New application of 4-methyl-N1-(3-phenylpropyl)-1, 2-phenylenediamine

Abstract

The invention relates to the technical field of new application of old medicines, in particular to new application of 4-methyl-N1-(3-phenylpropyl)-1, 2-phenylenediamine. According to the application of 4-methyl-N1-(3-phenyl propyl)-1, 2-phenylenediamine shown in the following structural formula in preparation of the medicine for resisting the bunyavirus, the structural formula is # imgabs0, and the 4-methyl-N1-(3-phenyl propyl)-1, 2-phenylenediamine has high antiviral activity on the bunyavirus; according to the present invention, the micro-replicon activity, the protein expression, the RNA level and the titer level of the severe fever with thrombocytopenia syndrome bunyavirus can be significantly reduced, and the protein expression levels of the Hartlan virus and the Collar virus can be effectively reduced, such that the application potential in inhibition of various bunyavirus infection is indicated. The compound can be further used as a candidate drug for resisting bunyavirus infection, white fiber virus infection, babavirus infection and severe fever with thrombocytopenia syndrome bunyavirus infection.

Description

Technical Field

[0001] The present invention relates to the technical field of new uses of old drugs, and in particular to a new use of 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine. Background Art

[0002] Severe fever with thrombocytopenia syndrome (SFTS) is a severe new tick-borne disease mainly caused by infection with severe fever with thrombocytopenia syndrome bunyavirus (SFTSV). SFTSV is a spherical, enveloped, segmented, negative-strand RNA virus (genomic RNA contains L, M, and S segments), belonging to the class Bunyaviridae, family Leucoviridae, and genus Buntavirus. SFTSV is a representative species of the genus Buntavirus, with the largest number of infection cases and the greatest threat to people's health and socioeconomic development. In addition to SFTSV, Heartlandvirus (HRTV) and Guertu virus (GTV) are two other representative members of the genus Buntavirus, which may also cause SFTS-like symptoms. The main mode of transmission of SFTSV and other viruses reported so far is tick bites, and most SFTS patients have a history of working in forest highlands or fields and a history of tick exposure. However, in recent years, there have been increasing reports of human-to-human transmission and transmission from domestic animals to humans, suggesting that we should be fully aware of and vigilant about the potential spread and epidemic risks of such viruses.

[0003] Typical clinical symptoms of SFTS patients include fever, thrombocytopenia and leukopenia, gastrointestinal symptoms, neurological symptoms and bleeding tendency. Some infected patients develop rapidly and may suffer from multiple organ failure, with a mortality rate of up to 30%. At present, the clinical treatment plan for SFTS patients is mainly symptomatic supportive treatment, such as monitoring the patient's coagulation function, intravenous infusion of fresh plasma, whole blood, platelets, granulocyte colony-stimulating factor according to the condition, or the use of the antiviral drug ribavirin. However, the anti-SFTSV effect of ribavirin is still unclear. A retrospective analysis of clinical cases shows that ribavirin cannot effectively control the SFTS condition and improve the patient's prognosis. At present, there is no approved vaccine or effective antiviral drug for the treatment of SFTS. In view of its high mortality rate, complex pathogenic mechanism, potential risk of epidemic outbreaks, and lack of vaccines and drugs, SFTS is listed by the World Health Organization as one of the top ten key infectious diseases that urgently need to be studied; and its pathogen SFTSV has also become a representative highly pathogenic Bunyavirus and one of the representative virulent emerging viruses in recent years. Therefore, the research and development and application of relevant antiviral drugs not only have urgent clinical needs, but also have great significance for preventing the outbreak of public health events.

[0004] In view of this, the present invention is proposed. Summary of the invention

[0005] The object of the present invention is to provide a new use of 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine. The 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine has strong antiviral activity against bunyaviruses, can significantly reduce the infection (protein expression), microreplicon (replication machinery) activity, RNA replication, proliferation titer and progeny viral genome copy number of fever with thrombocytopenia syndrome bunyavirus, has a good effect of inhibiting the infection and replication and proliferation of fever with thrombocytopenia syndrome bunyavirus, can also inhibit the infection of bunyaviruses of the same genus such as Gurtu virus and Hartland virus, and can then be used to prepare drugs against bunyaviruses, white fiber viruses, Banda viruses and fever with thrombocytopenia syndrome viruses, and can then treat fever with thrombocytopenia syndrome and related clinical symptoms.

[0006] The present invention is achieved in that:

[0007] In a first aspect, the present invention provides a use of 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine in the preparation of an anti-Bunyavirus drug, wherein the structural formula of 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine is:

[0008] In an alternative embodiment, the bunyavirus comprises a white fiber virus.

[0009] In an alternative embodiment, the Bunyavirus comprises a Banda virus.

[0010] In alternative embodiments, the Bunyavirus includes fever with thrombocytopenia syndrome virus, Gurtu virus and Heartland virus.

[0011] In an alternative embodiment, the drug includes a drug that reduces infection (protein expression) of FEVER WITH THROMACEEPHILA virus, Heartland virus, and Gurtu virus.

[0012] In an alternative embodiment, the drug includes a drug that reduces the activity of the FERR virus minireplicon (replication machinery).

[0013] In an alternative embodiment, the medicament comprises a drug that reduces RNA replication of the FEVER WITH THROMACEEPHILA virus.

[0014] In an alternative embodiment, the drug includes a drug that reduces the proliferation titer of the FEVER WITH THROMACEEPHILA virus.

[0015] In an alternative embodiment, the drug includes a drug that reduces the number of copies of the progeny viral genome of the HFTS virus.

[0016] In a second aspect, the present invention provides a use of 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine in the preparation of a drug for treating fever with thrombocytopenia syndrome, wherein the structural formula of 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine is:

[0017] The present invention provides an application of 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine in the preparation of a drug for treating acute infectious diseases caused by fever with thrombocytopenia syndrome virus, Heartland virus and Gurtu virus. The structural formula of 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine is:

[0018]

[0019] The present invention has the following beneficial effects: the 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine has strong antiviral activity against bunyavirus, can significantly reduce the minireplicon activity, protein expression, RNA replication level, titer and progeny virus copy number of bunyavirus, has good effects of inhibiting the infection, replication and proliferation of fever with thrombocytopenia syndrome virus, and can effectively reduce the protein expression level of Hartland virus and Gurtu virus, indicating its application potential in inhibiting various bunyavirus infections. It can further be used as a candidate drug for resisting bunyavirus, white fiber virus, Banda virus and fever with thrombocytopenia syndrome bunyavirus infection, and used for drug development and verification of clinical treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0021] Figure 1 The result diagram of the cytotoxicity test of 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine provided in Experimental Example 1 of the present invention;

[0022] Figure 2 This is a graph showing the results of the compound JSH-23 provided in Experimental Example 2 of the present invention inhibiting the expression of nucleocapsid protein (NP) of SFTSV;

[0023] Figure 3 This is a fluorescence image of the compound JSH-23 provided in Experimental Example 3 of the present invention inhibiting the activity of SFTSV minireplicon;

[0024] Figure 4 This is a result diagram of quantitative statistics of the inhibition of SFTSV minireplicon activity by the compound JSH-23 provided in Experimental Example 3 of the present invention;

[0025] Figure 5 This is a graph showing the result of the compound JSH-23 provided in Experimental Example 4 of the present invention inhibiting the replication of SFTSV RNA in cells;

[0026] Figure 6 This is a graph showing the results of the compound JSH-23 provided in Experimental Example 5 of the present invention inhibiting the proliferation titer of SFTSV;

[0027] Figure 7 This is a result diagram showing that the compound JSH-23 provided in Experimental Example 6 of the present invention inhibits the proliferation of SFTSV progeny copies;

[0028] Figure 8 This is a graph showing the inhibition of SFTSV virus proliferation by the compound JSH-23 provided in Experimental Example 6 of the present invention;

[0029] Fig. 9 This is a graph showing the result of the compound JSH-23 provided in Experimental Example 7 of the present invention inhibiting the transcriptional expression of SOCS3;

[0030] Fig.10 This is a graph showing the results of the compound JSH-23 provided in Experimental Example 8 of the present invention inhibiting HRTV infection (reducing the expression of HRTV nucleocapsid protein NP);

[0031] Fig.11 This is a graph showing the results of the compound JSH-23 provided in Experimental Example 8 of the present invention inhibiting GTV infection (reducing the expression of GTV nucleocapsid protein NP). DETAILED DESCRIPTION

[0032] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0033] The embodiment of the present invention provides a new use of 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine. Specifically, the molecular formula of the compound JSH-23 (i.e., 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine) is C 16 H 20 N2, its structural formula is as follows:

[0034] It is a compound first developed in 2004. Originally used as an NF-κB inhibitor, the compound JSH-23 can inhibit the nuclear translocation of NF-κB p65 without affecting the degradation of IκBα, thereby inhibiting the transcriptional activity of NF-κB. In addition, the compound can also inhibit the expression of multiple inflammatory factors and cytokines, such as LPS-induced tumor necrosis factor (TNF-a), interleukin 1b (IL-1b), interleukin 6 (IL-6), inducible nitric oxide synthase and cyclooxygenase-2, and also inhibit LPS-induced apoptosis of RAW 264.7 cells. Recently, studies in animal models have found that JSH-23 may also inhibit inflammation of the nervous system, thus having a potential antidepressant effect. However, there has been no report on whether the compound JSH-23 can inhibit bunyavirus replication.

[0035] The inventors found that compound JSH-23 can inhibit Banda virus, fever with thrombocytopenia syndrome virus, Hartland virus and Gurtu virus in the Leucoviridae family of the Bunyavirus class. Specifically, compound JSH-23 has strong antiviral activity against Bunyavirus, can significantly inhibit the infection (protein expression), microreplicon (replication machinery) activity, RNA replication, titer proliferation and progeny virus copy number of Bunyavirus, has a good effect of inhibiting the infection and replication and proliferation of fever with thrombocytopenia syndrome Bunyavirus, and can effectively reduce the protein expression level of Hartland virus and Gurtu virus, indicating its potential for application in inhibiting multiple Bunyavirus infections. It can further be used as a candidate drug for infection against Bunyavirus, Leucoviridae, Banda virus (fever with thrombocytopenia syndrome Bunyavirus, Hartland virus and Gurtu virus, etc.), and used for drug development and verification of clinical treatment.

[0036] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0037] Experimental Example 1

[0038] Cytotoxicity assay of target compound JSH-23

[0039] method:

[0040] The cytotoxicity of JSH-23 was tested in HEK293 cells. 5×10 4 Cells / well were added to 96-well cell culture plates and cultured in a 37°C, 5% CO2 incubator for 24 hours. JSH-23 was dissolved in dimethyl sulfoxide (DMSO) as a stock solution and diluted with cell culture medium DMEM to different JSH-23 working concentrations, namely 0 μM (containing only DMSO, as a control), 1 μM, 2 μM, 4 μM, 8 μM, 16 μM, 32 μM, 64 μM, 128 μM, 256 μM and 512 μM, and incubated with cells, with three replicates per group. After 24 hours, the cell activity was detected using a CCK-8 kit, and the toxicity of JSH-23 to cells was analyzed by the OD450 nm value.

[0041] The test results are as follows Figure 1 As shown. Figure 1 It can be seen that cells have a high tolerance to JSH-23. At a concentration of 95.50 μM, the cell viability can be maintained at more than 80% of the control group, and at a concentration of 128 μM, the cell viability is still close to 80% of the control group. JSH-23 has a high tolerance to CC of HEK239 cells. 50 It is 214.8μM.

[0042] Experimental Example 2

[0043] Detection of the effect of target compound JSH-23 on SFTSV infection (characterized by viral protein expression level)

[0044] method:

[0045] In HEK293 cells, the effect of JSH-23 on SFTSV-infected cells (intracellular SFTSV viral protein levels) was tested. 5 Cells / well were placed in a 24-well cell culture plate and cultured overnight in a 37°C, 5% CO2 incubator. HEK293 cells were infected with SFTSV at an MOI of 0.1 and incubated at 37°C for 2 hours, after which the supernatant was discarded, the cells were rinsed three times with fresh culture medium, and fresh culture medium containing JSH-23 (final concentrations of 10 μM and 20 μM, respectively) or DMSO was added, and culture was continued at 37°C. Cells were collected after 24 hours, and the expression levels of viral nucleocapsid protein (NP) and intracellular reference protein βactin were detected by Western Blot.

[0046] Test results see Figure 2 The JSH-23 treatment group can significantly inhibit the expression of SFTSV NP and show obvious dose dependence, that is, the higher the JSH-23 concentration, the lower the expression of viral protein. This result shows that JSH-23 has a strong and effective inhibitory effect on SFTSV virus infection (protein expression).

[0047] Experimental Example 3

[0048] Detection method of the target compound JSH-23 inhibiting the activity of SFTSV microreplicon (replication machinery):

[0049] In HEK293T cells, the effect of JSH-23 on the activity of SFTSV minireplicon (representing the activity of the replication machinery) was tested. 4 cells / well in a 96-well cell culture plate and cultured overnight at 37°C in a 5% CO2 incubator.

[0050] (SFTSV) and 50ng pCAGGS-NP(SFTSV) expression plasmids were co-transfected with 50ng pRF42h-SFTSVMeGFP reporter plasmid into cells, and the group transfected with equal amounts of empty pCAGGS plasmid and 50ng pRF42h-SFTSVMeGFP reporter plasmid was used as negative control. 12h after transfection, the culture medium was replaced with fresh culture medium containing JSH-23 (final concentrations of 10μM and 20μM, respectively) or DMSO, and culture was continued at 37°C. Three replicate wells were set for each experimental group. After 48h, the cell culture medium was discarded, the cells were rinsed 3 times with PBS, fixed with 4% paraformaldehyde for 10min, permeabilized with 0.25% TritonX-100 for 20min, and stained with DAPI nuclear staining solution. Finally, the expression of eGFP fluorescence in cells was analyzed using a high-content cell imaging system (ThermoFisher Scientific, USA), and the total number of cells and the number of cells expressing eGFP fluorescence were counted. The activity of SFTSV minireplicon was calculated as the percentage of cells expressing eGFP fluorescence to the total number of cells.

[0051] Test results such as Figure 3 As shown, compared with the control group, the number of cells expressing eGFP fluorescence in the JSH-23 treatment group was significantly reduced, and showed a dose-dependent trend, that is, the higher the JSH-23 concentration, the fewer cells expressing eGFP fluorescence. This result shows that JSH-23 has an inhibitory effect on the microreplicon activity of the SFTSV virus.

[0052] The activity of JSH-23 in inhibiting SFTSV microreplicon was further quantified and statistically analyzed, namely, the percentage of cells expressing eGFP fluorescence to the total number of cells.

[0053] Test results such as Figure 4 As shown, the minireplicon activity of SFTSV was significantly inhibited after cells were treated with 10 μM and 20 μM JSH-23 (P<0.001, Mean with SD), further confirming that JSH-23 has a significant inhibitory effect on the minireplicon activity of SFTSV.

[0054] Experimental Example 4

[0055] Effect of target compound JSH-23 on intracellular SFTSV RNA replication

[0056] method:

[0057] In HEK293 cells, the effect of JSH-23 on the replication of SFTSV viral RNA was tested. 5cells / well to a 24-well cell culture plate and cultured overnight in a 37°C, 5% CO2 incubator. HEK293 cells were infected with SFTSV at an MOI of 0.1 and incubated at 37°C for 2 hours. The supernatant was discarded, the cells were rinsed 3 times with fresh culture medium, and fresh culture medium containing JSH-23 (final concentrations of 2μM, 4μM, 8μM, 16μM and 32μM, respectively) or DMSO was added, and cultured at 37°C. Three replicate wells were set up for each experimental group. After 24 hours, the cells were collected and the replication levels of the internal reference genes and the viral S, M and L genomic segments in the cells were detected by real-time fluorescence quantitative PCR (qRT-PCR). The specific primers for the internal reference gene GAPDH and the viral S, M and L RNA are as follows,

[0058] GAPDH-F:ACCACAGTCCATGCCATCAC;

[0059] GAPDH-R:TCCACCACCCTGTTGCTGTA;

[0060] SFTSV-SF:CAATGAGGAAGAAGTGAACAAGT;

[0061] SFTSV-SR:CAATGAGGAAGAAGTGAACAAGT;

[0062] SFTSV-MF: TGTGGAGGGATGCGTGTCAGA;

[0063] SFTSV-MR: AGTGGAATTGAATCCGTGCT;

[0064] SFTSV-LF: TCACGCCACTGCTTTCGCTTT;

[0065] SFTSV-LR:CGGCTCCTGACAATGTTCCT.

[0066] According to 2 -△△CT Methods The replication levels of viral S, M and L RNA were calculated.

[0067] Test results such as Figure 5 As shown in the figure (Mean with SD), compared with the control group, the levels of viral S, M and L genomic RNA in the JSH-23-treated group were significantly decreased, and showed a dose-dependent trend, that is, the higher the concentration of JSH-23, the lower the level of viral RNA replication. This result shows that JSH-23 inhibits the replication of SFTSV RNA in cells.

[0068] Experimental Example 5

[0069] Detection of the effect of target compound JSH-23 on SFTSV virus titer

[0070] method:

[0071] The effect of JSH-23 on the proliferation titer of SFTSV virus was detected by TCID 50 Methods The titer of infectious virus particles in the cell culture supernatant collected in Experimental Example 3 was determined. Specifically, 5×10 3 Vero cells / well were added to a 96-well cell culture plate and cultured overnight in a 37°C, 5% CO2 incubator. The supernatant of the cell culture medium in Experimental Example 3 was collected and centrifuged at 5000g, 4°C for 2 min to remove cell debris. The supernatant was diluted 10-fold (10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 and 10 -8 ). Add 100 μl of cell supernatant dilutions of different concentration gradients to each well of Vero cells, set 7 replicates for each concentration gradient, and culture at 37°C, 5% CO2 for 7 days. After discarding the cell culture medium, fix with PBS containing 4% paraformaldehyde at room temperature for 20 minutes, and permeabilize the cells with PBS containing 0.25% Triton X-100 at room temperature for 10 minutes. After washing three times with PBS, block with 5% bovine serum albumin (BSA) at 37°C for 1 hour, and incubate with the primary antibody against SFTSV-NP at 4°C overnight. After washing three times with PBS, incubate with the secondary antibody conjugated with AF488 fluorescein at 37°C for 2 hours, observe the fluorescence under a fluorescence microscope, and count, and determine the virus titer TCID after treatment with different concentrations of JSH-23. 50 .

[0072] The results are as follows Figure 6 As shown in the figure (Mean with SD), 16μM JSH-23 can significantly inhibit the proliferation titer of SFTSV (P<0.05), and 32μM JSH-23 can extremely significantly inhibit the proliferation titer of SFTSV (P<0.001). This result shows that JSH-23 has a strong inhibitory activity on the proliferation titer of SFTSV infectious virus particles.

[0073] Experimental Example 6

[0074] Detection of the effect of the target compound JSH-23 on the proliferation of SFTSV progeny (progeny viral genome RNA copy number)

[0075] method:

[0076] In HEK293 cells, the effect of JSH-23 on the proliferation of SFTSV progeny viruses (genomic RNA copy number) was examined. 5 Cells / well were placed in a 24-well cell culture plate and cultured in a 37°C, 5% CO2 incubator for 24 hours. The cells were infected with SFTSV (MOI = 0.1). After incubation at 37°C for 2 hours, the virus solution was removed and rinsed three times with fresh culture medium. They were treated with fresh culture medium containing JSH-23 (final concentrations of 2μM, 4μM, 8μM, 16μM and 32μM) or DMSO for 24 hours, respectively. Three replicate wells were set for each group. The supernatant of the cell culture medium was collected, and the inhibitory effect of JSH-23 on the proliferation of SFTSV progeny viruses was analyzed from the perspective of the genomic RNA copy number of the progeny viruses produced by qRT-PCR and the standard curve method. The specific primers and probes for the qRT-PCR standard curve method for SFTSV S segment RNA are as follows:

[0077] SFTSV-SF:GGGTCCCTGAAGGAGTTGTAAA;

[0078] SFTSV-SR: TGCCTTCACCAAGACTATCAATGT;

[0079] SFTSV-S-probe:TexasRed-TTCTGTCTTGCTGGCTCCGCGC-BHQ.

[0080] The load of progeny viruses released from SFTSV infected cells was detected by combining the standard curve method. The full length of SFTSV S fragment was obtained by PCR, and the corresponding S fragment RNA was obtained by in vitro transcription. 1-8 copies / ml) to establish a detection standard curve for the detection and calculation of viral load.

[0081] Test results such as Figure 7 As shown in (Mean with SD). Figure 7 It can be seen that JSH-23 can significantly inhibit the progeny viral load of SFTSV (the number of progeny viral genome RNA copies), and the antiviral effect shows obvious dose dependence.

[0082] The inhibition rate of JSH-23 on SFTSV virus proliferation titer was further fitted, and the EC 50 (like Figure 8 JSH-23 inhibits the EC of SFTSV 50 =3.305μM, selection index SI = CC 50 / EC50 =64.99.

[0083] Experimental Example 7

[0084] JSH-23 inhibits the transcriptional expression of SOCS3 in SFTSV-infected cells

[0085] Method: Inoculate 5×10 5 HEK293 cells / well were placed in a 24-well cell culture plate and cultured overnight in a 37°C, 5% CO2 incubator. When the cell confluence was ~80%, the cells were infected with SFTSV (MOI=5). After incubation at 37°C for 2 hours, the cells were rinsed three times with fresh culture medium and incubated with 8μM and 16μM JSH-23 (or control DMSO), respectively. Three independent replicates were set for each group. Cells were collected at 6, 12, and 24 hours after infection, and the effect of JSH-23 on the expression of SOCS3 in SFTSV-infected cells was detected by real-time fluorescence quantitative PCR. The primers for the internal reference gene GAPDH are as described above, and the qRT-PCR specific primers for the target gene SOCS3 are as follows,

[0086] SOCS3-F: GGAGTCCCCCCAGAAGAGCCTATT;

[0087] SOCS3-R:TTGACGGTCTTCCGACAGAGATGCT.

[0088] According to 2 -△△CT Methods The transcriptional expression level of SOCS3 was calculated.

[0089] Test results see Fig. 9 (Mean with SD). JSH-23 can significantly inhibit the transcriptional expression of SOCS3 in SFTSV-infected cells, and this inhibitory ability shows a dose-dependent trend. This suggests that JSH-23 can inhibit the transcriptional expression of SOCS3 in SFTSV-infected cells and thus inhibit the replication and proliferation of the virus, which may be an important mechanism by which JSH-23 inhibits the replication and proliferation of SFTSV bunyavirus.

[0090] It should be noted that the verification that SOCS3 is a key host factor required for efficient replication of SFTSV can be found in patent ZL2022 1 0051206.1.

[0091] Experimental Example 8

[0092] Detection of the effect of target compound JSH-23 on Heartland virus (HRTV) and Gurtu virus (GTV) infection

[0093] method:

[0094] In HEK293 cells, the effect of JSH-23 on HRTV or GTV infected cells (characterized by the level of intracellular viral protein expression) was tested. 5 HEK293 cells / well were placed in a 24-well cell culture plate and cultured overnight in a 37°C, 5% CO2 incubator. The cells were infected with HRTV or GTV at an MOI of 0.5 and incubated at 37°C for 2 hours, after which the supernatant was discarded, the cells were rinsed 3 times with fresh culture medium, and fresh culture medium containing JSH-23 (final concentrations of 10 μM and 20 μM, respectively) or DMSO was added, and the cells were continued to be cultured at 37°C. After 24 hours, the cells were collected and the expression levels of viral nucleocapsid protein (NP) and intracellular reference protein βactin were detected by Western Blot.

[0095] The results of the test on the effect of JSH-23 on HRTV protein expression can be found in Fig.10 , JSH-23 treatment group can significantly inhibit the expression of HRTVNP. The test results of the effect of JSH-23 on GTV protein expression can be found in Fig.11 The JSH-23 treatment group could significantly inhibit the expression of GTVNP. The results showed that JSH-23 also had an inhibitory effect on the infection of HRTV and GTV.

[0096] It should be noted that the sequences of the primers or probes provided in the embodiments of the present invention are well known and are only used in the experiments in the experimental examples, and will not affect the disclosure of the technical solutions of the present invention and the display of the technical effects, and will not be described in detail in the embodiments of the present invention.

[0097] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A use of 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine in the preparation of an anti-Bunyavirus drug, characterized in that: The structural formula of 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine is:

2. The use according to claim 1, characterized in that: The bunyavirus includes the white fiber virus.

3. The use according to claim 1, characterized in that: The Bunyavirus includes Banda virus.

4. The use according to claim 1, characterized in that: The bunyaviruses include fever with thrombocytopenia syndrome virus, Gurtu virus and Heartland virus.

5. The use according to claim 1, characterized in that: The drugs include drugs that reduce the protein expression of fever with thrombocytopenia syndrome virus, Heartland virus and Gurtu virus.

6. The use according to claim 1, characterized in that: The drugs include drugs that reduce the activity of the minireplicon of the fever with thrombocytopenia syndrome virus.

7. The use according to claim 1, characterized in that: The medicaments include medicaments that reduce RNA replication of the fever with thrombocytopenia syndrome virus.

8. The use according to claim 1, characterized in that: The drugs include drugs for reducing the proliferation titer of fever with thrombocytopenia syndrome virus.

9. The use according to claim 1, characterized in that: The drugs include drugs that reduce the number of copies of the progeny viral genome of the fever with thrombocytopenia syndrome virus.

10. Use of 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine in the preparation of a drug for treating acute infectious diseases caused by fever with thrombocytopenia syndrome virus, Heartland virus and Gurtu virus, characterized in that: The structural formula of 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine is: Preferably, the acute infectious disease includes fever with thrombocytopenia syndrome.

Images