New application of 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine

Abstract

The present invention relates to the field of new drug applications, and more specifically, to a new application of 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine. The application of 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine in the preparation of an anti-bunyavir drug, as shown in the following structural formula, is: #imgabs0#. It has strong antiviral activity against bunyaviruses, can significantly reduce the minireplicon activity, protein expression, RNA level, and titer level of fever with thrombocytopenia syndrome bunyavirus, and can effectively reduce the protein expression levels of heartland virus and gurtu virus, indicating its potential application in inhibiting multiple bunyavirus infections. It can further be used as a candidate drug for infections with bunyaviruses, white fiber virus, banta virus, and fever with thrombocytopenia syndrome bunyavirus.

Description

Technical Field

[0001] The present invention relates to the technical field of new uses of old drugs, and in particular to a new use of 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine. Background Art

[0002] Severe fever with thrombocytopenia syndrome (SFTS) is a severe, emerging tick-borne illness primarily caused by infection with the severe fever with thrombocytopenia syndrome bunyavirus (SFTSV). SFTSV is a spherical, enveloped, segmented, negative-sense RNA virus (its genome contains L, M, and S segments) belonging to the class Bunyaviridae, family Leucoviridae, and genus Buntavirus. SFTSV is the representative species of the genus Buntavirus and is the member with the highest number of cases. In addition to SFTSV, Heartland virus (HRTV) and Guertu virus (GTV) are two other representative members of the genus Buntavirus that may also cause SFTS-like symptoms. The primary mode of transmission for viruses such as SFTSV is reportedly tick bites, and most patients with SFTS have a history of work in forested areas or fields, associated with tick exposure. However, in recent years, there have been increasing reports of human-to-human and domestic animal-to-human transmission cases, suggesting that we should be fully aware of and be vigilant about the potential spread and epidemic risks of such viruses.

[0003] Typical clinical symptoms of SFTS include fever, thrombocytopenia and leukopenia, gastrointestinal symptoms, neurological symptoms, and bleeding tendency. Some infected patients progress rapidly, potentially developing multiple organ failure, with a mortality rate of up to 30%. Currently, clinical treatment for SFTS patients primarily relies on symptomatic supportive care, such as monitoring coagulation function and, as needed, intravenous infusions of fresh plasma, whole blood, platelets, and granulocyte colony-stimulating factor, or the antiviral drug ribavirin. However, the efficacy of ribavirin against SFTSV remains unclear. Retrospective clinical case studies have shown that ribavirin is ineffective in controlling SFTS symptoms and improving patient outcomes. Currently, there are no approved vaccines or effective antiviral drugs for the treatment of SFTS. Due to its high mortality rate, complex pathogenic mechanisms, potential for epidemics, and the lack of vaccines and treatments, SFTS has been listed by the World Health Organization as one of the ten priority infectious diseases requiring urgent research. In recent years, its pathogen, SFTSV, has become a representative example of a highly pathogenic bunyavirus and a representative example of a virulent emerging virus. Therefore, the research and development and application of relevant antiviral drugs not only have urgent clinical needs, but also have great significance for preventing the outbreak of public health events.

[0004] In view of this, the present invention is proposed. Summary of the Invention

[0005] The present invention aims to provide a new use of 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine. The 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine has strong antiviral activity against bunyaviruses, significantly reducing the infection (protein expression), minireplicon (replication machinery) activity, RNA replication, proliferation titer, and progeny viral genome copy number of FET Bunyavirus. It has a good effect in inhibiting the infection and replication and proliferation of FET Bunyavirus, and can also inhibit infection by fellow Bunyaviruses such as Gurtu virus and Hartland virus. The 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine can be used to prepare drugs against bunyaviruses, white fiber viruses, Banda viruses, and FET virus, thereby treating FET and related clinical conditions.

[0006] The present invention is achieved in that:

[0007] In a first aspect, the present invention provides a use of 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine in the preparation of an anti-Bunyavirus drug, wherein the structural formula of 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine is:

[0008] In an alternative embodiment, the bunyavirus comprises a white fiber virus.

[0009] In an alternative embodiment, the Bunyavirus comprises a Banda virus.

[0010] In alternative embodiments, the bunyavirus includes fever with thrombocytopenia syndrome virus, Gurtu virus, and Heartland virus.

[0011] In an alternative embodiment, the drug includes a drug that reduces the infectivity (protein expression) of fever with thrombocytopenia syndrome virus, Heartland virus and Gurtu virus.

[0012] In an alternative embodiment, the drug includes a drug that reduces the activity of the FERT virus minireplicon (replication machinery).

[0013] In an alternative embodiment, the medicament comprises an agent that reduces RNA replication of the FEVER WITH THROMBOCYTOPIA SYNDROME VIRUS.

[0014] In an alternative embodiment, the drug includes a drug that reduces the proliferation titer of the FEVER WITH THROMBOCYTOPIA SYNDROME VIRUS.

[0015] In an alternative embodiment, the drug includes a drug that reduces the number of copies of the progeny viral genome of the FEVER WITH THROMBOCYTOPIA SYNDROME VIRUS.

[0016] In a second aspect, the present invention provides a use of 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine in the preparation of a drug for treating fever with thrombocytopenia syndrome, wherein the structural formula of 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine is:

[0017] The present invention provides a use of 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine in the preparation of a medicament for treating acute infectious diseases caused by fever with thrombocytopenia syndrome virus, Heartland virus, and Gurtu virus. The structural formula of 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine is:

[0018] The present invention has the following beneficial effects: 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine has strong antiviral activity against bunyaviruses, significantly reducing minireplicon activity, protein expression, RNA replication level, titer, and progeny viral copy number of bunyaviruses. It has a good inhibitory effect on the infection, replication, and proliferation of fever with thrombocytopenia syndrome virus, and can effectively reduce the protein expression levels of heartland virus and gurtu virus, indicating its potential application in inhibiting multiple bunyavirus infections. It can further be used as a candidate drug for anti-buyavirus, white fiber virus, banda virus, and fever with thrombocytopenia syndrome bunyavirus infections, and used for drug development and verification for clinical treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. It should be understood that the following drawings only illustrate certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without paying any creative work.

[0020] Figure 1 This is a graph showing the results of a cytotoxicity assay of 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine provided in Experimental Example 1 of the present invention;

[0021] Figure 2 This is a graph showing the results of the compound JSH-23 provided in Experimental Example 2 of the present invention inhibiting the expression of nucleocapsid protein (NP) of SFTSV;

[0022] Figure 3 This is a fluorescence image showing that the compound JSH-23 provided in Experimental Example 3 of the present invention inhibits the activity of SFTSV minireplicon;

[0023] Figure 4 This is a graph showing the quantitative statistical results of the inhibition of SFTSV minireplicon activity by the compound JSH-23 provided in Experimental Example 3 of the present invention;

[0024] Figure 5 This is a graph showing the results of the compound JSH-23 provided in Experimental Example 4 of the present invention inhibiting SFTSV RNA replication in cells;

[0025] Figure 6 This is a graph showing the results of the compound JSH-23 provided in Experimental Example 5 of the present invention inhibiting the proliferation titer of SFTSV;

[0026] Figure 7 This is a graph showing the results of the compound JSH-23 provided in Experimental Example 6 of the present invention inhibiting the proliferation of SFTSV progeny copies;

[0027] Figure 8 This is a graph showing the inhibition of SFTSV virus proliferation by the compound JSH-23 provided in Experimental Example 6 of the present invention;

[0028] Figure 9 This is a graph showing the results of the compound JSH-23 inhibiting the transcriptional expression of SOCS3 provided in Experimental Example 7 of the present invention;

[0029] Figure 10 This is a graph showing the results of the compound JSH-23 provided in Experimental Example 8 of the present invention inhibiting HRTV infection (reducing the expression of HRTV nucleocapsid protein NP);

[0030] Figure 11 This is a graph showing the results of the compound JSH-23 provided in Experimental Example 8 of the present invention inhibiting GTV infection (reducing the expression of GTV nucleocapsid protein NP). DETAILED DESCRIPTION

[0031] To make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention are described clearly and completely below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer are used. Where the manufacturer of the reagents or instruments is not specified, all are conventional products that can be purchased commercially.

[0032] The embodiment of the present invention provides a new use of 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine. Specifically, the molecular formula of compound JSH-23 (i.e., 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine) is C 16 H 20 N2, its structural formula is as follows:

[0033] JSH-23 is a compound first discovered in 2004. Originally used as an NF-κB inhibitor, the compound JSH-23 inhibits the nuclear translocation of NF-κB p65 without affecting IκBα degradation, thereby suppressing NF-κB transcriptional activity. Furthermore, the compound can inhibit the expression of multiple inflammatory factors and cytokines, such as LPS-induced tumor necrosis factor (TNF-α), interleukin-1b (IL-1b), interleukin-6 (IL-6), inducible nitric oxide synthase, and cyclooxygenase-2. It also suppresses LPS-induced apoptosis in RAW 264.7 cells. Recently, studies in animal models have shown that JSH-23 may also suppress neuroinflammation, potentially possessing antidepressant effects. However, whether JSH-23 can inhibit bunyavirus replication has not been reported.

[0034] The inventors discovered that compound JSH-23 can inhibit Bunyavirus, fever with thrombocytopenia syndrome virus, Hartland virus and Gurtu virus in the Bunyaviridae family. Specifically, compound JSH-23 has strong antiviral activity against Bunyavirus, and can significantly inhibit the infection (protein expression), microreplicon (replication machinery) activity, RNA replication, titer proliferation and progeny virus copy number of Bunyavirus. It has a good effect of inhibiting the infection and replication proliferation of fever with thrombocytopenia syndrome Bunyavirus, and can effectively reduce the protein expression level of Hartland virus and Gurtu virus, indicating its application potential in inhibiting multiple Bunyavirus infections. It can further be used as a candidate drug for infection with Bunyavirus, white fiber virus, and Ban Da virus (fever with thrombocytopenia syndrome Bunyavirus, Hartland virus and Gurtu virus, etc.), and is used for drug development and verification of clinical treatment.

[0035] The features and performance of the present invention are further described in detail below with reference to the embodiments.

[0036] Experimental Example 1

[0037] Cytotoxicity assay of target compound JSH-23

[0038] method:

[0039] The cytotoxicity of JSH-23 was tested in HEK293 cells. 5×10 4 Cells were plated per well in a 96-well cell culture plate and incubated at 37°C in a 5% CO2 incubator for 24 hours. JSH-23 was dissolved in dimethyl sulfoxide (DMSO) as a stock solution and diluted in DMEM (DMEM) to various working concentrations of JSH-23: 0 μM (DMSO alone, used as a control), 1 μM, 2 μM, 4 μM, 8 μM, 16 μM, 32 μM, 64 μM, 128 μM, 256 μM, and 512 μM. The cells were then incubated with these concentrations in triplicate. After 24 hours, cell viability was assessed using a CCK-8 assay, and the cytotoxicity of JSH-23 was analyzed by OD450 nm.

[0040] The test results are as follows Figure 1 As shown. Figure 1 It can be seen that the cells have a high tolerance to JSH-23. At a concentration of 95.50 μM, the cell viability can be maintained at more than 80% of the control group, and at a concentration of 128 μM, the cell viability is still close to 80% of the control group. JSH-23 has a high tolerance to CC of HEK239 cells. 50 It is 214.8μM.

[0041] Experimental Example 2

[0042] Detection of the effect of target compound JSH-23 on SFTSV infection (characterized by viral protein expression level)

[0043] method:

[0044] In HEK293 cells, the effect of JSH-23 on SFTSV-infected cells (intracellular SFTSV viral protein levels) was tested. 5 Cells / well were plated in a 24-well cell culture plate and cultured overnight at 37°C in a 5% CO2 incubator. HEK293 cells were infected with SFTSV at an MOI of 0.1 and incubated at 37°C for 2 hours. The supernatant was discarded, the cells were rinsed three times with fresh culture medium, and fresh culture medium containing JSH-23 (final concentrations of 10 μM and 20 μM, respectively) or DMSO was added and cultured at 37°C. After 24 hours, cells were harvested and the expression levels of viral nucleocapsid protein (NP) and the cellular reference protein β-actin were determined by Western blotting.

[0045] Test results see Figure 2 The JSH-23 treatment group significantly inhibited the expression of SFTSV NP in a dose-dependent manner, i.e., the higher the JSH-23 concentration, the lower the expression of viral protein. These results indicate that JSH-23 has a strong and effective inhibitory effect on SFTSV viral infection (protein expression).

[0046] Experimental Example 3

[0047] Detection method for the inhibition of the activity of the target compound JSH-23 on the SFTSV minireplicon (replication machinery):

[0048] The effect of JSH-23 on the activity of SFTSV minireplicon (representing the activity of the replication machinery) was tested in HEK293T cells. 4 Cells / well were transferred to 96-well cell culture plates and cultured overnight at 37°C in a 5% CO2 incubator. 100 ng of pCAGGS-RdRP

[0049] 50 ng of pCAGGS-NP (SFTSV) expression plasmids and 50 ng of pRF42h-SFTSVMeGFP reporter plasmid were co-transfected into cells. A negative control group was transfected with an equal amount of empty pCAGGS plasmid and 50 ng of pRF42h-SFTSVMeGFP reporter plasmid. 12 hours after transfection, the culture medium was replaced with fresh medium containing JSH-23 (final concentrations of 10 μM and 20 μM, respectively) or DMSO, and the cells were cultured at 37°C. Three replicates were set up for each experimental group. After 48 hours, the cell culture medium was discarded, and the cells were rinsed three times with PBS. The cells were fixed with 4% paraformaldehyde for 10 minutes, permeabilized with 0.25% TritonX-100 for 20 minutes, and nuclei were stained with DAPI. Finally, the expression of eGFP fluorescence in the cells was analyzed using a high-content cytometry system (ThermoFisher Scientific, USA). The total number of cells and the number of cells expressing eGFP fluorescence were counted. The activity of SFTSV minireplicon was calculated as the percentage of cells expressing eGFP fluorescence to the total number of cells.

[0050] Test results such as Figure 3 As shown in the figure, compared with the control group, the number of cells expressing eGFP fluorescence in the JSH-23-treated group was significantly reduced, and the trend was dose-dependent, that is, the higher the JSH-23 concentration, the fewer cells expressing eGFP fluorescence. This result indicates that JSH-23 has an inhibitory effect on the minireplicon activity of the SFTSV virus.

[0051] The activity of JSH-23 in inhibiting SFTSV minireplicon was further quantified and statistically analyzed as the percentage of cells expressing eGFP fluorescence to the total number of cells.

[0052] Test results such as Figure 4 As shown, the minireplicon activity of SFTSV was significantly inhibited after cells were treated with 10 μM and 20 μM JSH-23 (P<0.001, Mean with SD), further confirming that JSH-23 has a significant inhibitory effect on the minireplicon activity of SFTSV.

[0053] Experimental Example 4

[0054] Effect of target compound JSH-23 on intracellular SFTSV RNA replication

[0055] method:

[0056] The effect of JSH-23 on the intracellular SFTSV viral RNA replication was examined in HEK293 cells. 5Cells / well were transferred to a 24-well cell culture plate and cultured overnight in a 37°C, 5% CO2 incubator. HEK293 cells were infected with SFTSV at an MOI of 0.1, incubated at 37°C for 2 hours, the supernatant was discarded, the cells were rinsed 3 times with fresh culture medium, and fresh culture medium containing JSH-23 (final concentrations of 2μM, 4μM, 8μM, 16μM and 32μM, respectively) or DMSO was added and cultured at 37°C. Three replicates were set up for each experimental group. After 24 hours, the cells were collected and the replication levels of the internal reference genes and viral S, M and L genomic segments in the cells were detected by real-time fluorescence quantitative PCR (qRT-PCR). The specific primers for the internal reference gene GAPDH and viral S, M and L RNA are as follows,

[0057] GAPDH-F:ACCACAGTCCATGCCATCAC;

[0058] GAPDH-R:TCCACCACCCTGTTGCTGTA;

[0059] SFTSV-SF:CAATGAGGAAGAAGTGAACAAGT;

[0060] SFTSV-SR:CAATGAGGAAGAAGTGAACAAGT;

[0061] SFTSV-MF: TGTGGAGGGATGCGTGTCAGA;

[0062] SFTSV-MR: AGTGGAATTGAATCCGTGCT;

[0063] SFTSV-LF: TCACGCCACTGCTTTCGCTTT;

[0064] SFTSV-LR:CGGCTCCTGACAATGTTCCT.

[0065] According to 2 -△△CT Methods The viral S, M and L RNA replication levels were calculated.

[0066] Test results such as Figure 5 As shown in the mean with SD, compared with the control group, the levels of viral S, M, and L genomic RNA in the JSH-23-treated group were significantly decreased, and a dose-dependent trend was observed, that is, the higher the JSH-23 concentration, the lower the level of viral RNA replication. This result indicates that JSH-23 inhibits the replication of SFTSV RNA in cells.

[0067] Experimental Example 5

[0068] Detection of the effect of target compound JSH-23 on SFTSV virus titer

[0069] method:

[0070] The effect of JSH-23 on the proliferation titer of SFTSV virus was detected by TCID 50 Methods The titer of infectious virus particles in the supernatant of the cell culture medium collected in Experimental Example 3 was determined. Specifically, 5×10 3 Vero cells were plated / well in a 96-well cell culture plate and cultured overnight in a 37°C, 5% CO2 incubator. The supernatant of the cell culture medium in Experimental Example 3 was collected and centrifuged at 5000g for 2 min at 4°C to remove cell debris. The supernatant was diluted 10-fold (10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 and 10 -8 ). Add 100 μl of cell supernatant dilutions of different concentration gradients to each well of Vero cells, set up 7 replicates for each concentration gradient, and culture at 37°C, 5% CO2 for 7 days. After discarding the cell culture medium, fix with PBS containing 4% paraformaldehyde at room temperature for 20 minutes, and permeabilize the cells with PBS containing 0.25% Triton X-100 at room temperature for 10 minutes. After washing three times with PBS, block with 5% bovine serum albumin (BSA) at 37°C for 1 hour, and incubate with anti-SFTSV-NP primary antibody at 4°C overnight. After washing three times with PBS, incubate with AF488 fluorescein-conjugated secondary antibody at 37°C for 2 hours, observe the fluorescence under a fluorescence microscope, and count, and determine the virus titer TCID after treatment with different concentrations of JSH-23. 50 .

[0071] The results are as follows Figure 6 As shown in the table (mean with SD), 16 μM JSH-23 significantly inhibited the proliferation titer of SFTSV (P < 0.05), and 32 μM JSH-23 extremely significantly inhibited the proliferation titer of SFTSV (P < 0.001). These results indicate that JSH-23 has a strong inhibitory activity on the proliferation titer of SFTSV infectious virions.

[0072] Experimental Example 6

[0073] Detection of the effect of the target compound JSH-23 on SFTSV progeny proliferation (progeny viral genome RNA copy number)

[0074] method:

[0075] In HEK293 cells, the effect of JSH-23 on the proliferation of SFTSV progeny viruses (genomic RNA copy number) was examined. 5 Cells / well were plated in a 24-well cell culture plate and cultured in a 37°C, 5% CO2 incubator for 24 hours. The cells were infected with SFTSV (MOI = 0.1). After incubation at 37°C for 2 hours, the virus solution was removed and rinsed three times with fresh culture medium. They were treated with fresh culture medium containing JSH-23 (final concentrations of 2 μM, 4 μM, 8 μM, 16 μM and 32 μM) or DMSO for 24 hours, with three replicates per group. The cell culture supernatant was collected, and the inhibitory effect of JSH-23 on the proliferation of SFTSV progeny viruses was analyzed from the perspective of the genomic RNA copy number of the progeny viruses produced by qRT-PCR and the standard curve method. The specific primers and probes for the qRT-PCR standard curve method of SFTSV S segment RNA are as follows:

[0076] SFTSV-SF:GGGTCCCTGAAGGAGTTGTAAA;

[0077] SFTSV-SR: TGCCTTCACCAAGACTATCAATGT;

[0078] SFTSV-S-probe:TexasRed-TTCTGTCTTGCTGGCTCCGCGC-BHQ.

[0079] The load of progeny viruses released from SFTSV infected cells was detected by combining the standard curve method. The full length of SFTSV S segment was obtained by PCR, and the corresponding S segment RNA was obtained by in vitro transcription. 1-8 copies / ml) to establish a detection standard curve for the detection and calculation of viral load.

[0080] Test results such as Figure 7 As shown (Mean with SD). Figure 7 It can be seen that JSH-23 can significantly inhibit the progeny viral load of SFTSV (progeny viral genome RNA copy number), and the antiviral effect shows obvious dose dependence.

[0081] The inhibition rate of JSH-23 on SFTSV virus proliferation titer was further fitted and EC 50 (like Figure 8 JSH-23 inhibits the EC of SFTSV 50 =3.305μM, selection index SI=CC 50 / EC50 =64.99.

[0082] Experimental Example 7

[0083] JSH-23 inhibits the transcriptional expression of SOCS3 in SFTSV-infected cells

[0084] Method: Inoculate 5×10 5 HEK293 cells / well were plated in a 24-well cell culture plate and cultured overnight in a 37°C, 5% CO2 incubator. When the cell confluence was ~80%, the cells were infected with SFTSV (MOI=5). After incubation at 37°C for 2 hours, the cells were rinsed three times with fresh culture medium and incubated with 8μM and 16μM JSH-23 (or control DMSO), respectively. Three independent replicates were set up for each group. Cells were collected 6, 12, and 24 hours after infection, and the effect of JSH-23 on SOCS3 expression in SFTSV-infected cells was detected by real-time fluorescence quantitative PCR. The primers for the internal reference gene GAPDH are as described above, and the qRT-PCR specific primers for the target gene SOCS3 are as follows,

[0085] SOCS3-F: GGAGTCCCCCCAGAAGAGCCTATT;

[0086] SOCS3-R:TTGACGGTCTTCCGACAGAGATGCT.

[0087] According to 2 -△△CT Methods The transcriptional expression level of SOCS3 was calculated.

[0088] Test results see Figure 9 JSH-23 significantly inhibited SOCS3 transcription in SFTSV-infected cells in a dose-dependent manner. This suggests that JSH-23 inhibits SOCS3 transcription in SFTSV-infected cells, thereby inhibiting viral replication and proliferation. This may be an important mechanism by which JSH-23 inhibits SFTSV bunyavirus replication and proliferation.

[0089] It should be noted that the verification that SOCS3 is a key host factor required for efficient replication of SFTSV can be found in patent ZL2022 1 0051206.1.

[0090] Experimental Example 8

[0091] Detection of the effect of target compound JSH-23 on Heartland virus (HRTV) and Gurtu virus (GTV) infection

[0092] method:

[0093] In HEK293 cells, the effect of JSH-23 on HRTV or GTV infected cells (characterized by the expression level of intracellular viral proteins) was tested. 5 HEK293 cells were plated per well in a 24-well cell culture plate and cultured overnight at 37°C in a 5% CO2 incubator. The cells were infected with HRTV or GTV at an MOI of 0.5 and incubated at 37°C for 2 hours. The supernatant was discarded, the cells were rinsed three times with fresh culture medium, and fresh culture medium containing JSH-23 (final concentrations of 10 μM and 20 μM, respectively) or DMSO was added and cultured at 37°C. After 24 hours, the cells were harvested and the expression levels of viral nucleocapsid protein (NP) and the cellular reference protein β-actin were determined by Western blotting.

[0094] The results of the test on the effect of JSH-23 on HRTV protein expression can be found in Figure 10 The JSH-23 treatment group can significantly inhibit the expression of HRTVNP. The results of the test on the effect of JSH-23 on GTV protein expression can be found in Figure 11 The JSH-23 treatment group could significantly inhibit the expression of GTVNP. The results showed that JSH-23 also has an inhibitory effect on the infection of HRTV and GTV.

[0095] It should be noted that the sequences of the primers or probes provided in the embodiments of the present invention are well known and are only used for experiments in the experimental examples. They do not affect the disclosure of the technical solutions of the present invention and the display of the technical effects. The embodiments of the present invention will not describe them in detail.

[0096] The foregoing description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art will readily appreciate that various modifications and variations of the present invention are possible. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention are intended to be within the scope of protection of the present invention.

Claims

1. A use of 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine in the preparation of an anti-Bunyavirus drug, characterized in that: The structural formula of 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine is: , the Bunyavirus is selected from one or more of fever with thrombocytopenia syndrome virus, Gurtu virus and Heartland virus.

2. The use according to claim 1, characterized in that The 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine can reduce the protein expression of fever with thrombocytopenia syndrome virus, Heartland virus or Gurtu virus.

3. The use according to claim 1, characterized in that The 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine can reduce the minireplicon activity of the fever with thrombocytopenia syndrome virus.

4. The use according to claim 1, characterized in that The 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine can reduce the RNA replication of the fever with thrombocytopenia syndrome virus.

5. The use according to claim 1, characterized in that The 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine can reduce the proliferation titer of the fever with thrombocytopenia syndrome virus.

6. The use according to claim 1, characterized in that The 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine can reduce the number of copies of the progeny viral genome of the fever with thrombocytopenia syndrome virus.

7. Use of 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine in the preparation of a drug for treating acute infectious diseases caused by fever with thrombocytopenia syndrome virus, characterized in that: The structural formula of 4-methyl-N1-(3-phenylpropyl)-1,2-phenylenediamine is: ; The acute infectious disease is selected from fever with thrombocytopenia syndrome.

Images