RNA compositions for delivery of monkey pox antigens and related methods

Abstract

The present disclosure provides pharmaceutical compositions and related techniques (e.g., components thereof and / or methods related thereto) for delivering monkey pox antigens (e.g., monkey pox vaccines). For example, the disclosure provides polyribonucleotides encoding one or more monkey pox antigens or fragments thereof.

Description

[0001] Cross-reference to related applications

[0002] This application claims priority to U.S. Provisional Application No. 63 / 345,795, filed on May 25, 2022, and U.S. Provisional Application No. 63 / 442,109, filed on January 30, 2023, the entire contents of which are incorporated herein by reference. Background Art

[0003] Orthopoxviruses are a genus encompassing numerous viral species, including monkeypox, vaccinia, cowpox, and smallpox. Some orthopoxviruses are restricted to the host they infect, while others have been identified in a wide range of host species. Orthopoxviruses share many biological phenotypes, including the lack of specific receptors required for infecting mammalian cells, a relatively low mutation rate, environmental stability of virions, and the ability to infect hosts through multiple routes (e.g., mucosal, respiratory, parenteral, etc.).

[0004] Monkeypox (also referred to herein as mpox) was first discovered in 1958, when two outbreaks of a poxvirus-like illness occurred in monkey populations kept for research, hence the name 'monkeypox'. The first human case of monkeypox was documented in 1970 in the Democratic Republic of the Congo, during intensified smallpox eradication efforts. Since then, monkeypox has been reported in humans in other Central and West African countries. More recently, monkeypox infection has been confirmed in European countries, as well as in the United States, Canada, and Australia. Summary of the Invention

[0005] The present disclosure provides pharmaceutical compositions (e.g., immunogenic compositions, such as vaccines) and related technologies (e.g., methods) for delivering specific monkeypox antigen constructs to subjects (e.g., patients). Specifically, the present disclosure provides monkeypox vaccine compositions and related technologies (e.g., methods). The present disclosure includes the unexpected discovery that the monkeypox antigens and fragments thereof provided herein are particularly advantageous for preventing or treating monkeypox. The present disclosure includes the recognition that monkeypox antigen constructs (e.g., monkeypox antigen constructs that are or include polyribonucleotides) can include one or more B cell antigens or fragments thereof, one or more T cell antigens or fragments thereof, or a combination of B cell antigens or fragments thereof and T cell antigens or fragments thereof.

[0006] In some embodiments, the present disclosure provides certain monkeypox antigen constructs that are particularly useful in effective vaccination. In some embodiments, the monkeypox antigen constructs provided are effective for vaccination against monkeypox. In various embodiments, the monkeypox antigen construct includes and / or encodes one or more monkeypox antigens or fragments thereof (e.g., one or more B cell antigens of monkeypox and / or one or more T cell antigens of monkeypox, or fragments thereof). As disclosed herein, T cell antigens include, for example, CD4 T cell antigens and / or CD8 T cells. For the avoidance of doubt, as will be appreciated by those skilled in the art, any reference herein to an antigen as a "B cell antigen" or "T cell antigen" or the like does not exclude any given antigen or any given agent that can activate, induce and / or cause a variety of immune responses when exposed to the immune system, which immune responses may include one or both of a B cell response and a T cell response, regardless of the labeling used for ease of description.

[0007] The present disclosure also provides insights into the cross-protection of monkeypox vaccines against other orthopoxviruses (e.g., smallpox virus). In some embodiments, provided monkeypox antigenic constructs are effective for vaccination against monkeypox and one or more other orthopoxviruses. In some embodiments, provided monkeypox antigenic constructs are effective for vaccination against monkeypox and smallpox virus. In some embodiments, provided monkeypox antigenic constructs are effective for vaccination against monkeypox and novel orthopoxviruses.

[0008] In some embodiments, the monkeypox antigen construct may include and / or encode at least one of the following: A29L, A35R, B6R, M1R, E8L, A28L, H3L, A45L, B9R, B16R, C10L, C21L, E7R, F3L, F4L, G6R, H5R, I3L, O2L, Q1L, B12R, and / or C17L, or a fragment thereof. In some embodiments, the monkeypox antigen construct may include and / or encode at least one of the following: A29L, A35R, B6R, M1R, E8L, A28L, and / or H3L, or a fragment thereof. In some embodiments, the monkeypox antigen construct may include and / or encode one or more antigens selected from the group consisting of B6R, A35R, M1R, H3L, E8L, and a fragment thereof. In some embodiments, the monkeypox antigen construct may include and / or encode at least one of: A45L, B9R, B16R, C10L, C21L, E7R, F3L, F4L, G6R, H5R, I3L, O2L, Q1L, B12R and / or C17L, or fragments thereof.

[0009] In some embodiments, the monkeypox antigen construct may include and / or encode at least one monkeypox B cell antigen selected from the group consisting of A29L, A35R, B6R, M1R, E8L, A28L, and / or H3L, or a fragment thereof. In some embodiments, the monkeypox antigen construct may include and / or encode one or more monkeypox B cell antigens selected from the group consisting of B6R, A35R, M1R, H3L, E8L, and a fragment thereof.

[0010] In some embodiments, the monkeypox antigen construct may include and / or encode at least one intracellular mature virus (IMV) antigen (e.g., an IMV-specific antigen). In some embodiments, one or more IMV antigens (e.g., IMV-specific antigens) are selected from H3L, E8L, M1R, A29L, and a fragment of any one thereof. In some embodiments, the monkeypox antigen construct may include and / or encode at least one extracellular enveloped virus (EEV) antigen (e.g., an EEV-specific antigen). In some embodiments, one or more EEV antigens (e.g., EEV-specific antigens) are selected from A35R, B6R, and a fragment thereof. In some embodiments, the monkeypox antigen construct may include and / or encode at least one IMV antigen (e.g., an IMV-specific antigen) and at least one EEV antigen (e.g., an EEV-specific antigen).

[0011] In some embodiments, the monkeypox antigen construct may include and / or encode at least one monkeypox T cell antigen (e.g., at least one CD4 and / or CD8 T cell antigen) selected from the group consisting of A45L, B9R, B16R, C10L, C21L, E7R, F3L, F4L, G6R, H5R, I3L, O2L, Q1L, B12R and / or C17L, or fragments thereof.

[0012] In some embodiments, the monkeypox antigen construct can include and / or encode one or more of the following (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 of the following): A29L, A35R, B6R, M1R, E8L, A28L, H3L, A45L, B9R, B16R, C10L, C21L, E7R, F3L, F4L, G6R, H5R, I3L, O2L, Q1L, B12R, and / or C17L, or fragments thereof. In some embodiments, the monkeypox antigen construct may include and / or encode one or more (e.g., 1, 2, 3, 4, 5, 6, or 7) of the following: A29L, A35R, B6R, M1R, E8L, A28L, and / or H3L, or fragments thereof. In some embodiments, the monkeypox antigen construct may include and / or encode one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15) of the following: A45L, B9R, B16R, C10L, C21L, E7R, F3L, F4L, G6R, H5R, I3L, O2L, Q1L, B12R, and / or C17L, or fragments thereof.

[0013] In some embodiments, the monkeypox antigen (e.g., a monkeypox B cell antigen) is or includes an E8L polypeptide or a fragment thereof. In various embodiments, the E8L polypeptide or fragment thereof has at least 80% sequence identity (e.g., at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to the E8L amino acid sequence shown in any one of SEQ ID NOs: 41-50 or otherwise known in the art, or the corresponding portion thereof.

[0014] In some embodiments, the monkeypox antigen (e.g., a monkeypox B cell antigen) is or includes an A35R polypeptide or a fragment thereof. In various embodiments, the A35R polypeptide or fragment thereof has at least 80% sequence identity (e.g., at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to the A35R amino acid sequence shown in any one of SEQ ID NOs: 11-20 or otherwise known in the art, or the corresponding portion thereof.

[0015] In some embodiments, the monkeypox antigen (e.g., a monkeypox B cell antigen) is or includes a B6R polypeptide or a fragment thereof. In various embodiments, the B6R polypeptide or fragment thereof has at least 80% sequence identity (e.g., at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to the B6R amino acid sequence shown in any one of SEQ ID NOs: 21-30 or otherwise known in the art, or the corresponding portion thereof.

[0016] In some embodiments, the monkeypox antigen (e.g., a monkeypox B cell antigen) is or includes an M1R polypeptide or a fragment thereof. In various embodiments, the M1R polypeptide or fragment thereof has at least 80% sequence identity (e.g., at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to the M1R amino acid sequence set forth in any one of SEQ ID NOs: 31-40 or otherwise known in the art, or the corresponding portion thereof.

[0017] In some embodiments, the monkeypox antigen (e.g., a monkeypox B cell antigen) is or includes an H3L polypeptide or a fragment thereof. In various embodiments, the H3L polypeptide or fragment thereof has at least 80% sequence identity (e.g., at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to the H3L amino acid sequence shown in any one of SEQ ID NOs: 51-60 or otherwise known in the art, or the corresponding portion thereof.

[0018] In some embodiments, the monkeypox antigen (e.g., monkeypox B cell antigen) is or includes an A28L polypeptide or a fragment thereof. In various embodiments, the A28L polypeptide or fragment thereof has at least 80% sequence identity (e.g., at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to the A28L amino acid sequence shown in SEQ ID NO: 196 or otherwise known in the art, or a corresponding portion thereof.

[0019] In some embodiments, the monkeypox antigen (e.g., monkeypox T cell antigen) is or includes an A45L polypeptide or a fragment thereof. In various embodiments, the A45L polypeptide or fragment thereof has at least 80% sequence identity (e.g., at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to the A45L amino acid sequence shown in Table 2 or otherwise known in the art, or the corresponding portion thereof.

[0020] In some embodiments, the monkeypox antigen (e.g., a monkeypox B cell antigen) is or includes an A29L polypeptide or a fragment thereof. In various embodiments, the A29L polypeptide or fragment thereof has at least 80% sequence identity (e.g., at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to the A29L amino acid sequence shown in any one of SEQ ID NOs: 1-10 or otherwise known in the art, or the corresponding portion thereof.

[0021] In some embodiments, the monkeypox antigen (e.g., a monkeypox T cell antigen) is or includes a B9R polypeptide or a fragment thereof. In various embodiments, the B9R polypeptide or fragment thereof has at least 80% sequence identity (e.g., at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to a B9R amino acid sequence shown in Table 2 or otherwise known in the art, or a corresponding portion thereof.

[0022] In some embodiments, the monkeypox antigen (e.g., a monkeypox T cell antigen) is or includes a B16R polypeptide or a fragment thereof. In various embodiments, the B16R polypeptide or fragment thereof has at least 80% sequence identity (e.g., at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to the B16R amino acid sequence shown in Table 2 or otherwise known in the art, or the corresponding portion thereof.

[0023] In some embodiments, the monkeypox antigen (e.g., a monkeypox T cell antigen) is or includes a C10L polypeptide or a fragment thereof. In various embodiments, the C10L polypeptide or fragment thereof has at least 80% sequence identity (e.g., at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to the C10L amino acid sequence shown in Table 2 or otherwise known in the art, or the corresponding portion thereof.

[0024] In some embodiments, the monkeypox antigen (e.g., a monkeypox T cell antigen) is or includes a C21L polypeptide or a fragment thereof. In various embodiments, the C21L polypeptide or fragment thereof has at least 80% sequence identity (e.g., at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to the C21L amino acid sequence shown in Table 2 or otherwise known in the art, or the corresponding portion thereof.

[0025] In some embodiments, the monkeypox antigen (e.g., a monkeypox T cell antigen) is or includes an E7R polypeptide or a fragment thereof. In various embodiments, the E7R polypeptide or fragment thereof has at least 80% sequence identity (e.g., at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to the E7R amino acid sequence shown in Table 2 or otherwise known in the art, or the corresponding portion thereof.

[0026] In some embodiments, the monkeypox antigen (e.g., a monkeypox T cell antigen) is or includes a F3L polypeptide or a fragment thereof. In various embodiments, the F3L polypeptide or fragment thereof has at least 80% sequence identity (e.g., at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to a F3L amino acid sequence shown in Table 2 or otherwise known in the art, or a corresponding portion thereof.

[0027] In some embodiments, the monkeypox antigen (e.g., a monkeypox T cell antigen) is or includes a F4L polypeptide or a fragment thereof. In various embodiments, the F4L polypeptide or fragment thereof has at least 80% sequence identity (e.g., at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to a F4L amino acid sequence shown in Table 2 or otherwise known in the art, or a corresponding portion thereof.

[0028] In some embodiments, the monkeypox antigen (e.g., a monkeypox T cell antigen) is or includes a G6R polypeptide or a fragment thereof. In various embodiments, the G6R polypeptide or fragment thereof has at least 80% sequence identity (e.g., at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to a G6R amino acid sequence shown in Table 2 or otherwise known in the art, or a corresponding portion thereof.

[0029] In some embodiments, the monkeypox antigen (e.g., a monkeypox T cell antigen) is or includes an H5R polypeptide or a fragment thereof. In various embodiments, the H5R polypeptide or fragment thereof has at least 80% sequence identity (e.g., at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to an H5R amino acid sequence shown in Table 2 or otherwise known in the art, or a corresponding portion thereof.

[0030] In some embodiments, the monkeypox antigen (e.g., a monkeypox T cell antigen) is or includes a I3L polypeptide or a fragment thereof. In various embodiments, the I3L polypeptide or fragment thereof has at least 80% sequence identity (e.g., at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to the I3L amino acid sequence shown in Table 2 or otherwise known in the art, or the corresponding portion thereof.

[0031] In some embodiments, the monkeypox antigen (e.g., a monkeypox T cell antigen) is or includes an O2L polypeptide or a fragment thereof. In various embodiments, the O2L polypeptide or fragment thereof has at least 80% sequence identity (e.g., at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to the O2L amino acid sequence shown in Table 2 or otherwise known in the art, or the corresponding portion thereof.

[0032] In some embodiments, the monkeypox antigen (e.g., a monkeypox T cell antigen) is or includes a Q1L polypeptide or a fragment thereof. In various embodiments, the Q1L polypeptide or fragment thereof has at least 80% sequence identity (e.g., at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to a Q1L amino acid sequence shown in Table 2 or otherwise known in the art, or a corresponding portion thereof.

[0033] In some embodiments, the monkeypox antigen (e.g., a monkeypox T cell antigen) is or includes a B12R polypeptide or a fragment thereof. In various embodiments, the B12R polypeptide or fragment thereof has at least 80% sequence identity (e.g., at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to a B12R amino acid sequence shown in Table 2 or otherwise known in the art, or a corresponding portion thereof.

[0034] In some embodiments, the monkeypox antigen (e.g., a monkeypox T cell antigen) is or includes a C17L polypeptide or a fragment thereof. In various embodiments, the C17L polypeptide or fragment thereof has at least 80% sequence identity (e.g., at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to the C17L amino acid sequence shown in Table 2 or otherwise known in the art, or the corresponding portion thereof.

[0035] As disclosed herein, a monkeypox antigen can be or include (i) a polypeptide or fragment thereof of an antigen of Table 1 (e.g., an A29L polypeptide or fragment thereof, an A35R polypeptide or fragment thereof, a B6R polypeptide or fragment thereof, an M1R polypeptide or fragment thereof, an E8L polypeptide or fragment thereof, an A28L polypeptide or fragment thereof, or an H3L polypeptide or fragment thereof) or (ii) a polypeptide or fragment thereof of an antigen of Table 2 (e.g., an A45L polypeptide or fragment thereof, a B9R polypeptide or fragment thereof, a B16R polypeptide or fragment thereof, a C10L polypeptide or fragment thereof, a C21L polypeptide or fragment thereof, an E7R polypeptide or fragment thereof, an F3L polypeptide or fragment thereof, an F4L polypeptide or fragment thereof, a G6R polypeptide or fragment thereof, an H5R polypeptide or fragment thereof, an I3L polypeptide or fragment thereof, an O2L polypeptide or fragment thereof, a Q1L polypeptide or fragment thereof, a B12R polypeptide or fragment thereof, or a C17L polypeptide or fragment thereof).

[0036] In various embodiments, the monkeypox antigen may include amino acid modifications engineered to reduce the number of N-linked glycosylation sites present in the monkeypox antigen sequence (e.g., compared to a reference). Without wishing to be bound by any particular scientific theory, the reduction in the number of N-linked glycosylation sites may be advantageous, at least in part because monkeypox antigens expressed during viral infection do not undergo N-linked glycosylation, but monkeypox antigens expressed by polyribonucleotides of the present disclosure (e.g., when delivered to a host for monkeypox vaccination) may obtain N-linked glycans. This may occur, for example, when an antigen encoded by a polyribonucleotide of the present disclosure is operably linked to a signal peptide that targets the antigen to the host secretory system. This acquisition of N-linked glycans by polyribonucleotide-encoded antigens will potentially introduce structures and / or features (e.g., epitopes) that are not present in virally expressed antigens, and / or eliminate structures and / or features (e.g., epitopes) that are present in virally expressed antigens, thereby potentially reducing vaccine efficacy.

[0037] The present disclosure includes that, in various embodiments, the monkeypox antigens can include amino acid modifications that modify and / or eliminate N-linked glycosylation motifs present in the reference sequence (which is the corresponding portion of the sequence provided in Table 1 or Table 2). In specific embodiments, the monkeypox antigens can include amino acid modifications in which, for example, an asparagine (N) residue is substituted with a glutamine (Q) residue as compared to the reference sequence. In specific embodiments, the monkeypox antigens can include amino acid modifications in which, in the case of an NXT / S N-linked glycosylation motif of the reference sequence, an asparagine (N) residue is substituted with a glutamine (Q) residue as compared to the reference sequence, which substitution (in the absence of other changes) will result in a QXT / S motif.

[0038] In various embodiments, monkeypox antigens may include amino acid modifications (e.g., compared to a reference) that are engineered to reduce the number of unpaired cysteine ​​residues or mispaired cysteine ​​residues present in the monkeypox antigen sequence. Without wishing to be bound by any particular scientific theory, the reduction in the number of unpaired cysteine ​​residues may be advantageous, at least in part because the presence of unpaired cysteine ​​residues or mispaired cysteine ​​residues brings about the risk of misfolding and / or aggregation. Antigen misfolding and / or aggregation will potentially introduce structures and / or features (e.g., epitopes) that are not present in virally expressed antigens, and / or eliminate structures and / or features (e.g., epitopes) present in virally expressed antigens, thereby potentially reducing vaccine efficacy. In various embodiments, monkeypox antigens may include amino acid modifications that replace cysteine ​​residues (e.g., unpaired or mispaired cysteine ​​residues) with different residues (e.g., alanine residues) compared to the corresponding portions of the sequences provided in Table 1 or Table 2.

[0039] The monkeypox antigen can be encoded by a polyribonucleotide, which can be referred to as a monkeypox antigen construct. In various embodiments, the monkeypox antigen construct can be present in a composition for delivering the monkeypox antigen construct to a subject. In various embodiments, the monkeypox antigen construct can be present in a composition for delivering one or more monkeypox antigens and / or epitopes to a subject. In various embodiments, the monkeypox antigen construct can be or include a polyribonucleotide encoding one or more antigens and / or epitopes.

[0040] In some embodiments, the composition for delivering the monkeypox antigenic construct and / or the monkeypox antigenic construct may advantageously include, for example, one or more monkeypox B cell antigens and one or more monkeypox T cell antigens (e.g., CD4 and / or CD8 T cell antigens). Without wishing to be bound by any particular scientific theory, and without suggesting that other embodiments are not advantageous, a combination of B cell antigens and T cell antigens may be advantageous in promoting immune system defense against monkeypox at multiple points in the life cycle, including but not limited to before and after cell entry.

[0041] The present disclosure includes such recognition that for certain conditions (such as monkeypox), antibodies that target and / or bind to monkeypox antigens (e.g., neutralizing antibodies that target and / or bind to monkeypox antigens) can be used and / or are sufficient to treat the condition. Therefore, in various embodiments, the present disclosure provides monkeypox antigen constructs and compositions (e.g., pharmaceutical compositions, such as immunogenic compositions, such as vaccines) that contain and / or deliver monkeypox B cell antigens and / or antigenic constructs that induce neutralizing antibodies. In some embodiments, the present disclosure provides constructs and compositions that induce robust B cell responses. In some embodiments, the B cell response includes the generation of a diverse library of specific antibodies. In some embodiments, the present disclosure provides monkeypox antigen constructs and compositions (e.g., pharmaceutical compositions, such as immunogenic compositions, such as vaccines) that contain and / or deliver antigenic constructs that induce neutralizing antibodies and T cells (e.g., CD4 and / or CD8 T cells). Such neutralizing antibodies and / or T cells (e.g., CD4 and / or CD8 T cells) can target, for example, one or more monkeypox surface proteins. In some embodiments, the present disclosure provides constructs and compositions that induce particularly strong neutralizing antibody responses and / or particularly diverse T cell responses (e.g., targeting multiple T cell epitopes). In some embodiments, the present disclosure provides constructs and compositions that induce T cell and B cell responses to monkeypox antigens and / or epitopes.

[0042] The present disclosure provides the following understanding: for example, constructs and compositions comprising polyribonucleotide molecules as described herein (for example, encoding one or more monkeypox antigens and / or epitopes) can result in a higher degree of antigen presentation to various immune system components and / or pathways. In some embodiments, administering such constructs or compositions can induce B cell and / or T cell responses. The present disclosure provides such insights, that is, for example, in some embodiments wherein inducing B cell and T cell responses in a subject, the subject can have a more durable long-term immune response. Such an immune response can be beneficial, for example, utilizing a single administration to prevent monkeypox reactivation, which can improve vaccination rates and subject compliance compared to currently available vaccines that need to be administered every few years. In some embodiments, constructs and compositions comprising polyribonucleotides as described herein (for example, encoding one or more monkeypox antigens and / or epitopes) can provide more diverse protection (for example, protection against monkeypox variants), because without wishing to be bound by any particular theory, these constructs and compositions can induce a variety of immune system responses.

[0043] The present disclosure also provides the recognition that by administering constructs and compositions encoding monkeypox antigens and / or epitopes, the constructs and compositions described herein avoid the administration of monkeypox virus particles that could infect a subject, enter latency, and / or reactivate to cause an outbreak.

[0044] The present disclosure provides a variety of insights and technologies related to monkeypox antigen constructs and vaccines (e.g., polyribonucleotide vaccines) compositions. In some embodiments, the present disclosure provides specific pharmaceutical compositions (e.g., immunogenic compositions, such as vaccines) forms, including, for example, polyribonucleotide pharmaceutical compositions (e.g., immunogenic compositions, such as vaccines) comprising specific elements and / or sequences that can be used for vaccination.

[0045] As described herein, in many embodiments, the compositions (e.g., pharmaceutical compositions, immunogenic compositions and / or vaccines) provided include polyribonucleotides encoding one or more monkeypox antigens or fragments thereof or epitopes. In some embodiments, such polyribonucleotides are modified polyribonucleotides because they include positions where uridine residues are replaced by uridine analogs (e.g., pseudouridine) and / or positions where pseudouridine is present. Alternatively or additionally, in some embodiments, polyribonucleotides include specific elements (e.g., caps, 5'UTRs, 3'UTRs, poly-A tails, etc.) and / or features (e.g., codon optimization), which are identified, selected, characterized, and / or confirmed to achieve and / or increase the translatability (e.g., in vitro) and / or expression (e.g., in subjects to whom polyribonucleotides have been administered) of the encoded protein.

[0046] In some embodiments, polyribonucleotide comprises through identification, selection, characterization and / or confirmation to realize significant and / or increased polyribonucleotide stability and / or specific elements and / or features of effective manufacturing, particularly in large-scale situations (for example, 0.1-10g, 10-500g, 500g-1kg, 750g-1.5kg; It will be appreciated by those skilled in the art that different products can be manufactured with different scales (for example, depending on patient population size). In some embodiments, such polyribonucleotide manufacturing scale can be in the following range: about 0.01g / hr polyribonucleotide to about 1g / hr polyribonucleotide, about 1g / hr polyribonucleotide to about 100g / hr polyribonucleotide, about 1g polyribonucleotide / hr to about 20g polyribonucleotide / hr, or about 100g polyribonucleotide / hr to about 10,000g polyribonucleotide / hr. In some embodiments, polyribonucleotide manufacturing scale can be tens or hundreds of milligrams to tens or hundreds of grams (or more) of polyribonucleotide per batch. In some embodiments, the polyribonucleotide manufacturing scale can allow batch sizes in the following ranges: about 0.01g to about 500g polyribonucleotides, about 0.01g to about 10g polyribonucleotides, about 1g to about 10g polyribonucleotides, about 10g to about 500g polyribonucleotides, about 10g to about 300g polyribonucleotides, about 10g to about 200g polyribonucleotides, or about 30g to about 60g polyribonucleotides.

[0047] In many embodiments, provided compositions (e.g., pharmaceutical compositions, e.g., immunogenic compositions, e.g., vaccines) comprising polyribonucleotides are prepared, formulated, and / or used in specific LNP compositions (e.g., as described herein).

[0048] Among other things, the present disclosure provides techniques for the rapid development of pharmaceutical compositions (eg, immunogenic compositions, such as monkeypox vaccines) for delivering specific monkeypox antigen constructs to subjects.

[0049] In addition, the present disclosure provides, for example, nucleic acid constructs encoding the monkeypox antigens or fragments thereof disclosed herein, expressing the monkeypox antigens or fragments thereof disclosed herein; and various methods of production and / or use thereof; as well as compositions developed therewith and methods related thereto.

[0050] The present disclosure provides for preventing, characterizing, treating and / or monitoring monkeypox outbreak and / or infection technology, including for example various nucleic acid constructs and encoded proteins, and agents (for example, antibodies) bound to such proteins, and compositions comprising and / or delivering them. In some aspects, provided herein is technology (for example, compositions and methods) for strengthening, inducing, promoting, enhancing and / or improving the immune response for monkeypox or its components (for example, protein or its part). In some embodiments, provided herein is technology designed to strengthen, induce, promote, enhance and / or improve the immune memory for monkeypox or its components (for example, protein or its part). In some embodiments, technology as described herein is designed to be used as the immunopotentiator for the first vaccine (primary vaccine), such as vaccines for one or more epi-positions of monkeypox. In some embodiments, compositions of the present disclosure include one or more polynucleotide constructs (for example, one or more string constructs) encoding one or more epi-positions from monkeypox. In some embodiments, the present disclosure provides vaccines or other compositions comprising nucleic acids encoding such monkeypox epitopes; those skilled in the art will understand from the context that when referring to a particular polynucleotide (e.g., DNA or RNA), "encoding" such an epitope actually refers to the coding strand or its complement. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 This is a phylogenetic tree of the poxvirus, chordopoxvirus, and orthopoxvirus gene families.

[0052] Figure 2 is a phylogenetic heatmap showing the percentage of identity between the poxvirus, chordopoxvirus, and orthopoxvirus gene families.

[0053] Figure 3Schematic diagram showing the structure and life cycle of orthopoxviruses (ViralZone 2016, Swiss Institute of Bioinformatics, see https: / / viralzone.expasy.org / 4400).

[0054] Figure 4A This is a micrograph of vaccinia virus and the corresponding structural diagram. Figure 4B Schematic diagram of the vaccinia virus genome.

[0055] Figure 5 is a diagram illustrating the poxvirus life cycle.

[0056] Figure 6 is a schematic diagram showing vaccinia virus antigens.

[0057] Figure 7A is a line graph from Hooper et al., J Virol 2004 (https: / / doi.org / 10.1128 / JVI.78.9.4433-4443.2004 “Smallpox DNA Vaccine Protects Nonhuma n Primates against Lethal Monkeypox”) showing plaque reduction neutralization test (PRNT) 80% neutralization titers in sera collected from rhesus macaques immunized with various smallpox strains and challenged with monkeypox. Figure 7B yes Figure 7A Table of corresponding vaccination history and challenge outcomes for the rhesus macaques described in .

[0058] Figure 8A is a line graph from Fogg et al. J Virol 2004 (DOI: 10.1128 / JVI.78.19.10230–10237.2004; “Protective Immunity to Vaccinia Virus Induced by Vaccination with Multiple Recombinant Outer Membrane Proteins of Intracellular and Extracellular Virions”) showing the percentage of surviving mice immunized with a single recombinant protein or a combination of recombinant proteins and challenged with VV-WR. Figure 8B yes Figure 8A Line graph of the corresponding weights (percent of initial weight) of the mice described in .

[0059] Figure 9Ais a line graph from Heraud et al. J. Immunol 2016 (https: / / doi.org / 10.4049 / jimmunol.177.4.2552; “Subunit Recombinant Vaccine Protects against Monkeypox”) showing serum antibody titers collected from rhesus macaques immunized with purified monkeypox virus proteins A27Lo (top panel) and B5Ro (bottom panel); the x-axis shows the time of immunization in weeks. Figure 9B is a line graph from Heraud et al. showing serum antibody titers collected from rhesus macaques immunized with purified monkeypox virus proteins A33Ro (upper panel) and L1Ro (lower panel); the x-axis shows the time of immunization in weeks. Figure 9C is a graph showing kinetic ELISA data (mOD / minute) of serum antibody responses in rhesus macaques immunized with monkeypox protein or homologous vaccinia protein.

[0060] Figure 10A is a graph from Heraud et al. J. Immunol 2016 (https: / / doi.org / 10.4049 / jimmunol.177.4.2552; “Subunit Recombinant Vaccine Protects against Monkeypox”) showing regression analysis of the percentage of CD4+ T cell responses and the maximum number of lesions measured as IL-2-producing CD4+ T cells, where each number refers to data from animals from Groups 1-4. Figure 10B is a graph from Heraud et al. showing regression analysis of the percentage of CD4+ T cell response and the maximum number of lesions measured as TNF-α and IFN-γ producing CD4+ T cells. Figure 10C Figure 2 is a regression analysis of the level of neutralizing antibodies against intracellular mature vaccinia virus and the time to maximum pox lesion number. Open circles represent animals from the group immunized with DNA. Closed circles represent animals from the group immunized with protein plus CpG. Open rectangles represent animals from the group immunized with protein plus alum. Closed diamonds represent animals from the group immunized with DNA plus protein.

[0061] Figure 11Figure 2 is from Gilchuk et al. Cell 2016 (DOI: 10.1016 / j.cell.2016.09.049; “Cross-Neutralizing and Protective Human Antibody Specificities to Poxvirus Infections”) showing the cross-neutralizing potency (plotted as maximum percent neutralization (E)) of vaccinia virus (VACV), cowpox virus (CPXV), and monkeypox virus (MPXV) by individual neutralizing human monoclonal antibodies raised against vaccinia virus. max ), above; and IC 50 , below).

[0062] Figure 12 Figure 2 is a set of Kaplan-Meier plots from Gilchuk et al. Cell 2016 (DOI: 10.1016 / j.cell.2016.09.049; “Cross-Neutralizing and Protective Human Antibody Specificities to Poxvirus Infections”) showing the survival percentage of BalbC SCID mice challenged with vaccinia virus and then vaccinated with monoclonal antibodies targeting different antigens or combinations thereof.

[0063] Figure 13A is a set of line graphs from Gilchuk et al. Cell 2016 (DOI: 10.1016 / j.cell.2016.09.049; “Cross-Neutralizing and Protective Human Antibody Specificities to Poxvirus Infections”) showing body weights of C57BL / 6 mice vaccinated with individual monoclonal antibodies prior to challenge with vaccinia virus. Figure 13B is a set of graphs from Gilchuk et al. showing body weight (left panel) and percent survival (right panel) of C57BL / 6 mice vaccinated with a combination of monoclonal antibodies prior to challenge with vaccinia virus.

[0064] Figure 14Figure 1 is a set of graphs from Gilchuk et al. Cell 2016 (DOI: 10.1016 / j.cell.2016.09.049; “Cross-Neutralizing and Protective Human Antibody Specificities to Poxvirus Infections”) showing the cross-neutralizing potency (plotted as maximum percent neutralization (E)) of vaccinia virus (VACV), cowpox virus (CPXV), and monkeypox virus (MPXV) mature virions (MV, left panel) and enveloped virions (EV, right panel) by individual neutralizing human monoclonal antibodies raised against vaccinia virus and combinations of monoclonal antibodies. max ) and IC 50 .

[0065] Figure 15 Schematic diagram from Edghill-Smith et al. Nature Medicine 2005 (https: / / doi.org / 10.1038 / nm1261) showing the vaccination schedule for control antibody (RSV), anti-CD20 antibody (Rituxan), anti-CD28 antibody (cM-T807), Dryvax, and monkeypox virus challenge in three groups of macaques.

[0066] Figure 16 is a table from Edghill-Smith et al. Nature Medicine 2005 (https: / / doi.org / 10.1038 / nm1261), which shows Figure 15 Vaccinia virus antibody titers, monkeypox virus genome concentrations, and skin pockmark incidence in macaques vaccinated as described in [ 2 ].

[0067] Figure 17A and Figure 17B is a set of figures from Heraud et al. J. Immunol 2016 (https: / / doi.org / 10.4049 / jimmunol.177.4.2552) showing peptide scanning of L1Ro protein by ELISA. Figure 17C Figure 2 is a diagram of B cell predicted epitopes obtained from BcePred software and an inset showing the amino acid sequence of related orthopoxviruses.

[0068] Figure 18A is a ribbon topology showing the structure of smallpox (SPX) L1R from: Su et al. 2005. PNAS. Figure 18B Figure 2 is a ribbon topology diagram showing the binding interaction between the 7D11 neutralizing antibody and L1R. The arrow indicates the binding site at Asp35.

[0069] Figure 19 is a diagram showing the predicted transmembrane helices of the antigen M1R using TMHMM version 2.0, which is located at http: / / www.cbs.dtu.dk / services / TMHMM / .

[0070] Figure 20A is a schematic diagram from Chang et al. 2013. PLoS Pathogens showing the domain structure of SPX A27L. Figure 20B is a space-filling strip topology diagram showing the structure of SPX A27L.

[0071] Figure 21A A ribbon topology of the structure of poxvirus A33 (top) and a schematic diagram of its orientation in the cell membrane (bottom) from SU et al. J Virol. 2010, https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC2820914 / . Figure 21B is a schematic diagram of the orientation of A35R in the cell membrane (left). Figure 21C Figure 2 is a ribbon topology of the structure of the A27D7 “protective antibody” from Matho et al. PLoS Pathog. 2015 (https: / / doi.org / 10.1371 / journal.ppat.1005148) and its binding interaction with the A33 antigen (right panel).

[0072] Figure 22A and Figure 22B is a set of figures from Heraud et al. J. Immunol 2016 (https: / / doi.org / 10.4049 / jimmunol.177.4.2552) showing peptide scanning of A33Ro protein by ELISA. Figure 22C Figure 2 is a diagram of B cell predicted epitopes obtained from BcePred software and an inset showing the amino acid sequence of related orthopoxviruses.

[0073] Figure 23ASchematic representation of the orientation of the monkeypox (MPX) B6R antigen in the cell membrane, generated using Protter (Ulrich Omasits et al., Protter: interactive protein feature visualization and integration with experimental proteomic data, Bioinformatics, Vol. 30, No. 6, March 2014, pp. 884–886, https: / / doi.org / 10.1093 / bioinformatics / btt607). Figure 23B Space-filling model of C3b complement protein and variola virus SPICE antigens (CCP1-4) from Forneris et al. EMBO J. 2016 (https: / / doi.org / 10.15252 / embj.201593673). Figure 23C is a draft representation of the CCP domain (1-4) of the variola virus SPICE antigen from Forneris et al.

[0074] Figure 24A and Figure 24B is a set of figures from Heraud et al. J. Immunol 2016 (https: / / doi.org / 10.4049 / jimmunol.177.4.2552) showing peptide scanning of B5Ro protein by ELISA. Figure 24C Figure 2 is a diagram of B cell predicted epitopes obtained from BcePred software and an inset showing the amino acid sequence of related orthopoxviruses.

[0075] Figure 25 is a schematic diagram from Aldaz-Carroll et al. J Virol. 2005 (https: / / doi.org / 10.1128 / JVI.79.10.6260-6271.2005) showing the domain structure of the vaccinia virus B5R antigen and the change (n-fold) relative to background of monoclonal anti-B5R antibodies bound by a peptide spanning the extracellular domain of B5R.

[0076] Figure 26 is a graph from Aldaz-Carroll et al. J Virol. 2005 (https: / / doi.org / 10.1128 / JVI.79.10.6260-6271.2005) showing reduction of extracellular enveloped virus (EEV) plaques by anti-B5R(275t) monoclonal antibodies.

[0077] Figure 27 is the amino acid sequence of B5R from Aldaz-Carroll et al. J Virol. 2005 (https: / / doi.org / 10.1128 / JVI.79.10.6260-6271.2005), which shows overlapping peptides (black bars) spanning the extracellular domain of B5R (corresponding to Figure 25 peptides described in ).

[0078] Figure 28A is a schematic diagram generated using Protter showing the orientation of the H3L antigen in the cell membrane. Figure 28B is a ribbon topology from Singh et al., J Virol. 2016 (https: / / doi.org / 10.1128 / JVI.02933-15) showing the structure of the H3 antigen.

[0079] Figure 29 A multiple sequence alignment showing conservation of the A45L antigen between residues 57-149 among Orthopoxviridae viruses.

[0080] Figure 30 A multiple sequence alignment showing conservation of the Q1L antigen between residues 210-346 among Orthopoxviridae viruses.

[0081] Figure 31 A multiple sequence alignment showing the conservation of the Q1L antigen between residues 546-658 among Orthopoxviridae viruses.

[0082] Figure 32 A multiple sequence alignment showing conservation of the B12R antigen between residues 148-244 among Orthopoxviridae viruses.

[0083] Figure 33 A multiple sequence alignment showing conservation of the C17L antigen between residues 18-76 among Orthopoxviridae viruses.

[0084] Figure 34 A multiple sequence alignment showing conservation of the C17L antigen between residues 185-281 among Orthopoxviridae viruses.

[0085] Figure 35 A multiple sequence alignment showing conservation of the I3L antigen between residues 126-199 among Orthopoxviridae viruses.

[0086] Figure 36 is a set of schematic diagrams showing T cell string constructs.

[0087] Figure 37Heatmap of subsets of the complete monkeypox and caccinia transcriptomes from Rubins et al. PLosOne 2008 (https: / / doi.org / 10.1371 / journal.pone.0002628) showing early gene expression during poxvirus infection. MPX = Monkeypox Zaire; VAC WR = Vaccinia Western Reserve; E = Early; L = Late.

[0088] Figure 38 Heatmap from Rubins et al. PLos One 2008 (https: / / doi.org / 10.1371 / journal.pone.0002628) showing the expression levels of poxvirus gene transcripts whose products are known or predicted to regulate interferon signaling. MP X = Zaire monkeypox; VAC WR = Western Reserve vaccinia; E = early; L = late.

[0089] Figure 39A Figure 2 is a graph from Assarsson et al. PNAS 2008 (https: / / doi.org / 10.1073 / pnas.0711573105) showing the kinetics of orthopoxvirus gene expression for groups of genes associated with specific functions, with the fraction (%) of each group belonging to each kinetic category (immediate-early, early, early / late, or late). Figure 39B is a line graph from Assarsson et al. showing the average OPV ORF expression at each time point for genes within each kinetic category (e.g. Figure 39A (described in ).

[0090] Figure 40A is a set of line graphs from Croft et al. Mol Cell Proteomics 2015 (https: / / doi.org / 10.1074 / mcp.M114.047373) showing cluster analysis of vaccinia virus protein gene expression during the first time course. Figure 40B is a set of line graphs from Croft et al. showing cluster analysis of vaccinia virus protein gene expression during the second time course. The bar graphs show the relative percentage of proteins at each time category that fall within each cluster.

[0091] Figure 41 is a table showing the epitope density of monkeypox virus (MPXV) antigens and the identification of exemplary T cell epitopes.

[0092] Figure 42ASchematic diagram of the full-length M1R antigen and the corresponding amino acid sequence. Figure 42B Schematic diagram of the full-length M1R antigen with the N-terminal HSV-1 gD signal peptide / secretion domain and the corresponding amino acid sequence.

[0093] Figure 43A Schematic diagram of the full-length A29L antigen and the corresponding amino acid sequence. Figure 43B Schematic diagram of the full-length A29L antigen with the N-terminal HSV-1 gD signal peptide / secretion domain and the corresponding amino acid sequence. Figure 43C Schematic diagram of the full-length A29L antigen with C71A and C72A substitutions and the N-terminal HSV-1 gD signal peptide / secretion domain, and the corresponding amino acid sequence.

[0094] Figure 44A Schematic diagram of the full-length A35R antigen and the corresponding amino acid sequence. Figure 44B Schematic diagram of a polypeptide construct comprising an N-terminal HSV-1 gD signal peptide / secretion domain and two extracellular domains (ECDs) of A35R antigens connected by a linker, and the corresponding amino acid sequence.

[0095] Figure 45A Schematic diagram of the full-length B6R antigen and the corresponding amino acid sequence. Figure 45B Schematic diagram of the full-length B6R antigen with the C140A substitution and the corresponding amino acid sequence.

[0096] Figure 46A Schematic diagram of the full-length H3L antigen and the corresponding amino acid sequence. Figure 46B Schematic diagram of the full-length H3L antigen with the N-terminal HSV-1 gD signal peptide / secretion domain and the corresponding amino acid sequence. Figure 46C Schematic diagram of the full-length H3L antigen with C86A and C90A substitutions and the N-terminal HSV-1 gD signal peptide / secretion domain, and the corresponding amino acid sequence.

[0097] Figure 47A Schematic diagram of the full-length E8L antigen and the corresponding amino acid sequence. Figure 47B Schematic diagram of the full-length E8L antigen with the N-terminal HSV-1 gD signal peptide / secretion domain and the corresponding amino acid sequence.

[0098] Figure 48A Schematic diagram of the full-length A28L antigen and the corresponding amino acid sequence. Figure 48B Schematic diagram of the full-length A28L antigen with the N-terminal HSV-1 gD signal peptide / secretion domain and the corresponding amino acid sequence.

[0099] Figure 49Schematic diagram of the bicistronic construct encoding the A29L and A28L antigens.

[0100] Figure 50 is a schematic diagram showing a panel of T cell string constructs.

[0101] Figure 51 is a set of figures showing epitope mapping analysis of A45L antigen.

[0102] Figure 52 is a set of graphs showing epitope mapping analysis of Q1L antigen.

[0103] Figure 53 is a set of graphs showing epitope mapping analysis of B12R antigen.

[0104] Figure 54 is a set of graphs showing epitope mapping analysis of C17L antigen.

[0105] Figure 55 is a set of figures showing epitope mapping analysis of I3L antigen.

[0106] Figure 56 is a table showing characteristics of certain antigens of the present disclosure.

[0107] Figure 57 is a schematic diagram showing an optional immunization scheme for mouse studies.

[0108] Figures 58A to 58E It shows that at different RNA concentrations, the E8 ( Figure 58A )、M1( Figure 58B )、A35( Figure 58C )、B6( Figure 58D ) and H3( Figure 58E ) in mammalian cells (e.g., HEK293 cells).

[0109] Figure 59 Graph depicting in vitro expression of exemplary CSP antigen constructs encoding A35, B6, M1, E8, and H3 antigens in mammalian cells (e.g., HEK293 cells). The height of the bar indicates the mean fluorescence intensity; the data are the average of 2 to 3 technical replicates. NT indicates an untransfected control stained with each primary antibody. WT refers to the wild-type antigen sequence, B6C140A refers to the B6 antigen with a C140A substitution, +SP indicates that the antigen includes a secretion signal (e.g., M1 WT+SP refers to the M1 antigen with a secretion signal, e.g., SS+MIR as described in Table 9, H3 CCAA+SP refers to the H3 antigen with a secretion signal and C86A and C90A substitutions.

[0110] Figure 60Schematic representation of an exemplary immunization protocol for mouse immunization and germinal center induction studies.

[0111] Figure 61A and Figure 61B is a line graph showing antibody responses in mice immunized with the A35 antigen construct. Figure 61A is a line graph of serum anti-A35 IgG concentrations in mice immunized with wild-type A35 polyribonucleotide constructs. Figure 61B Graph showing serum anti-A35 IgG concentrations in mice immunized with A35 secretory dimer polyribonucleotide constructs. The vertical axis depicts the antibody level detected in serum (ng / mL), and the horizontal axis indicates the concentration of A35 IgG in the serum (ng / mL). Figure 60 Days after immunization according to the immunization schedule depicted in .

[0112] Figure 62A and Figure 62B is a graph showing anti-A35 antibody responses in mice immunized with A35 antigen constructs and combinations comprising the same. Figure 62A Is displayed based on Figure 60 Graph of serum anti-A35 IgG concentrations on day 21 after immunization according to the immunization schedule depicted in . Figure 62B Figure 2 is a graph showing serum anti-A35 IgG concentrations on day 35 after immunization and boost. The vertical axis depicts the antibody level (ng / mL) detected in serum. Combo 1 contains B6 and M1 antigens; Combo 2 contains A35, B6, and M1 antigens; Combo 3 contains A35, B6, M1, and E8 antigens; Combo 4 contains A35, B6, M1, and H3 antigens; and Combo 5 contains A35 and B6 antigens.

[0113] Figure 63A and Figure 63B is a line graph showing serum anti-B6 IgG concentrations in mice immunized with B6 antigen constructs. Figure 63A is a line graph showing serum anti-B6 IgG concentrations in mice immunized with wild-type B6 polyribonucleotide constructs. Figure 63B Graph depicting serum anti-B6 IgG concentrations in mice immunized with B6, C140A variant polyribonucleotide constructs. The vertical axis depicts the antibody level detected in serum (ng / mL), and the horizontal axis indicates the concentration of B6 IgG in the serum according to the B6 C140A variant polyribonucleotide constructs. Figure 60 Days after immunization according to the immunization schedule depicted in .

[0114] Figure 64A and Figure 64B is a graph showing antibody responses in mice immunized with B6 antigen constructs and combinations comprising the same. Figure 64A It is based on the description Figure 60Graph of serum anti-B6 IgG concentrations on day 21 after immunization according to the immunization schedule depicted in . Figure 64B This graph depicts serum anti-B6 IgG concentrations on day 35 after immunization and boost. The vertical axis depicts the antibody level detected in serum (ng / mL). Combo 1 contains B6 and M1 antigens; Combo 2 contains A35, B6, and M1 antigens; Combo 3 contains A35, B6, M1, and E8 antigens; Combo 4 contains A35, B6, M1, and H3 antigens; and Combo 5 contains A35 and B6 antigens.

[0115] Figure 65 is a line graph showing the concentration of anti-M1 IgG in mice immunized with M1 antigen constructs. The vertical axis depicts the antibody level detected in serum (ng / mL), and the horizontal axis indicates the concentration of anti-M1 IgG in mice immunized with M1 antigen constructs. Figure 60 Days after immunization according to the immunization schedule depicted in .

[0116] Figure 66A and Figure 66B is a graph showing antibody responses in mice immunized with the M1 antigen construct and combinations comprising the same. Figure 66A It is described based on Figure 60 Graph of serum anti-M1 IgG concentrations on day 21 after immunization according to the immunization schedule depicted in . Figure 66B Figure 2 is a graph depicting serum anti-M1 IgG concentrations on day 35 after immunization and boost. The vertical axis depicts the antibody level (ng / mL) detected in the serum. Combo 1 contains B6 and M1 antigens; Combo 2 contains A35, B6, and M1 antigens; Combo 3 contains A35, B6, M1, and E8 antigens; and Combo 4 contains A35, B6, M1, and H3 antigens.

[0117] Figure 67 Graph showing serum anti-E8 IgG concentrations in mice immunized with E8 antigen constructs. The vertical axis depicts the antibody level detected in serum (ng / mL), and the horizontal axis indicates the concentration of E8 in the serum (ng / mL). Figure 60 Days after immunization according to the immunization schedule depicted in .

[0118] Figure 68A and Figure 68B is a graph showing antibody responses in mice immunized with E8 antigen constructs and combinations including the same. Figure 68A It is based on the description Figure 60 Figure 2 is a graph of serum anti-E8 IgG concentrations on day 21 after immunization according to the immunization schedule depicted in FIG. Figure 68B This graph depicts serum anti-E8 IgG concentrations on day 35 after immunization and boost. The vertical axis depicts the antibody level detected in serum (ng / mL). Combo 3 contains A35, B6, M1, and E8 antigens.

[0119] Figure 69A and Figure 69B is a line graph showing antibody responses in mice immunized with H3 antigen constructs. Figure 69A is a line graph depicting serum anti-H3 IgG concentrations in mice immunized with wild-type H3 polyribonucleotide constructs. Figure 69B Graph depicting serum anti-H3 IgG concentrations in mice immunized with H3, C86A / C90A variant polyribonucleotide constructs. The vertical axis depicts the antibody level detected in serum (ng / mL), and the horizontal axis indicates the concentration of H3 antibodies according to the H3 C86A / C90A variant polyribonucleotide constructs. Figure 60 Days after immunization according to the immunization schedule depicted in .

[0120] Figure 70A and Figure 70B is a graph showing antibody responses in mice immunized with H3 antigen constructs and combinations including the same. Figure 70A It is based on the description Figure 60 Graph of serum anti-H3 IgG concentrations on day 21 after immunization according to the immunization schedule depicted in . Figure 70B This graph depicts serum anti-H3 IgG concentrations on day 35 after immunization and boost. The vertical axis depicts the antibody level detected in serum (ng / mL). Combo 4 contains A35, B6, M1, and H3 antigens.

[0121] Figure 71 Graph showing serum anti-A29 IgG concentrations in mice immunized with A29 C71A / C72A variant antigen constructs. The vertical axis depicts the antibody level detected in serum (ng / mL), and the horizontal axis indicates the concentration of A29 IgG in the serum (ng / mL). Figure 60 Days after immunization according to the immunization schedule depicted in .

[0122] Figure 72 The results were shown to achieve 50% neutralization (EC 0.001) of monkeypox virus in an in vitro neutralization assay with serum collected on day 35 from mice immunized with constructs encoding A35, B6, M1, A29, E8, H3 antigens, or a combination thereof. 50 Combo 1 contains B6 and M1 antigens; Combo 2 contains A35, B6, and M1 antigens; Combo 3 contains A35, B6, M1, and E8 antigens; and Combo 4 contains A35, B6, M1, and H3 antigens.

[0123] Figure 73 The present invention shows that 50% neutralization (EC) of monkeypox virus is achieved in an in vitro neutralization assay in the presence of complement by serum collected on day 35 from mice immunized with constructs encoding A35, B6, M1, A29, E8, H3 antigens or a combination thereof. 50Combo 1 contains B6 and M1 antigens; Combo 2 contains A35, B6, and M1 antigens; Combo 3 contains A35, B6, M1, and E8 antigens; and Combo 4 contains A35, B6, M1, and H3 antigens.

[0124] Figure 74A is a panel of flow cytometry dot plots showing cell surface expression of various germinal center induction markers. Figure 74B is a bar graph showing the percentage of germinal center B cells as a proportion of all B cells in mice immunized with A35, B6, M1, E8, or H3 antigen constructs (percentages are means ± SEM). Figure 74C is a bar graph showing the percentage of antigen-specific B cells as a proportion of all germinal center B cells in mice immunized with A35, B6, M1, E8, or H3 antigen constructs (percentages are means ± SEM).

[0125] Figures 75A to 75H is a set of bar graphs showing flow cytometric analysis of HEK293T cells 18 hours after transfection with nucleic acid constructs encoding combinations of antigens (Combo 3 or Combo 4) or combinations of polyribonucleotides encoding single MPXV antigens (A35, B6, M1 or H3). Figure 75A and Figure 75B are bar graphs showing cell viability and antigen expression of HEK293T cells transfected with constructs encoding A35 antigen, Combo 3, or Combo 4, respectively. Figure 75C and Figure 75D are bar graphs showing cell viability and antigen expression of HEK293T cells transfected with constructs encoding B6 antigen, Combo 3, or Combo 4, respectively. Figure 75E and Figure 75F are bar graphs showing cell viability and antigen expression of HEK293T cells transfected with constructs encoding M1 antigen, Combo 3, or Combo 4, respectively. Figure 75G and Figure 75G Figure 2 is a bar graph showing cell viability and antigen expression of HEK293T cells transfected with constructs encoding H3 antigen, Combo 3 or Combo 4, respectively. Combo 3 contains A35, B6, M1 and E8 antigens; and Combo 4 contains A35, B6, M1 and H3 antigens. Cell viability graphs of transfected cells are expressed as a percentage of all cells. Antigen expression is expressed as the mean fluorescence intensity (MFI) of total viable cells under intracellular (total protein) and surface (surface protein) staining conditions. Data are the mean (± standard deviation) of three technical replicates. NT = not transfected, NA = not applicable (i.e., the candidate vaccine does not encode the MPXV antigen being tested).

[0126] Figures 76A to 76D Figure 2 is a line graph showing serum levels of MPXV antigen-specific immunoglobulin G (IgG) collected on days 0 and 21 from Balb / C mice immunized with a combination of constructs encoding a combination of antigens (Combo 3 or Combo 4) or lipid nanoparticles (LNPs) incorporating polyribonucleotides encoding a single MPXV antigen (A35, B6, M1, or H3). Serum samples were collected weekly until day 35, and the expression of MPXV antigen A35 (B6) was measured by enzyme-linked immunosorbent assay (ELISA) at each time point. Figure 76A )、B6( Figure 76B )、M1( Figure 76C ) and H3( Figure 76D ) IgG levels. SEM = standard error of the mean. Combo 3 contains A35, B6, M1, and E8 antigens; and Combo 4 contains A35, B6, M1, and H3 antigens.

[0127] Figure 77A and Figure 77B is a graph showing the MPXV neutralizing activity of serum samples collected on day 35 from Balb / C mice immunized on days 0 and 21 with a composition comprising constructs encoding a combination of antigens (Combo 3 or Combo 4) or modified polyribonucleotides encoding a single MPXV antigen (A35, B6, M1 or H3) as determined by plaque reduction neutralization test (PRNT). Figure 77A and Figure 77B The 50% MPXV neutralizing antibody titers (NT) measured in the absence or presence of baby rabbit complement are shown. 50 ). The dotted line indicates the detection limit set at half the lowest serum dilution tested and twice the highest dilution tested. Combo 3 contains A35, B6, M1, and E8 antigens; and Combo 4 contains A35, B6, M1, and H3 antigens.

[0128] Figures 78A to 78E is a graph showing antigen-specific IFNγ+ T cell responses in whole splenocyte samples collected from Balb / C mice 7 days after immunization with a composition comprising constructs encoding a combination of antigens (Combo 3 or Combo 4) or polyribonucleotides encoding a single MPXV antigen A35, B6, M1, E8, or H3. Figure 78A 、 Figure 78B 、 Figure 78C 、 Figure 78D and Figure 78EThe number of IFNγ+ T cells (per million splenocytes) responding to A35, B6, M1, E8, and H3, respectively, as measured by ELISpot assay, is shown. Each data point represents an individual animal, with the median bar for each group indicated.

[0129] Figure 79A is a schematic diagram showing the immunization schedule used to test the efficacy of the combination polyribonucleotide vaccine in CAST / Ei mice infected intranasally with the hMPXV / USA / MA001 / 2022 monkeypox isolate. Figure 79B Graph showing monkeypox virus titers in the lungs of CAST / Ei mice immunized with control (saline or LNPs incorporating a combination of polyribonucleotides encoding A35 and B6) or compositions containing constructs encoding the combination (Combo 1, Combo 2, Combo 3, or Combo 4) 3 days after intranasal infection with the hMPXV / USA / MA001 / 2022 monkeypox isolate. Figure 79C Graph of monkeypox virus titers in the lungs of CAST / Ei mice immunized 7 days after intranasal infection with the hMPXV / USA / MA001 / 2022 monkeypox isolate with control (saline or LNPs incorporating a combination of polyribonucleotides encoding A35 and B6) or compositions containing constructs encoding combinations (Combo 1, Combo 2, Combo 3, or Combo 4). Combo 1 contains B6 and M1 antigens; Combo 2 contains A35, B6, and M1 antigens; Combo 3 contains A35, B6, M1, and E8 antigens; and Combo 4 contains A35, B6, M1, and H3 antigens.

[0130] Figure 80 is a graph showing the VACV neutralization activity of serum samples collected on day 35 from Balb / C mice immunized on days 0 and 21 with constructs encoding combinations of antigens (Combo 1, Combo 2, Combo 3, or Combo 4) or compositions encoding a single MPXV antigen (A35, B6, M1, A29, E8, or H3). Figure 80Shown are 50% MPXV neutralizing antibody titers (NT50). The dotted line indicates the detection limit set at half the lowest serum dilution tested and twice the highest dilution tested. CCAA+SP refers to H3 antigen with a secretion signal and C86A and C90A substitutions. WT represents wild-type antigen, and SP represents antigen with a non-wild-type signal peptide or secretion signal. Combo 1 contains B6 and M1 antigens; Combo 2 contains A35, B6, and M1 antigens; Combo 3 contains A35, B6, M1, and E8 antigens; Combo 4 contains A35, B6, M1, and H3 antigens; and Combo 5 contains A35 and B6 antigens.

[0131] Figures 81A to 81B is a set of line graphs showing body weight and survival of BALB / c mice immunized with compositions containing constructs encoding combinations of antigens (Combo 1, Combo 2, Combo 3, Combo 4, Combo 5) or saline prior to challenge with vaccinia virus. Figure 81A is a line graph showing weight, and Figure 81B Shown are the survival rates of BALB / c mice immunized with compositions containing constructs encoding combinations of antigens (Combo 1, Combo 2, Combo 3, Combo 4, Combo 5) or saline prior to challenge with vaccinia virus. Combo 1 contains B6 and M1 antigens; Combo 2 contains A35, B6, and M1 antigens; Combo 3 contains A35, B6, M1, and E8 antigens; Combo 4 contains A35, B6, M1, and H3 antigens; and Combo 5 contains A35 and B6 antigens.

[0132] definition

[0133] Compounds of the present disclosure include those generally described above and are further illustrated by the classes, subclasses, and species disclosed herein. As used herein, unless otherwise indicated, the following definitions shall apply. For the purposes of this disclosure, chemical elements are identified according to the Periodic Table of Elements, CAS version, Handbook of Chemistry and Physics, 75th edition. In addition, the general principles of organic chemistry are described in "Organic Chemistry", Thomas Sorrell, University Science Books, Sausalito: 1999 and "March's Advanced Organic Chemistry", 5th edition, editors: Smith, MB and March, J., John Wiley & Sons, New York: 2001, the entire contents of which are hereby incorporated by reference.

[0134] Unless otherwise stated, the structures depicted herein are intended to include all stereoisomeric (e.g., enantiomers or diastereoisomers) forms of the structure, as well as all geometric or conformational isomeric forms of the structure. For example, the R and S configurations of each stereocenter are considered to be part of the present disclosure. Therefore, single stereochemical isomers of the provided compounds, as well as enantiomers, diastereomers, and geometric (or conformational) isomer mixtures are within the scope of the present disclosure. For example, in some cases, the provided compounds display one or more stereoisomers of the compound, and unless otherwise stated, represent each individual stereoisomer and / or mixture. Unless otherwise stated, all tautomeric forms of the provided compounds are within the scope of the present disclosure.

[0135] Unless otherwise indicated, structures depicted herein are intended to include compounds that differ only in the presence of one or more isotopically enriched atoms. For example, compounds having the disclosed structures including replacement of hydrogen by deuterium or tritium or replacement of carbon by 13C- or 14C-enriched carbon are within the scope of the present disclosure.

[0136] About: The term "about" when used herein to refer to a value refers to a value that is similar to the referenced value in context. Generally, one skilled in the art familiar with the context will understand the relative degree of variation encompassed by "about" in that context. For example, in some embodiments, the term "about" can encompass a range of values ​​that are within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less of the referenced value.

[0137] Agent: As used herein, the term "agent" can refer to a physical entity. In some embodiments, an agent can be characterized by a particular characteristic and / or effect. For example, as used herein, the term "therapeutic agent" refers to a physical entity that has a therapeutic effect and / or elicits a desired biological and / or pharmacological effect. In some embodiments, an agent can be a compound, molecule, or entity of any chemical class, including, for example, small molecules, polypeptides, nucleic acids, sugars, lipids, metals, or combinations or complexes thereof.

[0138] Aliphatic: The term "aliphatic" refers to a straight chain (i.e., unbranched) or branched, substituted or unsubstituted hydrocarbon chain that is fully saturated or contains one or more unsaturated units, or a monocyclic or bicyclic hydrocarbon (also referred to herein as "alicyclic") that is fully saturated or contains one or more unsaturated units but is not aromatic, having a single point of attachment or more than one point of attachment to the rest of the molecule. Unless otherwise specified, an aliphatic group contains 1-12 aliphatic carbon atoms. In some embodiments, an aliphatic group contains 1-6 aliphatic carbon atoms (e.g., C 1-6 In some embodiments, aliphatic groups contain 1-5 aliphatic carbon atoms (e.g., C 1-5 In other embodiments, aliphatic groups contain 1-4 aliphatic carbon atoms (e.g., C 1-4 In still other embodiments, aliphatic groups contain 1-3 aliphatic carbon atoms (e.g., C 1-3 ), and in yet other embodiments, aliphatic groups contain 1-2 aliphatic carbon atoms (e.g., C 1-2 Suitable aliphatic groups include, but are not limited to, straight or branched, substituted or unsubstituted alkyl, alkenyl or alkynyl groups and hybrids thereof. Preferred aliphatic groups are C 1-6 alkyl.

[0139] Alkyl: The term "alkyl," used alone or as part of a larger moiety, refers to a group having (unless otherwise indicated) 1-12, 1-10, 1-8, 1-6, 1-4, 1-3, or 1-2 carbon atoms (e.g., C 1-12 、C 1-10 、C 1-8 、C 1-6 、C 1-4 、C 1-3 or C 1-2 ) is a saturated, optionally substituted, straight or branched chain hydrocarbon group. Exemplary alkyl groups include methyl, ethyl, propyl, butyl, pentyl, hexyl and heptyl.

[0140] Alkylene: The term "alkylene" refers to a divalent alkyl group. In some embodiments, an "alkylene" is a divalent straight or branched chain alkyl group. In some embodiments, an "alkylene chain" is a polymethylene group, i.e., -(CH2) n-, wherein n is a positive integer of, for example, 1 to 6, 1 to 4, 1 to 3, 1 to 2, or 2 to 3. Optionally substituted alkylene chains are polymethylenes in which one or more methylene hydrogen atoms are optionally replaced by substituents. Suitable substituents include those described below for substituted aliphatic groups, and also include those described in the specification herein. It should be understood that the two substituents of the alkylene group may together form a ring system. In some embodiments, the two substituents may together form a 3 to 7 membered ring. The substituents may be on the same or different atoms. When attached to certain groups herein, the suffix "-alkene" or "-alkenyl" is intended to refer to the difunctional portion of the group. For example, when attached to "cyclopropyl", "-alkene" or "-alkenyl" becomes "cyclopropylene" or "cyclopropylenyl" and is intended to refer to a difunctional cyclopropyl group, such as

[0141] Alkenyl: The term "alkenyl," used alone or as part of a larger moiety, refers to an alkenyl group having at least one double bond and having (unless otherwise specified) 2-12, 2-10, 2-8, 2-6, 2-4, or 2-3 carbon atoms (e.g., C 2-12 、C 2-10 、C 2-8 、C 2-6 、C 2-4 or C 2-3 ) is an optionally substituted straight or branched chain or cyclic hydrocarbon group. Exemplary alkenyl groups include ethenyl, propenyl, butenyl, pentenyl, hexenyl and heptenyl. The term "cycloalkenyl" refers to an optionally substituted non-aromatic monocyclic or polycyclic ring system containing at least one carbon-carbon double bond and having from about 3 to about 10 carbon atoms. Exemplary monocyclic cycloalkenyl rings include cyclopentenyl, cyclohexenyl and cycloheptenyl.

[0142] Alkynyl: The term "alkynyl," used alone or as part of a larger moiety, refers to a radical having at least one triple bond and having (unless otherwise specified) 2-12, 2-10, 2-8, 2-6, 2-4, or 2-3 carbon atoms (e.g., C 2-12 、C 2-10 、C 2-8 、C 2-6 、C 2-4 or C 2-3 ) is an optionally substituted straight or branched chain hydrocarbon group. Exemplary alkynyl groups include ethynyl, propynyl, butynyl, pentynyl, hexynyl, and heptynyl.

[0143] Amino Acid: In the broadest sense, as used herein, the term "amino acid" refers to a compound and / or substance that can be, is, or has been incorporated into a polypeptide chain, for example, by forming one or more peptide bonds. In some embodiments, an amino acid has the general structure H2N–C(H)(R)–COOH. In some embodiments, the amino acid is a naturally occurring amino acid. In some embodiments, the amino acid is a non-natural amino acid; in some embodiments, the amino acid is a D-amino acid; in some embodiments, the amino acid is an L-amino acid. "Standard amino acid" refers to any of the twenty standard L-amino acids commonly found in naturally occurring peptides. "Non-standard amino acid" refers to any amino acid other than the standard amino acids, whether synthetically prepared or obtained from a natural source. In some embodiments, the amino acids in a polypeptide (including the carboxyl and / or amino terminal amino acids) may contain structural modifications compared to the general structure described above. For example, in some embodiments, an amino acid may be modified compared to the general structure by methylation, amidation, acetylation, pegylation, glycosylation, phosphorylation, and / or substitution (e.g., substitution of an amino group, a carboxylic acid group, one or more protons, and / or hydroxyl groups). In some embodiments, such modifications may, for example, alter the circulating half-life of a polypeptide comprising the modified amino acid, compared to a polypeptide comprising an otherwise identical unmodified amino acid. In some embodiments, such modifications do not significantly alter the relevant activity of a polypeptide comprising the modified amino acid, compared to a polypeptide comprising an otherwise identical unmodified amino acid. As will be clear from the context, in some embodiments, the term "amino acid" may be used to refer to a free amino acid; in some embodiments, it may be used to refer to an amino acid residue of a polypeptide.

[0144] Aryl: The term "aryl" refers to monocyclic and bicyclic ring systems having a total of six to fourteen ring members (e.g., C6-C14), wherein at least one ring in the system is aromatic, and wherein each ring in the system contains three to seven ring members. In some embodiments, an "aryl" group contains between six and twelve total ring members (e.g., C6-C12). The term "aryl" can be used interchangeably with the term "aryl ring". In some embodiments, "aryl" refers to an aromatic ring system, which includes but is not limited to phenyl, biphenyl, naphthyl, anthracenyl, and the like, which may bear one or more substituents. Unless otherwise specified, an "aryl" group is a hydrocarbon. In some embodiments, an "aryl" ring system is an aromatic ring (e.g., phenyl) fused to a non-aromatic ring (e.g., cycloalkyl). Examples of fused aryl rings include

[0145] Correlation: Two events or entities are "correlated" with each other if the presence, level, extent, type, and / or form of one event or entity is related to the presence, level, extent, type, and / or form of another event or entity. For example, if the presence, level, and / or form of a particular entity (e.g., a polypeptide, genetic marker, metabolite, microorganism, etc.) is correlated with the incidence, susceptibility, severity, stage, etc. of a disease, disorder, or condition (e.g., among related populations), it is considered to be associated with a particular disease, disorder, or condition. In some embodiments, two or more entities are physically "associated" with each other if they interact, directly or indirectly, so that they are in physical proximity and / or remain in physical proximity to each other. In some embodiments, two or more entities that are physically associated with each other are covalently linked to each other; in some embodiments, two or more entities that are physically associated with each other are not covalently linked to each other, but are non-covalently associated, for example, by hydrogen bonds, van der Waals interactions, hydrophobic interactions, magnetism, and combinations thereof.

[0146] Co-administration: As used herein, the term "co-administration" refers to the use of a composition as described herein (e.g., a pharmaceutical composition) and one or more additional therapeutic agents. In some embodiments, one or more additional therapeutic agents comprise at least one polyribonucleotide. The combined use of a composition as described herein (e.g., a pharmaceutical composition) and an additional therapeutic agent can be performed simultaneously or separately (e.g., sequentially in any order). In some embodiments, a composition as described herein (e.g., a pharmaceutical composition) and an additional therapeutic agent can be combined in a pharmaceutically acceptable excipient, or they can be placed in a separate excipient and delivered to a target cell or administered to a subject at different times. Each of these situations is considered to fall within the meaning of "co-administration" or "combination", provided that the composition as described herein (e.g., a pharmaceutical composition) and the additional therapeutic agent are delivered or administered close enough in time so that there is at least some temporal overlap in the biological effects produced by each on the treated target cell or subject.

[0147] Combination therapy: As used herein, the term "combination therapy" refers to those situations in which a subject is exposed to two or more treatment regimens (e.g., two or more therapeutic agents) simultaneously. In some embodiments, two or more regimens may be administered simultaneously; in some embodiments, such regimens may be administered sequentially (e.g., all "doses" of the first regimen are administered prior to administering any doses of the second regimen); in some embodiments, such agents are administered in overlapping dosing regimens. In some embodiments, administration of a combination therapy may involve administering one or more agents or modalities to a subject receiving the other agents or modalities in the combination. For clarity, combination therapy does not require that the individual agents be administered together in a single composition (or not even necessarily simultaneously), but in some embodiments, two or more agents, or their active portions, may be combined in a composition and administered together.

[0148] Comparable: As used herein, the term "comparable" refers to two or more sets of agents, entities, situations, conditions, etc. that may not be identical to one another but are sufficiently similar to allow comparisons to be made therebetween so that one skilled in the art would understand that conclusions can be reasonably drawn based on the observed differences or similarities. In some embodiments, comparable sets of conditions, situations, individuals, or populations are characterized by a plurality of substantially identical features and one or a few different features. One of ordinary skill in the art would understand, in context, what degree of consistency is required for two or more such sets of agents, entities, situations, conditions, etc. to be considered comparable in any given case. For example, one of ordinary skill in the art would understand that sets of conditions, individuals, or populations are comparable to one another when they are characterized by a sufficient number and type of substantially identical features to ensure that the conclusion is reasonable that differences in the results obtained under different sets of conditions, individuals, or populations or in the phenomena observed with different sets of conditions, individuals, or populations are caused by or indicate changes in those features that have changed.

[0149] Corresponding to: As used herein, the term "corresponding to" refers to a relationship between two or more entities. For example, the term "corresponding to" can be used to indicate the position / characteristic of a structural element in a compound or composition relative to another compound or composition (e.g., relative to an appropriate reference compound or composition). For example, in some embodiments, monomer residues in a polymer (e.g., amino acid residues in a polypeptide or nucleic acid residues in a polynucleotide) can be identified as "corresponding to" residues in an appropriate reference polymer. For example, one of ordinary skill in the art will appreciate that, for simplicity, residues in polypeptides are often named using a canonical numbering system based on a reference to a related polypeptide, so that, for example, an amino acid that "corresponds to" a residue at position 190 need not actually be the 190th amino acid in a particular amino acid chain, but rather corresponds to the residue found at 190 in a reference polypeptide; one of ordinary skill in the art will readily understand how to identify a "corresponding" amino acid. For example, those skilled in the art will be aware of various sequence alignment strategies, including software programs such as BLAST, CS-BLAST, CUSASW++, DIA MOND, FASTA, GGSEARCH / GLSEARCH, Genoogle, HMMER, HHpred / HHsearch, IDF, Infernal, KLAST, USEARCH, parasail, PSI-BLAST, PSI-Search, ScalaBLAST, Sequilab, SAM, SSEARCH, SWAPHI, SWAPHI-LS, SWIMM, or SWIPE, which can be used, for example, to identify "corresponding" residues in polypeptides and / or nucleic acids according to the present disclosure. Those skilled in the art will also appreciate that, in some cases, the term "corresponding to" can be used to describe an event or entity that shares a relevant similarity with another event or entity (e.g., an appropriate reference event or entity). As just one example, a gene or protein in one organism may be described as "corresponding to" a gene or protein from another organism to indicate, in some embodiments, that it plays a similar role or performs a similar function, and / or that it exhibits a particular degree of sequence identity or homology, or shares particular characteristic sequence elements.

[0150] Alicyclic: As used herein, the term "alicyclic" refers to a monocyclic C 3-8 Hydrocarbon or bicyclic C 6-10 A hydrocarbon that is fully saturated or contains one or more units of unsaturation, but is not aromatic, having a single point of attachment or more than one point of attachment to the rest of the molecule.

[0151] Cycloalkyl: As used herein, the term "cycloalkyl" refers to an optionally substituted saturated monocyclic or polycyclic ring system having about 3 to about 10 ring carbon atoms. Exemplary monocyclic cycloalkyl rings include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and cycloheptyl.

[0152] Derived from: In the context of an amino acid sequence (peptide or polypeptide) "derived from" a specified amino acid sequence (peptide or polypeptide), it refers to a structural analog of the specified amino acid sequence. In some embodiments, an amino acid sequence derived from a specific amino acid sequence has an amino acid sequence that is identical, substantially identical, or homologous to the specific sequence or a fragment thereof. An amino acid sequence derived from a specific amino acid sequence may be a variant of the specific sequence or a fragment thereof.

[0153] Detection: The term "detection" is broadly used herein to include appropriate means for determining the presence or absence of an entity of interest in a sample or any form of measurement results of an entity of interest. Therefore, "detection" can include determining, measuring, evaluating or determining the presence or absence, level, amount and / or location of an entity of interest. Including quantitative and qualitative determination, measurement or evaluation, including semi-quantitative. Such determination, measurement or evaluation can be relative (for example, when the entity of interest is detected relative to a control reference), or absolute. Therefore, the term "quantitative" can refer to absolute or relative quantification when used in the context of a quantitative entity of interest. Absolute quantification can be achieved by associating the detected level of the entity of interest with a known control standard (for example, by generating a standard curve). Alternatively, relative quantification can be achieved by comparing the detected level or amount between two or more different entities of interest to provide the relative quantification of each of the two or more different entities of interest, i.e. relative quantification relative to each other.

[0154] Dosing regimen: Those skilled in the art will appreciate that the term "dosing regimen" (or "therapeutic regimen") can be used to refer to a group of unit doses (usually more than one) administered separately to a subject, usually at intervals of time. In some embodiments, a given therapeutic agent has a recommended dosing regimen, which may involve one or more doses.

[0155] Encoding: As used herein, the term "encode" or "encoding" refers to the sequence information of a first molecule, which instructs the production of a second molecule having a determined nucleotide sequence (e.g., a polyribonucleotide) or a determined amino acid sequence. For example, a DNA molecule can encode an RNA molecule (e.g., by a transcription process comprising a DNA-dependent RNA polymerase). An RNA molecule can encode a polypeptide (e.g., by a translation process). Therefore, if the transcription and translation of the RNA corresponding to a gene produces a polypeptide in a cell or other biological system, the gene, cDNA, or RNA molecule encodes a polypeptide. In some embodiments, the coding region of the polyribonucleotide encoding a target antigen refers to a coding strand whose nucleotide sequence is identical to the polyribonucleotide sequence of this target antigen. In some embodiments, the coding region of the polyribonucleotide encoding a target antigen refers to a non-coding strand of such a target antigen, which is used as a template for transcription of a gene or cDNA.

[0156] Engineered: Generally, the term "engineered" refers to aspects that have been manipulated by the hand of man. For example, a polynucleotide is considered "engineered" when two or more sequences that are not naturally linked together in the order described are artificially manipulated to be directly linked to each other in an engineered polynucleotide, and / or when specific residues in a polynucleotide are non-naturally occurring and / or are artificially linked to entities or moieties that are different from those to which they are naturally linked.

[0157] Epitope: As used herein, the term "epitope" refers to a portion that is specifically recognized by an immunoglobulin (e.g., an antibody or receptor) binding component. For example, an epitope can be recognized by a T cell, a B cell, or an antibody. In some embodiments, an epitope is composed of multiple chemical atoms or groups on an antigen. In some embodiments, when the antigen adopts a related three-dimensional conformation, such chemical atoms or groups are surface exposed. In some embodiments, when the antigen adopts such a conformation, such chemical atoms or groups are physically close to each other in space. In some embodiments, when the antigen adopts an alternative conformation (e.g., linearized), at least some of such chemical atoms and groups are physically separated from each other. Therefore, in some embodiments, the epitope of an antigen may include a continuous or discontinuous portion of the antigen. In some embodiments, an epitope is or comprises a T cell epitope. In some embodiments, an epitope may have a length of about 5 to about 30 amino acids, or about 10 to about 25 amino acids, or about 5 to about 15 amino acids, or about 5 to 12 amino acids, or about 6 to about 9 amino acids.

[0158] Expression: As used herein, the term "expression" of a nucleic acid sequence refers to the production of a gene product from the nucleic acid sequence. In some embodiments, the gene product can be a transcript, e.g., a polyribonucleotide as provided herein. In some embodiments, the gene product can be a polypeptide. In some embodiments, expression of a nucleic acid sequence involves one or more of the following: (1) production of an RNA template from the DNA sequence (e.g., by transcription); (2) processing of the RNA transcript (e.g., by splicing, editing, etc.); (3) translation of the RNA into a polypeptide or protein; and / or (4) post-translational modification of the polypeptide or protein.

[0159] Fragment: As used herein, "fragment" refers to a structure that is or includes a discrete portion of a reference agent (sometimes referred to as a "parent" agent). In some embodiments, a fragment lacks one or more portions found in a reference agent. In some embodiments, a fragment is or includes one or more portions found in a reference agent. In some embodiments, a reference agent is a polymer, such as a polynucleotide or polypeptide. 180, 190, 200, 210, 220, 230, 240, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, or more monomeric units (e.g., residues) of a reference polymer. In some embodiments, the fragment of a polymer is or includes at least about 5%, 10%, 15%, 20%, 25%, 30%, 25%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more of the monomeric units (e.g., residues) found in a reference polymer. The fragment of a reference polymer need not be identical to the corresponding portion of the reference polymer. For example, the fragment of a reference polymer can be a polymer having a residue sequence that is at least about 5%, 10%, 15%, 20%, 25%, 30%, 25%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identical to the reference polymer. The fragments may or may not be produced by physical fragmentation of a reference agent. In some cases, they are produced by physical fragmentation of a reference agent. In some cases, the fragments are not produced by physical fragmentation of a reference agent, but may be produced, for example, by de novo synthesis or other means.

[0160] Heteroaliphatic: As used herein, the term "heteroaliphatic" or "heteroaliphatic group" means an optionally substituted hydrocarbon moiety having from one to five heteroatoms in addition to carbon atoms, which may be straight chain (i.e., unbranched), branched, or cyclic ("heterocycle"), and may be fully saturated or may contain one or more unsaturated units, but is not aromatic. The term "heteroatom" refers to nitrogen, oxygen, or sulfur, and includes any oxidized form of nitrogen or sulfur, as well as any quaternized form of a basic nitrogen. The term "nitrogen" also includes substituted nitrogen. Unless otherwise specified, a heteroaliphatic group contains 1-10 carbon atoms, of which 1-3 carbon atoms are optionally and independently replaced by heteroatoms selected from oxygen, nitrogen, and sulfur. In some embodiments, a heteroaliphatic group contains 1-4 carbon atoms, of which 1-2 carbon atoms are optionally and independently replaced by heteroatoms selected from oxygen, nitrogen, and sulfur. In other embodiments, heteroaliphatic groups contain 1-3 carbon atoms, wherein 1 carbon atom is optionally and independently replaced by a heteroatom selected from oxygen, nitrogen and sulfur. Suitable heteroaliphatic groups include, but are not limited to, straight or branched heteroalkyl, heteroalkenyl and heteroalkynyl groups. For example, heteroaliphatic groups of 1 to 10 atoms include the following exemplary groups: -O-CH3, -CH2-O-CH3, -O-CH2-CH2-O-CH2-CH2-O-CH3, etc.

[0161] Heteroaryl: The terms "heteroaryl" and "heteroar-," used alone or as part of a larger moiety (e.g., "heteroaralkyl" or "heteroaralkoxy"), refer to a monocyclic or bicyclic radical having 5 to 10 ring atoms (e.g., a 5- to 6-membered monocyclic heteroaryl or a 9- to 10-membered bicyclic heteroaryl); having 6, 10, or 14 pi electrons shared in the ring array; and having one to five heteroatoms in addition to carbon atoms. Heteroaryl groups include, but are not limited to, thienyl, furanyl, pyrrolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, pyridinyl, pyridazinyl, pyrimidinyl, pyrazinyl, indolizinyl, purinyl, naphthyridinyl, pteridinyl, imidazo[1,2-a]pyrimidinyl, imidazo[1,2-a]pyridinyl, imidazo[4,5-b]pyridinyl, imidazo[4,5-c]pyridinyl, pyrrolopyridinyl, pyrrolopyrazinyl, thienopyrimidinyl, triazolopyridinyl, and benzisoxazolyl. As used herein, the terms "heteroaryl" and "heteroar-" also include groups in which a heteroaromatic ring is fused to one or more aryl, alicyclic, or heterocyclyl rings, where the radical or point of attachment is on the heteroaromatic ring (i.e., bicyclic heteroaryl rings having from 1 to 3 heteroatoms). Non-limiting examples include indolyl, isoindolyl, benzothienyl, benzofuranyl, dibenzofuranyl, indazolyl, benzimidazolyl, benzotriazolyl, benzothiazolyl, benzothiadiazolyl, benzoxazolyl, quinolinyl, isoquinolinyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 4H-quinolinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, pyrido[2,3-b]-1,4-oxazin-3(4H)-one, 4H-thieno[3,2-b]pyrrole, and benzisoxazolyl. The term "heteroaryl" may be used interchangeably with the term "heteroaryl ring," "heteroaryl group," or "heteroaromatic," any of which includes rings that are optionally substituted.

[0162] Heteroatom: As used herein, the term "heteroatom" refers to nitrogen, oxygen, or sulfur, and includes any oxidized form of nitrogen or sulfur, and any quaternized form of a basic nitrogen.

[0163] Heterocycle: As used herein, the terms "heterocycle," "heterocyclyl," "heterocyclic group," and "heterocycle" are used interchangeably and refer to a stable 3- to 8-membered monocyclic, 6- to 10-membered bicyclic, or 10- to 16-membered polycyclic heterocyclic moiety that is saturated or partially unsaturated and has, in addition to carbon atoms, one or more (e.g., one to four) heteroatoms as defined above. The term "nitrogen," when used to refer to a ring atom of a heterocycle, includes substituted nitrogen. For example, in a saturated or partially unsaturated ring having 0-3 heteroatoms selected from oxygen, sulfur, or nitrogen, nitrogen may be N (as in 3,4-dihydro-2H-pyrrolyl), NH (as in pyrrolidinyl), or NR +(as in N-substituted pyrrolidinyl). The heterocycle may be attached to its side group at any heteroatom or carbon atom that produces a stable structure, and any ring atom may be optionally substituted. Examples of such saturated or partially unsaturated heterocyclic groups include, but are not limited to, azetidinyl, oxetanyl, tetrahydrofuranyl, tetrahydrothiophenyl, pyrrolidinyl, piperidinyl, decahydroquinolinyl, oxazolidinyl, piperazinyl, dioxanyl, dioxolane, diazepine, oxadiazolyl ... Oxazolin thiazolinone The heterocyclic group can be monocyclic, bicyclic, tricyclic or polycyclic, preferably monocyclic, bicyclic or tricyclic, more preferably monocyclic or bicyclic. The bicyclic heterocycle also includes a group in which the heterocycle is fused to one or more aryl rings. Exemplary bicyclic heterocyclic groups include indolinyl, isoindolinyl, benzodioxolyl, 1,3-dihydroisobenzofuranyl, 2,3-dihydrobenzofuranyl and tetrahydroquinolinyl. The bicyclic heterocycle can also be a spirocyclic system (e.g., a 7 to 11-membered spirocyclic fused heterocycle having one or more heteroatoms (e.g., one, two, three or four heteroatoms) as defined above in addition to carbon atoms). The bicyclic heterocycle can also be a bridged ring system (e.g., a 7 to 11-membered bridged heterocycle having one, two or three bridging atoms).

[0164] Homology: As used herein, the terms "homology" or "homologs" refer to the overall relatedness between polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. In some embodiments, polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or polypeptide molecules are considered "homologous" to each other if their sequences are at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical. In some embodiments, polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or polypeptide molecules are considered to be "homologous" to each other if their sequences are at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% similar (e.g., containing residues with related chemical properties at corresponding positions). For example, as is well known to those of ordinary skill in the art, certain amino acids are typically classified as "hydrophobic" or "hydrophilic" amino acids that are similar to each other, and / or have "polar" or "non-polar" side chains. The substitution of an amino acid by another amino acid of the same type is generally considered to be a "homologous" substitution.

[0165] Identity: As used herein, the term "identity" refers to the overall correlation between polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. In some embodiments, polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or polypeptide molecules are considered to be "substantially identical" to each other if their sequences are at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical. The calculation of the percent identity between two nucleic acid or polypeptide sequences can be performed, for example, by aligning the two sequences for optimal comparison purposes (e.g., spaces can be introduced into one or both of the first and second sequences for optimal comparison, and non-identical sequences can be discarded for comparison purposes). In some embodiments, the length of the sequence compared for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or substantially 100% of the length of the reference sequence. The nucleotides at corresponding positions are then compared. When a position in a first sequence is occupied by the same residue (e.g., nucleotide or amino acid) as the corresponding position in a second sequence, the molecules are said to be identical at that position. The percent identity between two sequences is a function of the number of identical positions shared by the two sequences after considering the number of spaces required to introduce the optimal alignment of the two sequences and the length of each space. The sequence comparison between two sequences and the determination of percent identity can be accomplished using a mathematical algorithm. For example, the algorithm of Meyers and Miller, 1989, incorporated into the ALIGN program (version 2.0), can be used to determine the percent identity between two nucleotide sequences. In some embodiments, nucleic acid sequence comparisons performed using the ALIGN program use a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4. Alternatively, the percent identity between two nucleotide sequences can be determined using the GAP program in the GCG software package using the NWSgapdna.CMP matrix.

[0166] Increased, induced, or decreased: As used herein, these terms or grammatically comparable comparative terms refer to values ​​measured relative to a comparable reference. For example, in some embodiments, an assessment obtained with a provided composition (e.g., a pharmaceutical composition) can be "increased" relative to an assessment obtained with a comparable reference composition. Alternatively or additionally, in some embodiments, an assessment obtained in a subject can be relative to an assessment obtained under different conditions (e.g., before or after an event; or the presence or absence of an event, such as administration of a composition as described herein (e.g., a pharmaceutical composition), or in a different comparable subject (e.g., before exposure to a condition, such as without administration of a composition as described herein (e.g., a pharmaceutical composition), in a comparable subject different from the subject of interest). In some embodiments, comparative terms refer to statistically relevant differences (e.g., prevalence and / or magnitude sufficient to achieve statistical correlation). Those skilled in the art will recognize, or will be able to readily determine, that in a given context, the differences in achieving such a condition are statistically relevant. The degree and / or prevalence of the difference required or sufficient for statistical significance. In some embodiments, the term "reduced" or equivalent terms refer to a decrease in the level of the assessed value by at least 5%, at least 10%, at least 20%, at least 50%, at least 75% or more compared to a comparable reference. In some embodiments, the term "reduced" or equivalent terms refer to complete or substantially complete inhibition, i.e., reduced to zero or substantially reduced to zero. In some embodiments, the term "increased" or "induced" refers to an increase in the level of the assessed value by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 80%, at least 100%, at least 200%, at least 500% or more compared to a comparable reference.

[0167] In sequence: As used herein, with respect to polynucleotides or polyribonucleotides, "in sequence" refers to the order of features along the polynucleotide or polyribonucleotide from 5' to 3'. As used herein, with respect to polypeptides, "in sequence" refers to the order of features along the polypeptide moving from the N-terminus of the features to the C-terminus of the features. "In sequence" does not mean that there are no additional features among the listed features. For example, if features A, B, and C of a polynucleotide are described herein as "in sequence, feature A, feature B, and feature C," this description does not exclude, for example, that feature D is located between features A and B.

[0168] Ionizable: The term "ionizable" refers to a compound or group or atom that is charged at a certain pH. In the context of ionizable amino lipids, such lipids or their functional groups or atoms are positively charged at a certain pH. In some embodiments, ionizable amino lipids are positively charged at acidic pH. In some embodiments, ionizable amino lipids are mainly neutral at physiological pH (e.g., about 7.0-7.4 in some embodiments), but become positively charged at lower pH values. In some embodiments, ionizable amino lipids can have a pKa in the range of about 5 to about 7.

[0169] Isolated: The term "isolated" means altered or removed from its native state. For example, a nucleic acid or peptide naturally present in a living animal is not "isolated," but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its native state is "isolated." An isolated nucleic acid or protein can exist in a substantially purified form or can exist in a non-native environment, such as a host cell.

[0170] Lipid: As used herein, the terms "lipid" and "lipid-like material" are broadly defined as molecules comprising one or more hydrophobic moieties or groups and optionally also comprising one or more hydrophilic moieties or groups. Molecules comprising a hydrophobic portion and a hydrophilic portion are also commonly referred to as amphiphilic molecules.

[0171] RNA lipid nanoparticles: As used herein, the term "RNA lipid nanoparticle" refers to a nanoparticle comprising at least one lipid and an RNA molecule (e.g., one or more polyribonucleotides as provided herein). In some embodiments, the RNA lipid nanoparticle comprises at least one cationic amino lipid. In some embodiments, the RNA lipid nanoparticle comprises at least one cationic amino lipid, at least one helper lipid, and at least one polymer-conjugated lipid (e.g., PEG-conjugated lipid). In various embodiments, the RNA lipid nanoparticles as described herein may have an average size (e.g., Z-average) of about 100 nm to 1000 nm, or about 200 nm to 900 nm, or about 200 nm to 800 nm, or about 250 nm to about 700 nm. In some embodiments of the present disclosure, the RNA lipid nanoparticles can have a granularity (e.g., Z-average) of about 30 nm to about 200 nm or about 30 nm to about 150 nm, about 40 nm to about 150 nm, about 50 nm to about 150 nm, about 60 nm to about 130 nm, about 70 nm to about 110 nm, about 70 nm to about 100 nm, about 80 nm to about 100 nm, about 90 nm to about 100 nm, about 70 nm to about 90 nm, about 80 nm to about 90 nm, or about 70 nm to about 80 nm. In some embodiments, the average size of the lipid nanoparticles is determined by measuring the average particle size. In some embodiments, the RNA lipid nanoparticles can be prepared by mixing lipid with RNA molecules as described herein.

[0172] Neutralization: As used herein, the term "neutralization" refers to an event in which a binding agent (e.g., an antibody) binds to a biologically active site (e.g., a receptor binding protein) of a virus, thereby inhibiting parasitic infection of a cell. In some embodiments, the term "neutralization" refers to an event in which a binding agent eliminates or significantly reduces the ability of a binding agent to infect a cell.

[0173] Nucleic Acid / Polynucleotide: As used herein, the term "nucleic acid" refers to a polymer having at least 10 nucleotides or more. In some embodiments, the nucleic acid is or comprises DNA. In some embodiments, the nucleic acid is or comprises RNA. In some embodiments, the nucleic acid is or comprises a peptide nucleic acid (PNA). In some embodiments, the nucleic acid is or comprises a single-stranded nucleic acid. In some embodiments, the nucleic acid is or comprises a double-stranded nucleic acid. In some embodiments, the nucleic acid comprises both a single-stranded portion and a double-stranded portion. In some embodiments, the nucleic acid comprises a backbone comprising one or more phosphodiester linkages. In some embodiments, the nucleic acid comprises a backbone comprising both phosphodiester linkages and non-phosphodiester linkages. For example, in some embodiments, the nucleic acid may comprise a backbone comprising one or more phosphorothioate or 5'-N-phosphoramidite linkages and / or one or more peptide bonds, such as in "peptide nucleic acids." In some embodiments, the nucleic acid comprises one or more or all of the natural residues (e.g., adenine, cytosine, deoxyadenosine, deoxycytidine, deoxyguanosine, deoxythymidine, guanine, thymine, uracil). In some embodiments, nucleic acid comprises one or more or all non-natural residues.In some embodiments, non-natural residues include nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolopyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, 6-O-methylguanine, 2-thiocytidine, methylated bases, embedded bases, and combinations thereof). In some embodiments, non-natural residues include one or more modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose) compared to the sugar in natural residues. In some embodiments, nucleic acid has a nucleotide sequence encoding a functional gene product such as an RNA or polypeptide. In some embodiments, nucleic acid has a nucleotide sequence comprising one or more introns. In some embodiments, nucleic acid can be prepared by isolation from a natural source, enzymatic synthesis (e.g., by polymerization based on a complementary template, e.g., in vivo or in vitro), breeding in a recombinant cell or system, or chemical synthesis.In some embodiments, the nucleic acid is at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 20, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 800 18,000, 18,500, 19,000, 19,500, or 20,000 residues or nucleotides in length.

[0174] Operably connected: as used herein, "operably connected " refers to the association of at least the first element and the second element, so that component elements are in the relationship that allows them to work in their expected manner.For example, if nucleic acid sequence or amino acid sequence, for example, changes the expression, structure or activity of connected sequence in an expected manner, then it is operably connected with another sequence.In many cases, if two nucleic acid sequences contribute to the expression, structure or activity of gene or coded polypeptide, then they are operably connected.For example, if regulating sequence and coding sequence are connected in a manner that allows regulating sequence control coding sequence expression, then nucleic acid regulating sequence " is operably connected " to nucleic acid coding sequence.In some embodiments, the regulating sequence of " being operably connected " is directly or indirectly covalently linked (for example, in single nucleic acid) to coding sequence.In some embodiments, regulating sequence is with the expression of trans-control coding sequence, and regulating sequence is included in the nucleic acid identical with coding sequence and is not the requirement of being operably connected.In many cases, if two amino acid sequences are expressed as single polypeptide, then they are operably connected.

[0175] Pharmaceutically effective amount: The term "pharmaceutically effective amount" or "therapeutically effective amount" refers to an amount that, alone or in combination with further doses, achieves a desired response or desired effect. In the case of treating a particular disease (e.g., monkeypox), in some embodiments, the desired response involves inhibiting the course of the disease (e.g., monkeypox). In some embodiments, such inhibition may include slowing the progression of the disease (e.g., monkeypox) and / or interrupting or reversing the progression of the disease (e.g., monkeypox). In some embodiments, the desired response in treating a disease (e.g., monkeypox) may be or include delaying or preventing the onset of a disease (e.g., monkeypox) or condition (e.g., monkeypox-associated condition). The effective amount of a composition (e.g., a pharmaceutical composition) described herein will depend, for example, on the disease (e.g., monkeypox) or condition (e.g., monkeypox-associated condition) to be treated, the severity of such disease (e.g., monkeypox) or condition, the individual parameters of the patient (including, for example, age, physiological condition, size, and weight), the duration of treatment, the type of concomitant therapy (if any), the specific route of administration, and similar factors. Therefore, the dosage of a composition (e.g., a pharmaceutical composition) described herein may depend on various such parameters. In cases where a patient's response to an initial dose is inadequate, a higher dose (or an effectively higher dose achieved by a different, more localized route of administration) may be used.

[0176] Polypeptide: As used herein, the term "polypeptide" refers to a polymeric chain of amino acids. In some embodiments, a polypeptide has an amino acid sequence that occurs in nature. In some embodiments, a polypeptide has an amino acid sequence that does not occur in nature. In some embodiments, a polypeptide has an engineered amino acid sequence, meaning that it is designed and / or produced by the hand of man. In some embodiments, a polypeptide may comprise or consist of natural amino acids, non-natural amino acids, or both. In some embodiments, a polypeptide may comprise or consist exclusively of natural amino acids, or consist exclusively of non-natural amino acids. In some embodiments, a polypeptide may comprise D-amino acids, L-amino acids, or both. In some embodiments, a polypeptide may comprise exclusively D-amino acids. In some embodiments, a polypeptide may comprise exclusively L-amino acids. In some embodiments, a polypeptide may include one or more side groups or other modifications, such as modifications at the N-terminus of the polypeptide, at the C-terminus of the polypeptide, or any combination thereof, or attached to one or more amino acid side chains. In some embodiments, such side groups or modifications include acetylation, amidation, lipidation, methylation, pegylation, and the like, including combinations thereof. In some embodiments, the polypeptide may be cyclic and / or may contain a cyclic portion. In some embodiments, the polypeptide is not cyclic and / or does not contain any cyclic portion. In some embodiments, the polypeptide is linear. In some embodiments, the polypeptide may be or include a stapled polypeptide. In some embodiments, the term "polypeptide" may be appended to the name, activity, or structure of a reference polypeptide; in such cases, it is used herein to refer to polypeptides that share a related activity or structure and are therefore considered members of the same class or family of polypeptides. For each such class, this specification provides and / or those skilled in the art will be aware of exemplary polypeptides whose amino acid sequences and / or functions within that class are known; in some embodiments, such exemplary polypeptides are reference polypeptides for that class or family of polypeptides. In some embodiments, members of a class or family of polypeptides exhibit significant sequence homology or identity with a reference polypeptide of that class, share common sequence motifs (e.g., characteristic sequence elements) with a reference polypeptide of that class, and / or share a common activity (in some embodiments at a comparable level or within a specified range; in some embodiments, compared to all polypeptides within that class).For example, in some embodiments, member polypeptides exhibit a degree of overall sequence homology or identity to a reference polypeptide of at least about 30-40%, and typically greater than about 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more, and / or include at least one region (e.g., a conserved region that may be or include characteristic sequence elements in some embodiments) that exhibits very high sequence identity, typically greater than 90% or even 95%, 96%, 97%, 98% or 99%. Such conserved regions typically encompass at least 3-4 and typically up to 35 or more amino acids; in some embodiments, a conserved region encompasses at least a stretch of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 or more consecutive amino acids. In some embodiments, a related polypeptide may comprise or consist of a fragment of a parent polypeptide.

[0177] Prevent: As used herein, the terms "prevent" or "prevention," when used in conjunction with the occurrence of a disease, disorder, and / or condition, refers to reducing the risk of developing a disease, disorder, and / or condition and / or delaying the onset of one or more characteristics or symptoms of a disease, disorder, or condition. Prevention can be considered complete when the onset of a disease, disorder, or condition has been delayed for a predefined period of time.

[0178] Reference: As used herein, the term "reference" describes a standard or control to which a comparison is made. For example, in some embodiments, an agent, animal, individual, population, sample, sequence, or value of interest is compared to an agent, animal, individual, population, sample, sequence, or value of a reference or control. In some embodiments, a reference or control is tested and / or measured substantially simultaneously with the test or determination of interest. In some embodiments, a reference or control is a historical reference or control, optionally embodied in a tangible medium. Typically, as will be understood by those skilled in the art, a reference or control is measured or characterized under conditions or environments comparable to those under assessment. Those skilled in the art will understand when there is sufficient similarity to justify reliance on a particular possible reference or control and / or comparison with a particular possible reference or control.

[0179] Ribonucleic acid (RNA) or polyribonucleotide: As used herein, the term "ribonucleic acid," "RNA," or "polyribonucleotide" refers to a polymer of ribonucleotides. In some embodiments, RNA is single-stranded. In some embodiments, RNA is double-stranded. In some embodiments, RNA comprises both single-stranded and double-stranded portions. In some embodiments, RNA may comprise a backbone structure as described in the definition of "nucleic acid / polynucleotide" above. RNA may be a regulatory RNA (e.g., siRNA, microRNA, etc.) or messenger RNA (mRNA). In some embodiments, RNA is mRNA. In some embodiments in which RNA is mRNA, RNA typically comprises a poly (A) region at its 3' end. In some embodiments in which RNA is mRNA, RNA typically comprises a cap structure recognized in the art at its 5' end, for example, for identifying mRNA and attaching it to ribosomes to initiate translation. In some embodiments, RNA is synthetic RNA. Synthetic RNA includes RNA synthesized in vitro (e.g., by enzymatic synthesis methods and / or by chemical synthesis methods).

[0180] Ribonucleotide: As used herein, the term "ribonucleotide" encompasses unmodified ribonucleotides and modified ribonucleotides. For example, unmodified ribonucleotides include the purine bases adenine (A) and guanine (G) and the pyrimidine bases cytosine (C) and uracil (U). Modified ribonucleotides may include one or more modifications, including but not limited to, for example (a) end modifications, for example, 5' end modifications (e.g., phosphorylation, dephosphorylation, conjugation, reverse connection, etc.), 3' end modifications (e.g., conjugation, reverse connection, etc.), (b) base modifications, for example, replacement with modified bases, stable bases, destabilizing bases, bases paired with an expanded partner library, or conjugated bases, (c) sugar modifications (e.g., at the 2' or 4' position) or replacement of sugars, and (d) internucleoside bond modifications, including modification or replacement of phosphodiester bonds. The term "ribonucleotide" also encompasses ribonucleotide triphosphates, including modified and unmodified ribonucleotide triphosphates.

[0181] Risk: It will be understood from the context that the "risk" of a disease, condition and / or illness refers to the likelihood that a particular individual will develop the disease, condition and / or illness. In some embodiments, risk is expressed as a percentage. In some embodiments, risk is expressed as a risk relative to the risk associated with a reference sample or reference sample group. In some embodiments, a reference sample or reference sample group has a risk of a known disease, condition, illness and / or event. In some embodiments, a reference sample or reference sample group is from an individual comparable to a particular individual. In some embodiments, risk can reflect one or more genetic attributes, for example, which can predispose an individual to develop (or not develop) a particular disease, condition and / or symptom. In some embodiments, risk can reflect one or more epigenetic events or attributes and / or one or more lifestyle or environmental events or attributes.

[0182] Selectivity or specificity: When used herein to refer to an agent having activity, the term "selectivity" or "specificity" is understood by those skilled in the art to mean that the agent discriminates between potential target entities, states, or cells. For example, in some embodiments, an agent is considered to "specifically" bind to its target if it preferentially binds to its target in the presence of one or more competing alternative targets. In many embodiments, specific interactions depend on the presence of specific structural features (e.g., epitopes, clefts, binding sites) of the target entity. It is to be understood that specificity is not necessarily absolute. In some embodiments, the specificity of one or more other potential target entities (e.g., competitors) can be evaluated relative to the target binding portion. In some embodiments, specificity is evaluated relative to the specificity of a reference specific binding portion. In some embodiments, specificity is evaluated relative to the specificity of a reference non-specific binding portion.

[0183] Substituted or optionally substituted: As described herein, the compounds of the present invention may contain "optionally substituted" moieties. In general, the term "substituted," whether preceded by the term "optionally" or not, means that one or more hydrogen atoms of the designated moiety are replaced with a suitable substituent. "Substituted" applies to structures where one or more hydrogen atoms are replaced, either explicitly or implicitly (e.g., At least and At least ). Unless otherwise stated, an "optionally substituted" group may have a suitable substituent at each substitutable position of the group, and when more than one position in any given structure can be substituted by more than one substituent selected from a specified group, the substituent at each position may be the same or different. The substituent combinations contemplated by the present invention are preferably those that form stable or chemically feasible compounds. As used herein, the term "stable" refers to a compound that does not substantially change when subjected to conditions that allow it to be produced, detected, and, in some embodiments, recovered, purified, and used for one or more purposes provided herein. The group described as "substituted" preferably has between 1 and 4 substituents, more preferably 1 or 2 substituents. The group described as "optionally substituted" may be unsubstituted or "substituted" as described above.

[0184] Suitable monovalent substituents on the substitutable carbon atoms of an "optionally substituted" group are independently halogen; -(CH2) 0-4 R o ; -(CH2) 0-4 OR o ;-O(CH2) 0-4 R o 、-O-(CH2) 0-4 C(O)OR o ; -(CH2) 0-4 CH(OR o )2;-(CH2) 0- 4SR o ; -(CH2) 0-4 Ph, which can be R o Substitution; -(CH2) 0-4 O(CH2) 0-1 Ph, which can be R o Substitution; -CH=CHPh, which can be R o Substitution; -(CH2) 0-4 O(CH2) 0-1 -pyridyl, which may be R o Substitution; -NO2; -CN; -N3; ​​-(CH2) 0-4 N(R o )2;-(CH2) 0-4 N(R o )C(O)R o ;-N(R o )C(S)R o ; -(CH2) 0-4 N(R o )C(O)NR o 2;-N(R o )C(S)NR o 2; -(CH2) 0-4N(R o )C(O)OR o ;-N(R o )N(R o )C(O)R o ;-N(R o )N(R o )C(O)NR o 2;-N(R o )N(R o )C(O)OR o ;-(CH2) 0-4 C(O)R o ;C(S)R o ;-(CH2) 0-4 C(O)OR o ;-(CH2) 0-4 C(O)SR o ;-(CH2) 0-4 C(O)OSiR o 3;-(CH2) 0-4 OC(O)R o ;-OC(O)(CH2) 0-4 SR o ;-(CH2) 0-4 SC(O)R o ;-(CH2) 0-4 C(O)NR o 2;-C(S)NR o 2;-C(S)SR o ;-SC(S)SR o 、-(CH2) 0- 4OC(O)NR o 2;-C(O)N(OR o )R o ;-C(O)C(O)R o ;-C(O)CH2C(O)R o ;-C(NOR o )R o ;-(CH2) 0-4 SSR o ;-(CH2) 0-4 S(O)2R o ;-(CH2) 0-4 S(O)2OR o ;-(CH2) 0-4 OS(O)2R o ;-S(O)2NR o 2;-(CH2) 0-4 S(O)R o ;-N(R o)S(O)2NR o 2;-N(R o )S(O)2R o ;-N(OR o )R o ;-C(NH)NR o 2;-P(O)2R o ;-P(O)R o 2;-OP(O)R o 2;-OP(O)(OR o )2;SiR o 3;-(C 1-4 linear or branched alkylene)ON(R o )2; or -(C 1-4 linear or branched alkylene) C(O)ON(R o )2, where each R o may be substituted as defined below and are independently hydrogen, C 1-6 Aliphatic, -CH2Ph, -O(CH2) 0- 1Ph, -CH2-(5- to 6-membered heteroaryl ring) or a 3- to 6-membered saturated, partially unsaturated or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen or sulfur, or, notwithstanding the above definitions, two independent occurrences of R o Together with its middle atoms, it forms a 3- to 12-membered saturated, partially unsaturated or aromatic monocyclic or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen or sulfur, which may be substituted as defined below.

[0185] R o (or through two independent occurrences of R o Suitable monovalent substituents on the ring formed together with its middle atoms are independently halogen, -(CH2) 0-2 R ● 、-(halogenated R · ), -(CH2) 0-2 OH, -(CH2) 0-2 OR · 、-(CH2) 0-2 CH(OR · )2、-O(halogenated R ● )、-CN、-N3、-(CH2) 0-2 C(O)R ● 、-(CH2) 0-2 C(O)OH, -(CH2) 0-2 C(O)OR ● 、-(CH2) 0-2 SR · 、-(CH2) 0-2 SH, -(CH2)0-2 NH2, -(CH2) 0-2 NHR · 、-(CH2) 0-2 NR · 2. -NO2, -SiR · 3. -OSiR · 3. -C(O)SR · 、-(C 1-4 linear or branched alkylene)C(O)OR · or -SSR ● , where each R · is unsubstituted or, in the case of "halo" being preceded by "halo", is substituted only by one or more halogens, and is independently selected from C 1-4 Aliphatic, -CH2Ph, -O(CH2) 0-1 Ph or a 3- to 6-membered saturated, partially unsaturated or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen or sulfur. o Suitable divalent substituents on a saturated carbon atom of include =0 and =S.

[0186] Suitable divalent substituents on a saturated carbon atom of an "optionally substituted" group include the following: =0 ("oxo"), =S, =NNR * 2. =NNHC(O)R * 、=NNHC(O)OR * 、=NNHS(O)2R * 、=NR * 、=NOR * 、-O(C(R * 2)) 2-3 O- or -S(C(R * 2)) 2-3 S-, where each independent occurrence of R * is selected from hydrogen, C which may be substituted as defined below 1-6 An aliphatic or unsubstituted 5- to 6-membered saturated, partially unsaturated or aromatic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen or sulfur. Suitable divalent substituents bonded to an ortho-substitutable carbon of an "optionally substituted" group include: -O(CR * 2) 2-3 O-, where each independent occurrence of R * is selected from hydrogen, C which may be substituted as defined below 1-6 an aliphatic or unsubstituted 5- to 6-membered saturated, partially unsaturated or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen or sulfur.

[0187] R * Suitable substituents on the aliphatic group include halogen, -R · 、-(halogenated R· ), -OH, -OR · 、-O(halogenated R · )、-CN、-C(O)OH、-C(O)OR · 、-NH2、-NHR · 、-NR · 2 or -NO2, where each R · is unsubstituted or, when preceded by "halo", is substituted only with one or more halogens, and is independently C 1-4 Aliphatic, -CH2Ph, -O(CH2) 0-1 Ph or a 3- to 6-membered saturated, partially unsaturated or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen or sulfur.

[0188] Suitable substituents on a substitutable nitrogen of an "optionally substituted" group include Each of these are independently hydrogen, C 1-6 an aliphatic, unsubstituted -OPh or an unsubstituted 3- to 6-membered saturated, partially unsaturated or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen or sulfur, or, notwithstanding the above definition, two independent occurrences of Together with its middle atoms, it forms an unsubstituted 3- to 12-membered saturated, partially unsaturated or aromatic monocyclic or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen or sulfur.

[0190] Suitable substituents on the aliphatic group are independently halogen, -R · 、-(halogenated R · ), -OH, -OR · 、-O(halogenated R · )、-CN、-C(O)OH、-C(O)OR · 、-NH2、-NHR · 、-NR · 2 or -NO2, where each R · is unsubstituted or, when preceded by "halo", is substituted only with one or more halogens, and is independently C 1-4 Aliphatic, -CH2Ph, -O(CH2) 0-1 Ph or a 3- to 6-membered saturated, partially unsaturated or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen or sulfur.

[0191] Subject: As used herein, the term "subject" refers to an organism to which a composition described herein is administered, e.g., for experimental, diagnostic, prophylactic, and / or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, domestic pets, etc.) and humans. In some embodiments, the subject is a human subject. In some embodiments, the subject suffers from a disease, disorder, or condition (e.g., orthopox, such as monkeypox, smallpox, or vaccinia). In some embodiments, the subject is susceptible to a disease, disorder, or condition (e.g., orthopox, such as monkeypox, smallpox, or vaccinia). In some embodiments, the subject exhibits one or more symptoms or characteristics of a disease, disorder, or condition (e.g., orthopox, such as monkeypox, smallpox, or vaccinia). In some embodiments, the subject exhibits one or more nonspecific symptoms of a disease, disorder, or condition (e.g., orthopox, such as monkeypox, smallpox, or vaccinia). In some embodiments, the subject does not exhibit any symptoms or characteristics of a disease, disorder, or condition (e.g., orthopox, such as monkeypox, smallpox, or vaccinia). In some embodiments, the subject is a subject having one or more characteristics of susceptibility or risk for a disease, disorder, or condition (e.g., orthopox, such as monkeypox, pox, or vaccinia). In some embodiments, the subject is a patient. In some embodiments, the subject is an individual receiving and / or having received diagnosis and / or treatment.

[0192] Suffering from: An individual who is "suffering from" a disease, disorder, and / or condition (e.g., orthopox, such as monkeypox, smallpox, or vaccinia) has been diagnosed as having and / or exhibits one or more symptoms of the disease, disorder, and / or condition.

[0193] Susceptible to: An individual who is "susceptible" to a disease, disorder, and / or condition (e.g., orthopox, such as monkeypox, smallpox, or vaccinia) is an individual who has a higher risk of developing the disease, disorder, and / or condition (e.g., orthopox, such as monkeypox, smallpox, or vaccinia) than members of the general public. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition (e.g., orthopox, such as monkeypox, smallpox, or vaccinia) may not have been diagnosed as having the disease, disorder, and / or condition (e.g., orthopox, such as monkeypox, smallpox, or vaccinia). In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition (e.g., orthopox, such as monkeypox, smallpox, or vaccinia) may exhibit symptoms of the disease, disorder, and / or condition (e.g., orthopox, such as monkeypox, smallpox, or vaccinia). In some embodiments, an individual susceptible to a disease, disorder, and / or condition (e.g., orthopox, such as monkeypox, smallpox, or vaccinia) may not exhibit symptoms of the disease, disorder, and / or condition (e.g., orthopox, such as monkeypox, smallpox, or vaccinia). In some embodiments, an individual susceptible to a disease, disorder, and / or condition (e.g., orthopox, such as monkeypox, smallpox, or vaccinia) will develop the disease, disorder, and / or condition (e.g., orthopox, such as monkeypox, smallpox, or vaccinia). In some embodiments, an individual susceptible to a disease, disorder, and / or condition (e.g., orthopox, such as monkeypox, smallpox, or vaccinia) will not develop the disease, disorder, and / or condition (e.g., orthopox, such as monkeypox, smallpox, or vaccinia).

[0194] Therapy: The term "therapy" refers to the administration or delivery of an agent or intervention that has a therapeutic effect and / or induces a desired biological and / or pharmacological effect (e.g., has been shown to be statistically likely to have such an effect when administered to a relevant population). In some embodiments, a therapeutic agent or therapy is any substance that can be used to alleviate, ameliorate, relieve, inhibit, prevent, delay the onset of, reduce the severity of, and / or reduce the incidence of one or more symptoms or features of a disease, disorder, and / or condition (e.g., orthopox, such as monkeypox, smallpox, or vaccinia). In some embodiments, a therapeutic agent or therapy is a medical intervention (e.g., surgery, radiation, phototherapy) that can be performed to alleviate, relieve, inhibit, prevent, delay the onset of, reduce the severity of, and / or reduce the incidence of one or more symptoms or features of a disease, disorder, and / or condition.

[0195] Treatment: As used herein, the terms "treat," "treatment," and "treating" refer to any method for partially or completely alleviating, ameliorating, alleviating, inhibiting, preventing, delaying onset, reducing severity, and / or reducing incidence of one or more symptoms or features of a disease, disorder, and / or condition (e.g., orthopox, such as monkeypox, smallpox, or vaccinia). Treatment can be administered to a subject who does not exhibit signs of a disease, disorder, and / or condition (e.g., orthopox, such as monkeypox, smallpox, or vaccinia). In some embodiments, treatment can be administered to a subject who exhibits only early signs of a disease, disorder, and / or condition (e.g., orthopox, such as monkeypox, smallpox, or vaccinia), e.g., for the purpose of reducing the risk of developing pathology associated with the disease, disorder, and / or condition. In some embodiments, treatment can be administered to a subject at a later stage of a disease, disorder, and / or condition (e.g., orthopox, such as monkeypox, smallpox, or vaccinia). DETAILED DESCRIPTION

[0196] The present disclosure provides pharmaceutical compositions (e.g., immunogenic compositions, such as vaccines) and related technologies (e.g., methods) for delivering specific monkeypox antigen constructs to subjects (e.g., patients). Specifically, the present disclosure provides monkeypox vaccine compositions and related technologies (e.g., methods).

[0197] I. Monkeypox and other orthopoxviruses

[0198] Monkeypox virus (MPXV) is a member of the Poxviridae family and the Orthopoxvirus genus ( Figure 1 and Figure 2 Orthopoxviruses (OPVs) are characterized by their structural and life cycle complexity ( Figure 3 Orthopoxviruses also include, for example, variola virus (also known as smallpox, VARV), vaccinia virus (VACV), and cowpox (CPXV). Monkeypox is closely related to variola virus, and the present disclosure encompasses the recognition that the relevance of orthopoxviruses is generally higher.

[0199] Smallpox was declared eradicated in 1980 through successful vaccination. However, since then, much of the world's population has remained unvaccinated against orthopoxviruses. Low-level monkeypox has been endemic in West and Central Africa for many years, but community transmission has recently occurred in non-endemic areas, including Europe and North America. Declining immunity to orthopoxviruses worldwide is at least partially responsible for the recent spread of monkeypox.

[0200] Monkeypox and other orthopoxviruses are an ongoing global threat. Smallpox virus is classified as a Category A bioterrorism agent, which is of particular concern given the current limitations in the availability of regulated vaccines. The recent spread of monkeypox also highlights the ongoing risk of new orthopoxviruses emerging.

[0201] The present disclosure provides orthopox (e.g., monkeypox, smallpox, vaccinia, or cowpox) polyribonucleotides, antigenic constructs, and / or pharmaceutical compositions that are effective for vaccination against orthopox (e.g., monkeypox, smallpox, vaccinia, or cowpox). The present disclosure also provides the insight that polyribonucleotides, antigenic constructs, and pharmaceutical compositions that target one orthopox species can cross-protect against other orthopox viruses. For example, in some embodiments, the monkeypox polyribonucleotides, antigenic constructs, and / or pharmaceutical compositions provided are effective for vaccination against monkeypox and one or more other orthopox viruses. In some embodiments, the monkeypox polyribonucleotides, antigenic constructs, and / or pharmaceutical compositions provided are effective for vaccination against monkeypox and one or more of smallpox virus, vaccinia virus, and cowpox. In some embodiments, the monkeypox polyribonucleotides, antigenic constructs, and / or pharmaceutical compositions provided are effective for vaccination against monkeypox and smallpox virus. In some embodiments, the monkeypox polyribonucleotides, antigenic constructs, and / or pharmaceutical compositions provided are effective for vaccination against monkeypox and new orthopox viruses.

[0202] Monkeypox structure

[0203] Monkeypox virus particles are oval or brick-shaped particles surrounded by a geometrically corrugated lipoprotein outer membrane. The mature monkeypox virus particle has a densely packed core containing enzymes, a double-stranded DNA genome, and transcription factors protected by the protein core.

[0204] The monkeypox genome consists of a linear double-stranded DNA (about 197 kb) covalently linked at its ends by palindromic hairpins, and inverted terminal repeats (ITRs) consist of hairpin loops, tandem repeats, and some open reading frames (ORFs). Although MPXV is a DNA virus, its entire life cycle occurs in the cytoplasm of infected cells. All proteins required for viral DNA replication, transcription, virion assembly, and export are encoded by the monkeypox genome. Genes encoding housekeeping functions are highly conserved in OPV and are present in the central region of the genome, while those encoding genes mediating virus-host interactions are less conserved and are located in the terminal regions of the genome.

[0205] In vaccinia virus (and most likely in monkeypox), intracellular mature virus (IMV) and extracellular enveloped virus (EEV) are two forms of infectious virions produced in cells infected by poxviruses. IMV is released upon cell lysis, while EEV is released from the cell by interaction with the actin tail, and this is thought to be the reason for the rapid long-distance spread of the virus within the infected host. Although the above characteristics are for VACV, these characteristics are likely to be common to all OPVs. Cell-associated virions (CEV) are formed after microtubule-mediated transport of intracellular enveloped virus (IEV) to the cell periphery, where the outer membrane of IEV fuses with the plasma membrane and remains attached to the cell surface. CEV is primarily responsible for cell-to-cell transmission. IEV is formed when IMV is wrapped by a double membrane derived from early endosome components or the trans-Golgi network (TGN). However, in addition to IEV exocytosis, an alternative pathway for the formation of EEV is budding of IMV through the plasma membrane. In the prototype vaccinia virus, virion morphogenesis may be defective, resulting in non-infectious dense particles (DP), but this has not been reported for monkeypox. Furthermore, unlike some CPXV strains in which the IMV is enclosed within type A inclusion bodies (ATIs), monkeypox does not form ATIs or sequesters IMV into ATIs due to a truncation in the ATIP gene.

[0206] Monkeypox transmission

[0207] Two possible modes of monkeypox transmission are animal-to-human and human-to-human. Respiratory droplets, as well as contact with body fluids, contaminated environments or objects from infected individuals, and skin lesions from infected individuals, have been implicated in human-to-human transmission. Contact with broken skin or mucous membranes with infected body fluids, respiratory droplets, or scabs is considered a "high-risk" exposure and warrants prompt post-exposure vaccination. The Congo Basin (CB) clade (Central African clade) is reported to be more virulent than the West African (WA) clade and, therefore, more conducive to human-to-human transmission. Animal-to-human transmission, also known as zoonotic transmission, occurs through direct contact with any of the aforementioned natural viral reservoirs or objects used by these reservoirs. In addition, zoonotic transmission can occur through direct contact with blood, body fluids, and mucocutaneous inoculation of infected animals. Nosocomial transmission of the CB and WA clades of monkeypox has been reported, while sexual transmission from infected individuals with inguinal and genital lesions has been hypothesized. Human-to-animal transmission has not yet been reported. Human-to-human transmission, secondary morbidity (SARS), and sexual transmission events are significantly higher with the CB clade compared to the WA clade. The reproduction number R0 for the CB clade is estimated to be in the range of 0.6–1.0. The R0 for the WA clade of monkeypox has not yet been estimated but is presumed to be lower than that for the CB clade. The upper limit of 1.0 for the CB clade suggests that the virus will not only continue to spread from person to person but also persist in the human population. It is speculated that if, as expected, the R0 for the WA clade is much lower than the estimated R0 for the CB clade, then sustained human-to-human transmission and persistence in the human population are extremely unlikely, and the outbreak will be primarily attributable to spillover events from zoonotic reservoirs.

[0208] Monkeypox treatment

[0209] Currently, there is no specific, clinically proven treatment for monkeypox infection. As with most viral illnesses, treatment is supportive symptom management. However, there are some preventive measures that can help prevent and / or reduce the severity of an outbreak. Infected individuals should remain isolated, wear a surgical mask, and keep lesions covered as much as reasonably possible until all lesions have scabbed and fallen off naturally, and a new layer of skin has formed. For severe cases, the investigational use of compounds with demonstrated benefit against orthopoxviruses in animal studies and in severe vaccinia vaccine complications may be considered. The oral DNA polymerase inhibitor brincidofovir, the oral inhibitor of intracellular viral release tecovirimat, and intravenous vaccinia immune globulin have unknown efficacy against monkeypox virus. For individuals exposed to the virus, temperature and symptoms should be monitored twice daily for 21 days, as this is the accepted upper limit of the incubation period for monkeypox. Infectivity coincides with symptom onset; therefore, close contacts do not need to be isolated while asymptomatic. According to the Centers for Disease Control and Prevention (CDC), vaccination within four days of exposure can prevent the onset of illness, while vaccination within 14 days can reduce the severity of illness.

[0210] Exemplary Monkeypox Polypeptides

[0211] B6R

[0212] Monkeypox B6R (also known as MPXVgp167) is an approximately 35 kD polypeptide. B6R is classified as a membrane glycoprotein, which is a component of the monkeypox EEV envelope. B6R contains a transmembrane domain and two sushi domains. B6R is also classified as a negative regulator involved in complement activation. B6R polypeptide sequences include, for example, UniProt accession numbers Q8V4S2, V9NQJ0, and A0A0F6N8B7, each of which is incorporated herein by reference in its entirety. Exemplary B6R amino acid sequences are provided in Tables 1 and 8 below.

[0213] Monkeypox B6R is homologous to vaccinia B5R. Vaccinia virus B5R (see, e.g., accession number AAN78219.1) is a membrane protein required for the packaging of mature virions into enveloped virions within cells and is specific for EEV. DOI: https: / / doi.org / 10.1083 / jcb.200104124, https: / / doi.org / 10.1128 / jvi.68.1.130-147.1994, https: / / doi.org / 10.1099 / 0022-1317-83-12-2915

[0214] A35R

[0215] Monkeypox A35R (also known as MPXV-COP-139, MPXV-SL-139, and MPXV-WRAIR139) is an approximately 20 kD polypeptide. A35R is classified as a membrane protein, specifically a bifunctional EEV membrane phosphoglycoprotein. A35R polypeptide sequences include, for example, UniProt accession numbers Q8V4U4 and Q80KX2, each of which is incorporated herein by reference in its entirety. Exemplary A35R amino acid sequences are provided in Tables 1 and 8 below.

[0216] Monkeypox A35R is homologous to vaccinia A33R. Vaccinia virus A33R (see, e.g., accession number AAF63733, incorporated herein by reference in its entirety) is a type II integral membrane protein found in EEV (extracellular enveloped virus) but not IMV and is highly conserved among orthopoxviruses. See, e.g., DOI: 10.1128 / jvi.72.5.4192-4204.1998

[0217] M1R

[0218] MPXV M1R (also known as IMV membrane protein, MPXV-COP-074, MPXV-SL-074) is an approximately 27 kD polypeptide. M1R polypeptide sequences include, for example, UniProt accession numbers Q8V502, Q80KX3, and Q5IXU5, each of which is incorporated herein by reference in its entirety. Exemplary M1R amino acid sequences are provided in Tables 1 and 8 below.

[0219] MPXV M1R is homologous to vaccinia L1R. Vaccinia virus L1R (see, e.g., accession number AAF63732, incorporated herein by reference in its entirety) is a myristoylated transmembrane protein of approximately 250 residues expressed on the surface of IMVs. It is believed to be essential, at least because genetic deletion of L1R renders vaccinia virus unable to mature. L1R appears to be required for viral particle maturation. See, e.g., DOI: https: / / doi.org / 10.1128 / jvi.68.10.6401-6410.1994, 10.1073 / pnas.062163799

[0220] E8L

[0221] MPXV E8L (also known as cell surface binding protein, carbonic anhydrase homolog) is an approximately 35 kD polypeptide. E8L is a membrane protein. E8L binds to chondroitin sulfate on the surface of target cells, facilitating viral attachment to the target cell. E8L polypeptide sequences include, for example, UniProt accession numbers A0A0F6N859, Q8V4Y0, Q3I8Q9, Q3I9B0, and Q5IXS0, each of which is incorporated herein by reference in its entirety. Exemplary E8L amino acid sequences are provided in Tables 1 and 8 below.

[0222] H3L

[0223] H3L (also known as IMV heparin-binding surface protein, envelope protein H3, MPXV-COP-087, MPXV-SL-087, MPXV-WRAIR087, MPXVgp093) is an approximately 37.5 kD polypeptide localized to the monkeypox virus envelope. H3L polypeptide sequences include, for example, UniProt accession numbers Q8V4Z2, Q3I8S1, Q5IXT2, and A0A0F6N9X0, each of which is incorporated herein by reference in its entirety. Exemplary H3L amino acid sequences are provided in Tables 1 and 8 below. Monkeypox H3L was found to have high sequence similarity to vaccinia H3L.

[0224] A28L

[0225] A28L (also known as type A inclusion protein, vaccinia type A inclusion protein) is an approximately 60 kD polypeptide localized to the monkeypox virus envelope. A28L is involved in viral entry into host cells and cell-cell fusion (syncytium formation). Monkeypox A28L sequences include, for example, UniProt accession numbers Q8V4V0, V9NSD8, V9NNF4, V9NKU4, V9NWM3, V9NR63, A0A0F7GAP0, A0A2L1F535, A0A0F7G921, A0A0F7GB12, each of which is incorporated herein by reference in its entirety. Exemplary monkeypox A28L amino acid sequences are provided in Tables 1 and 8 below.

[0226] A29L

[0227] A29L (also known as 14 kDa protein, 14K membrane protein, IMV surface protein fusion protein, MPXV-COP-132, MPXV-SL-132) is an approximately 14 kDa polypeptide. A29L is localized to the viral envelope and is involved in the fusion of the viral membrane with the host plasma membrane. Monkeypox A29L sequences include, for example, UniProt accession numbers Q77HM6, Q9YN60, and Q3I824, each of which is incorporated herein by reference in its entirety. Exemplary A29L amino acid sequences are provided in Tables 1 and 8 below.

[0228] Monkeypox A29L is homologous to vaccinia A27L. Vaccinia virus A27L (see, e.g., accession number AAN78218.2, incorporated herein by reference in its entirety) has been implicated in viral attachment, virus-host cell fusion, cell-cell fusion, plaque size, and the formation of enveloped virions. See, e.g., Chung et al. J Virol. 1998 Feb;72(2):1577-85. doi:10.1128 / JV I.72.2.1577-1585.1998.; Doms et al. J Virol. 1990 Oct; 64(10): 4884-92. doi: 10.1128 / JVI.64.10.4884-4892. 1990.; Gong et al. Virology. 1990 Sep; 178(1): 81-91. doi: 10.1016 / 0042-6822(90)90381-z.; Dallo et al. Virology. 1987 Aug; 159(2): 423-32. doi: 10.1016 / 0042-6822(87)90481-8.; and Payne and Norrby J Gen Virol. 1976 Jul; 32(1): 63-72. doi: 10.1099 / 0022-1317-32-1-63.

[0229] II. Polyribonucleotides

[0230] A. Exemplary polyribonucleotide constructs

[0231] The present disclosure particularly utilizes RNA technology as a modality for expressing one or more orthoviral (eg, monkeypox) polypeptide constructs comprising one or more orthoviral (eg, monkeypox) antigens described herein, or one or more portions thereof.

[0232] In some embodiments, the present disclosure provides polyribonucleotides encoding one or more monkeypox antigens or fragments thereof. The present disclosure includes the unexpected discovery that the monkeypox B cell antigens and fragments thereof provided in Table 1 are particularly advantageous for use in preventing or treating monkeypox, for example, as further disclosed herein in monkeypox antigen constructs and / or monkeypox vaccines.

[0233] Table 1: Monkeypox B cell antigens

[0234]

[0235] In various embodiments, the polyribonucleotides of the present disclosure encode a single monkeypox antigen or a fragment thereof of Table 1 (e.g., an A29L polypeptide or a fragment thereof, an A35R polypeptide or a fragment thereof, a B6R polypeptide or a fragment thereof, an M1R polypeptide or a fragment thereof, an E8L polypeptide or a fragment thereof, an A28L polypeptide or a fragment thereof, or an H3L polypeptide or a fragment thereof). In some embodiments, the polyribonucleotides of the present disclosure encode an A29L polypeptide or a fragment thereof having the sequence of any one of the A29L sequences of Table 1. In some embodiments, the polyribonucleotides of the present disclosure encode an A35R polypeptide or a fragment thereof having the sequence of any one of the A35R sequences of Table 1. In some embodiments, the polyribonucleotides of the present disclosure encode a B6R polypeptide or a fragment thereof having the sequence of any one of the B6R sequences of Table 1. In some embodiments, the polyribonucleotides of the present disclosure encode an M1R polypeptide or a fragment thereof having the sequence of any one of the M1R sequences of Table 1. In some embodiments, the polyribonucleotides of the present disclosure encode an E8L polypeptide or a fragment thereof having the sequence of any one of the E8L sequences of Table 1. In some embodiments, the polyribonucleotides of the present disclosure encode an H3L polypeptide or a fragment thereof having a sequence of any one of the H3L sequences in Table 1. In some embodiments, the polyribonucleotides of the present disclosure encode an A28L polypeptide or a fragment thereof having a sequence of any one of the A28L sequences in Table 1.

[0236] In various embodiments, the polyribonucleotides of the present disclosure encode two, three, four, five, or six monkeypox antigens or fragments thereof of Table 1. In some embodiments, the polyribonucleotides of the present disclosure encode two or more monkeypox polypeptides selected from the group consisting of an E8L polypeptide or a fragment thereof, an A35R polypeptide or a fragment thereof, a B6R polypeptide or a fragment thereof, an M1R polypeptide or a fragment thereof, an H3L polypeptide or a fragment thereof, an A28L polypeptide or a fragment thereof, and an A29L polypeptide or a fragment thereof.

[0237] In some embodiments, the polyribonucleotides of the present disclosure encode a B6R polypeptide having a sequence of any one of the B6R sequences in Table 1 and an M1R polypeptide having a sequence of any one of the M1R sequences in Table 1. In some embodiments, the polyribonucleotides of the present disclosure encode an A35R polypeptide having a sequence of any one of the A35R sequences in Table 1, a B6R polypeptide having a sequence of any one of the B6R sequences in Table 1, and an M1R polypeptide having a sequence of any one of the M1R sequences in Table 1. In some embodiments, the polyribonucleotides of the present disclosure encode an A35R polypeptide having a sequence of any one of the A35R sequences in Table 1, a B6R polypeptide having a sequence of any one of the B6R sequences in Table 1, an M1R polypeptide having a sequence of any one of the M1R sequences in Table 1, and an E8L polypeptide having a sequence of any one of the E8L sequences in Table 1. In some embodiments, the polyribonucleotides of the present disclosure encode an A35R polypeptide having a sequence of any one of the A35R sequences in Table 1, a B6R polypeptide having a sequence of any one of the B6R sequences in Table 1, an M1R polypeptide having a sequence of any one of the M1R sequences in Table 1, and an H3L polypeptide having a sequence of any one of the H3L sequences in Table 1.

[0238] In some embodiments, the polyribonucleotides of the present disclosure encode one or more IMV antigens. In some embodiments, the one or more IMV antigens are selected from H3L, E8L, M1R, and A29L. In some embodiments, the polyribonucleotides of the present disclosure encode one or more IMV-specific antigens. In some embodiments, the one or more IMV-specific antigens are selected from H3L, E8L, M1R, and A29L.

[0239] In some embodiments, the polyribonucleotides of the present disclosure encode one or more EEV antigens. In some embodiments, the one or more EEV antigens are selected from A35R and B6R. In some embodiments, the polyribonucleotides of the present disclosure encode one or more EEV-specific antigens. In some embodiments, the one or more EEV-specific antigens are selected from A35R and B6R.

[0240] In some embodiments, the polyribonucleotides of the present disclosure encode one or more E8L polypeptides (e.g., E8L antigen or one or more fragments thereof). In some embodiments, the polyribonucleotides of the present disclosure encode one or more A35R polypeptides (e.g., A35R antigen or one or more fragments thereof). In some embodiments, the polyribonucleotides of the present disclosure encode one or more B6R polypeptides (e.g., B6R antigen or one or more fragments thereof). In some embodiments, the polyribonucleotides of the present disclosure encode one or more M1R polypeptides (e.g., M1R antigen or one or more fragments thereof). In some embodiments, the polyribonucleotides of the present disclosure encode one or more H3L polypeptides (e.g., H3L antigen or one or more fragments thereof). In some embodiments, the polyribonucleotides of the present disclosure encode one or more A28L polypeptides (e.g., A28L antigen or one or more fragments thereof). In some embodiments, the polyribonucleotides of the present disclosure encode one or more A29L polypeptides (e.g., A29L antigen or one or more fragments thereof).

[0241] The present disclosure includes the unexpected discovery that the monkeypox T cell antigens and fragments thereof provided in Table 2 are particularly advantageous for use in preventing or treating monkeypox, for example in monkeypox antigen constructs and / or monkeypox vaccines as further disclosed herein.

[0242] Table 2: Monkeypox T cell antigens

[0243]

[0244]

[0245] In various embodiments, the polyribonucleotides of the present disclosure encode a single monkeypox antigen or fragment thereof from Table 2 (e.g., an A45L polypeptide or fragment thereof, a B9R polypeptide or fragment thereof, a B16R polypeptide or fragment thereof, a C10L polypeptide or fragment thereof, a C21L polypeptide or fragment thereof, an E7R polypeptide or fragment thereof, a F3L polypeptide or fragment thereof, an F4L polypeptide or fragment thereof, a G6R polypeptide or fragment thereof, an H5R polypeptide or fragment thereof, an I3L polypeptide or fragment thereof, an O2L polypeptide or fragment thereof, a Q1L polypeptide or fragment thereof, a B12R polypeptide or fragment thereof, or a C17L polypeptide or fragment thereof). In various embodiments, the polyribonucleotides of the present disclosure encode multiple monkeypox antigens or fragments thereof from Table 2 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 monkeypox antigens or fragments thereof from Table 2). In various embodiments, the polyribonucleotides of the present disclosure encoding multiple monkeypox antigens or fragments thereof (e.g., monkeypox antigens or fragments thereof from Table 2) can be referred to as string constructs.

[0246] The present disclosure particularly encompasses the recognition that, in some embodiments, it may be particularly advantageous to include a string of monkeypox T-cell antigens or fragments thereof from Table 2 in a single polyribonucleotide. The present disclosure further particularly encompasses the recognition that, in some embodiments, it may be particularly advantageous to combine in a composition or use at least a first polyribonucleotide encoding a monkeypox B-cell antigen or fragment thereof (e.g., an antigen or fragment thereof from Table 1) and a second polyribonucleotide encoding a plurality of monkeypox T-cell antigens or fragments thereof (e.g., an antigen or fragment thereof from Table 2).

[0247] As described herein, in some embodiments, the provided technology involves administering multiple antigens to the same subject. In some embodiments, multiple antigens are administered simultaneously (e.g., in a single dose). In some embodiments, different antigens can be administered at different times (e.g., in different doses—e.g., a primary dose versus a booster dose). In some embodiments, multiple antigens are administered via the same composition.

[0248] For clarity, a single "antigenic" polypeptide may include multiple "epitopes," which may or may not be linked to each other in nature. For example, a single string construct antigen may include multiple epitopes, which may be from different portions of the same monkeypox protein and / or from different monkeypox proteins, linked together in a single polypeptide as described herein.

[0249] Thus, as described herein, a single pharmaceutical composition (e.g., an immunogenic composition, such as a vaccine) can include or deliver (e.g., because the pharmaceutical composition includes a nucleic acid, such as RNA, that encodes the antigen and is expressed upon administration) a single antigen, which itself can contain multiple epitopes (in its natural arrangement relative to each other or in an engineered or constructed arrangement as described herein), or can include or deliver multiple antigens, each of which can similarly be or contain a single epitope or multiple epitopes (in its natural arrangement relative to each other or in an engineered or constructed arrangement as described herein). Still further, a single pharmaceutical composition (e.g., an immunogenic composition, such as a vaccine) can, for example, include multiple different nucleic acids (e.g., RNA) that each encode a different antigen, or, in some embodiments, can include a single nucleic acid that encodes (and expresses) multiple antigens. Furthermore, in some embodiments, a single pharmaceutical composition (e.g., an immunogenic composition, such as a vaccine) that includes multiple different nucleic acids (e.g., RNA) that encode an antigen can be prepared by mixing the RNAs and then incorporating the mixture into LNPs, or alternatively by formulating the individual RNAs into LNPs and then mixing the LNPs. In some embodiments, the mixture (whether of pre-LNP preparation RNA or LNP) can include the relevant RNA in a 1:1 ratio in the subject to which the composition is administered, or in other ratios that may be preferred (e.g., to achieve a desired relative presentation of the antigen or epitope).

[0250] In some embodiments, two or more RNA molecules each encoding a different polypeptide (e.g., a monkeypox antigen as described herein) can be mixed with a particle forming agent to form particles containing nucleic acids as described above. In an alternative embodiment, two or more RNA molecules each encoding a different polypeptide (e.g., a monkeypox antigen as described herein) can be formulated into separate particle compositions and then mixed together. For example, in some embodiments, individual populations of particles containing nucleic acids, each population comprising RNA molecules encoding different immunogenic polypeptides or immunogenic fragments thereof (e.g., monkeypox antigens as described herein), can be formed separately and then mixed together, for example, before filling into a vial during the manufacturing process, or immediately before administration (e.g., by a health care professional). Thus, in some embodiments, compositions comprising two or more particle populations (e.g., in some embodiments, lipid nanoparticles) are described herein, each population comprising at least one RNA molecule encoding a different immunogenic polypeptide or immunogenic fragment thereof (e.g., a monkeypox antigen or fragment thereof). In some embodiments, each population can be provided in the composition in a desired ratio (e.g., in some embodiments, each population can be provided in the composition in an amount that provides the same amount of RNA molecules).

[0251] In some embodiments, one or more pharmaceutical compositions (e.g., immunogenic compositions, such as vaccines) may comprise or deliver a combination comprising polypeptides encoded by all or part of A29L, A35R, B6R, M1R, E8L, A28L, H3L, A45L, B9R, B16R, C10L, C21L, E7R, F3L, F4L, G6R, H5R, I3L, O2L, Q1L, B12R and / or C17L, or fragments thereof.

[0252] In some embodiments, one or more pharmaceutical compositions (e.g., immunogenic compositions, such as vaccines) may comprise or deliver a combination of polypeptides or portions thereof encoded by all or part of E8L, A35R, B6R, M1R, H3L, A28L, A29L, and / or fragments of any thereof.

[0253] In some embodiments, one or more pharmaceutical compositions (e.g., immunogenic compositions, such as vaccines) comprise or deliver a combination of one or more IMV antigens (e.g., IMV-specific antigens) and one or more EEV antigens (e.g., EEV-specific antigens). In some embodiments, one or more pharmaceutical compositions comprise or deliver a combination of monkeypox antigens, the combination comprising (i) one or more IMV antigens selected from H3L, E8L, M1R, A29L, and fragments thereof (e.g., IMV-specific antigens); and (ii) one or more EEV antigens selected from A35R, B6R, and fragments thereof (e.g., EEV-specific antigens).

[0254] In some embodiments, one or more pharmaceutical compositions (e.g., immunogenic compositions, such as vaccines) may include or deliver combinations comprising polypeptides encoded by all or part of the following, or portions thereof: B6R, M1R, and / or a fragment of any of them. In some embodiments, one or more pharmaceutical compositions (e.g., immunogenic compositions, such as vaccines) may include or deliver combinations comprising polypeptides encoded by all or part of the following, or portions thereof: B6R, A35R, and / or a fragment of any of them. In some embodiments, one or more pharmaceutical compositions (e.g., immunogenic compositions, such as vaccines) may include or deliver combinations comprising polypeptides encoded by all or part of the following, or portions thereof: B6R, A35R, M1R, and / or a fragment of any of them. In some embodiments, one or more pharmaceutical compositions (e.g., immunogenic compositions, such as vaccines) may include or deliver combinations comprising polypeptides encoded by all or part of the following, or portions thereof: B6R, A35R, M1R, and / or a fragment of any of them. In some embodiments, one or more pharmaceutical compositions (e.g., immunogenic compositions, such as vaccines) may include or deliver combinations comprising polypeptides encoded by all or part of the following, or portions thereof: B6R, A35R, M1R, H3L, and / or a fragment of any of them. In some embodiments, one or more pharmaceutical compositions (e.g., immunogenic compositions, such as vaccines) may comprise or deliver a combination comprising polypeptides encoded by all or part of B6R, A35R, M1R, E8L, and / or a fragment of any thereof, or portions thereof. In some embodiments, one or more pharmaceutical compositions (e.g., immunogenic compositions, such as vaccines) may comprise or deliver a combination comprising polypeptides encoded by all or part of B6R, A35R, M1R, H3L, E8L, and / or a fragment of any thereof, or portions thereof.

[0255] In some embodiments, the compositions provided include or deliver a monkeypox envelope glycoprotein antigen (e.g., a full-length monkeypox envelope glycoprotein, a fragment thereof, or one or more epitopes thereof, for example, in a string construct). In some embodiments, the compositions provided include or deliver such a monkeypox envelope glycoprotein antigen and one or more B cell targets (e.g., epitopes), which may be or include one or more other monkeypox proteins (or fragments or epitopes thereof). In some embodiments, such a B cell target is or includes a monkeypox protein (or a fragment or epitope thereof) that is predicted or known to induce a B cell response in an infected person. For example, in some embodiments, the B cell target is or includes a monkeypox protein (or a fragment or B cell epitope thereof) to which serum from an infected individual is reactive. In some specific embodiments, the B cell target is or includes a monkeypox envelope glycoprotein, or other related monkeypox proteins, or fragments or epitopes thereof.

[0256] In some embodiments, provided compositions comprise or deliver string construct antigens comprising multiple T cell epitopes (optionally from more than one monkeypox protein). In some such embodiments, provided compositions further comprise or deliver one or more B cell targets. Alternatively or additionally, in some embodiments, the string construct antigens so used comprise monkeypox sequences (e.g., one or more fragments or epitopes, such as T cell epitopes and / or B cell epitopes, but in some embodiments specifically T cell epitopes).

[0257] In some embodiments, the string construct antigen includes a B cell epitope and a T cell epitope (optionally from the same monkeypox protein or from different monkeypox proteins).

[0258] In some embodiments, different antigens can be delivered by administering different compositions, which in turn can be administered simultaneously in some embodiments (e.g., as a mixture, or otherwise administered substantially simultaneously), and in some embodiments, can be administered at different times. As just one example, in some embodiments, a particular antigen or antigens can be delivered via an initial pharmaceutical composition (e.g., an immunogenic composition, such as a vaccine) dose, and one or more additional antigens can be delivered via one or more booster doses.

[0259] In some embodiments, the antigens used in (i.e., included in and / or otherwise delivered by) the pharmaceutical compositions described herein (e.g., immunogenic compositions, such as vaccines) comprise, for example, multiple epitopes of a single monkeypox protein or multiple proteins.

[0260] In some embodiments, an antigen may comprise two or more epitopes from the same monkeypox protein in their native configuration relative to each other (e.g., as fragments in the case of related proteins). However, in some embodiments, an antigen may comprise at least two epitopes that are configured in a non-natural relationship relative to each other (e.g., as included in a string construct described herein).

[0261] Among other things, the present disclosure provides the insight that string construct antigens may be particularly useful or effective for vaccination against monkeypox infection. Without wishing to be bound by any particular theory, the present disclosure proposes that the ability to link individual epitopes predicted or determined to have specific properties (e.g., binding to relevant HLA alleles, expression at relevant infection times, representation of specific conserved sequences, perhaps across multiple different monkeypox proteins) may prove uniquely beneficial or indeed critical for effective vaccination against monkeypox, whereas more traditional vaccination approaches have so far provided only limited protection.

[0262] In some embodiments, polyepitope antigens (e.g., string construct antigens or multi-epitope antigens) can be administered as a polypeptide and / or as a collection of peptides. Alternatively or additionally, polyepitope antigens can be administered as a preparation of cells comprising (e.g., expressing) the antigen. However, the disclosure further provides such insights, i.e., in some embodiments, it may be particularly useful and / or effective to deliver by administering nucleic acids (and particularly RNA) encoding polyepitope antigens.

[0263] Experience with SARS-CoV-2 has demonstrated that administration of RNA can be a particularly effective way to deliver infectious disease antigens. Furthermore, the present disclosure provides insights into various features of nucleic acid formats, including, for example, their flexibility and adaptability to rapid design and modification, including incorporation of various insights (e.g., bioinformatics input, etc.), making them particularly attractive for use in monkeypox vaccines. Among other things, the present disclosure provides insights into that, in some embodiments, administration of RNA encoding string construct antigens as described herein may be a particularly desirable and / or effective method for immunizing against monkeypox infection.

[0264] In some embodiments, a "string" polynucleotide sequence encodes multiple antigens and / or epitopes in series. In some embodiments, the string encodes about 2 to about 100, about 2 to about 75, about 2 to about 50, about 2 to about 25, about 2 to about 20, about 2 to about 15, about 2 to about 10, or about 2 to about 5 antigens and / or epitopes. In some embodiments, the string encodes about 5 to about 100, about 5 to about 75, about 5 to about 50, about 5 to about 25, about 5 to about 20, about 5 to about 15, or about 5 to about 10 antigens and / or epitopes. In some embodiments, a "string" polynucleotide sequence encodes multiple epitopes in series. In some embodiments, the string encodes about 2 to about 1000 or about 2 to about 10,000 antigens and / or epitopes. In some embodiments, about 2-5,000 antigens and / or epitopes are encoded in one polynucleotide string. In some embodiments, about 2-4,000 antigens and / or epitopes are encoded in one polynucleotide string. In some embodiments, about 2-3,000 antigens and / or epitopes are encoded in one polynucleotide string. In some embodiments, about 2-2,000 antigens and / or epitopes are encoded in one polynucleotide string. In some embodiments, about 2-1,000 antigens and / or epitopes are encoded in one polynucleotide string. In some embodiments, about 10-500 antigens and / or epitopes are encoded in one polynucleotide string. In some embodiments, about 10-200 antigens and / or epitopes are encoded in one polynucleotide string. In some embodiments, about 20-100 antigens and / or epitopes are encoded in one polynucleotide string.

[0265] In some embodiments, the epitope encoded by the string construct comprises an epitope predicted by HLA binding and presentation prediction software to be likely presented by an HLA-encoded protein to T cells to elicit an immune response. In some embodiments, the epitope predicted to be likely presented by an HLA-encoded protein is selected from any one of the proteins or peptides described in Table 1 or Table 2. In some embodiments, the epitope encoded by the string construct comprises a membrane-associated or otherwise accessible epitope, for example, at a relevant time in the monkeypox life cycle.

[0266] In some embodiments, the antigen used in accordance with the present disclosure is or comprises A29L, A35R, B6R, M1R, E8L, A28L, H3L, A45L, B9R, B16R, C10L, C21L, E7R, F3L, F4L, G6R, H5R, I3L, O2L, Q1L, B12R and / or C17L or a fragment thereof, a variant thereof, and / or a fragment or epitope of any of the foregoing, or a combination of any of the foregoing. In some embodiments, the antigen used in accordance with the present disclosure is or comprises monkeypox protein, monkeypox envelope protein, monkeypox interlayer protein, monkeypox membrane protein, a variant thereof, and / or a fragment or epitope of any of the foregoing, or a combination of any of the foregoing. In some embodiments, the string construct can encode multiple epitopes from 2, 3, 4 or more monkeypox proteins. In some embodiments, the string construct comprises one or more features described herein, including the Examples and Tables. In some embodiments, the string construct encodes one or more antigens and / or epitopes comprising one or more sequences of Table 1 or Table 2, or fragments thereof.

[0267] Alternatively or additionally, in some embodiments, one or more string constructs can encode one or more other epitopes (e.g., as can be predicted or confirmed, e.g., in the literature). In some embodiments, the string constructs can include sequences encoding features such as linkers and cleavage sites (e.g., autocleavage sites, such as T2A or P2A sequences). In some embodiments, linkers rich in G and S residues can be used. In some embodiments, exemplary linkers can have the sequence of GGGGSGGGGS (SEQ ID NO: 222) or GGSGGGGSGG (SEQ ID NO: 176).

[0268] In some embodiments, the string construct comprises two or more overlapping epitope encoding sequences.

[0269] In some embodiments, the string construct comprises a nucleic acid sequence encoding a polypeptide comprising an amino acid sequence that is 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of the sequences in Table 1 or Table 2. As noted above, where the compared sequences are longer than about 20 amino acids, the percent identity or homology is typically greater than about 80%; for sequences longer than about 50 amino acids, the percent identity or homology is typically greater than about 90%.

[0270] In some embodiments, epitopes are arranged and / or encoded on a string to maximize the immunogenicity of the expressed epitope, for example, by maximizing recognition of the subject's HLA allele repertoire. In some embodiments, the same string encodes epitopes that can bind to different HLA alleles and / or are predicted to bind to different HLA alleles. For example, as fully illustrated in the sequence listings (e.g., at least in Tables 1 and 2), a string can encode: (a) a first epitope that binds or is predicted to bind to a first MHC peptide encoded by a first HLA allele; (b) a second epitope that binds or is predicted to bind to a second MHC peptide encoded by a second HLA allele; (c) a third epitope that binds or is predicted to bind to a third MHC peptide encoded by a third HLA allele, and more such epitopes can be added, for example, in a string sequence as provided herein; wherein the first, second, and third epitopes are epitopes from the same monkeypox protein or from different monkeypox proteins. In this way, the distribution of epitopes encoded by a single string is maximized to hit different MHC-based presentations on T cells, thereby maximizing the likelihood of generating the desired immune response from a wider range of patients in a given population and maximizing the robustness of the response in each patient.

[0271] In some embodiments, epitopes included in the string construct are selected based on high-scoring predictions for binding to HLA by a reliable prediction algorithm or system (such as the RECON prediction algorithm). In some embodiments, the present disclosure provides insights into how particularly successful strings can be provided by selecting epitopes based on highly reliable and efficient prediction algorithms, arranging the layout of string-encoded epitopes; including or omitting non-epitope sequences or sequences flanking epitopes, confirming the immunogenicity of the strings in an ex vivo cell culture model or an animal model, specifically showing T cell induction after vaccination with the string construct or a polypeptide encoded by the string construct, selecting strings that elicit specific T cell responses, or a combination thereof. In some embodiments, validation can come from use in human patients, and finding that T cells obtained from vaccinated patients show potent and long-lasting epitope-specific T cell responses. In some embodiments, the efficiency of the string as a vaccine is influenced by its design, which depends in part on the strength of the bioinformatics information used in the careful execution of the design, the reliability of the MHC presentation prediction model, the efficiency of epitope processing when the string vaccine is expressed in cells, or a combination thereof, etc.

[0272] In some embodiments, the multi-epitope RNA (e.g., mRNA) construct as described above comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more antigens and / or epitopes. In some embodiments, the pharmaceutical composition comprises 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more strings. In some embodiments, the pharmaceutical composition comprises 6 strings. In some embodiments, the pharmaceutical composition comprises 7 strings. In some embodiments, the pharmaceutical composition comprises 8 strings. In some embodiments, the pharmaceutical composition comprises 9 strings. In some embodiments, the pharmaceutical composition comprises 10 strings.

[0273] In some embodiments, the epitope encoding sequence in the string construct is flanked by one or more sequences selected to achieve higher immunogenicity, better cleavage of the peptide for presentation to MHC, better expression, and / or improved translation in the cells of the subject. In some embodiments, the flanking sequence comprises a linker with a specific cleavable sequence. In some embodiments, the epitope encoding sequence in the string construct is flanked by a secreted protein sequence.

[0274] In some embodiments, the string sequence encodes an epitope that may comprise or otherwise be linked to a signal sequence such as those listed in Table 3, or at least one sequence with 1, 2, 3, 4, or 5 amino acid differences therefrom. In some embodiments, the string sequence encodes an epitope that may comprise or otherwise be linked to a signal sequence such as MFVFLVLLPLVSSQCVNLT (SEQ ID NO: 146) or at least one sequence with 1, 2, 3, 4, or up to 5 amino acid differences therefrom. In some embodiments, the epitope encoded by the string sequence may be linked at the N-terminus by a sequence rich in G and S residues or a sequence with 1, 2, 3, 4, or up to 5 amino acid differences therefrom. In some embodiments, an exemplary linker that can be used to link an epitope has the sequence GGSGGGGSGG (SEQ ID NO: 176).

[0275] In some embodiments, the linked sequences can comprise a linker having a cleavage sequence, for example, having a specific cleavable sequence.

[0276] In some embodiments, the string construct is connected to a transmembrane domain (TM) or other membrane-associated elements. In some embodiments, the length of the joint can be 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acids. In some embodiments, a joint of no more than about 30, 25, 20, 15, 10 or less amino acids is used. In some embodiments, the joint sequence is not limited to comprising any specific amino acid; In some embodiments, the joint sequence comprises any amino acid. In some embodiments, the joint or cleavage sequence comprises glycine (G). In some embodiments, the joint or cleavage sequence comprises serine (S). In some embodiments, the joint is designed to comprise amino acids based on cutting predictors to produce highly cleavable sequence peptide sequences, and is a novel and effective way to deliver immunogenic T cell epitopes in a T cell vaccine environment.

[0277] In some embodiments, the distribution of epitopes encoded in the string constructs and their juxtaposition are designed to favor the cleavage sequence contributed by the amino acid sequence and / or flanking or connecting residues of the epitope, thereby using minimal linker sequence. Some exemplary cleavage sequences can be, but are not limited to, one or more of the following: FRAC, KRCF, KKRY, ARMA, RRSG, MRAC, KMCG, ARCA, KKQG, YRSY, SFMN, FKAA, KRNG, YNSF, KKNG, RRRG, KRYS, and ARYA (SEQ ID NOs: 223-240, respectively).

[0278] In some embodiments, the string construct is RNA (e.g., mRNA). In some embodiments, the pharmaceutical composition comprises one or more RNA (e.g., mRNA) string constructs, each construct comprising a sequence encoding multiple epitopes as described herein. In some embodiments, one or more RNA (e.g., mRNA) comprises multiple epitopes, wherein each of the multiple epitopes is predicted by an HLA binding and presentation prediction algorithm to be highly likely to be presented to T cells by a protein encoded by an HLA to elicit an immune response.

[0279] In some embodiments, one or more RNAs (e.g., mRNAs) used in the pharmaceutical compositions described herein (e.g., immunogenic compositions, such as vaccines) encode a plurality of epitopes (e.g., comprising one or more or two or more of the sequences provided in Table 1 or Table 2, or fragments thereof), optionally wherein each of the plurality of epitopes is predicted by an HLA binding and presentation prediction algorithm to be likely to be presented by an HLA-encoded protein to T cells to elicit an immune response. In some embodiments, the plurality of epitopes comprises epitopes from a single monkeypox protein. In some embodiments, the plurality of epitopes comprises epitopes from multiple monkeypox proteins.

[0280] In some embodiments, the one or more RNAs (e.g., mRNAs) used in the pharmaceutical compositions described herein (e.g., immunogenic compositions, such as vaccines) include a first RNA encoding a monkeypox antigen expressed before cell infiltration or infection, and include one or more portions expected or known to interface with the host cytoplasm. In some embodiments, the monkeypox antigen encoded by the first RNA is or comprises a monkeypox antigen, a fragment or epitope, such as A29L, A35R, B6R, M1R, E8L, A28L, H3L, A45L, B9R, B16R, C10L, C21L, E7R, F3L, F4L, G6R, H5R, I3L, O2L, Q1L, B12R and / or C17L, or a fragment thereof, an epitope thereof, and / or a combination thereof. In some embodiments, the one or more RNAs (e.g., mRNAs) utilized in the pharmaceutical compositions described herein (e.g., immunogenic compositions, such as vaccines) include a second antigen RNA encoding a polytopic (e.g., multi-epitope) antigen. In some embodiments, the polyepitopic antigen comprises two or more antigens, or fragments or epitopes thereof, found in Table 1 or Table 2. In some embodiments, the polyepitopic antigen comprises two or more antigens, and / or fragments and / or epitopes thereof, listed in Table 1 or Table 2.

[0281] In some embodiments, one or more RNAs (e.g., mRNAs) used in a pharmaceutical composition described herein (e.g., an immunogenic composition, such as a vaccine) include multiple epitopes that are predicted by an HLA binding and presentation prediction algorithm to be highly likely to be presented to T cells by proteins encoded by an HLA to elicit an immune response. In some embodiments, the multiple epitopes include epitopes from a single monkeypox protein. In some embodiments, the multiple epitopes include epitopes from multiple monkeypox proteins.

[0282] In some embodiments, the string construct can include an internal ribosome entry site (IRES), such as between two sequences encoding an antigen or its fragment, and the antigen or its fragment are engineered to be expressed as different polypeptides from polyribonucleotides. Internal ribosome entry site (IRES) is a cis-acting element, which can recruit small ribosomal subunits to the internal start codon in the polyribonucleotide together with cellular trans-acting factors. The ability of internal ribosome entry site (IRES) element to promote the translation of internal initiation polyribonucleotide sequences can promote or allow to express two or more polypeptides from polycistronic polyribonucleic acid. Exemplary IRES is encephalomyocarditis virus (EMCV) IRES.

[0283] In some embodiments, the polyribonucleotide encodes a polypeptide with a supermotif or a motif, and an auxiliary epitope (e.g., a heterologous auxiliary epitope) and an endoplasmic reticulum translocation signal sequence. See, e.g., An and Whitton, J. Virol. 71:2292, 1997; Thomson et al., J. Immunol. 157:822, 1996; Whitton et al., J. Virol 67:348, 1993; Hanke et al., Vaccine 16:426, 1998.

[0284] In addition, in some embodiments, the polyribonucleotides described herein include other elements as described below, including a secretion signal coding region, a 5' cap, a cap-proximal sequence, a 5' UTR, a 3' UTR, and / or a poly A tail. In some embodiments, the polyribonucleotides described herein may include a secretion signal coding region. In some embodiments, the epitope encoded in the string construct may be flanked by a signal peptide sequence, such as the SP1 sequence (HSV-1gD signal peptide / secretion domain, SEQ ID NO: 143). In some embodiments, the polyribonucleotides described herein may include a nucleotide sequence encoding a 5' UTR and / or a 3' UTR of interest. In some embodiments, the polynucleotide comprises a dEarI-hAg sequence (SEQ ID NO: 155). In some embodiments, the RNA (e.g., mRNA) comprises a 5' UTR and a 3' UTR. In some embodiments, the 3' UTR comprises a poly A sequence. In some embodiments, the poly A sequence comprises between 50-200 nucleotides. In some embodiments, the poly A tail of the string construct may comprise approximately 150 A residues. In some embodiments, the poly A tail may include 120 or less residues. In some embodiments, the poly A tail of string construct may include about 120 A residues. In some embodiments, the poly A tail of string construct may include about 100 A residues. In some embodiments, the poly A tail of string construct includes " split " or " interrupted " poly A tail (for example, as described in WO2016 / 005324). In some embodiments, polyribonucleotide as described herein may include a 5 ' cap, which may be incorporated into during transcription, or connected to a polyribonucleotide after transcription.

[0285] 1. Secretion signal

[0286] In some embodiments, the polyribonucleotides described herein comprise a sequence encoding a human secretion signal. For example, in some embodiments, such a human secretion signal can be or comprise the amino acid sequence of MDWIWRILFLVGAATGAHS (husec2; SEQ ID NO: 142). In some embodiments, the ribonucleic acid sequence encoding the secretion signal included in the polyribonucleotide consists of or comprises a nucleotide sequence encoding a non-human secretion signal. In some embodiments, the polyribonucleotide encodes a human secretion signal, wherein the secretion signal comprises the amino acid sequence MDWIWRILFLVGAATGAHS (husec2; SEQ ID NO: 142).

[0287] In some embodiments, the RNA sequence encodes an antigen or fragment thereof, which may comprise or otherwise be linked to a signal sequence (e.g., a secretory sequence) such as those listed in Table 3, or sequences with 1, 2, 3, 4, or 5 amino acid differences therefrom. In some embodiments, a signal sequence such as MRVMAPRTLILLLSGALALTETWAGS (SEQ ID NO: 157), or sequences with 1, 2, 3, 4, or up to 5 amino acid differences therefrom, is used.

[0288] In some embodiments, the signal sequence is selected from those included in Table 3 below:

[0289] Table 3: Exemplary signal sequences

[0290]

[0291]

[0292] 2.5' cap

[0293] A structural feature of mRNA is the cap structure at the five-terminal end (5'). Natural eukaryotic mRNA contains a 7-methylguanosine cap connected to the mRNA via a 5' to 5'-triphosphate bridge, thereby producing a cap0 structure (m7GpppN). In most eukaryotic mRNAs and some viral mRNAs, further modifications (e.g., 2'-hydroxyl groups (2'-OH) of the first and subsequent nucleotides) can occur, thereby producing "cap1" and "cap2" five-terminal ends, respectively). Diamond et al., (2014) Cytokine & Growth Factor Reviews, 25: 543–550 reported that cap0-mRNA cannot be translated as efficiently as cap1-mRNA, where the role of 2'-O-Me in the penultimate position of the mRNA 5' end is a determining factor. It has been shown that the lack of 2'-O-met triggers innate immunity and activates the IFN response. Daffis et al. (2010) Nature, 468:452-456; and Züst et al. (2011) Nature Immunology, 12:137-143.

[0294] RNA capping has been well studied and is described in, for example, Decroly E et al., (2012) Nature Reviews 10:51-65; and Ramanathan A. et al., (2016) Nucleic Acids Res; 44(16):7511–7526, each of which is hereby incorporated by reference in its entirety. For example, in some embodiments, 5'-cap structures that may be suitable in the context of the present invention are cap0 (methylation of the first nucleobase, e.g., m7GpppN), cap1 (additional methylation of the ribose of the adjacent nucleotide of m7GpppN), cap2 (additional methylation of the ribose of the second nucleotide downstream of m7GpppN), cap3 (additional methylation of the ribose of the third nucleotide downstream of m7GpppN), cap4 (additional methylation of the ribose of the fourth nucleotide downstream of m7GpppN), ARCA ("anti-reverse cap analog"), modified ARCA (e.g., phosphorothioate-modified ARCA), inosine, N1-methylguanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.

[0295] As used herein, the term "5'-cap" refers to a structure found at the 5' end of an RNA (e.g., an mRNA), and typically includes a guanosine nucleotide (also referred to as Gppp or G(5')ppp(5')) linked to the RNA (e.g., mRNA) via a 5'- to 5'-triphosphate bond. In some embodiments, the guanosine nucleoside included in the 5' cap may be modified, for example, by methylation at one or more positions (e.g., at the 7-position) on the base (guanine) and / or by methylation at one or more positions of the ribose. In some embodiments, the guanosine nucleoside included in the 5' cap includes 3'O methylation (3'OMeG) at the ribose. In some embodiments, the guanosine nucleoside included in the 5' cap includes methylation (m7G) at the 7-position of guanine. In some embodiments, the guanosine nucleoside included in the 5' cap includes methylation at the 7-position of guanine and 3'O methylation (m7(3'OMeG)) at the ribose. It will be understood that the symbols used in the above paragraphs, such as "(m2 7,3’-O )G" or "m7(3'OMeG)" is applicable to other structures described herein.

[0296] In some embodiments, providing an RNA having a 5'-cap disclosed herein can be achieved by in vitro transcription, wherein the 5' cap is expressed into the RNA chain in a co-transcriptional manner, or can be attached to the RNA after transcription using a capping enzyme. In some embodiments, co-transcriptional capping with the disclosed cap improves the capping efficiency of the RNA compared to co-transcriptional capping with an appropriate reference comparator. In some embodiments, improving the capping efficiency can increase the translation efficiency and / or translation rate of the RNA, and / or increase the expression of the encoded polypeptide. In some embodiments, the alteration of the polynucleotide produces a non-hydrolyzable cap structure, which can, for example, prevent decapping and increase the RNA half-life.

[0297] In some embodiments, T7 RNA polymerase prefers G as the start site. Thus, in some such embodiments, the present disclosure provides caps (e.g., trinucleotide and tetranucleotide caps described herein) wherein the 3' end of the trinucleotide (e.g., N2) or tetranucleotide cap (e.g., N3) is G.

[0298] In some embodiments, it is understood that all compounds or structures provided herein (eg, 5' caps) encompass compounds or structures comprising suitable counterions (eg, Na + ) in free base or salt form (e.g., Na + Salts). Compounds or structures depicted as salts (e.g., 5' cap) also encompass the free base and include a suitable counterion (e.g., Na + ).

[0299] In some embodiments, the 5' cap used is a cap0, cap1 or cap2 structure. See, for example, Ramanathan A et al. Figure 1 and Decroly E et al. Figure 1 , each of which is incorporated herein by reference in its entirety. See, for example, Ramanathan A et al. Figure 1 and Decroly E et al. Figure 1 , each of which is incorporated herein by reference in its entirety. In some embodiments, the RNA described herein comprises a cap1 structure. In some embodiments, the RNA described herein comprises a cap2.

[0300] In some embodiments, the RNA described herein comprises a cap0 structure. In some embodiments, the cap0 structure comprises a methylated guanosine nucleoside ((m 7 )G). In some embodiments, this capO structure is linked to the RNA via a 5'-to-5'-triphosphate bond and is also referred to herein as (m 7 )Gppp. In some embodiments, the cap0 structure comprises a methylated guanosine nucleoside at the 2'-position of the ribose sugar of guanosine. In some embodiments, the cap0 structure comprises a methylated guanosine nucleoside at the 3'-position of the ribose sugar of guanosine. In some embodiments, the guanosine nucleoside included in the 5' cap comprises a methylation at the 7-position of guanine and a methylation at the 2'-position of the ribose sugar ((m2 7,2’-O )G). In some embodiments, the guanosine nucleoside included in the 5' cap comprises a methylation at the 7-position of guanine and a methylation at the 2'-position of ribose ((m2 7,3’-O )G).

[0301] In some embodiments, the cap1 structure comprises a methylation at the 7-position of guanine ((m 7 )G) and optionally methylated guanosine nucleosides at the 2' or 3' position of the ribose and the first nucleotide in the RNA 2'O methylated ((m 2’-O )N1). In some embodiments, the cap1 structure comprises a guanine at the 7-position ((m 7 )G) and methylated guanosine nucleosides at the 3' position of ribose and 2'O-methylated first nucleotides in RNA ((m 2’-O )N1). In some embodiments, the cap1 structure is linked to the RNA via a 5'-to-5'-triphosphate bond and is also referred to herein as, for example ((m 7 )Gppp( 2’-O )N1) or (m2 7,3’-O )Gppp( 2’-O) N1), wherein N1 is as defined and described herein. In some embodiments, the cap1 structure comprises a second nucleotide N2, which is at position 2 and is selected from A, G, C or U, for example (m 7 )Gppp( 2’-O )N1pN2 or (m2 7,3’-O )Gppp( 2’-O )N1pN2, wherein each of N1 and N2 is as defined and described herein.

[0302] In some embodiments, the cap2 structure comprises a methylation at the 7-position of guanine ((m 7 )G) and optionally methylated guanosine nucleosides at the 2' or 3' position of the ribose and 2'O-methylated first and second nucleotides in the RNA ((m 2’-O )N1p(m 2’-O )N2). In some embodiments, cap2 comprises a guanine at the 7-position ((m 7 )G) and guanosine nucleosides methylated at the 3' position of the ribose and the first and second nucleotides methylated at the 2'O position in the RNA. In some embodiments, the cap2 structure is linked to the RNA via a 5'- to 5'-triphosphate bond and is also referred to herein as, for example, ((m 7 )Gppp( 2’-O )N1p( 2’-O )N2) or (m2 7,3’-O )Gppp( 2’-O )N1p( 2’-O )N2), wherein each of N1 and N2 is as defined and described herein.

[0303] In some embodiments, the 5' cap is a dinucleotide cap structure. In some embodiments, the 5' cap is a dinucleotide cap structure comprising N1, wherein N1 is as defined and described herein. In some embodiments, the 5' cap is a dinucleotide cap G*N1, wherein N1 is as defined above and herein, and:

[0304] G* comprises the structure of formula (I):

[0305]

[0306] or a salt thereof,

[0307] Each R 2 and R 3 is -OH or -OCH3; and X is O or S.

[0308] In some embodiments, R 2 In some embodiments, R 2 In some embodiments, R3 In some embodiments, R 3 In some embodiments, R 2 is -OH, and R 3 In some embodiments, R 2 is -OH, and R 3 is -CH3. In some embodiments, R 2 is -CH3, and R 3 In some embodiments, R 2 is -CH3, and R 3 It is -CH3.

[0309] In some embodiments, X is O. In some embodiments, X is S.

[0310] In some embodiments, the 5' cap is a dinucleotide cap0 structure (eg, (m 7 )GpppN1,(m2 7,2’-O )GpppN1、(m2 7,3’-O )GpppN1、(m 7 )GppSpN1、(m2 7,2’-O )GppSpN1 or (m2 7,3’-O )GppSpN1), wherein N1 is as defined and described herein. In some embodiments, the 5' cap is a dinucleotide cap0 structure (e.g., (m 7 )GpppN1、(m2 7,2’-O )GpppN1、(m2 7,3’-O )GpppN1、(m 7 )GppSpN1、(m2 7,2’-O )GppSpN1 or (m2 7,3’-O )GppSpN1), wherein N1 is G. In some embodiments, the 5' cap is a dinucleotide cap0 structure (e.g., (m 7 )GpppN1、(m2 7,2’-O )GpppN1、(m2 7,3’-O )GpppN1、(m 7 )GppSpN1、(m2 7,2’-O )GppSpN1 or (m2 7,3’-O )GppSpN1), wherein N1 is A, U or C. In some embodiments, the 5' cap is a dinucleotide cap1 structure (e.g., (m 7 )Gppp(m 2’-O )N1、(m2 7,2’-O )Gppp(m 2’-O )N1、(m2 7,3’-O )Gppp(m2’-O )N1、(m 7 )GppSp(m 2’-O )N1、(m2 7,2’-O )GppSp(m 2’-O )N1 or (m2 7,3’-O )GppSp(m 2’-O ) N1), wherein N1 is as defined and described herein. In some embodiments, the 5' cap is selected from the group consisting of: (m 7 )GpppG("Ecap0"),(m 7 )Gppp(m 2’-O )G(“Ecap1”),(m2 7,3’-O )GpppG("ARCA" or "D1") and (m2 7,2’-O )GppSpG ("β-S-ARCA"). In some embodiments, the 5' cap is (m 7 )GpppG("Ecap0"), has the following structure:

[0311]

[0312] or a salt thereof.

[0313] In some embodiments, the 5' cap is (m 7 )Gppp(m 2’-O )G("Ecap1"), has the following structure:

[0314]

[0315] or a salt thereof.

[0316] In some embodiments, the 5' cap is (m2 7,3’-O )GpppG ("ARCA" or "D1"), having the following structure:

[0317]

[0318] or a salt thereof.

[0319] In some embodiments, the 5' cap is (m2 7,2’-O )GppSpG ("β-S-ARCA"), has the following structure:

[0320]

[0321] or a salt thereof.

[0322] In some embodiments, the 5' cap is a trinucleotide cap structure. In some embodiments, the 5' cap is a trinucleotide cap structure comprising N1pN2, wherein N1 and N2 are as defined and described herein. In some embodiments, the 5' cap is a trinucleotide cap G*N1pN2, wherein N1 and N2 are as defined above and herein, and:

[0323] G* comprises the structure of formula (I):

[0324]

[0325] or a salt thereof, wherein R 2 、R 3 and X are as defined and described herein.

[0326] In some embodiments, the 5' cap is a trinucleotide capO structure (eg, (m 7 )GpppN1pN2、(m2 7,2’-O )GpppN1pN2 or (m2 7,3’-O )GpppN1pN2), wherein N1 and N2 are as defined and described herein). In some embodiments, the 5' cap is a trinucleotide cap1 structure (eg, (m 7 )Gppp(m 2’-O )N1pN2、(m2 7,2’-O )Gppp(m 2’-O )N1pN2、(m2 7,3’-O )Gppp(m 2’-O )N1pN2), wherein N1 and N2 are as defined and described herein. In some embodiments, the 5' cap is a trinucleotide cap2 structure (e.g., (m 7 )Gppp(m 2’-O )N1p(m 2’-O )N2、(m2 7,2’-O )Gppp(m 2’-O )N1p(m 2’-O )N2、(m2 7,3’-O )Gppp(m 2’-O )N1p(m 2’-O )N2), wherein N1 and N2 are as defined and described herein. In some embodiments, the 5' cap is selected from the group consisting of: (m2 7,3’-O )Gppp(m 2’-O )ApG("CleanCap AG 3'OMe", "CC413"), (m2 7,3’-O )Gppp(m 2’-O )GpG("CleanCap GG"), (m 7 )Gppp(m 2’-O )ApG、(m7 )Gppp(m 2’-O )GpG、(m2 7,3’-O )Gppp(m2 6 ,2’-O )ApG and (m 7 )Gppp(m 2’-O In some embodiments, the 5' cap is selected from the group consisting of: (m2 7,3’-O )Gppp(m 2’-O )ApG("CleanCap AG", "CC413"), (m2 7,3’-O )Gppp(m 2’-O )GpG("CleanCap GG"), (m 7 )Gppp(m 2’-O )ApG, and (m2 7,3’-O )Gppp(m2 6,2’-O )ApG、(m 7 )Gppp(m 2’-O )ApU, and (m2 7,3’-O )Gppp(m 2’-O )CpG.

[0327] In some embodiments, the 5' cap is (m2 7,3’-O )Gppp(m 2’-O )ApG ("CleanCap AG 3'OMe", "CC413"), having the following structure:

[0328]

[0329] or a salt thereof.

[0330] In some embodiments, the 5' cap is (m2 7,3’-O )Gppp(m 2’-O )GpG ("CleanCap GG"), having the following structure:

[0331]

[0332] or a salt thereof.

[0333] In some embodiments, the 5' cap is (m 7 )Gppp(m 2’-O )ApG, has the following structure:

[0334]

[0335] or a salt thereof.

[0336] In some embodiments, the 5' cap is (m 7)Gppp(m 2’-O )GpG, has the following structure:

[0337]

[0338] or a salt thereof.

[0339] In some embodiments, the 5' cap is (m2 7,3’-O )Gppp(m2 6,2’-O )ApG, has the following structure:

[0340]

[0341] or a salt thereof.

[0342] In some embodiments, the 5' cap is (m 7 )Gppp(m 2’-O )ApU, has the following structure:

[0343]

[0344] or a salt thereof.

[0345] In some embodiments, the 5' cap is (m2 7,3’-O )Gppp(m 2’-O )CpG, has the following structure:

[0346]

[0347] or a salt thereof.

[0348] In some embodiments, the 5' cap is a tetranucleotide cap structure. In some embodiments, the 5' cap is a tetranucleotide cap structure comprising N1pN2pN3, wherein N1, N2, and N3 are as defined and described herein. In some embodiments, the 5' cap is a tetranucleotide cap G*N1pN2pN3, wherein N1, N2, and N3 are as defined above and herein, and:

[0349] G* comprises the structure of formula (I):

[0350]

[0351] or a salt thereof, wherein R 2 、R 3 and X are as defined and described herein.

[0352] In some embodiments, the 5' cap is a tetranucleotide cap0 structure (eg, (m 7 )GpppN1pN2pN3、(m2 7,2’-O )GpppN1pN2pN3 or (m2 7,3’-O)GpppN1N2pN3, wherein N1, N2, and N3 are as defined and described herein). In some embodiments, the 5' cap is a tetranucleotide Cap1 structure (eg, (m 7 )Gppp(m 2’-O )N1pN2pN3、(m2 7,2’-O )Gppp(m 2’-O )N1pN2pN3、(m2 7,3’-O )Gppp(m 2’-O )N1pN2N3), wherein N1, N2 and N3 are as defined and described herein. In some embodiments, the 5' cap is a tetranucleotide Cap2 structure (e.g., (m 7 )Gppp(m 2’-O )N1p(m 2’-O )N2pN3、(m2 7,2’-O )Gppp(m 2’-O )N1p(m 2’-O )N2pN3、(m2 7,3’-O )Gppp(m 2’-O )N1p(m 2’-O )N2pN3), wherein N1, N2 and N3 are as defined and described herein. In some embodiments, the 5' cap is selected from the group consisting of: (m2 7,3’-O )Gppp(m 2’-O )Ap(m 2’-O )GpG、(m2 7,3’-O )Gppp(m 2’-O )Gp(m 2’-O )GpC、(m 7 )Gppp(m 2’-O )Ap(m 2’-O )UpA and (m 7 )Gppp(m 2’-O )Ap(m 2’-O )GpG.

[0353] In some embodiments, the 5' cap is (m2 7,3’-O )Gppp(m 2’-O )Ap(m 2’-O )GpG, has the following structure:

[0354]

[0355] or a salt thereof.

[0356] In some embodiments, the 5' cap is (m2 7,3’-O )Gppp(m 2’-O )Gp(m 2’-O )GpC, having the following structure:

[0357]

[0358] or a salt thereof.

[0359] In some embodiments, the 5' cap is (m 7 )Gppp(m 2’-O )Ap(m 2’-O )UpA, has the following structure:

[0360]

[0361] or a salt thereof.

[0362] In some embodiments, the 5' cap is (m 7 )Gppp(m 2’-O )Ap(m 2’-O )GpG, has the following structure:

[0363]

[0364] or a salt thereof.

[0365] In some embodiments, N1 is A or an analog thereof. In some embodiments, N1 is adenosine. In some embodiments, N1 is a modified adenosine. In some embodiments, N1 is 6-methyladenosine. In some embodiments, N1 is:

[0366]

[0367] where % represents the point of attachment to G*.

[0368] In some embodiments, N2 is U or an analog thereof. In some embodiments, N2 is a modified U. In some embodiments, N2 is 3-methyl-uridine (m 3 U), 5-methoxy-uridine (mo 5 U), 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine (s 2 U), 4-thio-uridine (s 4 U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine (ho 5 U), 5-aminoallyl-uridine, 5-halo-uridine (e.g., 5-iodo-uridine or 5-bromo-uridine), uridine 5-hydroxyacetic acid (cmo 5 U), uridine 5-hydroxyacetate (mcmo 5 U), 5-carboxymethyl-uridine (cm 5 U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine (chm 5U), 5-carboxyhydroxymethyl-uridine methyl ester (mchm 5 U), 5-methoxycarbonylmethyl-uridine (mcm 5 U), 5-methoxycarbonylmethyl-2-thio-uridine (mcm 5 s 2 U), 5-aminomethyl-2-thio-uridine (nm 5 s 2 U), 5-methylaminomethyl-uridine (mnm 5 U), 1-ethyl-pseudouridine, 5-methylaminomethyl-2-thio-uridine (mnm 5 s 2 U), 5-methylaminomethyl-2-seleno-uridine (mnm 5 se 2 U), 5-carbamoylmethyl-uridine (ncm 5 U), 5-carboxymethylaminomethyl-uridine (cmnm 5 U), 5-carboxymethylaminomethyl-2-thio-uridine (cmnm 5 s 2 U), 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurine methyl-uridine (τm 5 U), 1-taurine methyl-pseudouridine, 5-taurine methyl-2-thio-uridine (τm5s2U), 1-taurine methyl-4-thio-pseudouridine), 5-methyl-2-thio-uridine (m 5 s 2 U), 1-methyl-4-thio-pseudouridine (m 1 s 4 ψ), 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine (m 3 ψ), 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine (D), dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine (m 5 D), 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine (acp 3 U), 1-methyl-3-(3-amino-3-carboxypropyl) pseudouridine (acp 3 ψ)、5-(Isopentenylaminomethyl)uridine (inm 5 U), 5-(isopentenylaminomethyl)-2-thio-uridine (inm 5 s 2U), α-thio-uridine, 2′-O-methyl-uridine (Um), 5,2′-O-dimethyl-uridine (m 5 Um), 2′-O-methyl-pseudouridine (ψm), 2-thio-2′-O-methyl-uridine (s 2 Um), 5-methoxycarbonylmethyl-2′-O-methyl-uridine (mcm 5 Um), 5-carbamoylmethyl-2′-O-methyl-uridine (ncm 5 Um), 5-carboxymethylaminomethyl-2′-O-methyl-uridine (cmnm 5 Um), 3,2′-O-dimethyl-uridine (m 3 Um), 5-(isopentenylaminomethyl)-2′-O-methyl-uridine (inm 5 Um), 1-thio-uridine, deoxythymidine, 2′-F-arabino-uridine, 2′-F-uridine, 2′-OH-arabino-uridine, 5-(2-carbomethoxyvinyl)uridine, 5-[3-(1-E-propenylamino)uridine, or any other modified uridine known in the art.

[0369] In some embodiments, N2 has formula (II):

[0370]

[0371] or a salt thereof, wherein:

[0372] Each are independently single or double bonds, as valence permits;

[0373] Y 1 is O or S;

[0374] Y 2 is N, C or CH;

[0375] Y 3 It is N or NR a1 , CR a1 or CHR a1 ;

[0376] Y 4 It is NR a2 or CHR a2 ;

[0377] R a1 or R a2 are each independently hydrogen or C 1-6 aliphatic;

[0378] R 4 is -OH or -OMe; and

[0379] # indicates the connection point with p of N1p.

[0380] In some embodiments, Y 1 Is O. In some embodiments, Y 1 It’s S.

[0381] In some embodiments, Y 2 is N. In some embodiments, Y 2 is C or CH. In some embodiments, Y 2 is C. In some embodiments, Y 2 It is CH.

[0382] In some embodiments, Y 3 Is N or CR a1 In some embodiments, Y 3 is N. In some embodiments, Y 3 It's CR a1 In some embodiments, Y 3 is CH or C(CH3). In some embodiments, Y 3 In some embodiments, Y 3 is C(CH3). In some embodiments, Y 3 It is NR a1 or CHR a1 In some embodiments, Y 3 is NH or N(CH3). In some embodiments, Y 3 In some embodiments, Y 3 is N(CH3). In some embodiments, Y 3 is CH2 or CH(CH3). In some embodiments, Y 3 is CH2. In some embodiments, Y 3 It is CH(CH3).

[0383] In some embodiments, Y 4 It is NR a2 In some embodiments, Y 4 is NH or NCH3. In some embodiments, Y 4 In some embodiments, Y 4 In some embodiments, Y 4 It is CHR a2 In some embodiments, Y 4 is CH2 or CH(CH3). In some embodiments, Y 4 is CH2. In some embodiments, Y 4 It is CH(CH3).

[0384] In some embodiments, R a1 In some embodiments, R a1 It is C 1-6 In some embodiments, R a1 is methyl, ethyl, n-propyl or isopropyl. In some embodiments, R a1 It's methyl.

[0385] In some embodiments, R a2 In some embodiments, R a2 It is C 1-6 In some embodiments, R a2 is methyl, ethyl, n-propyl or isopropyl. In some embodiments, R a2 It's methyl.

[0386] In some embodiments, R 4 In some embodiments, R 4 Yes-OMe.

[0387] In some embodiments, N 2 Having formula (IIa):

[0388]

[0389] or a salt thereof, wherein Y 1 、Y 3 、R 4 and # are each as defined above and described herein.

[0390] In some embodiments, N 2 Having formula (IIb):

[0391]

[0392] or a salt thereof, wherein Y 1 、Y 3 、R 4 and # are each as defined above and described herein.

[0393] In some embodiments, N2 is uridine, 1-methylpseudouridine, 2-thio-uridine, or 5-methyluridine.

[0394] In some embodiments, N2 is:

[0395]

[0396] or a salt thereof, wherein # represents the point of attachment to p of N1p.

[0397] In some embodiments, N2 is:

[0398]

[0399] or a salt thereof, wherein # represents the point of attachment to p of N1p.

[0400] In some embodiments, p is -P(=O)(OH)- or a salt thereof.

[0401] In some embodiments, the 5' cap is (m 7,2’-O )Gppp(m 2’-O )A1pU2、(m 7,3’-O )Gppp(m 2’-O )A1pU2、(m 7,2’-O )Gppp(m 2’-O )A1pΨ2、(m 7,3’-O )Gppp(m 2’-O )A1pΨ2、(m 7,2’-O )Gppp(m 2’-O )A1p(m 1 )Ψ2、(m 7 ,3’-O )Gppp(m 2’-O )A1p(m 1 )Ψ2、(m 7,2’-O )Gppp(m 2’-O )A1pS 2 U2、(m 7,3’-O )Gppp(m 2’-O )A1pS 2 U2、(m 7 ,2’-O )Gppp(m 2’-O )A1p(m 5 )U2 or (m 7,3’-O )Gppp(m 2’-O )A1p(m 5 )U2.

[0402] In some embodiments, the 5' cap is (m 7,2’-O )Gppp(m 6,2’-O )A1pU2、(m 7,3’-O )Gppp(m 6,2’-O )A1pU2、(m 7,2’-O )Gppp(m 6,2’-O )A1pΨ2、(m 7,3’-O )Gppp(m 6,2’-O )A1pΨ2、(m 7,2’-O )Gppp(m 6,2’-O )A1p(m 1 )Ψ2、(m 7,3’-O )Gppp(m6,2’-O )A1p(m 1 )Ψ2、(m 7,2’-O )Gppp(m 6,2’-O )A1pS 2 U2、(m 7,3’-O )Gppp(m 6 ,2’-O )A1pS 2 U2、(m 7,2’-O )Gppp(m 6,2’-O )A1p(m 5 )U2 or (m 7,3’-O )Gppp(m 6,2’-O )A1p(m 5 )U2.

[0403] In some embodiments, the 5' cap is (m 7,2’-O )Gppp(m 2’-O )A1pU2, has the following structure:

[0404]

[0405] or a salt thereof.

[0406] In some embodiments, the 5' cap is (m 7,3’-O )Gppp(m 2’-O )A1pU2,

[0407]

[0408] or a salt thereof.

[0409] In some embodiments, the 5' cap is (m 7,3’-O )Gppp(m 2’-O )A1pΨ2,

[0410]

[0411] or a salt thereof.

[0412] In some embodiments, the 5' cap is (m 7,2’-O )Gppp(m 2’-O )A1pΨ2,

[0413]

[0414] or a salt thereof.

[0415] In some embodiments, the 5' cap is (m 7,2’-O )Gppp(m 2’-O )A1p(m 1 )Ψ2,

[0416]

[0417] or a salt thereof.

[0418] In some embodiments, the 5' cap is (m 7,3’-O )Gppp(m 2’-O )A1p(m 1 )Ψ2,

[0419]

[0420] or a salt thereof.

[0421] In some embodiments, the 5' cap is (m 7,3’-O )Gppp(m 2’-O )A1pS 2 U2,

[0422]

[0423] or a salt thereof.

[0424] In some embodiments, the 5' cap is (m 7,2’-O )Gppp(m 2’-O )A1pS 2 U2,

[0425]

[0426] or a salt thereof.

[0427] In some embodiments, the 5' cap is (m 7,3’-O )Gppp(m 2’-O )A1p(m 5 )U2,

[0428]

[0429] or a salt thereof.

[0430] In some embodiments, the 5' cap is (m 7,2’-O )Gppp(m 2’-O )A1p(m 5 )U2,

[0431]

[0432] or a salt thereof.

[0433] In some embodiments, it will be understood that the disclosure of a 5' cap above and herein encompasses the 5' cap itself or as part of a larger molecule (e.g., RNA). For example, the structure drawn above encompasses a 3' ether bond to the next nucleotide or as a free -OH.

[0434] In some embodiments, it will be appreciated that any of the above structures may exist in salt form. For example, each phosphate group may be deprotonated, such as -OP(=O)(O - )-, and associated with appropriate counter ions.

[0435] 3. Cap proximal sequence

[0436] In some embodiments, the 5'UTR utilized in accordance with the present disclosure comprises a cap-proximal sequence, e.g., as disclosed herein. In some embodiments, the cap-proximal sequence comprises a sequence adjacent to the 5' cap. In some embodiments, the cap-proximal sequence comprises nucleotides at positions +1, +2, +3, +4, and / or +5 of the RNA polynucleotide.

[0437] In some embodiments, the cap structure comprises one or more polynucleotides of a cap proximal sequence. In some embodiments, the cap structure comprises m 7 In some embodiments, the cap structure comprises m 7 In some embodiments, the cap structure comprises m 7 The guanosine cap and nucleotides +1 and +2 (N1 and N2) of the RNA polynucleotide. In some embodiments, the cap structure comprises m 7 The guanosine cap and nucleotides +1, +2, and +3 (N1, N2, and N3) of the RNA polynucleotide.

[0438] Those skilled in the art who read this disclosure will appreciate that, in some embodiments, one or more residues of the cap-proximal sequence (e.g., one or more of residues +1, +2, +3, +4, and / or +5) may be included in the RNA by virtue of being already included in the cap entity (e.g., cap1 or cap2 structure, etc.); alternatively, in some embodiments, at least some of the residues in the cap-proximal sequence may be added enzymatically (e.g., by a polymerase, such as T7 polymerase). For example, in which m2 is used 7,3’-O Gppp(m1 2’-O In certain exemplary embodiments of the ApG cap, +1 (ie, N1) and +2 (ie, N2) are the (m1 2’-O ) A and G residues, and +3, +4, and +5 are added by a polymerase (e.g., T7 polymerase).

[0439] In some embodiments, the 5'-cap is a dinucleotide cap structure, wherein the cap-proximal sequence comprises N1 of the 5'-cap, wherein N1 is any nucleotide, such as A, C, G, or U. In some embodiments, the 5'-cap is a trinucleotide cap structure (e.g., a trinucleotide cap structure described above and herein), wherein the cap-proximal sequence comprises N1 and N2 of the 5'-cap, wherein N1 and N2 are independently any nucleotide, such as A, C, G, or U. In some embodiments, the 5'-cap is a tetranucleotide cap structure (e.g., a trinucleotide cap structure described above and herein), wherein the cap-proximal sequence comprises N1, N2, and N3 of the 5'-cap, wherein N1, N2, and N3 are any nucleotides, such as A, C, G, or U.

[0440] In some embodiments, for example, when the 5' cap is a dinucleotide cap structure, the cap-proximal sequence comprises N1, and N2, N3, N4, and N5 of the 5' cap, wherein N1 to N5 correspond to positions +1, +2, +3, +4, and / or +5 of the RNA polynucleotide. In some embodiments, for example, when the 5' cap is a trinucleotide cap structure, the cap-proximal sequence comprises N1 and N2, and N3, N4, and N5 of the 5' cap, wherein N1 to N5 correspond to positions +1, +2, +3, +4, and / or +5 of the RNA polynucleotide. In some embodiments, for example, when the 5' cap is a tetranucleotide cap structure, the cap-proximal sequence comprises N1, N2, and N3, and N4, and N5 of the 5' cap, wherein N1 to N5 correspond to positions +1, +2, +3, +4, and / or +5 of the RNA polynucleotide.

[0441] In some embodiments, N1 is A. In some embodiments, N1 is C. In some embodiments, N1 is G. In some embodiments, N1 is U. In some embodiments, N2 is A. In some embodiments, N2 is C. In some embodiments, N2 is G. In some embodiments, N2 is U. In some embodiments, N3 is A. In some embodiments, N3 is C. In some embodiments, N3 is G. In some embodiments, N3 is U. In some embodiments, N4 is A. In some embodiments, N4 is C. In some embodiments, N4 is G. In some embodiments, N4 is U. In some embodiments, N5 is A. In some embodiments, N5 is C. In some embodiments, N5 is G. In some embodiments, N5 is U. It will be understood that each of the embodiments described above and herein (e.g., for N1 to N5) may be employed alone or in combination, and / or may be combined with other embodiments of variables described above and herein (e.g., 5' cap).

[0442] 4.5'UTR

[0443] In some embodiments, nucleic acids (e.g., DNA, RNA) utilized in accordance with the present disclosure comprise a 5'-UTR. In some embodiments, the 5'-UTR may comprise a plurality of different sequence elements; in some embodiments, such a plurality of different sequence elements may be or comprise multiple copies of one or more specific sequence elements (e.g., may be derived from a specific source or otherwise referred to as functional or characteristic sequence elements). In some embodiments, the 5'UTR comprises a plurality of different sequence elements.

[0444] The term "untranslated region" or "UTR" is generally used in the art to refer to a region that is transcribed in a DNA molecule but is not translated into an amino acid sequence, or to a corresponding region in an RNA polynucleotide (such as an mRNA molecule). An untranslated region (UTR) may be present in the 5' (upstream) (5'-UTR) and / or 3' (downstream) (3'-UTR) of an open reading frame. As used herein, the term "five end untranslated regions" or "5'UTR" refers to the sequence of the polyribonucleotides between the 5' ends (for example, transcription start site) and the start codon of the coding region of the polyribonucleotide. In some embodiments, "5'UTR" refers to the sequence of the polyribonucleotides, which begins at the 5' ends (for example, transcription start site) of the polyribonucleotides and ends at a nucleotide (nt) before the start codon (typically AUG) of the coding region of the polyribonucleotides, for example, in its natural context. In some embodiments, 5'UTR comprises a Kozak sequence. The 5'-UTR is downstream of the 5'-cap (if present), e.g., directly adjacent to the 5'-cap. In some embodiments, the 5'UTR disclosed herein comprises a cap-proximal sequence, e.g., as defined and described herein. In some embodiments, the cap-proximal sequence comprises a sequence adjacent to the 5'-cap.

[0445] Exemplary 5'UTRs include human alpha globulin (hAg) 5'UTR or a fragment thereof, TEV 5'UTR or a fragment thereof, HSP70 5'UTR or a fragment thereof, or c-Jun 5'UTR or a fragment thereof.

[0446] In some embodiments, the RNA disclosed herein comprises the hAg 5'UTR or a fragment thereof.

[0447] In some embodiments, the RNA disclosed herein comprises a 5'UTR that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a 5'UTR having a sequence according to SEQ ID NO: 155 (AGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCA GAGAGAACCCGCCACC). In some embodiments, the RNA disclosed herein comprises a 5'UTR provided in SEQ ID NO: 155.

[0448] In some embodiments, the RNA disclosed herein comprises a 5'UTR that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a 5'UTR having the sequence AACUAGUAUUCUUCUGGUCCCCACAGACUCAGAGAGAACCCG CCACC (SEQ ID NO: 272) (hAg-Kozak / 5'UTR). In some embodiments, the RNA disclosed herein comprises a 5'UTR provided in SEQ ID NO: 272.

[0449] 5. Poly A tail

[0450] In some embodiments, the polynucleotides disclosed herein (e.g., DNA, RNA) comprise a polyadenylic acid (poly A) sequence, e.g., as described herein. In some embodiments, the poly A sequence is located downstream of the 3'-UTR, e.g., adjacent to the 3'-UTR.

[0451] As used herein, the term "poly (A) sequence" or "poly-A tail" refers to an uninterrupted or interrupted sequence of adenosine residues, which is typically located at the 3' end of an RNA polynucleotide. Poly (A) sequences are known to those skilled in the art and may be after the 3'-UTR in the RNA described herein. An uninterrupted poly (A) sequence is characterized by continuous adenosine residues. In nature, an uninterrupted poly (A) sequence is typical. In some embodiments, the polynucleotides disclosed herein comprise an uninterrupted poly (A) sequence. In some embodiments, the polynucleotides disclosed herein comprise an interrupted poly (A) sequence. In some embodiments, the RNA disclosed herein may have a poly (A) sequence that is attached to the free 3' end of the RNA by a template-independent RNA polymerase after transcription or a poly (A) sequence that is encoded by DNA and transcribed by a template-dependent RNA polymerase.

[0452] It has been demonstrated that a poly(A) sequence of approximately 120 A nucleotides has a beneficial effect on RNA levels in transfected eukaryotic cells and on the levels of proteins translated from open reading frames present upstream (5') of the poly(A) sequence (Holtkamp et al., 2006, Blood, Vol. 108, pp. 4009-4017, incorporated herein by reference).

[0453] In some embodiments, the poly(A) sequence according to the present disclosure is not limited to a specific length; in some embodiments, the poly(A) sequence is of any length. In some embodiments, the poly(A) sequence comprises, consists essentially of, or consists of at least 20, at least 30, at least 40, at least 80, or at least 100 and up to 500, up to 400, up to 300, up to 200, or up to 150 A nucleotides, and in particular about 120 A nucleotides. In this context, "consisting essentially of" means that the majority of the nucleotides in the poly(A) sequence, typically at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% by number of nucleotides in the poly(A) sequence, are A nucleotides, but the remaining nucleotides are allowed to be nucleotides other than A nucleotides, such as U nucleotides (uridylic acid), G nucleotides (guanylic acid), or C nucleotides (cytidylic acid). In this context, "consisting of" means all nucleotides in the poly(A) sequence, ie 100% by number of nucleotides in the poly(A) sequence are A nucleotides. The term "A nucleotide" or "A" refers to adenylate.

[0454] In some embodiments, during RNA transcription, for example, during the preparation of in vitro transcribed RNA, a poly(A) sequence is attached based on a DNA template comprising repeated dT nucleotides (deoxythymidylate) in a strand complementary to the coding strand. The DNA sequence encoding the poly(A) sequence (coding strand) is referred to as a poly(A) cassette.

[0455] In some embodiments, the poly (A) box present in the DNA coding chain is essentially composed of dA nucleotides, but is interrupted by a random sequence of four nucleotides (dA, dC, dG and dT). The length of this random sequence can be 5 to 50, 10 to 30 or 10 to 20 nucleotides. Such a box is disclosed in WO 2016 / 005324A1, which is hereby incorporated by reference. According to the present disclosure, any poly (A) box disclosed in WO 2016 / 005324 A1 can be used. Essentially composed of dA nucleotides, but interrupted by a random sequence with a uniform distribution of four nucleotides (dA, dC, dG, dT) and a length of, for example, 5 to 50 nucleotides, shows that plasmid DNA continues to proliferate in Escherichia coli (E. coli) at the DNA level, and is still associated with the beneficial properties of supporting RNA stability at the RNA level, and covers translation efficiency. In some embodiments, the poly(A) sequence contained in the RNA polynucleotides described herein consists essentially of A nucleotides, but is interrupted by a random sequence of four nucleotides (A, C, G, U). The length of this random sequence can be 5 to 50, 10 to 30, or 10 to 20 nucleotides.

[0456] In some embodiments, no nucleotides other than A nucleotides flank the 3' end of the poly(A) sequence, ie, the poly(A) sequence is not masked or followed by nucleotides other than A at its 3' end.

[0457] In some embodiments, the poly (A) sequence may comprise at least 20, at least 30, at least 40, at least 80, or at least 100 and up to 500, up to 400, up to 300, up to 200, or up to 150 nucleotides. In some embodiments, the poly (A) sequence may consist essentially of at least 20, at least 30, at least 40, at least 80, or at least 100 and up to 500, up to 400, up to 300, up to 200, or up to 150 nucleotides. In some embodiments, the poly (A) sequence may consist of at least 20, at least 30, at least 40, at least 80, or at least 100 and up to 500, up to 400, up to 300, up to 200, or up to 150 nucleotides. In some embodiments, the poly (A) sequence comprises at least 100 nucleotides. In some embodiments, the poly (A) sequence comprises about 150 nucleotides. In some embodiments, the poly(A) sequence comprises about 120 nucleotides.

[0458] In some embodiments, the poly A tail comprises a specific number of adenosines, such as about 50 or more, about 60 or more, about 70 or more, about 80 or more, about 90 or more, about 100 or more, about 120, or about 150 or about 200. In some embodiments, the poly A tail of the string construct may comprise 200 or fewer A residues. In some embodiments, the poly A tail of the string construct may comprise about 200 A residues. In some embodiments, the poly A tail of the string construct may comprise 180 or fewer A residues. In some embodiments, the poly A tail of the string construct may comprise about 180 A residues. In some embodiments, the poly A tail may comprise 150 or fewer residues.

[0459] In some embodiments, the poly(A) tail comprises a plurality of A residues interrupted by a linker. In some embodiments, the linker comprises the nucleotide sequence GCATATGAC (SEQ ID NO: 156).

[0460] In some embodiments, the polyribonucleotide of the present disclosure comprises a poly(A) sequence comprising the nucleotide sequence of SEQ ID NO: 268, or a nucleotide sequence that is at least 99%, 98%, 97%, 96%, 95%, 90%, 85% or 80% identical to the nucleotide sequence of SEQ ID NO: 268.

[0461] 6.3'UTR

[0462] In some embodiments, the polyribonucleotides utilized according to the present disclosure include 3'-UTR. As used herein, the term "three-terminal untranslated region", "3' untranslated region" or "3'UTR" refers to the sequence after the stop codon of the coding region of the open reading frame sequence of the mRNA molecule. In some embodiments, the 3'UTR starts immediately after the stop codon of the coding region of the open reading frame sequence, for example, in its natural background. In other embodiments, the 3'UTR does not start immediately after the stop codon of the coding region of the open reading frame sequence, for example, in its natural background. The term "3'-UTR" preferably does not include a poly (A) sequence. Therefore, the 3'-UTR is upstream of the poly (A) sequence (if present), for example, directly adjacent to the poly (A) sequence.

[0463] In some embodiments, the RNA disclosed herein comprises a 3'UTR comprising an F element and / or an I element. In some embodiments, the 3'UTR or its proximal sequence comprises a restriction site. In some embodiments, the restriction site is a BamHI site. In some embodiments, the restriction site is an XhoI site.

[0464] In some embodiments, the RNA construct comprises an F element. In some embodiments, the F element sequence is the 3'-UTR of a split amino-terminal enhancer (AES).

[0465] In some embodiments, the RNA disclosed herein comprises a 3'UTR.

[0466] In some embodiments, the 3'UTR is an FI element as described in WO2017 / 060314, which is herein incorporated by reference in its entirety.

[0467] 7. Multimerization Elements

[0468] In some embodiments, the monkeypox antigens utilized as described herein include a multimerization element (e.g., a heteromultimerization element). In some embodiments, the heteromultimerization element comprises a dimerization, trimerization, or tetramerization element.

[0469] In some embodiments, the multimerization element is a multimerization element described in WO2017 / 081082 (e.g., a sequence of SEQ ID NOs: 1116-1167 of WO2017 / 081082, or a fragment or variant thereof).

[0470] Exemplary trimerization and tetramerization elements include, but are not limited to, engineered leucine zippers, the fiber protein foldon domain from Enterobacteriaceae phage T4, GCN4pll, GCN4-pll, and p53.

[0471] In various embodiments, antigen construct of the present disclosure includes an antigen that is operably connected with a multimerization element (such as a foldon domain), and / or polyribonucleotides of the present disclosure encode this antigen. In various embodiments, antigen construct of the present disclosure includes an antigen that is operably connected with a foldon domain according to SEQ ID NO: 256 and / or an antigen that is coded by the sequence according to SEQ ID NO: 257, and / or polyribonucleotides of the present disclosure encode this antigen.

[0472] In some embodiments, provided antigens are capable of forming trimeric complexes. For example, the antigen utilized may comprise a domain that allows for the formation of multimeric complexes (e.g., a trimeric complex comprising the amino acid sequence of a monkeypox antigen as described herein). In some embodiments, the domain that allows for the formation of multimeric complexes comprises a trimerization domain, e.g., a trimerization domain as described herein.

[0473] In some embodiments, monkeypox antigens can be modified by adding a T4-fibrin-derived "foldon" trimerization domain, for example, to increase their immunogenicity.

[0474] 8. Membrane-related elements

[0475] In some embodiments, a monkeypox antigen as described herein includes a membrane-associated element (eg, a heterologous membrane-associated element), such as a transmembrane domain.

[0476] The transmembrane domain may be N-terminal, C-terminal or internal to the antigen. The coding sequence for the transmembrane element is typically located in frame (ie, in the same reading frame) with, 5', 3' or internal to the coding sequence to which it is linked (eg, monkeypox antigen coding sequence).

[0477] In some embodiments, the transmembrane domain comprises or is the hemagglutinin (HA) of influenza virus, Env of HIV-1, equine infectious anemia virus (EIAV), murine leukemia virus (MLV), mouse mammary tumor virus, the G protein of vesicular stomatitis virus (VSV), the transmembrane domain of rabies virus, or a seven transmembrane domain receptor.

[0478] In various embodiments, the antigenic constructs of the present disclosure include an antigen operably linked to a transmembrane domain, and / or the polyribonucleotides of the present disclosure encode the antigen. In various embodiments, the antigenic constructs of the present disclosure include an antigen operably linked to an HSV-1 gD transmembrane domain (TM) according to SEQ ID NO: 254 and / or encoded by a sequence according to SEQ ID NO: 255, and / or the polyribonucleotides of the present disclosure encode the antigen.

[0479] B. RNA form

[0480] At least three different formats have been developed for RNA compositions (e.g., pharmaceutical compositions): unmodified uridine-containing mRNA (uRNA), nucleoside-modified mRNA (modRNA), and self-amplifying mRNA (saRNA). Each of these platforms has its own unique characteristics. Generally speaking, in all three formats, the RNA is capped, contains an open reading frame (ORF) flanked by untranslated regions (UTRs), and has a poly A tail at the 3' end. The ORFs of uRNA and modRNA vectors encode antigens or fragments thereof. saRNAs have multiple ORFs.

[0481] In some embodiments, the RNA described herein can have modified nucleosides.In some embodiments, the RNA comprises a modified nucleoside in place of at least one (e.g., each) uridine.

[0482] As used herein, the term "uracil" describes one of the nucleobases that may occur in RNA nucleic acids. The structure of uracil is:

[0483]

[0484] The term "uridine" as used herein describes one of the nucleosides that may occur in RNA.

[0485] The structure of uridine is:

[0486]

[0487] UTP (uridine 5'-triphosphate) has the following structure:

[0488]

[0489] Pseudo-UTP (pseudouridine 5'-triphosphate) has the following structure:

[0490]

[0491] "Pseudouridine" is an example of a modified nucleoside, which is an isomer of uridine in which uracil is linked to the pentose ring via a carbon-carbon bond rather than a nitrogen-carbon glycosidic bond.

[0492] Another exemplary modified nucleoside is N1-methyl-pseudouridine (m1Ψ), which has the following structure:

[0493]

[0494] N1-methyl-pseudo-UTP has the following structure:

[0495]

[0496] Another exemplary modified nucleoside is 5-methyl-uridine (m5U), which has the following structure:

[0497]

[0498] In some embodiments, one or more uridines in the RNA described herein are replaced by modified nucleosides. In some embodiments, the modified nucleosides are modified uridines.

[0499] In some embodiments, the RNAs described herein comprise a modified nucleoside in place of at least one uridine. In some embodiments, the RNAs described herein comprise a modified nucleoside in place of each uridine.

[0500] In some embodiments, the modified nucleosides are independently selected from pseudouridine (ψ), N1-methyl-pseudouridine (m1ψ) and 5-methyl-uridine (m5U). In some embodiments, the modified nucleosides include pseudouridine (ψ). In some embodiments, the modified nucleosides include N1-methyl-pseudouridine (m1ψ). In some embodiments, the modified nucleosides include 5-methyl-uridine (m5U). In some embodiments, RNA may contain more than one type of modified nucleosides, and the modified nucleosides are independently selected from pseudouridine (ψ), N1-methyl-pseudouridine (m1ψ) and 5-methyl-uridine (m5U). In some embodiments, the modified nucleosides include pseudouridine (ψ) and N1-methyl-pseudouridine (m1ψ). In some embodiments, the modified nucleosides include pseudouridine (ψ) and 5-methyl-uridine (m5U). In some embodiments, the modified nucleosides include N1-methyl-pseudouridine (m1ψ) and 5-methyl-uridine (m5U). In some embodiments, modified nucleosides include pseudouridine (ψ), N1-methyl-pseudouridine (m1ψ), and 5-methyl-uridine (m5U).

[0501] In some embodiments, the modified nucleoside replacing one or more (e.g., all) uridines in the RNA can be any one or more of the following: 3-methyl-uridine (m3U), 5-methoxy-uridine (mo5U), 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine (s2U), 4-thio-uridine (s4U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine (ho5U), 5-aminoallyl-uridine, 5-halo-uridine (e.g., 5-iodo-uridine or 5-bromo-uridine), uridine 5-hydroxyacetic acid (cmo5U), uridine 5-hydroxyacetic acid methyl ester (mcmo5U), 5-carboxymethyl -uridine (cm5U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine (chm5U), 5-carboxyhydroxymethyl-uridine methyl ester (mchm5U), 5-methoxycarbonylmethyl-uridine (mcm5U), 5-methoxycarbonylmethyl-2-thio-uridine (mcm5s2U), 5-aminomethyl-2-thio-uridine (nm5s2U), 5-methylaminomethyl-uridine (mnm5U), 1-ethyl-pseudouridine, 5-methylaminomethyl-2-thio-uridine (mnm5s2U), 5-methylaminomethyl-2-seleno-uridine (mnm5se2U), 5-carbamoylmethyl-uridine (ncm5U), 5-carboxymethylaminomethyl-uridine (cmnm5 U), 5-carboxymethylaminomethyl-2-thio-uridine (cmnm5s2U), 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurine methyl-uridine (τm5U), 1-taurine methyl-pseudouridine, 5-taurine methyl-2-thio-uridine (τm5s2U), 1-taurine methyl-4-thio-pseudouridine), 5-methyl-2-thio-uridine (m5s2U), 1-methyl-4-thio-pseudouridine (m1s4ψ), 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine (m3ψ), 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine ( D), dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine (m5D), 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine (acp3U), 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine (acp3ψ), 5-(isopentenylaminomethyl)uridine (inm5U), 5-(isopentenylaminomethyl)-2-thio-uridine (inm5s2U), α-thio-uridine, 2′-O-methyl-uridine (Um), 5,2′-O-dimethyl-uridine (m5Um), 2′-O-methyl-pseudouridine (ψm), 2-thio-2′-O-methyl-uridine (s2Um), 5-methoxycarbonylmethyl-2′-O-methyl-uridine (mcm5Um), 5-carbamoylmethyl-2′-O-methyl-uridine (ncm5Um), 5-carboxymethylaminomethyl-2′-O-methyl-uridine (cmnm5Um), 3, 2′-O-dimethyl-uridine (m3Um), 5-(isopentenylaminomethyl)-2′-O-methyl-uridine (inm5Um), 1-thio-uridine, deoxythymidine, 2′-F-arabino-uridine, 2′-F-uridine, 2′-OH-arabino-uridine, 5-(2-carboxymethoxyvinyl)uridine, 5-[3-(1-E-propenylamino)uridine, or any other modified uridine known in the art.

[0502] In some embodiments, the RNA of the present disclosure comprises other modified nucleosides or comprises additional modified nucleosides, such as modified cytidine. For example, in some embodiments, in the RNA of the present disclosure, cytidine is partially or completely, preferably completely substituted with 5-methylcytidine. In some embodiments, the RNA of the present disclosure comprises 5-methylcytidine and one or more selected from the following: pseudouridine (ψ), N1-methyl-pseudouridine (m1ψ) and 5-methyl-uridine (m5U). In some embodiments, the RNA of the present disclosure comprises 5-methylcytidine and N1-methyl-pseudouridine (m1ψ). In some embodiments, the RNA of the present disclosure comprises 5-methylcytidine instead of each cytidine and N1-methyl-pseudouridine (m1ψ) instead of each uridine.

[0503] In some embodiments of the present disclosure, RNA is "replicon RNA" or simply "replicon", in particular "self-replicating RNA" or "self-amplifying RNA". In a particularly preferred embodiment, the replicon or self-replicating RNA is derived from or comprises elements derived from single-stranded (ss) RNA viruses, in particular positive-stranded ssRNA viruses such as alphaviruses. Alphaviruses are typical representatives of positive-strand RNA viruses. Alphaviruses replicate in the cytoplasm of infected cells (for a review of the life cycle of alphaviruses, see José et al., Future Microbiol., 2009, Vol. 4, pp. 837–856, which is incorporated herein by reference in its entirety). The total genome length of many alphaviruses typically ranges between 11,000 and 12,000 nucleotides, and the genomic RNA typically has a 5'-cap and a 3' poly (A) tail. The genome of alphaviruses encodes non-structural proteins (participating in the transcription, modification and replication of viral RNA and protein modification) and structural proteins (forming viral particles). There are typically two open reading frames (ORFs) in the genome. The four nonstructural proteins (nsP1–nsP4) are typically encoded together by a first ORF that begins near the 5' end of the genome, while the alphavirus structural proteins are encoded together by a second ORF found downstream of the first ORF and extending to near the 3' end of the genome. Typically, the first ORF is larger than the second ORF, with a ratio of approximately 2:1. In cells infected with alphaviruses, only the nucleic acid sequences encoding the nonstructural proteins are translated from the genomic RNA, while the genetic information encoding the structural proteins can be translated from subgenomic transcripts, which are RNA molecules similar to eukaryotic messenger RNA (mRNA; Gould et al., 2010, Antiviral Res., Vol. 87, pp. 111–124). After infection, i.e., early in the viral life cycle, the (+) strand of the genomic RNA directly serves as messenger RNA to translate the open reading frame encoding the nonstructural polyprotein (nsP1234).

[0504] Alphavirus-derived vectors have been proposed for delivering foreign genetic information to target cells or target organisms. In a simple method, the first ORF encodes an RNA-dependent RNA polymerase (replicase) derived from an alphavirus, which mediates the self-amplification of RNA after translation. The second ORF encoding the alphavirus structural protein is replaced by an open reading frame encoding the protein of interest (e.g., an antigen or a fragment thereof). The trans-replication system based on alphavirus relies on alphavirus nucleotide sequence elements on two independent nucleic acid molecules: one nucleic acid molecule encodes viral replicase, and the other nucleic acid molecule can be trans-replicated by the replicase (therefore designated as a trans-replication system). Trans-replication requires the simultaneous presence of these two nucleic acid molecules in a given host cell. The nucleic acid molecule that can be replicated by the trans-replicase must contain certain alphavirus sequence elements to allow recognition and RNA synthesis by the alphavirus replicase.

[0505] Characteristics of the non-modified uridine platform may include, for example, one or more of an intrinsic adjuvant effect, good tolerability, and improved safety. Characteristics of the modified uridine (e.g., pseudouridine) platform may include reduced adjuvant effect, reduced ability to activate innate immune sensors, good tolerability, and improved safety. Characteristics of the self-amplification platform may include, for example, long duration of protein expression, good tolerability and safety, and a higher likelihood of efficacy at very low vaccine doses.

[0506] The present disclosure provides optimized specific RNA constructs, e.g., for improved manufacturability, encapsulation, expression levels (and / or timing), etc. Certain components are discussed below, and certain preferred embodiments are exemplified herein.

[0507] C. Codon Optimization and GC Enrichment

[0508] As used herein, the term "codon optimization" refers to changing the codons in the coding region of a nucleic acid molecule (e.g., a polyribonucleotide) to reflect the typical codon usage of a host organism (e.g., a subject receiving the nucleic acid molecule (e.g., a polyribonucleotide)), without preferably changing the amino acid sequence encoded by the nucleic acid molecule. Within the context of the present disclosure, in some embodiments, the coding region is codon optimized for optimal expression in a subject to be treated with the RNA molecules described herein. In some embodiments, codon optimization can be performed so that codons available for tRNA that occur frequently are inserted to replace "rare codons." In some embodiments, codon optimization can include increasing the G / C content of the coding region of the RNA described herein compared to the guanosine / cytosine (G / C) content of the corresponding coding sequence of the wild-type RNA, wherein the amino acid sequence encoded by the RNA is preferably not modified compared to the amino acid sequence.

[0509] In some embodiments, the coding sequence (also referred to as a "coding region") is codon-optimized for expression in a subject (e.g., a human) to whom a composition (e.g., a pharmaceutical composition) is to be administered. Thus, in some embodiments, the sequence in such a polynucleotide (e.g., a polyribonucleotide) may differ from the wild-type sequence encoding the relevant antigen, or a fragment thereof, or an epitope, even when the amino acid sequence of the antigen, or a fragment thereof, or an epitope is wild-type.

[0510] In some embodiments, the coding sequence is codon-optimized for expression in a relevant subject (e.g., a human), and even in some cases, in specific cells or tissues.

[0511] Different species show specific biases for certain codons of specific amino acids. Without wishing to be bound by any one theory, codon bias (the difference in codon usage between organisms) is generally related to the translation efficiency of messenger RNA (mRNA), which is believed to depend, among other things, on the properties of the codons being translated and the availability of specific transfer RNA (tRNA) molecules. The predominance of selected tRNAs in cells can generally reflect the codons most frequently used in peptide synthesis. Therefore, genes can be customized based on codon optimization to achieve optimal gene expression in a given organism. For example, codon usage tables can be obtained in the "codon usage database" available at www.kazusa.orjp / codon / , and these tables can be adjusted in a variety of ways. Computer algorithms for codon optimization of specific sequences to be expressed in specific subjects or their cells can also be obtained, such as Gene Forge (Aptagen; Jacobus, PA).

[0512] In some embodiments, the polynucleotides of the present disclosure (e.g., polyribonucleotides) are codon-optimized, wherein the codons in the polynucleotides (e.g., polyribonucleotides) are adapted to the use of human codons (referred to herein as "human codon-optimized polynucleotides"). Codons encoding the same amino acid occur at different frequencies in subjects (e.g., humans). Therefore, in some embodiments, the coding sequence of the polynucleotides of the present disclosure is modified so that the frequency of the codons encoding the same amino acid corresponds to the frequency at which the codons are naturally present according to human codon use, e.g., as shown in Table 4. For example, in the case of amino acid Ala, the wild-type coding sequence is preferably adjusted as follows: codon "GCC" is used at a frequency of 0.40, codon "GCT" is used at a frequency of 0.28, codon "GCA" is used at a frequency of 0.22, and codon "GCG" is used at a frequency of 0.10, etc. (see Table 4). Therefore, in some embodiments, this program (as exemplified for Ala) is applied to each amino acid encoded by the coding sequence of the polynucleotide to obtain a sequence adapted to human codon use.

[0513] Table 4: Human codon usage table, indicating the frequency of each amino acid.

[0514]

[0515]

[0516] WO2002 / 098443 describes certain strategies for codon optimization and / or G / C enrichment for human expression, which is incorporated herein by reference in its entirety. In some embodiments, a multi-parameter optimization strategy can be used to optimize the coding sequence. In some embodiments, the optimization parameters may include parameters that affect protein expression, which may be affected, for example, at the transcriptional level, at the mRNA level, and / or at the translational level. In some embodiments, exemplary optimization parameters include, but are not limited to, transcriptional parameters (including, for example, GC content, a common splice site, a hidden splice site, a SD sequence, a TATA box, a termination signal, an artificial recombination site, and combinations thereof); mRNA level parameters (including, for example, RNA instability motifs, ribosome entry sites, repetitive sequences, and combinations thereof); translational parameters (including, for example, codon usage, premature poly (A) sites, ribosome entry sites, secondary structures, and combinations thereof); or combinations thereof. In some embodiments, the coding sequence can be optimized by a gene optimization algorithm as described in Fath et al. "Multiparameter RNA and Codon Optimization: A Standardized Tool to Assess and Enhance Autologous Mammalian Gene Expression" PLoS ONE 6(3): e17596; Rabb et al., "The Gene Optimizer Algorithm: using a sliding window approach to cope with the vast sequence space in multiparameter DNA sequence optimization" Systems and Synthetic Biology (2010) 4: 215-225; and Graft et al. "Codon-optimized genes that enable increased heterologous expression in mammalian cells and elicit efficient immune responses in mice after vaccination of naked DNA" Methods Mol Med (2004) 94: 197-210, each of which is incorporated herein in its entirety for the purposes described herein.In some embodiments, the coding sequence can be optimized by an adaptation of the Eurofins optimization algorithm "GENEius" and as described in Eurofins' Application Notes: Eurofins' adaptation and optimization software "GENEius" in comparison to other optimization algorithms, the entire contents of which are incorporated by reference for the purposes described herein.

[0517] In some embodiments, coding sequences utilized in accordance with the present disclosure have increased G / C content compared to wild-type coding sequences.

[0518] In some embodiments, the present invention provides the nucleic acid sequence of the present invention.Do not wish to be bound by any particular theory, it is proposed that GC enrichment can improve the translation of payload sequence.Usually, the sequence that the increase of G (guanosine) / C (cytidine) content is more stable than the sequence that the increase of A (adenosine) / U (uridine) content.About the fact of several codons encoding the same amino acid (the degeneracy of so-called genetic code), it is possible to determine that the codon (so-called alternative codon is used) that stability is most favourable.Depend on the amino acid of polyribonucleotide encoding, compared with its wild-type sequence, the modification of ribonucleic acid sequence has multiple possibilities.Especially, the codon containing A and / or U nucleoside can be modified by replacing these codons with other codons that encode the same amino acid but do not contain A and / or U or contain lower content A and / or U nucleoside.

[0519] In some embodiments, the G / C content of the coding region of polyribonucleotide as herein described and for example before the codon optimization of wild-type RNA compared the G / C content of coding region and increased at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6% or even more.In some embodiments, the G / C content of the coding region of polyribonucleotide as herein described and for example before the codon optimization of wild-type RNA compared the G / C content of coding region and reduced at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6% or even more.

[0520] In some embodiments, the stability of polyribonucleotide and translation efficiency can be incorporated into one or more elements that are established to help the stability of polyribonucleotide and / or translation efficiency; For example, exemplary this element has been described in the PCT / EP2006 / 009448 that is incorporated to this paper by reference.In some embodiments, for increasing the expression of the polyribonucleotide used according to the disclosure, polyribonucleotide can be modified in the coding region (that is, the peptide of encoding expression or protein sequence), and the peptide of expression or protein sequence are not changed, for example, in order to increase GC content, to improve mRNA stability and / or carry out codon optimized, thereby strengthen the translation in the cell.

[0521] D. Exemplary polyribonucleotide sequences

[0522] The present disclosure includes certain exemplary antigenic constructs and polyribonucleotides that can be used, for example, for vaccination against orthopoxviruses (e.g., monkeypox) that encode and / or express one or more monkeypox antigens. In some embodiments, the polyribonucleotides as described herein have one of the following structures:

[0523] Cap-hAg-Kozak-Antigen-FI-A30L70

[0524] Cap-hAg-Kozak-sec-antigen-FI-A30L70

[0525] wherein cap refers to the 5' cap as described above; hAg-Kozak refers to the 5' UTR human α-globin; sec refers to the secretion signal; antigen refers to a nucleotide sequence comprising a sequence encoding a monkeypox antigen as described herein; FI refers to the 3'-UTR as described above, and A30L70 refers to a poly A sequence. In some embodiments, the hAg 5' UTR comprises the nucleotide sequence of SEQ ID NO: 155. In some embodiments, A30L70 comprises 30 adenine nucleotides followed by 70 adenine nucleotides, wherein the 30 adenine nucleotides and the 70 adenine nucleotides are separated by a linker sequence.

[0526] 1. Exemplary B cell antigen polyribonucleotide sequences

[0527] The present disclosure includes certain exemplary antigenic constructs and polyribonucleotides that can be used, for example, for vaccination against orthopoxviruses (e.g., monkeypox) that encode and / or express one or more antigens or fragments thereof according to Table 1. In some embodiments, the polyribonucleotides of the present disclosure encode wild-type antigen sequences. In some embodiments, the polyribonucleotides of the present disclosure encode antigenic polypeptides that are operably linked to an N-terminal viral signal peptide. Without wishing to be bound by any particular theory, inclusion of a viral signal peptide can be useful, for example, because monkeypox antigens do not naturally include conventional secretory signal peptides, and / or because inclusion of a viral signal peptide can allow for enhanced surface expression of the operably linked antigen on cells of vaccination.

[0528] Exemplary antigens of the present disclosure (e.g., A29L, A28L, H3L, and B6R, or fragments thereof) may further include substitutions of unpaired cysteine ​​residues present in the corresponding reference sequences. Without wishing to be bound by any particular scientific theory, the present disclosure includes cysteines that, if unpaired, have a high risk of causing protein misfolding and / or aggregation, and this risk is mitigated by alanine substitutions. Exemplary substitutions may include positions C71A and / or C72A of A29L, position C140A of B6R, and / or positions C86A and / or C90A of H3L.

[0529] For the avoidance of doubt, the present disclosure includes the exemplary polypeptide sequences and polyribonucleic acid sequences as described herein and / or shown in the sequence identification numbers of the present disclosure, as well as sequences having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity thereto.

[0530] In some embodiments, the polyribonucleotides of the present disclosure encode a wild-type M1R polypeptide. In some embodiments, the wild-type M1R polypeptide has or includes a sequence according to SEQ ID NO: 158 (see, e.g., Figure 42A ), and / or the polyribonucleotide has or includes a sequence according to SEQ ID NO: 159. In some embodiments, the polyribonucleotide of the present disclosure encodes a wild-type M1R polypeptide operably linked to a signal peptide, such as the HSV / gD secretory sequence (HSV / gD) according to SEQ ID NO: 160. sec ), optionally encoded by a sequence according to SEQ ID NO: 161. In some embodiments, the wild-type M1R polypeptide operably linked to the HSV / gD secretory sequence has or includes a sequence according to SEQ ID NO: 162 (see, e.g., Figure 42B ), and / or the encoding polyribonucleotide has or includes the sequence according to SEQ ID NO:162.

[0531] In some embodiments, the polyribonucleotides of the present disclosure encode a wild-type M1R polypeptide. In some embodiments, the wild-type M1R polypeptide has or includes a sequence according to SEQ ID NO: 258, and / or the polyribonucleotide encoding the wild-type M1R polypeptide has or includes a sequence according to SEQ ID NO: 259. In some embodiments, the polyribonucleotides of the present disclosure encode a wild-type M1R polypeptide operably linked to a signal peptide, such as the HSV / gD secretory sequence (HSV / gD) according to SEQ ID NO: 160. sec ), optionally encoded by a sequence according to SEQ ID NO: 161.

[0532] In some embodiments, the polyribonucleotides of the present disclosure encode wild-type A29L polypeptide. In some embodiments, the wild-type A29L polypeptide has or includes a sequence according to SEQ ID NO: 164 (see, e.g., Figure 43A ), and / or the polyribonucleotide encoding the wild-type A29L polypeptide has or includes a sequence according to SEQ ID NO: 165. In some embodiments, the polyribonucleotide of the present disclosure encodes a wild-type A29L polypeptide operably linked to a signal peptide, such as the HSV / gD secretory sequence (HSV / gD) according to SEQ ID NO: 160. sec ), optionally encoded by a sequence according to SEQ ID NO: 161. In some embodiments, the wild-type A29L polypeptide operably linked to the HSV / gD secretory sequence has or includes a sequence according to SEQ ID NO: 166 (see, e.g., Figure 43B ), and / or the encoding polyribonucleotide has or includes the sequence according to SEQ ID NO:167.

[0533] In some embodiments, the polyribonucleotides of the present disclosure encode an A29L polypeptide comprising a CC to AA substitution at positions 71 and 72 corresponding to SEQ ID NO: 168 (substitutions C71A and C72A compared to the corresponding reference sequence). In some embodiments, the A29L polypeptide comprising C71A and C72A substitutions has or includes a sequence according to SEQ ID NO: 168, and / or the polyribonucleotide encoding the A29L polypeptide has or includes a sequence according to SEQ ID NO: 169. In some embodiments, the polyribonucleotides of the present disclosure encode an A29L polypeptide comprising C71A and C72A substitutions operably linked to a signal peptide, such as the HSV / gD secretory sequence (HSV / gD) according to SEQ ID NO: 160. sec), optionally encoded by a sequence according to SEQ ID NO: 161. In some embodiments, the A29L polypeptide comprising C71A and C72A substitutions operably linked to the HSV / gD secretory sequence has or comprises a sequence according to SEQ ID NO: 170 (see, e.g., Figure 43C ), and / or the encoding polyribonucleotide has or includes the sequence according to SEQ ID NO: 171.

[0534] In some embodiments, the polyribonucleotides disclosed herein encode a soluble form of the extracellular domain of A35R. Without wishing to be bound by any particular scientific theory, the soluble form of the extracellular domain of A35R will function independently of membrane insertion, thereby reducing the potential need or requirement for membrane insertion of the A35R antigen or its fragment. The A35R extracellular domain disclosed herein may have or include a sequence according to SEQ ID NO: 174. The boundaries of the extracellular domain are known from two X-ray crystallographic studies that define the structure of the protein region. The inventors of this case selected amino acids 89-181 for this design, at least in part because the selected amino acids span the resolved region of the protein elucidated by these studies. A35R forms a dimer that relies in part on disulfide bonds between residues not included in the extracellular domain. To compensate for the absence of such disulfide bonds, the inventors of this case engineered a construct comprising two copies of the extracellular domain that is sufficient to form a dimer with a linker between them. Without wishing to be limited or bound by any particular scientific theory, the linker size was chosen (10 amino acids) based on the distance between the C-terminus of one ectodomain and the N-terminus of its binding partner as measured in the crystal structure of the ectodomain, while one skilled in the art will appreciate that linkers can be larger or smaller and that any linker disclosed herein can be used. (See, e.g., Figure 44B )

[0535] In some embodiments, the polyribonucleotides of the present disclosure encode wild-type A35R polypeptide. In some embodiments, the wild-type A35R polypeptide has or includes a sequence according to SEQ ID NO: 172 (see, e.g., Figure 44A), and / or the polyribonucleotide encoding the A35R polypeptide has or includes a sequence according to SEQ ID NO: 173. In some embodiments, the polyribonucleotide of the present disclosure encodes a wild-type A35R extracellular domain (ECD) fragment having or including a sequence according to SEQ ID NO: 174, and / or the encoding polyribonucleotide has or includes a sequence according to SEQ ID NO: 175. In some embodiments, the polyribonucleotides of the present disclosure encode a first wild-type A35R ECD fragment and a second wild-type A35R ECD fragment, wherein the first wild-type A35R ECD fragment has or includes a sequence according to SEQ ID NO: 174 and / or is encoded by a sequence according to SEQ ID NO: 175, and the second wild-type A35R ECD fragment has or includes a sequence according to SEQ ID NO: 174 and / or is encoded by a sequence according to SEQ ID NO: 175, optionally wherein the first wild-type A35R fragment and the second wild-type A35R fragment are operably linked via a linker (e.g., a linker according to SEQ ID NO: 176 and / or encoded by SEQ ID NO: 177). In some embodiments, the polyribonucleotides of the present disclosure encode a first wild-type A35R fragment and a second wild-type A35R fragment, wherein the first wild-type A35R fragment and the second wild-type A35R fragment are operably linked by a linker, and wherein the first and second wild-type A35R fragments are operably linked to a signal peptide, such as the HSV / gD secretory sequence according to SEQ ID NO: 160 (HSV / gD sec ), optionally encoded by a sequence according to SEQ ID NO: 161. In certain such embodiments, the polypeptide encoded by the polyribonucleotide has or comprises a sequence according to SEQ ID NO: 178 (see, e.g., Figure 44B ), and / or the encoding polyribonucleotide has or includes the sequence according to SEQ ID NO: 179.

[0536] In some embodiments, the polyribonucleotides of the present disclosure encode wild-type B6R polypeptide. In some embodiments, the wild-type B6R polypeptide has or includes a sequence according to SEQ ID NO: 180 (see, e.g., Figure 45A ), and / or the polyribonucleotide encoding the B6R polypeptide has or includes a sequence according to SEQ ID NO: 181. In some embodiments, the polyribonucleotide of the present disclosure encodes a B6R polypeptide comprising a C to A substitution at position 140 corresponding to SEQ ID NO: 182 (substitution C140A compared to the corresponding reference sequence). In some embodiments, the B6R polypeptide comprising the C140A substitution has or includes a sequence according to SEQ ID NO: 182 (see, e.g., Figure 45B ), and / or the encoding polyribonucleotide has or includes the sequence according to SEQ ID NO: 183.

[0537] In some embodiments, the polyribonucleotides of the present disclosure encode a wild-type H3L polypeptide. In some embodiments, the wild-type H3L polypeptide has or includes a sequence according to SEQ ID NO: 184 (see, e.g., Figure 46A ), and / or the polyribonucleotide encoding the H3L polypeptide has or includes a sequence according to SEQ ID NO: 185. In some embodiments, the polyribonucleotide of the present disclosure encodes a wild-type H3L polypeptide operably linked to a signal peptide, such as the HSV / gD secretory sequence (HSV / gD) according to SEQ ID NO: 160. sec ), optionally encoded by a sequence according to SEQ ID NO: 161. In some embodiments, the wild-type H3L polypeptide operably linked to the HSV / gD secretory sequence has or includes a sequence according to SEQ ID NO: 186 (see, e.g., Figure 46B ), and / or the encoding polyribonucleotide has or includes the sequence according to SEQ ID NO: 187.

[0538] In some embodiments, the polyribonucleotides of the present disclosure encode an H3L polypeptide comprising a C to A substitution at positions 86 and 90 corresponding to SEQ ID NO: 188 (substitutions C86A and C90A compared to the corresponding reference sequence). In some embodiments, the H3L polypeptide comprising the C86A and C90A substitutions has or includes a sequence according to SEQ ID NO: 188, and / or the polyribonucleotide encoding the H3L polypeptide has or includes a sequence according to SEQ ID NO: 189. In some embodiments, the polyribonucleotides of the present disclosure encode an H3L polypeptide comprising the C86A and C90A substitutions operably linked to a signal peptide, such as the HSV / gD secretory sequence (HSV / gD) according to SEQ ID NO: 160. sec ), optionally encoded by a sequence according to SEQ ID NO: 161. In some embodiments, the H3L polypeptide comprising C86A and C90A substitutions operably linked to the HSV / gD secretory sequence has or comprises a sequence according to SEQ ID NO: 190 (see, e.g., Figure 46C ), and / or the encoding polyribonucleotide has or includes the sequence according to SEQ ID NO: 191.

[0539] In some embodiments, the polyribonucleotides of the present disclosure encode a wild-type H3L polypeptide. In some embodiments, the wild-type H3L polypeptide has or includes a sequence according to SEQ ID NO: 260, and / or the polyribonucleotide encoding the H3L polypeptide has or includes a sequence according to SEQ ID NO: 261. In some embodiments, the polyribonucleotides of the present disclosure encode a wild-type H3L polypeptide operably linked to a signal peptide, such as the HSV / gD secretory sequence (HSV / gD) according to SEQ ID NO: 160. sec ), optionally encoded by a sequence according to SEQ ID NO: 161.

[0540] In some embodiments, the polyribonucleotides of the present disclosure encode an H3L polypeptide comprising a C to A substitution at positions 86 and 90 corresponding to SEQ ID NO: 262 (substitutions C86A and C90A compared to the corresponding reference sequence). In some embodiments, the H3L polypeptide comprising the C86A and C90A substitutions has or includes a sequence according to SEQ ID NO: 262, and / or the polyribonucleotide encoding the H3L polypeptide has or includes a sequence according to SEQ ID NO: 263. In some embodiments, the polyribonucleotides of the present disclosure encode an H3L polypeptide comprising the C86A and C90A substitutions operably linked to a signal peptide, such as the HSV / gD secretory sequence (HSV / gD) according to SEQ ID NO: 160. sec ), optionally encoded by a sequence according to SEQ ID NO: 161.

[0541] In some embodiments, the polyribonucleotides of the present disclosure encode a wild-type E8L polypeptide. In some embodiments, the wild-type E8L polypeptide has or includes a sequence according to SEQ ID NO: 192 (see, e.g., Figure 47A ), and / or the polyribonucleotide encoding the E8L polypeptide has or includes a sequence according to SEQ ID NO: 193. In some embodiments, the polyribonucleotide of the present disclosure encodes a wild-type E8L polypeptide operably linked to a signal peptide, such as the HSV / gD secretory sequence (HSV / gD) according to SEQ ID NO: 160. sec ), optionally encoded by a sequence according to SEQ ID NO: 161. In some embodiments, the wild-type E8L polypeptide operably linked to the HSV / gD secretory sequence has or includes a sequence according to SEQ ID NO: 194 (see, e.g., Figure 47B ), and / or the encoding polyribonucleotide has or includes the sequence according to SEQ ID NO: 195.

[0542] In some embodiments, the polyribonucleotides of the present disclosure encode a wild-type E8L polypeptide. In some embodiments, the wild-type E8L polypeptide has or includes a sequence according to SEQ ID NO: 264, and / or the polyribonucleotide encoding the E8L polypeptide has or includes a sequence according to SEQ ID NO: 265. In some embodiments, the polyribonucleotides of the present disclosure encode a wild-type E8L polypeptide operably linked to a signal peptide, such as the HSV / gD secretory sequence (HSV / gD) according to SEQ ID NO: 160. sec ), optionally encoded by a sequence according to SEQ ID NO: 161.

[0543] In some embodiments, the polyribonucleotides of the present disclosure encode a wild-type E8L polypeptide. In some embodiments, the wild-type E8L polypeptide has or includes a sequence according to SEQ ID NO: 266, and / or the polyribonucleotide encoding the E8L polypeptide has or includes a sequence according to SEQ ID NO: 267. In some embodiments, the polyribonucleotides of the present disclosure encode a wild-type E8L polypeptide operably linked to a signal peptide, such as the HSV / gD secretory sequence (HSV / gD) according to SEQ ID NO: 160. sec ), optionally encoded by a sequence according to SEQ ID NO: 161.

[0544] In some embodiments, the polyribonucleotides of the present disclosure encode wild-type A28L polypeptide. In some embodiments, the wild-type A28L polypeptide has or includes a sequence according to SEQ ID NO: 196 (see, e.g., Figure 48A ), and / or the polyribonucleotide encoding the A28L polypeptide has or includes a sequence according to SEQ ID NO: 197. In some embodiments, the polyribonucleotide of the present disclosure encodes a wild-type A28L polypeptide operably linked to a signal peptide, such as the HSV / gD secretory sequence (HSV / gD) according to SEQ ID NO: 160. sec ), optionally encoded by a sequence according to SEQ ID NO: 161. In some embodiments, the wild-type A28L polypeptide operably linked to the HSV / gD secretory sequence has or includes a sequence according to SEQ ID NO: 198 (see, e.g., Figure 48B ), and / or the encoding polyribonucleotide has or includes the sequence according to SEQ ID NO: 199.

[0545] In some embodiments, the polyribonucleotides of the present disclosure are bicistronic sequences encoding A29L and A28L. A29L and A28L form heterodimers, which are assembled into large macromolecular complexes on the surface of monkeypox virus particles. This interaction is stabilized by a pair of disulfide bonds between A29L and A28L, which are formed by continuous cysteine ​​residues in each protein (A29L: C71, C72, A28L: C441, C442). The inventors of this case have designed constructs for producing the natural configurations of these proteins (large complexes of heterodimers). The present disclosure includes bicistronic constructs that ensure that A29L and A28L are co-expressed in a cell. Bicistronic polyribonucleotides encode complete A29L ORF and complete A28L ORF, with an internal ribosome entry site between them. (See, for example, Figure 49 )

[0546] In some embodiments, the present disclosure includes a bicistronic polyribonucleotide that (i) encodes an A29L antigen according to SEQ ID NO: 171, and / or has or includes a sequence according to SEQ ID NO: 200; and (ii) encodes an A28L antigen according to SEQ ID NO: 196, and / or has or includes a sequence according to SEQ ID NO: 197. In some embodiments, the bicistronic polyribonucleotide of the present disclosure encodes an A29L polypeptide operably linked to a signal peptide, such as the HSV / gD secretory sequence (HSV / gD) according to SEQ ID NO: 160. sec ), optionally encoded by a sequence according to SEQ ID NO: 161. In some embodiments, the bicistronic polyribonucleotide of the present disclosure encodes an A28L polypeptide operably linked to a signal peptide, such as the HSV / gD secretory sequence (HSV / gD) according to SEQ ID NO: 160. sec ), optionally encoded by a sequence according to SEQ ID NO: 161. In some embodiments, the polyribonucleotide sequences encoding A29L and A28L are separated by an IRES. In some embodiments, the bicistronic polyribonucleotides of the present disclosure encode an A29L polypeptide operably linked to a signal peptide, such as an HSV / gD secretory sequence according to SEQ ID NO: 173 and / or encoded by SEQ ID NO: 201 (HSV / gD sec ); and an A28L polypeptide operably linked to a signal peptide, such as an HSV / gD secretory sequence (HSV / gD) according to SEQ ID NO: 198 and / or encoded by SEQ ID NO: 199. sec), the two polypeptides are separated by an IRES (e.g., SEQ ID NO: 202) encoded by the sequence according to SEQ ID NO: 203. (See, e.g., Figure 49 ).

[0547] 2. Exemplary T cell antigen polyribonucleotide sequences

[0548] The present disclosure includes certain exemplary antigenic constructs and polyribonucleotides that can be used, for example, for vaccination against orthopoxviruses (e.g., monkeypox), encoding one or more antigens or fragments thereof according to Table 2. As disclosed herein, polyribonucleotides encoding T cell antigens and / or antigens of Table 2 may include antigenic fragments that are or include T cell epitopes. In various embodiments disclosed herein, polyribonucleotides encoding T cell antigens or fragments thereof and / or antigens of Table 2 or fragments thereof may encode multiple such antigens or fragments thereof or such antigens or fragments thereof "strings." The antigens of the string may be connected, for example, by a linker. The polyribonucleotides encoding the T cell antigen may also include a signal peptide, such as the HSV-1 gD secretion signal (e.g., according to SEQ ID NO: 218). The polyribonucleotides encoding the T cell antigen may also encode a MITD domain (e.g., according to SEQ ID NO: 219). Without wishing to be bound by any particular scientific theory, the MITD domain may facilitate the shuttling of the expressed polyprotein string to the proteasome of the host cell to enhance epitope presentation and T cell responses.

[0549] The present disclosure particularly includes exemplary fragments of T cell antigens that the inventors have determined, which include T cell epitopes and / or can be encoded by polyribonucleotides of the present disclosure (e.g., polyribonucleotides that are or encode T cell strings). The inventors have further determined that the T cell antigen fragments encoded by the exemplary T cell antigen polyribonucleotides of the present invention do not include sequences with 8 or more amino acids identical to the human proteome.

[0550] For the avoidance of doubt, the present disclosure includes the exemplary polypeptide sequences and polyribonucleic acid sequences as described herein and / or shown in the sequence identification numbers of the present disclosure, as well as sequences having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity thereto.

[0551] Exemplary fragments of T cell antigens that can be encoded by the polyribonucleotides of the present disclosure include:

[0552] (i) an A45L fragment according to SEQ ID NO: 204 (amino acids 57-149 of the A45L reference sequence; see e.g., Figure 51 ), which can be encoded by the exemplary nucleic acid sequence according to SEQ ID NO: 205;

[0553] (ii) a Q1L fragment according to SEQ ID NO: 206 (amino acids 210-346 of the Q1L reference sequence; "Q1L-1"; see e.g., Figure 52 ), which can be encoded by the exemplary nucleic acid sequence according to SEQ ID NO: 207;

[0554] (iii) a Q1L fragment according to SEQ ID NO: 208 (amino acids 546-658 of the Q1L reference sequence; "Q1L-2"; see e.g., Figure 52 ), which can be encoded by the exemplary nucleic acid sequence according to SEQ ID NO: 209;

[0555] (iv) a B12R fragment according to SEQ ID NO: 210 (amino acids 148-244 of the B12R reference sequence; see e.g., Figure 53 ), which can be encoded by the exemplary nucleic acid sequence according to SEQ ID NO: 211;

[0556] (v) a C17L fragment according to SEQ ID NO: 212 (amino acids 18-76 of the C17L reference sequence; "C17L-1"; see e.g., Figure 54 ), which can be encoded by the exemplary nucleic acid sequence according to SEQ ID NO: 213;

[0557] (vi) a C17L fragment according to SEQ ID NO: 214 (amino acids 185-281 of the C17L reference sequence; "C17L-2"; see e.g., Figure 54 ), which can be encoded by the exemplary nucleic acid sequence according to SEQ ID NO: 215; and

[0558] (vii) an I3L fragment according to SEQ ID NO: 216 (amino acids 126-199 of the I3L reference sequence; see e.g., Figure 55 ), which can be encoded by the exemplary nucleic acid sequence according to SEQ ID NO: 217.

[0559] In an exemplary embodiment, a T cell string construct may include: an HSV-1 signal polypeptide according to SEQ ID NO: 218; a T cell antigen fragment string comprising fragments of A45L (SEQ ID NO: 204), Q1L (Q1L-1; SEQ ID NO: 206), Q1L (Q1L-2; SEQ ID NO: 208), B12R (SEQ ID NO: 210), C17L (C17L-1; SEQ ID NO: 212), C17L (C17L-2; SEQ ID NO: 214), and I3L (SEQ ID NO: 216); and MITD (SEQ ID NO: 219). The T cell antigen fragments may be connected by a linker, such as a linker having a sequence according to SEQ ID NO: 176 or a linker having the sequence GGSGG (SEQ ID NO: 252). In some embodiments, the polyribonucleotide encoding the T cell string may encode a polypeptide according to SEQ ID NO: 220. (See, e.g., Figure 50 In one exemplary embodiment, a T cell string construct may include: an HSV-1 signal polypeptide according to SEQ ID NO: 218; a T cell antigen fragment string comprising fragments of I3L (SEQ ID NO: 216), C17L (C17L-2; SEQ ID NO: 214), C17L (C17L-1; SEQ ID NO: 212), Q1L (Q1L-1; SEQ ID NO: 206), B12R (SEQ ID NO: 210), A45L (SEQ ID NO: 204), and Q1L (Q1L-2; SEQ ID NO: 208); and MITD (SEQ ID NO: 219). The T cell antigen fragments may be connected by a linker, such as a linker having a sequence according to SEQ ID NO: 176. In some embodiments, the polyribonucleotide encoding the T cell string may encode a polypeptide according to SEQ ID NO: 221. (See, e.g., Figure 50 (Schematic diagram) and Figure 36 (Schematic diagram, with sequence lengths shown to scale)

[0560] III. RNA Delivery Technology

[0561] The polyribonucleotides provided can be delivered for therapeutic applications as described herein using any appropriate method known in the art, including, for example, as naked RNA delivery, or by viral and / or non-viral vectors, polymer-based carriers, lipid-based carriers, nanoparticles (e.g., lipid nanoparticles, polymer nanoparticles, lipid-polymer hybrid nanoparticles, etc.) and / or based on peptide-mediated delivery. About information on the various methods that can be used for delivering polyribonucleotides as described herein, see, for example, Wadhwa et al. " Opportunities and Challenges in the Delivery of mRNA-Based Vaccines " Pharmaceutics (2020) 102 (27 pages), the contents of which are incorporated herein by reference.

[0562] In some embodiments, one or more polyribonucleotides can be formulated with lipid nanoparticles for delivery (eg, administration).

[0563] In some embodiments, lipid nanoparticle can be designed to protect polyribonucleotide from the infringement of extracellular RNA enzyme and / or be engineered so that RNA systemically is delivered to target cell (for example, hepatocyte).In some embodiments, when polyribonucleotide is used intravenously or intramuscularly to experimenter, this type of lipid nanoparticle is particularly useful for delivering polyribonucleotide.

[0564] A. Particles for delivering at least one polyribonucleotide

[0565] Polyribonucleotide provided herein can be delivered by particle.In the context of the present disclosure, term " particle " relates to the structured entity formed by molecule or molecular complex.In some embodiments, term " particle " relates to micron or nanometer size structure, as dispersed in the micron or nanometer size dense structure in the medium.In some embodiments, particle is the particle that contains nucleic acid, as the particle that comprises polyribonucleotide.

[0566] Electrostatic interactions between positively charged molecules (such as polymers and lipids) and negatively charged nucleic acids (e.g., polyribonucleotides) involve particle formation. This results in the compounding and spontaneous formation of nucleic acid particles (e.g., ribonucleic acid particles). In some embodiments, the nucleic acid particles (e.g., ribonucleic acid particles) are nanoparticles.

[0567] A "nucleic acid particle" (e.g., a ribonucleic acid particle) is a particle that encompasses or contains a nucleic acid and is used to deliver the nucleic acid (e.g., a polyribonucleotide) to a target site of interest (e.g., a cell, tissue, organ, etc.). Nucleic acid particles (e.g., ribonucleic acid particles) can be formed from: (i) at least one cationic or cationic ionizable lipid or lipid-like material, (ii) at least one cationic polymer, such as protamine, or a mixture of (i) and (ii), and (iii) a nucleic acid (e.g., a polyribonucleotide). Nucleic acid particles (e.g., ribonucleic acid particles) include lipid nanoparticles (LNPs) and lipid complexes (LPXs).

[0568] In some embodiments, a nucleic acid particle (e.g., a ribonucleic acid particle) comprises more than one type of nucleic acid molecule (e.g., a polyribonucleotide), wherein the molecular parameters of the nucleic acid molecules can be similar or different from each other, such as with respect to molar mass or basic structural elements, such as molecular structure, capping, coding region or other characteristics.

[0569] In some embodiments, the nucleic acid particles (for example, ribonucleic acid particles) provided can include lipid nanoparticles. As used in the present disclosure, " nanoparticles " refer to particles with an average diameter suitable for parenteral administration. In various embodiments, lipid nanoparticles can have an average size (for example, average diameter) of about 30nm to about 150nm, about 40nm to about 150nm, about 50nm to about 150nm, about 60nm to about 130nm, about 70nm to about 110nm, about 70nm to about 100nm, about 70 to about 90nm or about 70nm to about 80nm. In some embodiments, according to lipid nanoparticles of the present disclosure, there can be an average size (for example, average diameter) of about 50nm to about 100nm. In some embodiments, lipid nanoparticles can have an average size (for example, average diameter) of about 50nm to about 150nm. In some embodiments, lipid nanoparticles can have an average size (for example, average diameter) of about 60nm to about 120nm. In some embodiments, lipid nanoparticles according to the present disclosure may have an average size (e.g., average diameter) of about 30 nm, 35 nm, 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm.

[0570] The nucleic acid particles (e.g., RNA particles) described herein can exhibit a polydispersity index of less than about 0.5, less than about 0.4, less than about 0.3, or about 0.2 or less. For example, the nucleic acid particles (e.g., RNA particles) can exhibit a polydispersity index ranging from about 0.1 to about 0.3 or from about 0.2 to about 0.3.

[0571] The nucleic acid particles described herein (e.g., ribonucleic acid particles) can be characterized by an "N / P ratio," which is the molar ratio of cationic (nitrogen) groups ("N" in N / P) to anionic (phosphate) groups ("P" in N / P) in the cationic polymer in the RNA. It is understood that the cationic groups are in the form of cations (e.g., N + ) groups or groups that can be ionized into cations. The use of a single digit in the N / P ratio (e.g., an N / P ratio of about 5) is intended to refer to a number greater than 1, for example, an N / N ratio of about 5 is intended to mean 5:1. In some embodiments, the nucleic acid particles described herein (e.g., ribonucleic acid particles) have an N / P ratio greater than or equal to 5. In some embodiments, the nucleic acid particles described herein (e.g., ribonucleic acid particles) have an N / P ratio of about 5, 6, 7, 8, 9 or 10. In some embodiments, the nucleic acid particles described herein (e.g., ribonucleic acid particles) have an N / P ratio of about 10 to about 50. In some embodiments, the nucleic acid particles described herein (e.g., ribonucleic acid particles) have an N / P ratio of about 10 to about 70. In some embodiments, the nucleic acid particles described herein (e.g., ribonucleic acid particles) have an N / P ratio of about 10 to about 120.

[0572] The nucleic acid particles (e.g., ribonucleic acid particles) described herein can be prepared using a wide range of methods that can involve obtaining a colloid from at least one cationic or cationically ionizable lipid or lipid-like material and / or at least one cationic polymer and mixing the colloid with nucleic acid to obtain the nucleic acid particle.

[0573] As used herein, the term "colloid" refers to a type of homogeneous mixture in which dispersed particles do not settle. The insoluble particles in the mixture can be microscopic, with particle sizes ranging from 1 to 1000 nanometers. This mixture can be referred to as a colloid or a colloidal suspension. Sometimes the term "colloid" refers only to the particles in the mixture, rather than the entire suspension.

[0574] The term "mean diameter" or "median diameter" refers to the average hydrodynamic diameter of the particles measured by dynamic laser light scattering (DLS), the data analysis using the so-called cumulant algorithm, which provides as a result the so-called Z-average value with a length dimension and a dimensionless polydispersity index (PI) (Koppel, D., J. Chem. Phys. 57, 1972, pp. 4814-4820, ISO 13321, which is incorporated herein by reference). The use of "mean diameter," "median diameter," "diameter," or "size" of the particles herein is synonymous with the Z-average value.

[0575] "Polydispersity index" is preferably calculated based on dynamic light scattering measurements by so-called cumulative analysis as mentioned in the definition of "average diameter." Under certain prerequisites, it can be considered as a measure of the size distribution of ribonucleic acid nanoparticles (e.g., ribonucleic acid nanoparticles) as a whole.

[0576] Different types of nucleic acid particles have been previously described as suitable for delivering nucleic acids in particulate form (e.g., Kaczmarek, JC et al., 2017, Genome Medicine 9, 60, which is incorporated herein by reference). For non-viral nucleic acid delivery vectors, nanoparticle encapsulation of nucleic acids physically protects the nucleic acid from degradation and, depending on the specific chemistry, can aid cellular uptake and endosomal escape.

[0577] The present disclosure describes particles and compositions comprising such particles, which comprise nucleic acids (e.g., polyribonucleotides), at least one cationic or cationically ionizable lipid or lipid-like material, and / or at least one cationic polymer that associates with nucleic acids (e.g., polyribonucleotides) to form nucleic acid particles (e.g., ribonucleic acid particles, such as ribonucleic acid nanoparticles). Nucleic acid particles (e.g., ribonucleic acid particles, such as ribonucleic acid nanoparticles) can comprise nucleic acids (e.g., polyribonucleotides) that are complexed in various forms through non-covalent interactions with the particles. The particles described herein are not viral particles, in particular, they are not infectious viral particles, i.e., they are incapable of virally infecting cells.

[0578] Some embodiments described herein relate to compositions, methods, and uses involving more than one (eg, 2, 3, 4, 5, 6, or even more) nucleic acid species (eg, polyribonucleotide species).

[0579] In nucleic acid particles (for example, ribonucleic acid particles, for example ribonucleic acid nanoparticles) preparations, every kind of nucleic acid species (for example, polyribonucleotide species) can be formulated as independent nucleic acid particles (for example, ribonucleic acid particles, for example ribonucleic acid nanoparticles) preparations respectively. In this case, every kind of independent nucleic acid particles (for example, ribonucleic acid particles, for example ribonucleic acid nanoparticles) preparations will comprise a kind of nucleic acid species (for example, polyribonucleotide species). Independent nucleic acid particles (for example, ribonucleic acid particles, for example ribonucleic acid nanoparticles) preparations can exist as independent entities, for example, in independent containers. Such preparations can be provided together with particle forming agents by every kind of nucleic acid species (for example, polyribonucleotide species) respectively (usually every kind with the form of containing nucleic acid solution), thereby allowing to form particles and obtain. Corresponding particles will only contain the specific nucleic acid species (for example, polyribonucleotide species) (independent particle preparations) provided when forming particles.

[0580] In some embodiments, a composition (such as a pharmaceutical composition) comprises more than one separate nucleic acid particle (e.g., ribonucleic acid particle, such as ribonucleic acid nanoparticle) preparation. The corresponding pharmaceutical composition is referred to as a "mixed particle preparation". The mixed particle preparation of the present invention can be obtained by separately forming the separate nucleic acid particle (e.g., ribonucleic acid particle, such as ribonucleic acid nanoparticle) preparations as described above, and then mixing the separate nucleic acid particle (e.g., ribonucleic acid particle, such as ribonucleic acid nanoparticle) preparations. By the mixing step, a preparation comprising a mixed population of nucleic acid particles can be obtained. The separate nucleic acid particle (e.g., ribonucleic acid particle, such as ribonucleic acid nanoparticle) populations can be together in a container that contains a mixed population of separate nucleic acid particles (e.g., ribonucleic acid particles, such as ribonucleic acid nanoparticles) preparations.

[0581] Alternatively, different nucleic acid species (e.g., polyribonucleotide species) can be formulated together into a "combined particle preparation". Such a preparation can be obtained by providing a combined preparation (usually a combined solution) of different nucleic acid species (e.g., polyribonucleotide species) and a particle forming agent, thereby allowing particles to form. In contrast to a "mixed particle preparation", a "combined particle preparation" typically comprises particles containing more than one nucleic acid species (e.g., polyribonucleotide species). In a combined particle composition, different nucleic acid species (e.g., polyribonucleotide species) are typically present together in a single particle.

[0582] In some embodiments, nucleic acids (eg, polyribonucleotides) resist degradation by nucleases in aqueous solution when present in provided nucleic acid particles (eg, ribonucleic acid particles, such as lipid nanoparticles).

[0583] In some embodiments, the nucleic acid particle (e.g., ribonucleic acid particle) is a lipid nanoparticle. In some embodiments, the lipid nanoparticle is a lipid nanoparticle targeting the liver. In some embodiments, the lipid nanoparticle is a cationic lipid nanoparticle comprising one or more cationic lipids (e.g., those described herein). In some embodiments, the cationic lipid nanoparticle can include at least one cationic lipid, at least one polymer-conjugated lipid, and at least one helper lipid (e.g., at least one neutral lipid).

[0584] 1. Cationic polymer materials

[0585] As reported in PCT application publication number WO 2021 / 001417, cationic polymers have been considered to be useful for developing such delivery vectors, and the entire content of the document is incorporated herein by reference. As used herein, the term "polymer" refers to a composition comprising one or more molecules that comprise repeating units of one or more monomers. As used herein, "polymer," "polymer material," and "polymer composition" are used interchangeably and, unless otherwise specified, refer to a composition of polymer molecules. Those skilled in the art will appreciate that polymer compositions comprise polymer molecules having molecules of different lengths (e.g., comprising monomers of varying amounts). The polymer compositions described herein are characterized by one or more of a standardized molecular weight (Mn), weight-average molecular weight (Mw), and / or polydispersity index (PDI). In some embodiments, such repeating units may all be identical ("homopolymers"); alternatively, in some cases, more than one type of repeating unit ("heteropolymer" or "copolymer") may be present in a polymer material. In some cases, polymers are of biological origin, such as biopolymers, such as proteins. In some cases, additional moieties may also be present in the polymeric material, such as targeting moieties, such as those described herein.

[0586] In some embodiments, the polymer utilized according to the present disclosure can be a copolymer. The repeating units forming the copolymer can be arranged in any manner. For example, in some embodiments, the repeating units can be arranged in a random order; alternatively or additionally, in some embodiments, the repeating units can be arranged in an alternating order, or as a "block" copolymer arrangement, for example, comprising one or more regions each comprising a first repeating unit (e.g., a first block) and one or more regions each comprising a second repeating unit (e.g., a second block). Block copolymers can have two (diblock copolymers), three (triblock copolymers) or more different blocks.

[0587] In some embodiments, polymeric materials used in accordance with the present disclosure are biocompatible.In some embodiments, biocompatible materials are biodegradable, eg, capable of chemically and / or biologically degrading in a physiological environment (eg, in vivo).

[0588] In some embodiments, the polymeric material can be or include protamine or a polyalkyleneimine.

[0589] As known to those skilled in the art, the term "protamine" is generally used to refer to any one of various strongly basic proteins of relatively low molecular weight, which are rich in arginine and are found to be particularly associated with DNA to replace the somatic histones in the sperm cells of various animals (e.g., fish). In particular, the term "protamine" is generally used to refer to a protein found in fish sperm that is strongly alkaline, soluble in water, not coagulated by heat, and primarily produces arginine when hydrolyzed. In purified form, they are used for long-acting preparations of insulin and to neutralize the anticoagulant effect of heparin.

[0590] In some embodiments, as used herein, the term "protamine" refers to a protamine amino acid sequence obtained or derived from a natural or biological source, including fragments thereof and / or multimeric forms of said amino acid sequence or its fragments, as well as (synthetic) polypeptides that are artificial and specifically designed for a specific purpose and cannot be isolated from a natural or biological source.

[0591] In some embodiments, the polyalkyleneimine comprises polyethyleneimine (PEI) and / or polypropyleneimine. In some embodiments, the preferred polyalkyleneimine is polyethyleneimine (PEI). In some embodiments, the average molecular weight of PEI is preferably 0.75 x 10 2 to 10 7 Da, preferably 1000 to 10 5 Da, more preferably 10,000 to 40,000 Da, more preferably 15,000 to 30,000 Da, even more preferably 20,000 to 25,000 Da.

[0592] Cationic materials (e.g., polymeric materials, including polycationic polymers) contemplated for use herein include those capable of electrostatically binding nucleic acids. In some embodiments, cationic polymeric materials contemplated for use herein include any cationic polymeric material with which nucleic acids can associate (e.g., by forming a complex with the nucleic acid or forming a vesicle in which the nucleic acid is encapsulated or encapsulated).

[0593] In some embodiments, the particles described herein may comprise polymers other than cationic polymers, such as non-cationic polymeric materials and / or anionic polymeric materials. Anionic and neutral polymeric materials are collectively referred to herein as non-cationic polymeric materials.

[0594] 2. Lipid particles

[0595] The terms "lipid" and "lipid-like material" are used herein to refer to molecules that contain one or more hydrophobic moieties or groups and optionally also contain one or more hydrophilic moieties or groups. Molecules that contain both hydrophobic and hydrophilic moieties are also often referred to as amphiphilic molecules. Lipids are generally poorly soluble in water. In aqueous environments, the amphiphilic nature enables the molecules to self-assemble into organized structures and different phases. One of these phases consists of a lipid bilayer, as they are present in vesicles, multilamellar / unilamellar liposomes, or membranes in aqueous environments. Hydrophobicity can be imparted by including non-polar groups, including but not limited to long-chain saturated and unsaturated aliphatic hydrocarbon groups and such groups substituted with one or more aromatic, alicyclic, or heterocyclic groups. In some embodiments, the hydrophilic group may contain polar and / or charged groups, and include carbohydrates, phosphates, carboxyls, sulfates, amino groups, sulfhydryls, nitro groups, hydroxyl groups, and other similar groups.

[0596] The lipid nanoparticles of the present disclosure (also referred to as "lipid nanoparticles") comprise (i) a cationic lipid; (ii) a polymer-conjugated lipid; and (iii) one or more helper lipids. The lipid nanoparticles described herein can be used to deliver nucleic acid cargo (e.g., polyribonucleotides) to cells of a subject. In some embodiments, lipid na...

Claims

1. A composition comprising a polyribonucleotide encoding one or more monkeypox antigens or fragments thereof and a pharmaceutically acceptable carrier.

2. A composition comprising a plurality of polyribonucleotides and a pharmaceutically acceptable carrier, wherein at least one polyribonucleotide in the plurality of polyribonucleotides encodes one or more monkeypox antigens or a fragment thereof.

3. compositions as claimed in claim 2, at least two polyribonucleotides in wherein said a plurality of polyribonucleotides are unequal.

4. compositions as claimed in claim 2 or 3, all polyribonucleotides in wherein said multiple polyribonucleotides encode one or more monkeypox antigens or its fragment.

5. The composition of any one of claims 2 to 4, wherein at least one of the plurality of polyribonucleotides encodes only a monkeypox antigen or a fragment thereof.

6. The composition of any one of claims 2 to 5, wherein the first polyribonucleotide of the plurality of polyribonucleotides encodes a first set of one or more monkeypox antigens or fragments thereof, wherein the first set of one or more monkeypox antigens or fragments thereof comprises: (i) B6R or a fragment of B6R, (ii) M1R or a fragment of M1R, (iii) A35R or a fragment of A35R, (iv) H3L or a fragment of H3L, and (v) E8L or a fragment of E8L, or (vi) any combination of these; wherein a second polyribonucleotide in the plurality of polyribonucleotides encodes a second set of one or more monkeypox antigens or fragments thereof, wherein the first group of one or more monkeypox antigens or fragments thereof and the second group of one or more monkeypox antigens or fragments thereof are different.

7. The composition of any one of claims 2 to 5, wherein the first polyribonucleotide of the plurality of polyribonucleotides encodes a first set of one or more monkeypox antigens or fragments thereof, wherein the first set of one or more monkeypox antigens or fragments thereof comprises: (i) A29L or a fragment of A29L, (ii) A35R or a fragment of A35R, (iii) B6R or a fragment of B6R, (iv) M1R or a fragment of M1R, (v) E8L or a fragment of E8L, (vi) A28L or a fragment of A28L, (vii) H3L or a fragment of H3L, or (viii) any combination of them; wherein a second polyribonucleotide in the plurality of polyribonucleotides encodes a second set of one or more monkeypox antigens or fragments thereof, wherein the first group of one or more monkeypox antigens or fragments thereof and the second group of one or more monkeypox antigens or fragments thereof are different.

8. The composition of any one of claims 2 to 5, wherein the first polyribonucleotide of the plurality of polyribonucleotides encodes a first set of one or more monkeypox antigens or fragments thereof, wherein the first set of one or more monkeypox antigens or fragments thereof comprises: (i) A29L or a fragment of A29L, (ii) A35R or a fragment of A35R, (iii) B6R or a fragment of B6R, (iv) M1R or a fragment of M1R, (v) E8L or a fragment of E8L, (vi) H3L or a fragment of H3L, (vii) A45L or a fragment of A45L, (viii) B9R or a fragment of B9R, (ix) B16R or a fragment of B16R, (x) C10L or a fragment of C10L, (xi) C21L or a fragment of C21L, (xii) E7R or a fragment of E7R, (xiii) F3L or a fragment of F3L, (xiv) F4L or a fragment of F4L, (xv) G6R or a fragment of G6R, (xvi) H5R or a fragment of H5R, (xvii) I3L or a fragment of I3L, (xviii) O2L or a fragment of O2L, (xix) Q1L or a fragment of Q1L, (xx) B12R or a fragment of B12R, (xxi) C17L or a fragment of C17L, (xxii) A28L or a fragment of A28L, or (xxiii) any combination of them; wherein a second polyribonucleotide in the plurality of polyribonucleotides encodes a second set of one or more monkeypox antigens or fragments thereof, wherein the first group of one or more monkeypox antigens or fragments thereof and the second group of one or more monkeypox antigens or fragments thereof are different.

9. The composition of any one of claims 2 to 8, wherein the first set of one or more monkeypox antigens or fragments thereof and the second set of one or more monkeypox antigens or fragments thereof do not include any identical monkeypox antigens or fragments thereof.

10. The composition according to any one of claims 6 to 9, wherein The first polyribonucleotide encodes B6R antigen or a fragment thereof, and The second polyribonucleotide encodes the M1R antigen or a fragment thereof.

11. The composition of claim 10, wherein The first polyribonucleotide encodes a B6R antigen or a fragment thereof, wherein the B6R antigen or a fragment thereof comprises an amino acid sequence that is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to any one of SEQ ID NOs: 21-30, 180 and 182, and The second polyribonucleotide encodes an M1R antigen or a fragment thereof, which comprises an amino acid sequence that is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to any one of SEQ ID NOs: 31-40 and 158.

12. The composition of claim 10 or 11, further comprising a third polyribonucleotide encoding the A35R antigen or a fragment thereof.

13. The composition of claim 12, wherein The third polyribonucleotide encodes an A35R antigen or a fragment thereof, and the A35R antigen or a fragment thereof comprises an amino acid sequence that is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to any one of SEQ ID NO: 11-20, 172 and 174.

14. The composition of claim 12 or 13, further comprising a fourth polyribonucleotide encoding the E8L antigen or a fragment thereof.

15. The composition of claim 14, wherein The fourth polyribonucleotide encodes an E8L antigen or a fragment thereof, which comprises an amino acid sequence that is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to any one of SEQ ID NOs: 41-50 and 192.

16. The composition of claim 12 or 13, further comprising a fourth polyribonucleotide encoding an H3L antigen or a fragment thereof.

17. The composition of claim 16, wherein The fourth polyribonucleotide encodes an H3L antigen or a fragment thereof, which comprises an amino acid sequence that is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to any one of SEQ ID NOs: 51-60, 184, 188 and 190.

18. The composition of any one of claims 1 to 17, wherein the composition further comprises lipid nanoparticles, polyplexes, lipidated polyplexes or liposomes, Wherein the polyribonucleotide or multiple polyribonucleotides are completely or partially encapsulated in the lipid nanoparticle, polyplex, lipidated polyplex or liposome.

19. The composition of any one of claims 1 to 18, wherein the composition further comprises lipid nanoparticles, Wherein the polyribonucleotide or multiple polyribonucleotides are completely or partially encapsulated in the lipid nanoparticle.

20. The composition of claim 19, wherein the lipid nanoparticles are targeted to hepatocytes.

21. The composition of claim 19, wherein the lipid nanoparticles are targeted to secondary lymphoid organ cells.

22. A composition as described in any one of claims 18 to 21, wherein the lipid nanoparticle is a cationic lipid nanoparticle.

23. The composition of any one of claims 18 to 22, wherein each of the lipid nanoparticles comprises: (a) polymer-conjugated lipids; (b) cationic lipids; and (c) one or more neutral lipids.

24. The composition of claim 23, wherein the polymer-conjugated lipid comprises a PEG-conjugated lipid.

25. The composition of claim 23 or 24, wherein the polymer-conjugated lipid comprises 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide.

26. The composition of any one of claims 23 to 25, wherein the one or more neutral lipids comprise 1,2-distearoyl-sn-glycero-3-phosphocholine (DPSC).

27. A composition as described in any one of claims 23 to 26, wherein the one or more neutral lipids include cholesterol.

28. A composition as described in any one of claims 23 to 27, wherein the cationic lipid comprises ((3-hydroxypropyl) azanediyl)bis(nonane-9,1-diyl)bis(2-butyloctanoate).

29. The composition of any one of claims 23 to 28, wherein each of the lipid nanoparticles comprises: (a) 2-[(Polyethylene glycol)-2000]-N,N-ditetradecylacetamide; (b) DPSC; (c) cholesterol; and (d) ((3-Hydroxypropyl)azanediyl)bis(nonane-9,1-diyl)bis(2-butyloctanoate).

30. The composition of any one of claims 23 to 29, wherein the lipid nanoparticles comprise: (a) about 1-2.5 mol % of the polymer-conjugated lipids based on the total lipids; (b) about 35-65 mol % of the cationic lipid based on the total lipids; and (c) the one or more neutral lipids are present in 35-65 mol % of the total lipids.

31. A composition as described in any one of claims 23 to 30, wherein the lipid nanoparticles have an average diameter of about 50-150 nm.

32. A method of inducing an immune response against an orthopoxvirus in a subject, the method comprising administering to the subject a composition as claimed in any one of claims 1 to 31.

33. The method of claim 32, wherein the orthopoxvirus is monkeypox virus, smallpox virus, vaccinia virus, or cowpox virus. SEQ ID NO:160

Images