Application of TCF7L2 gene SNP site rs11196251 in the preparation of a product for predicting individual susceptibility to essential hypertension

Abstract

The present invention provides an application of the TCF7L2 gene SNP site rs11196251 in the preparation of a product for predicting individual susceptibility to essential hypertension. Specifically, there are three genotypes at the TCF7L2 rs11196251 site, namely CC type, CT type and TT type, and the prediction includes: when the TCF7L2 rs11196251 site genotype of the individual is TT type and CT type, predicting that the individual has a high susceptibility to essential hypertension. The present invention first discovered that TCF7L2 rs11196251 (C>T) is significantly correlated with an increased risk of essential hypertension, and can achieve early assessment of people with essential hypertension, thereby achieving early, rapid, accurate and large-scale screening of people with essential hypertension.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the application of TCF7L2 gene SNP site rs11196251 in the preparation of a product for predicting individual susceptibility to essential hypertension. Background Art

[0002] Essential Hypertension (EH) is a hypertensive disease with unknown etiology, caused by both genetic and environmental factors. Research evidence shows that the Wnt / β-catenin pathway may be a new way to regulate blood pressure. In general, the typical Wnt / β-catenin pathway plays a key role in cardiac development, angiogenesis, and myocardial hypertrophy. Animal experiments have shown that perfusing Wnt3a into the brain of spontaneously hypertensive rats can reduce blood pressure and heart rate and increase nitric oxide release. In addition, inhibiting the β-catenin signaling pathway can improve the effects of hypertension on vascular smooth muscle cell proliferation. Therefore, it is of great significance to further study the relationship between genes in the Wnt signaling pathway and essential hypertension.

[0003] Transcription factor-7Like-2 (TCF7L2) acts as a molecular switch in the Wnt / β-catenin pathway and is involved in regulating the proliferation, differentiation, polarization, migration and apoptosis of a variety of cells. Previous studies have shown that TCF7L2 is associated with cardiac hypertrophy and atherosclerosis. Recent studies have found that TCF7L2 is involved in the phenotypic transformation and functional changes of vascular smooth muscle cells. Impaired LRP6 / TCF7L2 activity leads to enhanced non-canonical Wnt signaling, resulting in excessive proliferation of vascular smooth muscle cells. Abnormal proliferation and apoptosis of vascular smooth muscle cells is one of the key cellular factors that induce or aggravate hypertension. In addition, the activation of TCF7L2 is necessary for the survival of vascular smooth muscle cells mediated by β-catenin. Summary of the invention

[0004] The purpose of the present invention is to provide a new biomarker TCF7L2 gene SNP site rs11196251 for the prediction of susceptibility to essential hypertension, and to provide a new approach for predicting the susceptibility to essential hypertension in individuals.

[0005] In order to achieve the above object, the present invention provides the use of TCF7L2 gene SNP site rs11196251 in the preparation of a product for predicting individual susceptibility to essential hypertension.

[0006] In a specific embodiment, the individual is of Han Chinese ethnicity.

[0007] In a specific embodiment, there are three genotypes at the TCF7L2 rs11196251 locus, namely TT type, CC type and CT type, and the prediction includes: when the TCF7L2 rs11196251 locus genotype of the individual is TT type and CT type, predicting that the individual has a high susceptibility to essential hypertension.

[0008] In a specific embodiment, the prediction includes: the susceptibility to primary hypertension of the TCF7L2 rs11196251 locus genotype of TT type is greater than the susceptibility to primary hypertension of the TCF7L2 rs11196251 locus genotype of CT type, and the susceptibility to primary hypertension of the TCF7L2 rs11196251 locus genotype of CT type is greater than the susceptibility to primary hypertension of the TCF7L2 rs11196251 locus genotype of CC type.

[0009] In a specific embodiment, the product is a kit or a reagent.

[0010] In a specific embodiment, the product includes a detection reagent, and the detection reagent is used to detect the genotype of the TCF7L2 rs11196251 site of the individual, and the detection sample of the individual is the DNA of the individual.

[0011] In a specific embodiment, the detection reagent also includes a primer pair for PCR amplification, wherein the sequence of the upstream primer is shown as SEQ ID NO.27, and the sequence of the downstream primer is shown as SEQ ID NO.28.

[0012] In a specific embodiment, the product includes a detection reagent for detecting the expression level of the TCF7L2 gene in any tissue of the individual's heart-auricle, heart-left ventricle, cerebellum, and pituitary gland.

[0013] In a specific embodiment, when the expression level of the TCF7L2 gene in the heart-auricle, heart-left ventricle, cerebellum, and pituitary gland of the individual is low relative to the expression level of the TCF7L2 gene in a normal control, the individual is predicted to have a high susceptibility to primary hypertension, and the genotype of the TCF7L2 rs11196251 locus of the normal control is CC type.

[0014] The beneficial effects of the present invention include at least:

[0015] 1. The present invention adopts a whole-genome strategy to study and explore the polymorphisms related to the TCF7L2 gene, and finds that TCF7L2rs11196251 (C>T) is significantly correlated with an increased risk of essential hypertension, indicating that the rs11196251 T allele may be an independent risk factor and predictor for essential hypertension. By detecting the genotype of the TCF7L2rs11196251 locus of an individual through a detection reagent, early assessment of the population with essential hypertension can be achieved, thereby realizing early, rapid, accurate and large-scale screening of the population with essential hypertension.

[0016] 2. The present invention can quickly screen people with essential hypertension by applying a detection reagent for detecting the genotype of the TCF7L2 rs11196251 locus of an individual to a kit, so that intervention can be carried out at an early stage to reduce the risk of hypertension.

[0017] 3. The present invention also found that the genotype of rs11196251 in the heart-auricle, heart-left ventricle, cerebellum, and pituitary gland was significantly correlated with the expression level of TCF7L2. In this way, the susceptibility of an individual to essential hypertension can be predicted by detecting the expression level of the TCF7L2 gene in the heart-auricle, heart-left ventricle, cerebellum, and pituitary gland. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is the structure diagram of the human TCF7L2 gene;

[0019] Figure 2 The relationship between TCF7L2 rs11196251 locus genotype and TCF7L2 gene expression level in heart-auricular tissue;

[0020] Figure 3 The relationship between TCF7L2 rs11196251 locus genotype and TCF7L2 gene expression level in heart-left ventricle tissue;

[0021] Figure 4 The relationship between TCF7L2 rs11196251 locus genotype and TCF7L2 gene expression level in pituitary tissue;

[0022] Figure 5 The relationship between TCF7L2 rs11196251 locus genotype and TCF7L2 gene expression level in brain-cerebellum tissues. DETAILED DESCRIPTION

[0023] The present invention is described in detail below with reference to the accompanying drawings and embodiments, but the present invention can be implemented in many different ways as limited and covered by the claims.

[0024] The experimental methods without specific conditions in the examples are usually carried out under conventional conditions or conditions recommended by the manufacturers. The materials and reagents used in the following examples are all commercially available unless otherwise specified.

[0025] Example 1

[0026] 1.1 Research subjects

[0027] The present invention selected patients with essential hypertension according to the internationally accepted diagnostic criteria for hypertension. The specific inclusion criteria are: without taking antihypertensive drugs, blood pressure was measured three times on different days, and the systolic blood pressure (SBP) was greater than / equal to 140 mmHg and / or the diastolic blood pressure (DBP) was greater than / equal to 90 mmHg; patients with essential hypertension who are currently taking antihypertensive drugs. The present invention excludes secondary hypertension. All healthy control populations were excluded from hypertension, coronary heart disease, ischemic cardiomyopathy, heart failure and diabetes. The basic clinical information of the case group and the healthy control group was recorded, such as gender, age, height, weight, smoking, drinking, systolic blood pressure, diastolic blood pressure, etc.

[0028] A total of 268 participants were included in the present invention, including 134 cases in the essential hypertension case group and 134 cases in the healthy control group. Their specific clinical basic information is shown in Table 1.

[0029]

[0030] 1.2 Selection of SNP sites

[0031] According to the SNPs data of TCF7L2 gene in Chinese Han population in the international human genome haplotype map project (HapMap project), the downloaded TCF7L2 genotyping data were imported into Haploview 4.2 software, and the candidate SNPs were selected with the minimum allele frequency>0.05, r 2 ≥ 0.8 was used as the condition for screening. In this step, 14 tag SNPs of the full-length TCF7L2 gene were screened, namely: rs290489, rs3750804, rs3750805, rs3814573, rs7085532, rs7895307, rs7917983, rs290481, rs290487, rs11196224, rs77961654, rs10749127, rs11196251 and rs17130188. The distribution of these SNPs in the TCF7L2 gene is shown in the figure. Figure 1 shown.

[0032] 1.3 SNP genotyping

[0033] Blood sample collection and DNA extraction: Blood was collected from the participants’ forearm venous blood in EDTA anticoagulation tubes. DNA was extracted from peripheral blood using a whole blood DNA extraction kit. The extracted DNA was measured for concentration and purity using an ultra-micro spectrophotometer NanoDrop2000. The DNA extraction steps included: 1. Add 900 ul of red blood cell lysis buffer to a 1.5 ml centrifuge tube; 2. Gently invert the blood tube placed in a 4-degree refrigerator until the blood sample is thoroughly mixed; 3. Take 300 ul of blood sample and place it in centrifuge tube (1), invert it several times to mix; 4. Incubate at room temperature for 10 minutes (invert the centrifuge tube 2-3 times to mix), and centrifuge at 13000-16000g for 20 seconds; 5. Discard the supernatant, leaving about 10-20 ul of liquid, and do not stir the white precipitate; 6. Mix vigorously on a vortex oscillator for 10-15 seconds to resuspend the white blood cells; 7. Add 300u l Nucleic acid lysis solution to the cell resuspension solution, turn upside down until filaments appear; 8. Add 10ul protein precipitation solution, vortex for 20s, mix thoroughly, and break up the viscous lysate (to prevent the inability to separate protein and DNA, resulting in DNA loss or reduced yield). After mixing, the original red liquid will turn into red flocculent precipitation, centrifuge at 13000g for 3 minutes (after centrifugation, the original red part in the tube will precipitate, the bottom of the tube is dark brown protein precipitation, and the upper layer is clear liquid); 9. Transfer the supernatant to another new centrifuge tube with isopropanol added ( Isopropanol: supernatant = 1:1), white linear precipitate can be seen, after centrifugation at 13000~16000g for 1min (≤300ul blood sample), small white DNA precipitate can be seen at the bottom of the tube; 10. Discard the supernatant, add an equal amount of 70% ethanol (same volume as isopropanol), and gently invert several times to clean the tube wall and DNA precipitate; 11. Discard ethanol after centrifugation, and use a gun tip to carefully suck away the small amount of ethanol remaining in the tube. Since the DNA precipitate is relatively loose, it is necessary to prevent the DNA precipitate from being sucked into the tube at this time. Invert the centrifuge tube on clean absorbent paper and air-dry it naturally at room temperature for 10~15min; 12. Finally, add nucleic acid dissolving solution to the centrifuge tube to completely dissolve the DNA precipitate (water bath at 65℃ for 1 hour or refrigerator at 4℃ overnight); 13. DNA concentration and purity are detected using a UV spectrophotometer.

[0034] Genotyping method: The detection of TCF7L2 SNP in the present invention uses Sequenom flight mass spectrometry technology for genotyping. Specifically:

[0035] The main reagents required for genetic testing are: (1) water, HPLC grade; (2) 0.5uM amplification and extension primer mixture; (3) 10× PCR buffer; (4) 25mM MgCl2 mixture; (5) 25mM dNTP mixture; (6) SAP buffer; (7) SAP enzyme (1.7U / uL); (8) iPLEX positive buffer; (9) iPLEX termination mixture; (10) iPLEX extension primer mixture; (11) iPLEX enzyme.

[0036] The main instruments required for genetic testing are: (1) MassARRAY system (Sequenom); (2) 384-well PCR instrument (ABI); (3) plate centrifuge (Eppendorf); (4) 384-well PCR plate cover (Axygen); (5) sample loading tank; (6) 384-well PCR plate (ABI); (7) 12-channel micropipette (Eppendorf); (8) 10ul, 200ul, 1000ul Tip heads (Axygen).

[0037] The steps of genetic testing include:

[0038] Step 1), PCR amplification reaction

[0039] The primers for PCR amplification reaction are as follows:

[0040] The upstream primer sequence of SNP site rs7917983 is shown in SEQ ID NO.1, and the downstream primer sequence is shown in SEQ ID NO.2, wherein: SEQ ID NO.1: ACGTTGGATGGTTCTACTCCTTGGAGATTC, SEQ ID NO.2: ACGTTGGATGTGGATTCCCAGTCTGCTCTC.

[0041] The upstream primer sequence of SNP site rs7895307 is shown in SEQ ID NO.3, and the downstream primer sequence is shown in SEQ ID NO.4, wherein, SEQ ID NO.3: ACGTTGGATGTGGTCAATAGACTTTCCCCC; SEQ ID NO.4: ACGTTGGATGGAAGGGTGGGAAGGTATAAC.

[0042] The upstream primer sequence of SNP site rs3750804 is shown in SEQ ID NO.5, and the downstream primer sequence is shown in SEQ ID NO.6, wherein SEQ ID NO.5: ACGTTGGATGAGAAAGGTGCCAGCTTCAAC, SEQ ID NO.6: ACGTTGGATGTCACCTCTGGGTGGTTTCTG.

[0043] The upstream primer sequence of SNP site rs3750805 is shown in SEQ ID NO.7, and the downstream primer sequence is shown in SEQ ID NO.8, wherein SEQ ID NO.7: ACGTTGGATGTCTAGAAGGAACCCAGCAAC, SEQ ID NO.8: ACGTTGGATGCCTCTTTGCTCTCAGCATTG.

[0044] The upstream primer sequence of SNP site rs10749127 is shown in SEQ ID NO.9, and the downstream primer sequence is shown in SEQ ID NO.10, wherein SEQ ID NO.9: ACGTTGGATGGAGCAGAATCACGGTATGAG, SEQ ID NO.10: ACGTTGGATGTGCCCTAGAGAGAGGTAAAC.

[0045] The upstream primer sequence of SNP site rs11196224 is shown in SEQ ID NO.11, and the downstream primer sequence is shown in SEQ ID NO.12, wherein SEQ ID NO.11: ACGTTGGATGCAGTCCAAGGAATGGTGAAC, SEQ ID NO.12: ACGTTGGATGTGCTACCAGGAAAACAGACG.

[0046] The upstream primer sequence of SNP site rs7085532 is shown in SEQ ID NO.13, and the downstream primer sequence is shown in SEQ ID NO.14, wherein SEQ ID NO.13: ACGTTGGATGTGTCACACTCGAGTGAACAG, SEQ ID NO.14: ACGTTGGATGTTACATGTGTGCGATGGCTG.

[0047] The upstream primer sequence of SNP site rs17130188 is shown in SEQ ID NO.15, and the downstream primer sequence is shown in SEQ ID NO.16, wherein SEQ ID NO.15: ACGTTGGATGATTCAATCCCCCACCATGAG, SEQ ID NO.16: ACGTTGGATGAACACCTCCTTTTGTGTCCG.

[0048] The upstream primer sequence of SNP site rs3814573 is shown in SEQ ID NO.17, and the downstream primer sequence is shown in SEQ ID NO.18, wherein SEQ ID NO.17: ACGTTGGATGGGCGATTCCAACAAAAGGTG, SEQ ID NO.18: ACGTTGGATGAACTAGTTGGCTAGGCTCAG.

[0049] The upstream primer sequence of SNP site rs290489 is shown in SEQ ID NO. 19, and the downstream primer sequence is shown in SEQ ID NO. 20, wherein SEQ ID NO. 19: ACGTTGGATGGCATCTTGACCTGTCTTTCC, SEQ ID NO. 20: ACGTTGGATGTTCTTTCCCCAGTCCCTGTG.

[0050] The upstream primer sequence of SNP site rs290487 is shown in SEQ ID NO.21, and the downstream primer sequence is shown in SEQ ID NO.22, wherein SEQ ID NO.21: ACGTTGGATGACCCAGTACAAATCATGGTG, SEQ ID NO.22: ACGTTGGATGATCTGCAGACTGACAACTGG.

[0051] The upstream primer sequence of SNP site rs290481 is shown in SEQ ID NO.23, and the downstream primer sequence is shown in SEQ ID NO.24, wherein SEQ ID NO.23: ACGTTGGATGCAGATACAGGAAGTGTGCTC, SEQ ID NO.24: ACGTTGGATGACGTGTTTCCAGTTGGAGTG.

[0052] The upstream primer sequence of SNP site rs77961654 is shown in SEQ ID NO.25, and the downstream primer sequence is shown in SEQ ID NO.26, wherein SEQ ID NO.25: ACGTTGGATGGGCGAATCTAGTAAGCTTCC, SEQ ID NO.26: ACGTTGGATGGTGCGTTCGCTACATACAAG.

[0053] The upstream primer sequence of SNP site rs11196251 is shown in SEQ ID NO.27, and the downstream primer sequence is shown in SEQ ID NO.28, wherein SEQ ID NO.27: ACGTTGGATGCCATCTTCGTTTCCCCTTTG, SEQ ID NO.28: ACGTTGGATGGTTTTGTACACGGTCAGTCC.

[0054] The PCR amplification step includes: (1) preparing a PCR reaction system according to the PCR reaction system sequence listed in Table 2, wherein the reagents in the PCR reaction system are listed in Table 2. (2) placing a PCR reaction plate on a PCR instrument and starting a PCR reaction, wherein the PCR amplification program is detailed in Table 3.

[0055]

[0056]

[0057] Step 2), SAP reaction

[0058] The SAP reaction step comprises: step (1) preparing a shrimp alkaline phosphatase (SAP enzyme) reaction system according to the sequence in Table 4, wherein the reagents in the SAP reaction system are as shown in Table 4; step (2) placing a 384-well plate on a PCR instrument compatible with a 384-well plate, setting PCR reaction conditions: 37°C, 40 minutes; 85°C, 5 minutes; 4°C, maintain, and starting the PCR instrument to perform a SAP enzyme digestion reaction.

[0059]

[0060] Step 3) Extension reaction

[0061] The extension reaction step comprises: (1) preparing a single base extension reaction system according to the sequence of Table 5, wherein the reagents in the extension reaction system are as shown in Table 5; (2) performing a single base extension reaction in a PCR instrument according to the following procedure, wherein the extension reaction procedure is as shown in Table 6.

[0062]

[0063]

[0064] Step 4), after the extension reaction, the salt was removed, and the samples were spotted again, and analyzed using Massarray. The test results were analyzed using Typer4.0 software to obtain genotyping data.

[0065] 1.4 Relationship between TCF7L2 polymorphism and susceptibility to essential hypertension

[0066] The present invention detected a total of 14 SNPs in TCF7L2, namely rs290489, rs3750804, rs3750805, rs3814573, rs7085532, rs7895307, rs7917983, rs290481, rs290487, rs11196224, rs77961654, rs10749127, rs11196251 and rs17130188. The genotype distribution of all sites conformed to the Hardy-Weinberg equilibrium. The association between these SNPs and essential hypertension is shown in Table 7. It can be seen from Table 7 that the rs11196251 gene variation is significantly correlated with essential hypertension (P = 0.003).

[0067]

[0068] 1.5 Relationship between TCF7L2 rs11196251 genotype and susceptibility to essential hypertension

[0069] Based on the genotyping data obtained in step 1.3, the relationship between TCF7L2 rs11196251 genotype and susceptibility to essential hypertension was further analyzed. The analysis results are shown in Table 8. As can be seen from Table 8, compared with TCF7L2rs11196251 wild-type CC individuals, individuals with heterozygous genotype CT and homozygous genotype TT mutations at the rs11196251 locus had significantly increased risks of essential hypertension, with magnitudes of 106% and 157%, respectively (CT vs CC: OR=2.06, P =0.006; TT vs CC: OR=2.57, P =0.019); while the risk of essential hypertension in individuals carrying the T allele (CT+TT) increased by 116% (95%CI=1.32~3.53, P =0.002). In addition, allele model analysis also showed that compared with TCF7L2 rs11196251 C allele carriers, T allele carriers had a 74% increased risk of developing essential hypertension (95%CI=1.21~2.49,P =0.003).

[0070]

[0071] Example 2

[0072] The present invention relates to a biomarker rs11196251 that can predict the risk of hypertension and is located in the 3'UTR region of the TCF7L2 gene, and its functional mechanism is not yet clear. Therefore, the present invention analyzes and identifies the function and mechanism of TCF7L2 rs11196251 based on the expression quantitative trait locus eQTL positioning analysis strategy, and the data comes from the Genotype-Tissue Expression Alliance (GTEx). GTEx is a tissue-specific gene expression and regulation database constructed by transcriptome sequencing and genotype data of 47 different human tissues, which can provide eQTL data related to complex diseases and help reveal the complex patterns of genetic variation and gene regulation in different human tissue types.

[0073] The present invention uses GTEx to perform eQTL analysis in 47 tissues. The analysis results are shown in Table 9. Among them, no significant difference was found between the expression levels of rs11196251 and TCF7L2 in 43 tissues (P>0.05). The present invention found that in 4 tissues, namely the auricle, left ventricle, cerebellum and pituitary, the genotype of rs11196251 was significantly correlated with the expression level of TCF7L2 (P<0.05), and the results were displayed using violin plots. The results are detailed in Figure 2~Figure 5 .

[0074]

[0075]

[0076] Combining the experimental results of Example 1 and Example 2, it can be seen that TCF7L2 rs11196251 (C>T) is significantly correlated with an increased risk of essential hypertension, and the genotype of rs11196251 in the heart-auricle, heart-left ventricle, cerebellum, and pituitary gland is significantly correlated with the expression level of TCF7L2. In this way, the susceptibility of an individual to essential hypertension can be predicted to be high or low by detecting the genotype of the TCF7L2rs11196251 locus and detecting the expression level of the TCF7L2 gene in the heart-auricle, heart-left ventricle, cerebellum, and pituitary gland, thereby achieving rapid screening of people with essential hypertension, so that early intervention can be carried out to reduce the risk of hypertension.

[0077] The above contents are further detailed descriptions of the present invention in combination with specific preferred embodiments, and it cannot be determined that the specific implementation of the present invention is limited to these descriptions. For ordinary technicians in the technical field to which the present invention belongs, several simple deductions and substitutions can be made without departing from the concept of the present invention, which should be regarded as belonging to the protection scope of the present invention.

Claims

1. Use of a reagent for detecting the TCF7L2 gene SNP site rs11196251 in the preparation of a product for predicting individual susceptibility to essential hypertension, characterized in that: The C>T base type of the rs11196251 site can predict the susceptibility to hypertension.

2. The use according to claim 1, characterized in that: The individual is of Han Chinese ethnicity.

3. The use according to claim 1, characterized in that: The product is a test kit.

4. The use according to claim 1, characterized in that: The detection reagent is used to detect the genotype of the TCF7L2rs11196251 site of the individual, and the detection sample of the individual is the DNA of the individual.

5. The use according to claim 4, characterized in that: The detection reagent also includes a primer pair for PCR amplification, wherein the sequence of the upstream primer is shown as SEQ ID NO.27, and the sequence of the downstream primer is shown as SEQ ID NO.

28.

6. The use according to claim 1, characterized in that: The detection reagent also includes a reagent for detecting the expression level of the TCF7L2 gene in any one of the heart-auricle, heart-left ventricle, cerebellum, and pituitary gland of the individual.

7. The use according to claim 6, characterized in that: When the expression level of the TCF7L2 gene in the heart-auricle, heart-left ventricle, cerebellum, and pituitary gland of the individual is low relative to the expression level of the TCF7L2 gene in normal controls, it is predicted that the individual has a high susceptibility to primary hypertension, and the TCF7L2 rs11196251 locus genotype of the normal controls is CC type.

Images