Preparation method of light-regulated single-stranded DNA and application of light-regulated single-stranded DNA in CRISPR nucleic acid detection

Abstract

The invention discloses a preparation method of light-regulated single-stranded DNA and application of the light-regulated single-stranded DNA in CRISPR nucleic acid detection. According to the invention, Lambda excision enzyme and a primer modified with PC-Linker are introduced into a detection system based on RPA-CRISPR / Cas12a, and a one-tube nucleic acid detection system without PAM limitation is constructed. By introducing Lambda excision enzyme, the strict dependence of the traditional CRISPR / Cas12a detection technology on PAM sites is broken through, and the application range of the CRISPR / Cas12a detection technology is remarkably widened. And the system is integrated into one-tube detection, so that the risk of aerosol pollution caused by opening a cover for multiple times and transferring a sample is avoided while the experimental operation process is simplified. According to the research, CRISPR / Cas12a and CRISPR / Cas13a are further integrated into a single-tube reaction system, so that the probability of false negative results is reduced in a double-gene detection manner, and the detection accuracy is improved.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering, and in particular to a method for preparing light-regulated single-stranded DNA and its application in CRISPR nucleic acid detection. Background Art

[0002] The CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) system is an adaptive immune mechanism of prokaryotes (such as bacteria and archaea) that resists invasion by recognizing and cleaving foreign genetic material (such as phage DNA). Nucleic acid detection methods based on the CRISPR system have become emerging tools in the field of nucleic acid detection due to their high specificity and signal amplification capabilities. In recent years, due to the precise, efficient and programmable nucleic acid targeting and cleavage capabilities of the CRISPR-Cas system, current CRISPR-Cas systems, such as the CRISPR-Cas12 system and the CRISPR-Cas13 system, have been widely used in the field of in vitro nucleic acid diagnosis.

[0003] The field of clinical testing based on the CRISPR system often faces the problem of trace amounts of target nucleic acids. The detection sensitivity of the CRISPR-Cas system alone is far from meeting the requirements, so the integration of the nucleic acid amplification step has become an effective means to improve its detection sensitivity. The pre-amplification step in the traditional two-step detection method prolongs the detection time and the opening link is prone to aerosol contamination, which limits the application of the traditional two-step method for instant detection. In order to overcome this limitation, the one-pot technology came into being. This technology integrates nucleic acid amplification and CRISPR detection in a single test tube, simplifying the process and avoiding aerosol contamination. However, it is not easy to effectively integrate the CRISPR system with the amplification reaction. The target site of the CRISPR system is usually within the amplification area, resulting in the amplification template being cut before the amplification starts or during the amplification. This compatibility challenge has become a key obstacle to promoting the application of CRISPR detection technology. In existing one-tube CRISPR detection technologies, the physical isolation strategy utilizes spatial structures or multiphase systems to construct separate areas within a single reactor, enabling the independent conduct of nucleic acid amplification and CRISPR cleavage reactions, thereby preventing the cleavage reaction from interfering with the amplification process, thereby ensuring the effective accumulation of target nucleic acids during the amplification phase and improving detection sensitivity. Another type of strategy focuses on the dynamic regulation of the cleavage activity of the CRISPR system, such as achieving cleavage activity and kinetic regulation of Cas protein activity through modified guide RNA. This approach inhibits the cleavage activity of the Cas protein during the amplification phase, ensuring efficient target amplification, and then reactivates the cleavage activity during the detection phase, solving the compatibility issue between amplification and detection.

[0004] In addition to the compatibility issues of single-tube reactions, the widespread application of CRISPR molecular diagnostics still faces several key challenges. For example, in traditional single-tube nucleic acid detection techniques, the widely used Cas12a system is highly dependent on the TTTN PAM site for recognition of dsDNA targets. The PAM motif, consisting of the "TTTN" sequence, is a prerequisite for the Cas12a protein to bind and cleave its target. When the Cas12a complex detects the correct PAM sequence, it promotes dsDNA unwinding and hybridization with the crRNA. However, assuming a random and uniform distribution of nucleotides within the genome, the probability of finding a sequence like TTTN at any given location is only 1.17%. This limitation presents a significant disadvantage, making the design of detection targets for CRISPR systems less programmable. For example, in cancer liquid biopsies, the mutation sites in circulating tumor DNA (ctDNA) are highly random, and traditional CRISPR systems often fail to identify mutations due to PAM mismatches. However, PAM-independent systems can cover more mutation hotspots, improving early diagnosis capabilities. Therefore, developing CRISPR detection technologies without PAM site restrictions has become a key approach to breaking through current diagnostic bottlenecks.

[0005] Furthermore, existing molecular diagnostic technologies based on the indiscriminate trans-cleavage activity of the CRISPR system struggle to achieve multiplexed detection within a single tube, a capability crucial for the application of genetic testing. For example, in PCR, even when testing a single target gene, simultaneous detection of an internal reference gene is necessary to provide quality control and avoid false-negative results. However, most current molecular diagnostic technologies based on the CRISPR system can only detect a single gene in a single tube, a key limitation to their widespread application. Summary of the Invention

[0006] The purpose of the present invention is to overcome the shortcomings and deficiencies of the prior art and provide a method for preparing light-regulated single-stranded DNA.

[0007] Another object of the present invention is to provide the application of the above-mentioned method for preparing light-regulated single-stranded DNA in CRISPR nucleic acid detection.

[0008] The purpose of the present invention is achieved through the following technical solutions:

[0009] A method for preparing light-regulated single-stranded DNA comprises the following steps:

[0010] The primers modified with the photoresponsive group and the template sequence are mixed with the amplification system for amplification. Lambda exonuclease is added to the amplified product, and after mixing, the product is irradiated with UV light for digestion to obtain single-stranded DNA.

[0011] The photoresponsive group-modified primer is a primer with PC-Linker inserted before the 1st to 4th nucleotides.

[0012] Preferably, the 1st to 3rd nucleotides of the primer modified with the photoresponsive group are phosphorothioate-modified nucleotides.

[0013] Preferably, 1 to 3 LNA locked nucleic acids are inserted before the first nucleotide of the primer modified with the photoresponsive group.

[0014] Preferably, the sequence of the primer modified with the photoresponsive group is:

[0015] EBV F 1PC3 3PS:C*C*A*(PC-Linker)TCAATCACCTTGTCCTGTTTGACAACGC;

[0016] EBV R 3PS: C*G*G*ACACGATTCTTTAGCTCGTCGGCCAGCTG;

[0017] The nucleotides marked with * are phosphorothioate-modified nucleotides.

[0018] The template sequence is the nucleotide sequence of the gene contained in the Epstein-Barr virus.

[0019] The amplification system is a PCR amplification system or an RPA isothermal amplification system.

[0020] A one-tube detection method for PAM-free RPA assisted by light-controlled lambda exonuclease comprises the following steps:

[0021] The Cas protein, crRNA, fluorescent probe, Lambda exonuclease and reaction buffer are mixed to prepare reaction solution 1, and the primer modified with the photoresponsive group, A buffer and target are mixed to prepare reaction solution 2. After mixing reaction solution 1 and reaction solution 2, the mixture is placed in a PCR instrument for reaction. During the reaction, the mixture is taken out and irradiated with UV light, and then the mixture is placed in the PCR instrument again for reaction. The detection result is judged by detecting the fluorescence intensity.

[0022] The Cas protein is Cas12 protein or Cas13 protein; preferably at least one of LbCas12a protein or LbuCas13a protein.

[0023] The crRNA is a crRNA designed according to the target; preferably, it is a crRNA mix obtained by mixing 1 to 5 crRNAs designed according to the target.

[0024] Preferably, when the target is an EBV (Epstein-Barr virus) target, the crRNA is at least one of the nucleotide sequences shown in SEQ ID NO.6 to 11.

[0025] Preferably, when the target is the ACTB gene target, the crRNA is at least one of the nucleotide sequences shown in SEQ ID NOs. 23 to 27.

[0026] Preferably, when the target is MTB (Mycobacterium tuberculosis) target, the crRNA is at least one of the nucleotide sequences shown in SEQ ID NO.16 to 20.

[0027] The nucleotide sequence of the EBV target is shown in SEQ ID NO.1.

[0028] The nucleotide sequence of the MTB target is shown in SEQ ID NO.2.

[0029] The nucleotide sequence of the ACTB gene target is shown in SEQ ID NO.3.

[0030] The fluorescent probe is a fluorescent probe that emits fluorescence after being cut by the Cas protein; preferably Fam-BHQ1 or ROX-BHQ2.

[0031] The final concentration of the Lambda exonuclease in the reaction solution 1 is 0.08-1.7 U / μL.

[0032] The reaction buffer is a solution that can dissolve the reaction system and act as a buffer; preferably, it is Buffer 1 or NEBr1.1.

[0033] The photoresponsive group-modified primer is a primer in which a PC-Linker is inserted before the 1st to 4th nucleotides; preferably, the 1st to 3rd nucleotides of the photoresponsive group-modified primer are also modified with thiophosphate.

[0034] Preferably, when the target is the EBV gene, the primer modified with the photoresponsive group is:

[0035] EBV2 F2 1PC3 3PS: C*G*G*(PC-Linker)CCCTCCTTCCGTCAGTTCCAGGCCATCA;

[0036] EBV2 R2 3PS: A*A*G*GACCAAGTGGCCCGAGTAAGTGTCTCGC.

[0037] Preferably, when the target is the ACTB gene, the primer modified with the photoresponsive group is:

[0038] ACTB F 1PC3 3PS: G*A*A*(PC-Linker)CGGTGAAGGTGACAGCAGTCGGTTGGA;

[0039] ACTB R 3PS: A*G*A*GAAGTGGGGTGGCTTTTAGGATGGCAA.

[0040] Preferably, when the target is the IS6110 gene, the primer modified with the photoresponsive group is:

[0041] IS6110 F 1PC3 3PS: T*G*C*(PC-linker)GAGCCGTAGGCGTCGGTGACAAAGGCCACGTAG;

[0042] IS6110 R 3PS: T*C*C*GGCCACAGCCCGTCCCGCCGATCTCGTCCAGC.

[0043] The target is a nucleotide sequence containing a PAM site or not containing a PAM site; preferably at least one of the EBV gene, ACTB gene or IS6110 gene.

[0044] The period is taken out using UV light irradiation, the timing of removal is 5 to 30 minutes after the start of the PCR reaction; preferably 15 minutes.

[0045] The irradiation with UV light is irradiation with UV light for 1 to 2 minutes.

[0046] The present invention has the following advantages and effects compared to the prior art:

[0047] This paper develops a novel CRISPR-based nucleic acid detection method without PAM site restriction and integrates it into a one-tube nucleic acid detection technology. This paper introduces Lambda exonuclease and primers modified with PC-Linker into the RPA-CRISPR / Cas12a-based detection system, constructing a one-tube nucleic acid detection system without PAM restriction. The primer contains two modifications: a photoresponsive group and an optionally added steric hindrance group (such as thiophosphate, locked nucleic acid, etc.). The primer is used for isothermal amplification and hinders the nonspecific digestion of the DNA substrate (primer and amplicon) by the nuclease through the steric hindrance effect. After the RPA amplification is completed, the amplicon does not contain a 5' phosphorylated end when it is not light-excited, so that its enzyme activity is in an inhibited state. The photoresponsive group breaks after light excitation, relieving the inhibitory effect of the primer on the Lambda exonuclease and releasing the 5' phosphorylated end, activating the digestive activity of the Lambda exonuclease, digesting the double-stranded DNA into single-stranded DNA, thereby specifically activating the trans-cutting ability of CRISPR / Cas12a and avoiding the PAM site restriction of CRISPR / Cas12a. On this basis, the study further integrated the system into a one-tube method, thereby simplifying the experimental process and avoiding the risk of aerosol contamination.

[0048] Because the target recognition fragment does not contain the classic Cas12a PAM site TTTN, the cleavage activity of the CRISPR / Cas12a system is weak, and the amplification reaction is less affected by the cleavage reaction. After UV illumination, the amplicon is digested into single-stranded DNA, and the Cas12a cleavage activity is not restricted by the PAM site, enabling light-controlled regulation of the CRISPR / Cas12a one-tube assay and improving the efficiency of the one-tube assay.

[0049] In summary, this method overcomes the strict reliance of traditional CRISPR / Cas12a detection technology on PAM sites by introducing the Lambda exonuclease, significantly broadening its applicability. Furthermore, integrating this system into a single-tube assay simplifies the experimental workflow while avoiding the risk of aerosol contamination caused by multiple openings and sample transfers. This study further reduced the probability of false-negative results and improved detection accuracy by integrating CRISPR / Cas12a and CRISPR / Cas13a into a single-tube reaction system using dual-gene testing. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] Figure 1 This figure shows the results of an experiment evaluating the digestion of double-stranded DNA obtained by primers modified with different photoresponsive groups in the presence or absence of UV light using different concentrations of Lambda exonuclease.

[0051] Figure 2This figure shows the results of an experiment evaluating the digestion of double-stranded DNA obtained by primers modified with photoresponsive groups and different intersteric effect groups using different concentrations of Lambda exonuclease in the presence or absence of UV light.

[0052] Figure 3 This is an experimental result diagram for evaluating the efficiency and specificity of isothermal amplification of primers modified with different photoresponsive groups and different steric effect groups;

[0053] Figure 4 1 is a graph showing the experimental results of the one-tube light-regulated single-stranded DNA production and preparation combined with isothermal amplification as described in an embodiment of the present invention.

[0054] Figure 5 It is a Lambda exonuclease-assisted CRISPR / Cas12a two-step system component removal experiment;

[0055] Figure 6 This is a comparison experiment between the traditional CRISPR / Cas12a two-step method and the Lambda exonuclease-assisted PAM-free CRISPR / Cas12a two-step method;

[0056] Figure 7 This is a primer optimization experiment in the Lambda exonuclease-assisted PAM-free CRISPR / Cas12a one-tube detection system;

[0057] Figure 8 This is an experiment to optimize the Lambda exonuclease concentration in the Lambda exonuclease-assisted PAM-free CRISPR / Cas12a one-tube detection system;

[0058] Figure 9 This experiment optimizes the timing of UV irradiation in the Lambda exonuclease-assisted PAM-free CRISPR / Cas12a one-tube detection system.

[0059] Figure 10 It is a multiple crRNA optimization experiment in the Lambda exonuclease-assisted PAM-free CRISPR / Cas12a one-tube detection system;

[0060] Figure 11 It is a comparison of the detection limits of three detection methods (qPCR, NPOM light-controlled one-tube method, and Lambda exonuclease-assisted PAM-free one-tube method);

[0061] Figure 12 It is a one-tube CRISPR / Cas12a method that achieves PAM site-free asymmetric RPA amplification.

[0062] Figure 13This is a comparison of the detection efficiency of single-crRNA system and multiple-crRNA system in the Lambda exonuclease-assisted PAM-free CRISPR / Cas12a one-tube detection system;

[0063] Figure 14 It is a real sample test of Lambda exonuclease-assisted PAM-free CRISPR / Cas12a one-tube method;

[0064] Figure 15 Optimized reaction buffer for Lambda exonuclease-assisted PAM-free CRISPR / Cas13a one-tube assay.

[0065] Figure 16 The fluorescence signal and detection limit of the target of the gradient dilution detected by the Lambda exonuclease-assisted PAM-free CRISPR / Cas13a one-tube method are as follows;

[0066] Figure 17 It is a Lambda exonuclease-assisted PAM-free CRISPR / Cas13a one-tube method for actual sample detection;

[0067] Figure 18 It is the reaction buffer optimization of the Lambda exonuclease-assisted PAM-free Cas12 / Cas13a dual-gene one-tube detection system;

[0068] Figure 19 It is an orthogonality assessment of the Lambda exonuclease-assisted PAM-free Cas12 / Cas13a one-tube dual-gene detection system;

[0069] Figure 20 This is the actual sample detection of the Lambda exonuclease-assisted PAM-free Cas12 / Cas13a one-tube dual-gene detection system.

[0070] Figure 21 Schematic diagram of the principle of one-tube light-regulated single-stranded DNA production and preparation combined with isothermal amplification as described in Example 4 of the present invention DETAILED DESCRIPTION

[0071] The present invention will be described in further detail below with reference to the embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0072] If specific experimental conditions are not specified in the following embodiments, conventional experimental conditions or those recommended by the reagent company will generally be used. Materials and reagents used were commercially available unless otherwise specified.

[0073] Example 1

[0074] Regarding the effect of the number and position of the modified photoresponsive groups of the primers on the Lambda exonuclease digestion reaction, the following experiments were conducted in Example 1 of the present invention:

[0075] (1) Mix the PCR amplification system and primers to form reaction solution 1, and place it in a PCR instrument. The reaction solution 1 includes: 1× Premix Taq, 800nM forward primer, 800nM rear primer, and 1ng / μL template DNA. The remaining volume is made up to 250μL with RNase-free water. The solution is divided into 5 parts and placed in a PCR instrument. The PCR program is: 94℃ for 1min, followed by 98℃ for 10s, 59℃ for 5s, and 72℃ for 30s for 35 cycles, and finally 72℃ for 10min.

[0076] The primers used are as follows:

[0077] EBV F 1PC0: (PC-Linker)CCATCAATCACCTTGTCCTGTTTGACAACGC;

[0078] EBV F 1PC3:CCA(PC-Linker)TCAATCACCTTGTCCTGTTTGACAACGC;

[0079] EBV R: CGGACACGATCTTTAGCTCGTCGGCCAGCTG.

[0080] In the codes contained in the primers, PC is the primer sequence with a photoresponsive group, the prefix number is the number of modifications, and the suffix number represents the modification site. The specific modification position and the number of modification sites are detailed in the primer sequence.

[0081] The template DNA was a plasmid containing the Epstein-Barr virus EBV gene sequence, purchased from Beijing Qingke Biotechnology Co., Ltd., and the sequence was shown in SEQ ID NO.1.

[0082] (2) Take the PCR product, 1× loading buffer, and 1× Gel Red dye, mix them evenly, spot them into the wells of a 3% agarose gel, and use an electrophoresis instrument (Mupid One) at 135V for 30 minutes. Then use a gel imager to evaluate the quality of the PCR product. Then use a DNA Clean & Concentrator kit to recover and concentrate the PCR product. The recovered PCR product is quantified using Nanodrop-2000. After calculation, different volumes of DNA diluent are added to quantify the product to a uniform concentration. The target after uniform concentration is stored at -20°C.

[0083] (3) The recovered and quantified PCR products and Lambda exonuclease were prepared into reaction solution 2. The reaction solution was irradiated with UV light for 1 min and incubated at 37°C for 30 min. In reaction solution 2, the amounts of Lambda exonuclease were 5 U, 1 U, 0.2 U, 0.04 U, and 0.008 U, respectively, and the final concentration of the Lambda exonuclease reaction buffer was 1×.

[0084] (4) The reaction solution 2 was digested at 37°C for 30 min. After completion, the digestion product, 1× loading buffer, and 1× Gel Red dye were mixed evenly and spotted into the wells of a 3% agarose gel. Electrophoresis was performed at 135V for 30 min using an electrophoresis apparatus, and then the digestion product was imaged and evaluated using a gel imager.

[0085] The digestion results were analyzed by agarose gel electrophoresis. Figure 1 As shown in the results, the digestion efficiency gradually improved with increasing amounts of Lambda exonuclease. Lambda exonuclease preferentially targets double-stranded DNA with 5'-phosphorylated ends. While its activity against non-phosphorylated blunt-ended or 3'-overhanging DNA substrates was significantly reduced, it still exhibited some digestion activity. The brightness of the double-stranded DNA bands not exposed to UV light decreased compared to the untreated control, and single-stranded DNA bands were also generated, indicating that Lambda exonuclease also exhibited some digestion activity against double-stranded DNA not exposed to UV light.

[0086] Example 2

[0087] In order to evaluate the effect of the number and position of steric group modifications on the Lambda exonuclease digestion reaction, different modified primers were designed in this example to verify their effects. The specific steps were similar to those in Example 1, except that the primers used were replaced with the following primers:

[0088] EBV F 1PC3 3PS:C*C*A*(PC-Linker)TCAATCACCTTGTCCTGTTTGACAACGC;

[0089] EBV R 3PS: C*G*G*ACACGATTCTTTAGCTCGTCGGCCAGCTG;

[0090] EBV F 1PC3 LNA: LNA / LNA / CCA(PC-Linker)TCAATCACCTTGTCCTGTTTGACAACGC;

[0091] EBV R LNA: LNA / LNA / CGGACACGATCTTTAGCTCGTCGGCCAGCTG;

[0092] EBV F 1PC3 Digoxin:Dig / Dig / CCA(PC-Linker)TCAATCACCTTGTCCTGTTTGACAACGC;

[0093] EBV R Digoxin:Dig / Dig / CGGACACGATCTTTAGCTCGTCGGCCAGCTG;

[0094] EBV F 1PC3 C6 Biotin: Bio / Bio / CCA(PC-Linker)TCAATCACCTTGTCCTGTTTGACAACGC;

[0095] EBV R C6 Biotin: Bio / Bio / CGGACACGATTCTTTAGCTCGTCGGCCAGCTG.

[0096] Among the codes contained in the primers, PC is a primer sequence with a photoresponsive group, the prefix number is the number of modifications, and the suffix number represents the modification site. The code PS is a primer sequence with a phosphorothioate modification, the prefix number represents the number of modifications, LNA is a primer sequence with a locked nucleic acid modification, Digoxin is a primer sequence with a digoxigenin modification, and Biotin is a primer sequence with a biotin modification. In the sequence, * represents phosphorothioate modification, LNA represents locked nucleic acid modification, Dig represents digoxigenin modification, and Bio represents biotin modification. The specific modification positions and the number of modification sites are detailed in the table above.

[0097] The experimental results are as follows Figure 2 As shown in the figure, Biotin and Digoxin modification promoted the digestion of double-stranded DNA by Lambda exonuclease without UV irradiation, while PS and LNA modification effectively avoided the digestion of double-stranded DNA by Lambda exonuclease without UV irradiation.

[0098] Example 3

[0099] In order to verify the effect of the number and position of the modified photoresponsive groups and steric hindering groups of the primers on the isothermal amplification efficiency, the following experiment was conducted in Example 3 of the present invention:

[0100] (1) The isothermal amplification system and primers were mixed to form reaction solution 1, and incubated at 37°C for 30 minutes. In the reaction solution 1, the final concentration of the primers was 400 nM, and the final concentrations of the template DNA were 5, 50, 500, and 5000 aM, respectively. The isothermal amplification system includes isothermal amplification primers, isothermal amplification raw materials, reaction buffer, isothermal amplification enzyme, and amplification template. The primers used are all the primers in Examples 1 and 2.

[0101] (2) Mix the isothermal amplification product, 1× loading buffer, and 1× Gel Red dye evenly, spot it into the wells of a 3% agarose gel, and electrophorese it at 135V for 30 minutes. Then, use a gel imager to evaluate the quality of the isothermal amplification product.

[0102] The experimental results are as follows Figure 3 As shown, compared with the RPA amplification efficiency of the template 0 (control) group without modified primers, the primers with PC-Linker and other modified groups that prevent nonspecific digestion by Lambda exonuclease showed comparable amplification efficiency.

[0103] Example 4

[0104] The isothermal amplification reaction and Lambda exonuclease digestion reaction were integrated into one tube to verify their effectiveness. The specific experimental steps are as follows:

[0105] (1) The isothermal amplification system, primers, and Lambda exonuclease were mixed to prepare reaction solution 1, and incubated at 37°C for 30 minutes. In the reaction solution 1, the final concentration of the primers was 400 nM, the final concentration of the template DNA was 1 fM, and the final concentration of the Lambda exonuclease was 5 U. The no-enzyme control group did not add Lambda exonuclease, and the primers used were EBV F1PC3 3PS and EBV R 3PS in Example 2. After incubation, the light group irradiated the reaction solution with UV light for 1 minute and continued to incubate at 37°C for 30 minutes. The no-light group was not irradiated.

[0106] (2) The incubated product, 1× loading buffer, and 1× Gel Red dye were mixed evenly, spotted into the wells of a 3% agarose gel, and electrophoresed at 135V for 30 minutes. The quality of the single-stranded DNA product was then evaluated using a gel imager.

[0107] The experimental results are as follows Figure 4As shown, in the experimental group without illumination, the presence or absence of Lambda exonuclease had no significant effect on the amplification of double-stranded DNA. In the illumination group, after irradiating the reaction solution with UV light for 1 minute and incubating at 37°C for another 30 minutes, the brightness of the double-stranded DNA band decreased, and single-stranded DNA bands were generated, indicating that the isothermal amplification reaction and Lambda exonuclease digestion reaction are compatible in a single-tube system, thereby generating and preparing single-stranded DNA.

[0108] Example 5

[0109] The effectiveness of the light-controlled lambda exonuclease-mediated PAM-free CRISPR-Cas12 assay was verified by component depletion experiments. The specific steps are as follows:

[0110] (1) Preparation of dsDNA target: Refer to the method of step (1) of Example 1, except that the primers used are as follows:

[0111] EBV F: CCATCAATCACCTTGTCCTGTTTGACAACGC;

[0112] EBV R: CGGACACGATCTTTAGCTCGTCGGCCAGCTG.

[0113] (2) Evaluate and quantify according to the method of step (2) in Example 1.

[0114] (3) Cas12 protein, guide RNA (crRNA), FQ probe, target DNA, Lambda exonuclease and reaction buffer were mixed to prepare reaction solution 2. In the reaction solution 2: the final concentration of Cas12 protein was 1 μM, the final concentration of crRNA was 100 nM, the final concentration of FQ probe was 500 nM, 1 U Lambda exonuclease, the final concentration of target was 1 nM, and the final concentration of reaction buffer was 1×. The concentrations of each component in 1× reaction buffer were 5 mM NaCl, 15 mM MgCl2, 0.1% CA630, and 5 mM Tris-HCI (pH 9.0). The FQ probe used in this embodiment was FQC6 (purchased from Huzhou Hippo Biotechnology Co., Ltd., the same below), and the sequence was FAM-CCCCCC-BHQ1. The remaining control groups eliminated some components, and the specific reference can be made to Figure 5 The illumination group was irradiated with LED ultraviolet light for 1 min, centrifuged and placed in a real-time fluorescence quantitative PCR instrument to start the reaction.

[0115] EBV crRNA2:

[0116] UAAUUUCUACUAAGUGUAGAUACCUUGUCCUGUUUGACAAC.

[0117] (4) The reaction was carried out at 37° C. for 60 min. The fluorescence signal was collected using a Thermal Cycler Dice Real-Time System III, and the instrument collected the signal once every minute.

[0118] The experimental results are as follows Figure 5 As shown, when any key components or conditions are missing, the fluorescence intensity is low; when Lambda exonuclease and ultraviolet light are present at the same time, the fluorescence intensity is highest, and the fluorescence signal intensity is comparable to that when targeting ssDNA, indicating that the presence of Lambda exonuclease and ultraviolet light activates the trans-cleavage activity of LbCas12a.

[0119] Example 6

[0120] Using crRNA with classical PAM sites and non-classical PAM sites, the efficiency of nucleic acid detection of the traditional CRISPR / Cas12a two-step method and the Lambda exonuclease-assisted PAM-free CRISPR / Cas12a two-step method was compared, and the effectiveness of the present invention was verified.

[0121] 6.1 Traditional two-step detection

[0122] Refer to the experimental steps of the experimental group in Example 5, except that Lambda exonuclease is not added to reaction solution 2, and crRNA is replaced with the following crRNA, wherein crRNA1 is a crRNA involved in the classic PAM site:

[0123] EBV crRNA1:UAAUUUCUACUAAGUGUAGAUACAACGCCCUUCGCAAGUAC;

[0124] EBV crRNA2:UAAUUUCUACUAAGUGUAGAUACCUUGUCCUGUUUGACAAC;

[0125] EBV crRNA3:UAAUUUCUACUAAGUGUAGAUCAGAGACCGCUGACACGAGG;

[0126] EBV crRNA4:UAAUUUCUACUAAGUGUAGAUGGCUUCCAGAGGGCCCUUCU;

[0127] EBV crRNA5:UAAUUUCUACUAAGUGUAGAUAGUACGAUUCCGGCCAGGUG;

[0128] EBV crRNA6:UAAUUUCUACUAAGUGUAGAUCAGACAGCUGGCCGACGAGC.

[0129] 6.2 Lambda exonuclease-assisted two-step detection

[0130] Refer to the experimental steps of the experimental group in Example 5, except that the crRNA is replaced with the crRNA in 6.1.

[0131] 6.3 Experimental Results

[0132] The experimental results are as follows Figure 6 As shown, for the traditional two-step CRISPR / Cas12a method, crRNA1 at the classic PAM site produced a higher fluorescence signal in a short time, while the crRNAs at the other five non-classical PAM sites produced lower fluorescence signals (EBV crRNA2-6); for the Lambda exonuclease-assisted PAM-free CRISPR / Cas12a two-step system, all crRNAs quickly produced high fluorescence signals, realizing CRISPR / Cas12a detection without PAM site restriction, indicating the effectiveness of the present invention.

[0133] Example 7

[0134] 7.1 Experimental steps

[0135] Regarding primer optimization in the light-controlled Lambda exonuclease-assisted PAM-free CRISPR / Cas12a one-tube detection system, Example 3 of the present invention conducted the following experiments:

[0136] (1) Cas12 protein, crRNA, FQ probe, Lambda exonuclease and reaction buffer were mixed to prepare reaction solution 1. The reaction solution 1 included 1 μL of 10×NEB 2.1 buffer, 1 μL of 20 μM Fam-BHQ1 DNA probe, 1 μL of 2 μM crRNA (EBV crRNA2 in Example 5), 1 μL of 4 μM LbCas12a protein and 2 μL of 0.5U Lambda exonuclease.

[0137] (2) Prepare the RPA reaction solution. The RPA dry powder dissolution reaction solution 2 includes: 29.4 μL A buffer, 2 μL 10 μM front primer, 2 μL 10 μM back primer, 1.6 μL RNase-free water and 7.5 μL target (same as Example 5). The negative control group is 7.5 μL RNase-free water.

[0138] The primers used are as follows:

[0139] EBV2 F2 1PC0: (PC-Linker)CGGCCCTCCTTCCGTCAGTTCCAGGCCATCA;

[0140] EBV2 F2 1PC3: CGG(PC-Linker)CCCTCCTTCCGTCAGTTCCAGGCCATCA;

[0141] EBV2 F2 1PC3 3PS: C*G*G*(PC-Linker)CCCTCCTTCCGTCAGTTCCAGGCCATCA;

[0142] EBV2 R2: AAGGACCAAGTGGCCCGAGTAAGTGTCTCGC;

[0143] EBV2 R2 3PS: A*A*G*GACCAAGTGGCCCGAGTAAGTGTCTCGC.

[0144] The primer sets used were:

[0145] Primer set 1: EBV2 F2 1PC0 / EBV2 R2; Primer set 2: EBV2 F2 1PC3 / EBV2 R2; Primer set 3: EBV2 F2 1PC0 / EBV2 R23PS; Primer set 4: EBV2 F2 1PC3 / EBV2 R2 3PS; Primer set 5: EBV2 F2 1PC33PS / EBV2 R2 3PS.

[0146] (3) Divide reaction solution 2 into five portions, add 8.5 μL of each portion to the bottom of a fluorescent quantitative PCR tube, then add 6 μL of reaction solution 1 to one side of the tube wall, and add 0.5 μL of initiator B buffer to the other side of the tube wall. Mix the solution by centrifugation, then place it in a real-time fluorescent quantitative PCR instrument, Thermal Cycler Dice Real-Time System III, and react at 37°C for 90 minutes, collecting the fluorescent signal every minute. At the 30th minute of the reaction, pause the program, remove the eight-tube strip, and irradiate it with an LED ultraviolet lamp for 1 minute. Centrifuge it and place it in the real-time fluorescent quantitative PCR instrument to continue the reaction for 60 minutes.

[0147] 7.2 Experimental Results

[0148] Experimental results Figure 7As shown in the figure, the performance of different primer pairs varies, using the rate of increase of the fluorescence signal as the evaluation indicator. Primer pair 5 exhibits the best kinetic characteristics and achieves the best detection effect, confirming that the modification scheme of primer pair 5 is the optimal combination.

[0149] Example 8

[0150] The specific steps for optimizing the Lambda exonuclease concentration in the photoactivated Lambda exonuclease-assisted PAM-free CRISPR / Cas12a one-tube assay are as follows:

[0151] The experiment was conducted with reference to the experimental steps of Example 7, except that the amount of Lambda exonuclease added to reaction solution 1 was adjusted to 0.019-10 U, and the primers used were primer set 5 in Example 7.

[0152] The experimental results are as follows Figure 8 As shown in the figure, through the Lambda exonuclease concentration gradient experiment, the effect of different Lambda exonuclease concentrations on the one-tube reaction was evaluated by the level of fluorescence signal, and the optimal Lambda exonuclease concentration range was determined, namely 0.5U to 0.2U.

[0153] Example 9

[0154] The specific steps for optimizing the UV illumination timing in the light-controlled Lambda exonuclease-assisted PAM-free CRISPR / Cas12a one-tube detection system are as follows:

[0155] The experiment was conducted with reference to the experimental steps of Example 7, except that the timing of ultraviolet lamp irradiation in step (3) was adjusted to irradiation at 5, 10, 15, 20, and 30 minutes of reaction. The primers used were the same as those in Example 8, and the total PCR reaction time was 90 minutes.

[0156] The experimental results are as follows Figure 9 As shown in the figure, UV irradiation at 15 min can make the sensitivity of the detection system reach the highest level.

[0157] Example 10

[0158] The specific steps for optimizing multiple crRNAs in a one-tube, photoactivated lambda exonuclease-assisted PAM-free CRISPR / Cas12a assay are as follows:

[0159] The experiment was carried out with reference to the experimental steps of Example 9. The timing of ultraviolet lamp irradiation in step (3) was adjusted to take out and irradiate when the reaction reached 15 min. In addition, crRNA was replaced with a combination of different crRNAs. Among them, the single crRNA group included 1 μL 2 μM crRNA2, the 3crRNA group included 1 μL 2 μM 3crRNA Mix (666 nM each of EBV crRNA2, EBV crRNA4, and EBV crRNA6), and the 5crRNA group included 1 μL 2 μM 5crRNA Mix (400 nM each of EBV crRNA2, EBV crRNA3, EBV crRNA4, EBVcrRNA5, and EBV crRNA6).

[0160] The experimental results are as follows Figure 10 As shown, the use of three non-classical PAM site crRNAs did not significantly improve the detection efficiency compared to the traditional single crRNA system, while increasing the number of non-classical PAM site crRNAs to five significantly improved the detection efficiency.

[0161] Example 11

[0162] In this comparative example, the detection limits of three detection methods (qPCR, NPOM-mediated light-controlled one-tube method, and light-controlled Lambda exonuclease-assisted PAM-free one-tube method) were compared. The specific steps are as follows:

[0163] 11.1 qPCR

[0164] Takara quantitative PCR kit TB Premix Ex Taq TM Detection was performed using a PCR amplification reaction system containing 12.5 μL of TB Green Premix Ex Taq (Tli RNaseH Plus) (2X), 0.5 μL of forward primer, 0.5 μL of backward primer, 10 μL of RNase-free water, and 1.5 μL of target. The fluorescence quantitative PCR protocol was as follows: initial denaturation at 95°C for 30 seconds, followed by 40 cycles of 95°C for 5 seconds and 60°C for 30 seconds, with fluorescence signal acquisition at the 35th second. The primers and target used were the same as in Example 5.

[0165] 11.2 NPOM-mediated light-controlled one-tube method

[0166] The experiment was carried out with reference to the experimental steps of Example 7. The primers used were the same as those in Example 8, except that the crRNA was replaced with NPOM-modified crRNA. The specific sequences are as follows:

[0167] crRNA(NPOM):

[0168] UAAUUUCUACUAAGUGUAGAUACAACGCCCdt(NPOM)dt(NPOM)CGCAAGdt(NPOM)AC;

[0169] 11.3 Photoactivated Lambda exonuclease-assisted PAM-free one-tube method

[0170] The experiment was performed with reference to the experimental steps of Example 10, and the crRNA used included 1 μL of 2 μM 5crRNA Mix (400 nM each of EBV crRNA2, EBV crRNA3, EBV crRNA4, EBV crRNA5, and EBV crRNA6).

[0171] 11.4 Experimental Results

[0172] The experimental results are as follows Figure 11 As shown, the detection limit of the three methods is 1.6 copies; when the target concentration in the reaction system is 1.6 copies, in 20 detection reactions, the detection rate of the fluorescent dye qPCR method is 95%, the detection rate of the NPOM-modified crRNA light-controlled CRISPR / Cas12a one-tube method is 100%, and the detection rate of this method is 100%; when the target concentration in the reaction system is 0.8 copies, the detection rates of the three methods are 50%, 85% and 65%, respectively, indicating that the detection performance of the three methods is comparable.

[0173] Example 12

[0174] This example compares the asymmetric RPA amplification-mediated CRISPR / Cas12a one-tube method without PAM site restriction. The specific steps are as follows:

[0175] The experiment was carried out according to the experimental steps of Example 7, except that the primers used in step (2) were replaced by:

[0176] EBV2 F2: CGGCCCTCCTTCCGTCAGTTCCAGGCCATCA;

[0177] EBV2 R2: AAGGACCAAGTGGCCCGAGTAAGTGTCTCGC.

[0178] The detection limit of this method was compared with the previously reported CRISPR / Cas12a one-tube method that achieved no PAM site restriction through asymmetric RPA amplification. Figure 12As shown in the figure, under the premise of keeping the experimental conditions consistent, the detection limit of the CRISPR / Cas12a strategy without PAM site restriction achieved by asymmetric RPA amplification is only 80 copies, indicating that this method is far superior to the strategy of using asymmetric RPA amplification to achieve CRISPR / Cas12a one-tube method without PAM site restriction.

[0179] Example 13

[0180] In this example, the sensitivity of the single crRNA system and the multiple crRNA system in the light-controlled Lambda exonuclease-assisted PAM-free CRISPR / Cas12a one-tube detection system was compared. The specific experimental steps are as follows:

[0181] (1) The target nucleic acid for preparing dsDNA in this example is a plasmid containing a Mycobacterium tuberculosis (MTB) gene sequence (the sequence is shown in SEQ ID NO. 2). The experimental procedure for preparing the dsDNA target is the same as step (1) of Example 1. The primers used are as follows:

[0182] IS6110 F:TGCGAGCGTAGGCGTCGGTGACAAAGGCCACGTAG;

[0183] IS6110 R: TCCGGCCACAGCCCGTCCCGCCGATCTCGTCCAGC.

[0184] (2) The detection step was similar to that in Example 7, except that the primers were replaced with the following primers and the crRNAs were replaced with different crRNA combinations, wherein the single crRNA group included 1 μL of 2 μM IS6110 crRNA1, and the multi-crRNA group included 1 μL of 2 μM 5crRNA Mix (400 nM each of IS6110 crRNA1, IS6110 crRNA2, IS6110 crRNA3, IS6110 crRNA4, and IS6110 crRNA5).

[0185] IS6110 F 1PC3 3PS: T*G*C*(PC-linker)GAGCCGTAGGCGTCGGTGACAAAGGCCACGTAG;

[0186] IS6110 R 3PS: T*C*C*GGCCACAGCCCGTCCCGCCGATCTCGTCCAGC;

[0187] IS6110 crRNA1: UAAUUUCUACUAAGUGUAGAUCCACGUAGGCGAACCCUGCC;

[0188] IS6110 crRNA2: UAAUUUCUACUAAGUGUAGAUAAAGGCCACGTAGGCGAACC;

[0189] IS6110 crRNA3: UAAUUUCUACUAAGUGUAGAUCTGCTACCCACAGCCGGTTA;

[0190] IS6110 crRNA4: UAAUUUCUACUAAGUGUAGAUGAGCGTAGGCGTCGGTGACA;

[0191] IS6110 crRNA5: UAAUUUCUACUAAGUGUAGAUGCTGGTGGTCCGAAGCGGCG.

[0192] The experimental results are as follows Figure 13 As shown, this method successfully detected the target DNA, and the multiple crRNA strategy increased the detection limit of the single crRNA one-tube detection system from 7 copies to 1.4 copies.

[0193] Example 14

[0194] In this example, 40 actual clinical samples were collected from a group of patients suspected of Mycobacterium tuberculosis. Genomic DNA from these samples was extracted and purified. The actual MTB samples were tested using the photoactivated Lambda exonuclease-assisted PAM-free CRISPR / Cas12a one-tube method. The specific steps are as follows:

[0195] The experimental steps were similar to those in Example 13, except that the target was replaced with genomic DNA extracted from clinical samples, and the crRNA was 1 μL of 2 μM 5crRNA Mix.

[0196] In order to compare and verify the results, the extracted DNA samples were tested using the careTB PCR Assay Mycobacterium tuberculosis detection kit. It was finally determined that among the 40 samples, 12 samples were positive for Mycobacterium tuberculosis, while the remaining 28 samples were negative.

[0197] The experimental results are as follows Figure 14 As shown, this detection method showed highly consistent results with qPCR in the detection of Mycobacterium tuberculosis-positive samples, missing one suspected positive case (sample number 30, Ct of 39.26). However, samples with Ct values ​​greater than 35 are generally considered not to be infectious. All positive samples were successfully identified with a specificity of 100%.

[0198] Example 15

[0199] Regarding the optimization of the reaction buffer for the photoactivated Lambda exonuclease-assisted PAM-free CRISPR / Cas13a one-tube assay, the specific steps are as follows:

[0200] (1) The target nucleic acid for preparing dsDNA in this example is a plasmid containing the human actin (ACTB) gene sequence (the sequence is shown in SEQ ID NO. 3). The experimental procedure for preparing the dsDNA target is the same as step (1) of Example 1. The primers used are as follows:

[0201] ACTB F:GAACGGTGAAGGTGACAGCAGTCGGTTGGA;

[0202] ACTB R: AGAGAAGTGGGGTGGCTTTTAGGATGGCAA.

[0203] (2) Cas13 protein, crRNA, RQ probe, Lambda exonuclease and reaction buffer were mixed to prepare reaction solution 1. The reaction solution 1 includes 1 μL of Buffer shown in Table 11, 1 μL of 20 μM ROX-BHQ2 DNA probe, 1 μL of 2 μM crRNAMix (400 nM each of ACTB crRNA1, ACTB crRNA2, ACTB crRNA3, ACTB crRNA4, and ACTB crRNA5), 1 μL of 4 μM LbuCas13a protein and 2 μL of 0.5 U Lambda exonuclease. The reaction buffer used in this example and the concentration of each component are shown in Table 1:

[0204] Table 1 Components of different buffer formulas

[0205]

[0206] (3) Prepare the RPA reaction solution. The RPA dry powder dissolution reaction solution 2 includes: 29.4 μL A buffer, 2 μL 10 μM forward primer ACTB F 1PC3 3PS, 2 μL 10 μM rear primer ACTB R 3PS, 1.6 μL RNase-free water, and 7.5 μL target (negative control group: 7.5 μL RNase-free water).

[0207] (4) Follow the reaction and detection steps of Example 7.

[0208] The primers and crRNA sequences used in this example are as follows:

[0209] ACTB F 1PC3 3PS: G*A*A*(PC-Linker)CGGTGAAGGTGACAGCAGTCGGTTGGA;

[0210] ACTB R 3PS: A*G*A*GAAGTGGGGTGGCTTTTAGGATGGCAA;

[0211] ACTB crRNA1: GACCACCCCAAAAAUGAAGGGGACUAAAACUGAAGGUGACAGCAGUCGGUUGGAGCGA; ACTB crRNA2: GACCACCCCAAAAAUGAAGGGGACUAAAACGCAUCCCCCAAAGUUCACAAUGUGGCCG; ACTB crRNA3: GACCACCCAAAAUGAAGGGGACUAAAACAGGACUUUGAUUGCACAUUGUUGUUUUU; ACTBcrRNA4: GACCACCCCAAAAAUGAAGGGGACUAAAACUUAAUAGUCAUUCCAAAUAUGAGAUGC. ACTB crRNA5: GACCACCCAAAAUGAAGGGGACUAAAACGUUGUUACAGGAAGUCCCUUGCCAUCCU.

[0212] The experimental results are as follows Figure 15 The results showed that at the same target concentration, the Lambda exonuclease-assisted PAM-free CRISPR / Cas13a one-tube system exhibited high activity in Buffer 1 and NEBr 1.1 across all reaction buffers, without any nonspecific activation. NEB r1.1 Buffer was selected as the final optimized buffer for subsequent experiments.

[0213] Example 16

[0214] In this example, the detection limit of the light-controlled lambda exonuclease-assisted PAM-free CRISPR / Cas13a one-tube assay was tested. The specific steps are as follows:

[0215] The experiment was conducted with reference to the experimental steps of Example 15, except that NEBr1.1 Buffer was used in reaction solution 1. The difference was that the added target concentration was graded diluted to verify its detection limit.

[0216] The experimental results are as follows Figure 16As shown in the figure, by optimizing the reaction buffer and adopting a multiple crRNA strategy, we significantly improved the performance of the CRISPR / Cas13a one-tube detection system, and the final detection limit reached 6.6 copies, further improving the reliability and practicality of the method.

[0217] Example 17

[0218] In this example, the clinical samples obtained in Example 14 were used as targets, and the Lambda exonuclease-assisted PAM-free CRISPR / Cas13a one-tube method was used to detect actual samples of ATCB. The specific steps were as follows:

[0219] The experiment was conducted with reference to the experimental steps of Example 15. NEBr1.1 Buffer was used in reaction solution 1. The difference was that the added target was replaced with genomic DNA extracted from the clinical sample in Example 14.

[0220] In order to compare and verify the results, the extracted DNA samples were tested for the ACTB gene using fluorescent dye qPCR technology. It was finally determined that among the 40 samples, 38 samples were positive for the ACTB gene and 2 samples were negative, indicating that the sampling or DNA extraction of these two samples was unqualified.

[0221] The experimental results are as follows Figure 17 As shown, this method showed highly consistent results with qPCR in the detection of ACTB gene, successfully identifying all positive samples with a specificity of 100%.

[0222] Example 18

[0223] Regarding the optimization of the reaction buffer for the light-controlled Lambda exonuclease-assisted PAM-free Cas12 / Cas13a dual-gene one-tube detection system, the specific experimental procedures are as follows:

[0224] (1) Cas12a protein, Cas12a crRNA Mix, Cas13 protein, Cas13 crRNA Mix, FQ probe RQ probe, Lambda exonuclease and reaction buffer were mixed to prepare reaction solution 1. The reaction solution 1 includes 1.5 μL of 10 × buffer 1, 1 μL of 20 μM Rox-BHQ2 RNA probe, 1 μL of 2 μM Cas12a crRNA Mix, 1 μL of 4 μM LbCas13a protein, 1 μL of 20 μM Fam-BHQ1 DNA probe, 1 μL of 2 μM Cas13 crRNA Mix, 1 μL of 4 μM LbCas12a protein and 2 μL of 0.5U Lambda exonuclease. The different reaction buffers used in this embodiment and the concentrations of each component are shown in Table 1. Cas 12a crRNA is IS6110 crRNA in Example 13, and Cas13a crRNA is ACTB crRNA in Example 15.

[0225] (2) Referring to the reaction and detection steps of Example 10, the target dsDNA extracted in Examples 13 and 15 were detected using the primers in Examples 13 and 15, respectively.

[0226] The experimental results are as follows Figure 18 The results showed that the reaction systems exhibited optimal kinetic characteristics in Buffer 1, and the fluorescence signal growth rate of the two CRISPR systems was the highest, indicating that this buffer system can effectively coordinate the RPA amplification reaction and the activity requirements of the Cas protein.

[0227] Example 19

[0228] This example evaluates the orthogonality of a one-tube dual-gene detection system using a light-activated lambda exonuclease-assisted PAM-free Cas12 / Cas13a assay. The specific experimental procedures are as follows:

[0229] The reaction solution was prepared and the reaction and detection were carried out according to the steps of Example 18. The buffer used was Buffer 1 in Table 1. The difference was that in addition to using the primers in Example 13 and Example 15 to perform single-target detection on the target dsDNA extracted in Example 13 and Example 15, the two were combined to form a dual-target system for detection.

[0230] The cross-reactivity between the two subsystems was detected by setting up single-target independent reactions, dual-target mixed reactions and negative control experiments. Figure 19The results show that in the presence of a single target, only the corresponding CRISPR system is specifically activated, and the fluorescence signal intensity of the non-targeted system does not change significantly. When two targets coexist, the fluorescence intensity of the two detection channels is not significantly different from that of the single-target reaction group, indicating that the dual-gene detection system has good compatibility in Buffer 1, confirming that the system can still maintain strict specificity under mixed reaction conditions, and no nonspecific interactions are generated between the reactions.

[0231] Example 20

[0232] This example is a real sample test of the PAM-free Cas12 / Cas13a one-tube dual-gene detection system assisted by light-controlled Lambda exonuclease. The specific steps are as follows:

[0233] The experiment was performed with reference to the dual-target detection experimental steps of Example 19, except that the target was the genomic DNA extracted from the clinical sample in Example 14.

[0234] The experimental results are as follows Figure 20 As shown in the figure, in the IS6110 target detection, 12 cases were positive, 28 cases were negative, and 1 suspected positive case was missed (sample number 30, Ct was 39.26). The results of the ACTB gene test showed that 38 cases were positive and 2 cases were negative, indicating that there were problems with sampling or nucleic acid extraction failure in 2 samples. Based on the ROC curve analysis, the AUC of this platform in IS6110 and ACTB detection were 0.97 and 1.00, respectively, indicating that it has excellent diagnostic performance. Although this platform failed to detect extremely low copy samples with a Ct value of 39.26, samples with a Ct value greater than 35 are generally considered to be non-infectious. Therefore, on the whole, this method can basically meet the needs of clinical sample testing.

[0235] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. A method for preparing light-regulated single-stranded DNA, characterized in that The steps include: The primers modified with the photoresponsive group and the template sequence are mixed with the amplification system for amplification. Lambda exonuclease is added to the amplified product, and after mixing, the product is irradiated with UV light for digestion to obtain single-stranded DNA.

2. The method for preparing light-regulated single-stranded DNA according to claim 1, wherein: The photoresponsive group-modified primer is a primer with a PC-Linker inserted before the 1st to 4th nucleotides; The first to third nucleotides of the photoresponsive group-modified primer are phosphorothioate-modified nucleotides or 1 to 3 LNA locked nucleic acids are inserted before the first nucleotide.

3. The method for preparing light-regulated single-stranded DNA according to claim 1, wherein: The sequence of the primer modified with the photoresponsive group is: EBV F 1PC3 3PS:C*C*A*(PC-Linker)TCAATCACCTTGTCCTGTTTGACAACGC; EBV R 3PS: C*G*G*ACACGATTCTTTAGCTCGTCGGCCAGCTG; The nucleotides marked with * are phosphorothioate-modified nucleotides; The template sequence is the nucleotide sequence of the Epstein-Barr virus EBV gene.

4. The method for preparing light-regulated single-stranded DNA according to claim 1, wherein: The amplification system is a PCR amplification system or an RPA isothermal amplification system.

5. A light-controlled lambda exonuclease-assisted PAM-free RPA one-tube detection method, characterized in that The steps include: The Cas protein, crRNA, fluorescent probe, Lambda exonuclease and reaction buffer are mixed to prepare reaction solution 1, and the primer modified with the photoresponsive group, A buffer and target are mixed to prepare reaction solution 2. After mixing reaction solution 1 and reaction solution 2, the mixture is placed in a PCR instrument for reaction. During the reaction, the mixture is taken out and irradiated with UV light, and then the mixture is placed in the PCR instrument again for reaction. The detection result is judged by detecting the fluorescence intensity.

6. The light-controlled lambda exonuclease-assisted PAM-free RPA one-tube detection method according to claim 1, characterized in that: The Cas protein is Cas12 protein or Cas13 protein; The crRNA is designed according to the target.

7. The light-controlled lambda exonuclease-assisted PAM-free RPA one-tube detection method according to claim 1, characterized in that: When the target is an EBV target, the crRNA is at least one of the nucleotide sequences shown in SEQ ID NOs. 6 to 11; When the target is the ACTB gene target, the crRNA is at least one of the nucleotide sequences shown in SEQ ID NOs. 23 to 27; When the target is an MTB target, the crRNA is at least one of the nucleotide sequences shown in SEQ ID NOs. 16 to 20.

8. The light-controlled lambda exonuclease-assisted PAM-free RPA one-tube detection method according to claim 1, characterized in that: The fluorescent probe is a fluorescent probe that emits fluorescence after being cut by the Cas protein; The final concentration of the Lambda exonuclease in reaction solution 1 is 0.08-1.7 U / μL; The reaction buffer solution is a solution that can dissolve the reaction system and play a buffering role.

9. The light-controlled lambda exonuclease-assisted PAM-free RPA one-tube detection method according to claim 1, characterized in that: The photoresponsive group-modified primer is a primer with a PC-Linker inserted before the 1st to 4th nucleotides; The 1st to 3rd nucleotides of the photoresponsive group-modified primer are modified with phosphorothioate; When the target is the EBV gene, the primer modified with the photoresponsive group is: EBV2 F2 1PC3 3PS: C*G*G*(PC-Linker)CCCTCCTTCCGTCAGTTCCAGGCCATCA; EBV2 R2 3PS: A*A*G*GACCAAGTGGCCCGAGTAAGTGTCTCGC; When the target is the ACTB gene, the primer modified with the photoresponsive group is: ACTB F 1PC3 3PS: G*A*A*(PC-Linker)CGGTGAAGGTGACAGCAGTCGGTTGGA; ACTB R 3PS: A*G*A*GAAGTGGGGTGGCTTTTAGGATGGCAA; When the target is the IS6110 gene, the primer modified with the photoresponsive group is: IS6110 F 1PC3 3PS: T*G*C*(PC-linker)GAGCGTAGGCGTCGGTGACAAAGGCCACGTAG; IS6110 R 3PS: T*C*C*GGCCACAGCCCGTCCCGCCGATCTCGTCCAGC; The nucleotides marked with * are phosphorothioate-modified nucleotides; The target is at least one of the EBV gene, the ACTB gene or the IS6110 gene.

10. The light-controlled lambda exonuclease-assisted PAM-free RPA one-tube detection method according to claim 1, characterized in that: During the above period, the cells are taken out and irradiated with UV light, and the timing of taking out is 5 to 30 minutes after the start of the PCR reaction; The irradiation with UV light is irradiation with UV light for 1 to 2 minutes.

Images