of the Septine 9 gene.

[0200] (2) By ultrasonic treatment of methylated Jurka genomic DNA, fragmented DNA with a fragment size of about 150 bp was obtained.

[0201] (3) The DNA fragmented by ultrasonic treatment was digested with the methylation-dependent restriction endonuclease GlaI. The reaction system was: 1× digestion buffer, 10 U GlaI, ultrasonic fragmented DNA, and a total volume of 10 μL. The reaction conditions were incubation at 37°C for 1 hour. After the digestion reaction was completed, the system was heated to 85°C and incubated for 10 minutes to heat inactivate GlaI.

[0202] (4) Septine 9 gene capture oligonucleotide and universal primers were added to the above enzyme digestion system for amplification. The reaction system was: ultrasonic fragmented DNA after digestion, 5 nM capture oligonucleotide, 0.5 U Taq DNA polymerase, 200 μM dNTPs, 2.5 mM MgCl2 and 1X PCR buffer, with a final volume of 20 μl; the PCR reaction program was pre-denaturation at 95°C for 3 min; 94°C for 10 s, 66°C for 90 s, 5 cycles; 95°C for 10 s, 65°C for 20 s, 40 cycles; real-time fluorescence PCR was performed on a ROCHE instrument (480) and the corresponding fluorescence values ​​were collected.

[0203] Capture oligonucleotide (2' methoxy modified bases in italics)

[0204]

[0205] Universal primer

[0206] ACGCTCACGCTCGCTGCTAC(SEQ ID NO:2)

[0207] Target-specific primers

[0208] GCGACCCGCTGCCCAC (SEQ ID NO: 3)

[0209] Specific probe

[0210] 5'FAM-ACCAGCCATCATGTCGGAC-MGB(SEQ ID NO:4)

[0211] The partial sequence of human Septine 9 gene is as follows: / / indicates the restriction site, and the CG before and after it indicates the methylation site.

[0212] ATCCCATCCAGCTGCGC / / GTTGACCGCGGGGTCCGACATGATGGCTGGTGGGCAGCGGGTCGC / / GCGGAGGGC (SEQ ID NO: 5, wherein positions 18 to 62 are the target molecule 1 sequence, and the target molecule 1 sequence number is SEQ ID NO: 15)

[0213] The 3' end of the capture oligonucleotide has Spacer C3 to block extension. Figure 2 This indicates that the present invention has good specificity for detecting the methylation of Septine 9 gene in ultrasonically fragmented DNA.

[0214] Example 3: Experiments with different probe selections

[0215] In order to improve the flexibility of capture oligonucleotide detection, this embodiment selected a universal probe sequence added between the universal primer sequence of the capture oligonucleotide and the binding capture sequence. Other universal primers used were the same as those in Example 1, and the enzyme digestion conditions and amplification conditions were the same as those in Example 1.

[0216] Capture oligonucleotide (2' methoxy modified bases in italics)

[0217]

[0218] Universal primer

[0219] ACGCTCACGCTCGCTGCTAC(SEQ ID NO:2)

[0220] Target-specific primers

[0221] GCGACCCGCTGCCCAC (SEQ ID NO: 3)

[0222] Universal probe

[0223] 5'FAM-CGATGGCTGAGGATTCTG-MGB(SEQ ID NO:7)

[0224] The partial sequence of human Septine 9 gene is as follows: / / indicates the restriction site, and the CG before and after it indicates the methylation site.

[0225] ATCCCATCCAGCTGCGC / / GTTGACCGCGGGGTCCGACATGATGGCTGGTGGGCAGCGGGTCGC / / GCGGAGGGC (SEQ ID NO: 5, wherein positions 18 to 62 are the target molecule 1 sequence, and the target molecule 1 sequence number is SEQ ID NO: 15)

[0226] like Figure 3 As shown, using the capture oligonucleotide containing the universal probe sequence, amplification curves appeared in the detection of 2000 copies, 200 copies, and 20 copies of methylation-positive genomic DNA, showing positive results, indicating that the use of the universal probe sequence can achieve highly sensitive methylation detection.

[0227] Example 4: Detection of hypomethylation of human LINE-1 gene based on the amplification principle of capture oligonucleotides without enzyme recognition tags

[0228] (1) Obtain HELA genomic DNA and sequence to identify the methylation status.

[0229] (2) DNA was digested with methylation-sensitive restriction endonuclease HinP1I. The reaction system was: 1× digestion buffer, 10 U HinP1I, genomic DNA, and the total volume was 10 μL. The reaction conditions were incubation at 37°C for 1 hour.

[0230] (3) The capture oligonucleotide and universal primer of the treated gene were added to the above enzyme digestion system for amplification. The reaction system was: genomic DNA after digestion, 5nM capture oligonucleotide, 0.5U Taq DNA polymerase, 200μM dNTPs, 2.5mM MgCl2 and 1X PCR buffer, with a final volume of 20μl; the PCR reaction program was pre-denaturation at 95℃ for 3min; 94℃ for 10s, 66℃ for 90s, 5 cycles; 95℃ for 10s, 65℃ for 20s, 40 cycles; real-time fluorescence PCR was performed on a ROCHE instrument (480) and the corresponding fluorescence values ​​were collected.

[0231] The combinations of capture oligonucleotides, specific primers, universal primers, and specific probes used include:

[0232] Capture oligonucleotide (2' methoxy modified bases in italics)

[0233]

[0234] Target-specific primers

[0235] CAGGTGCGACCGGTCACC(SEQ ID NO:9)

[0236] Universal primer

[0237] ACGCTCACGCTCGCTGCTAC(SEQ ID NO:2)

[0238] Target-specific probes

[0239] 5'FAM-GAGTTCCTTTCTGAGTCA-MGB(SEQ ID NO:10)

[0240] The partial sequence of the human LINE-1 gene is as follows: / / indicates the restriction site, and the CG before and after it indicates the methylation site.

[0241] CGAGGCATTGCCTCACCTGGGAAG / / CGCAAGGGGTCAGGGAGTTCCCTTTCTGAGTCAAAGAAAGGGGTGACCGGTCGCACCTGGAAAATCGG(SEQ ID NO:11)

[0242] The 3' end of the capture oligonucleotide has Spacer C3 to block extension. Figure 4 This indicates that the results of the detection can be based on the non-methylated state based on the methylation-sensitive restriction endonuclease treatment.

[0243] Example 5: m6A modification on RNA based on the present invention

[0244] (1) Obtain relevant RNA.

[0245] (2) Prepare the reaction system: 2.5 μl of specific capture primer (initial concentration is 0.4 μM), 8 U Bst 2.0 DNA polymerase, final concentration is 1×Isothermal Amplification Buffer (containing 20 mM Tris-HCl, 10 mM (NH4)2SO4, 50 mM KCl, 2 mM MgSO4 and 0.1% Tween 20, pH 8.8), 6 mM MgSO4, 0.4 mM dNTPs, add 2.5 μl of RNA template of appropriate concentration, and finally make up to 25 μl with enzyme-free water. After mixing well, place the reaction system in a common PCR instrument, and the reaction program is 60°C for 30 min, 80°C for 20 min, and inactivate Bst 2.0 DNA polymerase. The final reaction solution is stored at 4°C for use.

[0246] (3) The capture oligonucleotide and universal primer of the treated gene were added to the above-mentioned enzyme digestion system for amplification. The reaction system was: the Mycobacterium tuberculosis genome after digestion, 5 nM capture oligonucleotide, 0.5 U Taq DNA polymerase, 200 μM dNTPs, 2.5 mM MgCl2 and 1X PCR buffer, with a final volume of 20 μl; the PCR reaction program was pre-denaturation at 95°C for 3 min; 94°C for 10 s, 66°C for 90 s, 5 cycles; 95°C for 10 s, 65°C for 20 s, 40 cycles; real-time fluorescence PCR was performed on a ROCHE instrument (480) and the corresponding fluorescence values ​​were collected.

[0247] The combinations of capture oligonucleotides, specific primers, universal primers, and specific probes used include:

[0248] Capture oligonucleotide (2' methoxy modified bases in italics)

[0249]

[0250] Universal primer

[0251] ACGCTCACGCTCGCTGCTAC(SEQ ID NO:2)

[0252] Target-specific primers

[0253] AATCCTTCCGCAGGTTCAC(SEQ ID NO:13)

[0254] Universal probe

[0255] 5'FAM-CGATGGCTGAGGATTCTG-MGB(SEQ ID NO:7)

[0256] The partial sequence of 18S rRNA m6A-1832 is as follows: m6A is the methylation position.

[0257]

[0258] The 3' end of the capture oligonucleotide has Spacer C3 to block extension. Figure 5 This indicates that the present invention can detect m6A modification at specific sites on RNA.

[0259] Those skilled in the art will readily appreciate other embodiments of the present invention after considering the specification and practicing the invention disclosed herein. This application is intended to cover any variations, uses or adaptations of the present invention, which follow the general principles of the present invention and include common knowledge or customary techniques in the art that are not disclosed by the present invention. The specification and examples are intended to be exemplary only, and the true scope and spirit of the present invention are indicated by the appended claims.

Claims

1. A capture oligonucleotide for nucleic acid amplification, characterized in that: The capture oligonucleotide includes: a universal sequence and a binding capture sequence from the 5' end to the 3' end; wherein, (1) the binding capture sequence is at least partially identical to the 5' end sequence of the target molecule, and (2) The capture oligonucleotide further comprises a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence.

2. The capture oligonucleotide according to claim 1, characterized in that The capture oligonucleotide also includes a nucleic acid analog modification; Preferably, (3) the 3' end of the binding capture sequence is modified with a nucleic acid analog.

3. The capture oligonucleotide according to claim 1, characterized in that The nucleic acid extension blocking modification is selected from the following group: Spacer, amino, C6, methyl, azide, phosphoramidite, alkyne, DBCO, biotin, digoxigenin, puromycin, methylene blue, azobenzene, locked nucleic acid, 5-nitroindole, inverted base, or a combination thereof.

4. The capture oligonucleotide according to claim 2, wherein The nucleic acid analog modification is selected from the following group: peptide nucleic acid, locked nucleic acid, transposed base, Spacer, 2'-O, 4'-C-methylated bridging RNA, 2'-methoxy modified base, 2'-O-methyl RNA, deoxyuridine, 2-fluoro RNA, 2'-fluoro RNA, or a combination thereof.

5. A composition or kit for nucleic acid amplification, characterized in that: The composition or kit comprises the capture oligonucleotide according to any one of claims 1-4.

6. The composition or kit according to claim 5, characterized in that The composition or kit also includes a target molecule pre-sequence pretreatment reagent to obtain a target molecule with a clear 5' end sequence; Preferably, the pretreatment reagent comprises a methylation-dependent restriction endonuclease, a methylation-sensitive restriction endonuclease, a nickase, a CRISPR-Cas system, a mismatch repair enzyme, or a combination thereof.

7. A nucleic acid detection system, characterized in that: The detection system comprises the capture oligonucleotide according to any one of claims 1 to 4 or the composition or kit according to claim 5.

8. The nucleic acid detection system according to claim 7, characterized in that: The detection system also includes universal primers, target-specific primers and probes.

9. A method for amplifying or detecting nucleic acid for non-diagnostic purposes, characterized in that: The method comprises the step of using a capture oligonucleotide to bind to an extension product of a target-specific primer, wherein the capture oligonucleotide is as described in claim 1.

10. The method according to claim 9, characterized in that Includes steps: (a) using a target-specific primer to bind to the target molecule and extend it; (b) using a capture oligonucleotide to bind to and extend the extension product of the target-specific primer; (c) exponential amplification based on target-specific primers and universal primers; Wherein, the capture oligonucleotide is the capture oligonucleotide according to any one of claims 1-4.

Images