Treatment application of miR155 SNP rs377265631

Abstract

The present invention relates to the therapeutic use of a single nucleotide polymorphism (SNP) of miR155. The SNPs have multi-functional benefits on immune cells, such as T cells, and can be recombined for the treatment of diseases, such as cancer.

Description

[0001] Statement on funding

[0002] This invention was made in part with government support through the National Institutes of Health. The government has certain rights in this invention. Background Art

[0003] MicroRNA (miRNA; miR) is a small non-coding RNA that controls the gene expression of a wide range of target genes based on sequence complementarity. By binding to the 3' untranslated region (3'UTR) of the target mRNA, miRNA regulates gene expression and is potentially able to control multiple gene targets within the same or different signaling pathways (Nat Rev Immunol. 2016; 16(5): 279-294; Nat Rev Drug Discov. 2010; 9(10): 775-789). Many miRNAs are dysregulated in cancer, cardiovascular and autoimmune diseases (FEBS J. 2018; 285(20): 3695-3716). Genomic mutations, deletions or changes in key enzymes in miRNA biosynthesis can all lead to changes in miRNA levels.

[0004] (Nat Rev Cancer. 2011; 11(12):849-864; Nat Rev Cancer. 2009; 9(4): 293-302).

[0005] MicroRNAs are involved in the normal function of eukaryotic cells. Imbalance of microRNAs may lead to disease, and for many microRNAs, roles in pathogenesis or disease have been reported (FEBS J. 2018; 285 (20): 3695-3716). Diseases associated with the dysregulation of miRNAs include cancer (Nature. 2012; 482 (7385): 347-355), heart disease (Heart. 2015; 101: 921-928), nephropathy (Nature Reviews Nephrology 2015; 11: 23-33), nervous system diseases (Brain. 2011; 134 (Pt12): 3578-3589), obesity (Cells. 2019; 8 (8): 859), hemostatic diseases (JTH. 2015; 13 (2): 170-81) and other diseases. Depending on the type of disorder, various treatment methods are possible. For some diseases, especially those caused by or associated with upregulation of microRNAs, inhibiting the function or expression of microRNAs may be beneficial (Blood. 2018; 132 (Supplement 1): 2903). For other diseases, especially those caused by or associated with downregulation of microRNAs, recombinant expression of microRNAs or addition of therapeutic agents that increase the expression of microRNAs may be beneficial (Proc Natl Acad Sci USA. 2015; 112 (2): 476-81, Blood. 2015; 125 (22): 3377-3387).

[0006] One specific microRNA is miR155. MiR155 has been used in a variety of methods, including the use of miR155 as a diagnostic or prognostic marker, the therapeutic use of miR155 by inhibiting or blocking its activity, and the therapeutic use of miR155 by expressing it in tissues or cells (Carcinogenesis. 2020; 41(1): 2-7, Blood. 2018; 132(Supplement 1): 2903, Blood. 2011; 118(21): 2728, Int J Mol Sci. 2020; 21(16): 5834). The biology of miR155 is multifaceted. MiR155 is a key regulator of Treg homeostasis (Immunity. 2009; 30(1): 80-91). miR155 also promotes pro-inflammatory macrophages while inhibiting the polarization of anti-inflammatory macrophages (Cell Mol Immunol. 2009; 6(5): 343-352). miR155 also enhances the production and co-stimulatory function of DC cytokines (Science. 2007; 316(5824): 608-611). miR155 also promotes B cell proliferation, survival, germinal center formation, plasma cell differentiation and antibody production (Immunity. 2007; 27(6): 847-859). miR155 also promotes Th1, Th17, Tfh differentiation while inhibiting type 2 polarization (Immunity. 2010; 33(4): 607-619). miR155 also enhances NK cell proliferation, chemotaxis, and effector function (Blood 2013; 121(16):3126-3134; Plos One 2020; 15(2):e0225820.). Finally, miR-155 promotes CD8+ T cell effector responses against viruses and tumors (2013Apr 18; 38(4):742-53; NatImmunol. 2013Jun; 14(6):593-602).

[0007] WO2007 / 127190 describes the development of a transgenic mouse model in which the mice express miR155. However, WO2007 / 127190 does not consider any therapeutic use of miR155. WO2009 / 026576 discloses certain nucleic acids, so-called external guide sequences (EGS), which can be used to target the activity of miR-155 and thus downregulate the activity of miR-155. WO2010 / 135714 relates to the regulation of genes involved in adipocyte expression by a composition comprising miR155. WO2011 / 029903 relates to the therapeutic use of miRs by enriching microRNAs in a patient's blood preparation. One of the miRs is miR155. WO2014 / 059248 relates to enhancing anti-cancer immunity by expression of miR155 in specific T cells. A similar concept is disclosed in WO2014 / 066137. WO2016 / 077574 discloses that inhibitors of miR-155 are used to increase atrial natriuretic peptide (ANP) levels to treat cardiovascular disease. WO2017 / 182580 relates to the treatment of production-related diseases with miR155, etc. WO2018 / 177746 relates to the treatment of polycystic ovary syndrome with miR155, etc. WO2019 / 227260 relates to mammalian virus-mediated miR expression (including miR155). WO2020 / 002430 relates to stimulating mesenchymal stem cells with miR (such as miR155). WO2020 / 221821 relates to the treatment of cognitive impairment with miR155, etc. CN112481218 describes a porcine mIR-155 vector system. CN113337544 relates to a retroviral vector expressing CAR and microRNA, wherein the microRNA is miR155, etc. However, none of the above references mention or otherwise anticipate or disclose SNP4.

[0008] For many genes, single nucleotide polymorphisms (SNPs) have been described. A SNP refers to a variant of a gene in which a single nucleotide in the genome is replaced. SNPs have also been described for microRNAs. SNP rs377265631 (SNP4) is one of the many SNPs described for miR155. Compared to wild-type miR155, SNP4 carries an A-to-G variation:

[0009] Wild-type miR155 ACTCCTACAT A TTAGCATTAA (SEQ ID No. 1)

[0010] rs377265631(SNP4)ACTCCTACAT G TTAGCATTAA (SEQ ID No. 2)

[0011] Before the present invention, the function or effect of rs377265631 were unknown. In this article, it has been demonstrated that the overexpression of rs377265631 has a beneficial effect in treating diseases (such as cancer) for the first time. Surprisingly, this effect exceeds the effect obtained in the situation corresponding to the microRNA type. Summary of the invention

[0012] The present disclosure relates to specific SNPs of miR155, which surprisingly have been found to be useful for treating various diseases, such as cancer. In certain embodiments, the present disclosure relates to recombinant nucleic acids comprising a nucleic acid sequence of SEQ ID No.2 or SEQ ID No.5 for use in medicine. In certain embodiments, the use in medicine is for use in treating cancer. In certain embodiments, the use in treating cancer is for treating melanoma, NSCLC, sarcoma or HPV-related cancer.

[0013] In some embodiments, the nucleic acid comprising the nucleic acid sequence of SEQ ID No.2 or SEQ ID No.5 is operably linked to a promoter. In some embodiments, the recombinant nucleic acid is encoded on an expression vector. In some embodiments, the expression vector is a viral vector or a plasmid. In some embodiments, the recombinant nucleic acid is an isolated or purified nucleic acid.

[0014] In certain embodiments, the disclosure relates to a recombinant immune cell comprising a nucleic acid of SEQ ID No.2 or SEQ ID No.5. In certain embodiments, the recombinant immune cell is a T cell. In certain embodiments, the T cell is a CD8 positive T cell. In certain embodiments, the CD8 positive T cell is a tumor infiltrating lymphocyte (TIL) or a peripheral blood lymphocyte (PBL) isolated from a patient with cancer. In certain embodiments, the immune cell further comprises a nucleic acid encoding a chimeric antigen receptor or a T cell receptor.

[0015] In certain embodiments, the nucleic acid comprising the nucleic acid sequence of SEQ ID No.2 or SEQ ID No.5 is located within the coding region of the chimeric antigen receptor or the T cell receptor, such as within the intracellular portion of the chimeric antigen receptor or the T cell receptor. In certain embodiments, the chimeric antigen receptor or the T cell receptor is specific for a cancer antigen. In certain embodiments, the immune cell is an isolated or purified immune cell. In certain embodiments, the immune cell is a human immune cell.

[0016] In certain embodiments, the present disclosure relates to a cell population comprising at least one immune cell as described above. In certain embodiments, the present disclosure relates to a composition comprising at least one immune cell as described above and a carrier therefor, preferably a pharmaceutically acceptable carrier.

[0017] In certain embodiments, the disclosure relates to recombinant immune cells, cell populations, or compositions as described herein for use in medicine. In certain embodiments, the use in medicine is for use in the treatment of cancer. In certain embodiments, the cancer is melanoma, NSCLC, sarcoma, or HPV-related cancer.

[0018] definition

[0019] As used herein, the terms "miR", "miRNA" and "microRNA" refer to unprocessed or processed RNA transcripts from miR genes. MiR can regulate gene expression by interacting with messenger RNA molecules (mRNA), DNA or proteins. Typically, microRNAs are composed of a nucleic acid sequence of about 19-25 nucleotides (bases) and are present in mammalian cells. Mature microRNA molecules are single-stranded RNA molecules processed from double-stranded precursor transcripts that form local hairpin structures. The hairpin structure is usually cut into active RNA molecules of 19-25 nucleotides by RNases (such as Dicer, Argonaut or RNase 111). Unprocessed miR gene transcripts are also referred to as "miR precursors" and typically contain RNA transcripts of about 70-100 nucleotides in length. This active 19-25 nucleotide RNA molecule is also referred to as "processed" miR gene transcripts or "mature" miRNAs. It should be understood that the term "miR" as used herein can include one or more of miR oligonucleotides, including mature miR, pre-miR, pri-miR or miR seed sequences. In certain embodiments, miR can be modified to enhance delivery. Various sources of miRNA (miR) information are available (e.g., Sanger Institute, miRbase, TargetSCAN, miRDB). The term microRNA as used herein includes duplexes (i.e., double-stranded miR) and single-stranded miR (i.e., mature miR) in the 5' to 3' direction and complementary strands in the 3' to 5' direction.

[0020] As used herein, the terms "miR155", "miRNA155" and "microRNA155" refer to a specific microRNA with GeneID 406947. The unprocessed precursor pre-miR155 has the following sequence:

[0021] CTGTTAATGCTAATCGTGATAGGGGTTTTTGCCTCCAACTGACTCCTACATATTAGCATTAACAG (SEQ ID No. 3).

[0022] The processed mature miR155 has the following sequence:

[0023] ACTCCTACATATTAGCATTAA(SEQ ID No.1)

[0024] Homologs of miR155 exist in many other species:

[0025] Table 1:

[0026]

[0027]

[0028] As used herein, the terms "rs377265631" and "SNP4" refer to the specific SNP of miR155. The unprocessed SNP4 precursor has the following sequence:

[0029] CTGTTAATGCTAATCGTGATAGGGGTTTTTGCCTCCAACTGACTC CTACAT G TTAGCATTAACAG (SEQ ID No. 5).

[0030] The processed SNP4 has the following sequence:

[0031] ACTCCTACAT G TTAGCATTAA (SEQ ID No. 2).

[0032] Note that the sequence of SNP4 is identical to miR155 homologs in orangutans, gibbons, and multiple other species; see Table 1.

[0033] The terms "SNP" and "single nucleotide polymorphism" refer to a polymorphism at a specific position in the genome of a species that varies among a population of individuals, ie, for which two or more alternative alleles exist in a given population.

[0034] The term "cell" as used herein refers to a single cell or a plurality of cells.

[0035] The term "host cell" as used herein refers to a cell comprising a nucleic acid and / or a vector. In the context of the present disclosure, the term host cell refers to a cell comprising a nucleic acid and / or a vector encoding miR (preferably SNP4). Such host cells will express miR and are suitable for use in medicine. Preferred host cells of the present invention are eukaryotic host cells, such as immune cells. Particularly preferred host cells are T cells, such as CD8 positive T cells.

[0036] The term "T cell" as used herein refers to a lymphocyte that plays a central role in cell-mediated immunity. T cells, also referred to as T lymphocytes, can be distinguished from other lymphocytes (such as B cells and natural killer cells) by the presence of T cell receptors (TCR) on the cell surface. There are a variety of subpopulations of T cells (including but not limited to, T helper cells, cytotoxic T cells, memory T cells, regulatory T cells and natural killer T cells) with different functions. In some embodiments, T cells are engineered T cells. In other embodiments, T cells are CD8 positive T cells. In some other embodiments, T cells are CAR-T cells.

[0037] As used herein, the term "CD8" or "differentiation cluster 8" refers to a transmembrane glycoprotein (UniProt: P01732) present on certain T cells and acting as a co-receptor for the T cell receptor (TCR). Together with the TCR, the CD8 co-receptor plays a role in T cell signaling and helps cytotoxic T cell-antigen interactions. T cells expressing CD8 are referred to as "CD8 positive T cells".

[0038] As used herein, the term "CAR" or "chimeric antigen receptor" refers to an artificial cell surface receptor that is designed to bind to certain proteins on cells (e.g., cancer cells). When certain CARs are expressed by T cells, the binding of the CAR extracellular binding portion to the target antigen can activate the T cells. CAR is also referred to as a chimeric T cell receptor or chimeric immune receptor. A typical CAR comprises (i) an extracellular domain comprising a portion that binds to a target antigen; (ii) a transmembrane domain; and (iii) an intracellular signaling domain that sends an activation signal when the CAR is stimulated by the binding of the extracellular binding portion to the target antigen.

[0039] The term "CAR-T cell" as used herein refers to a T cell engineered to express a chimeric antigen receptor.

[0040] As used herein, the term "T cell receptor" or "TCR" refers to a complex of integral membrane proteins involved in the activation of T cells in response to antigen binding. The TCR is a disulfide-linked, membrane-anchored heterodimer consisting of a highly variable α chain and a β chain, which is usually expressed as part of a complex with an invariant CD3 (cluster of differentiation 3) chain molecule.

[0041] As used herein, the terms "polynucleotide" and / or "nucleic acid sequence" and / or "nucleic acid" refer to a sequence of nucleoside or nucleotide monomers consisting of bases, sugars, and intersugar (backbone) bonds. The term includes DNA and RNA, and may be double-stranded or single-stranded, and represent a sense strand or an antisense strand. The term also includes modified or substituted sequences comprising non-naturally occurring monomers or portions thereof. The nucleic acid sequence of the present application may be a deoxyribonucleic acid sequence (DNA) or a ribonucleic acid sequence (RNA), and may comprise naturally occurring bases (including adenine, guanine, cytosine, thymidine, and uracil). The sequence may also comprise modified bases. Examples of such modified bases include aza and deazaadenine, guanine, cytosine, thymidine, and uracil; as well as xanthine and hypoxanthine. The nucleic acids of the present disclosure may be isolated from biological organisms, formed by laboratory genetic recombination methods, or obtained by chemical synthesis or other known protocols for producing nucleic acids.

[0042] As used herein, the term "modified RNA" or "modified DNA" refers to a nucleic acid molecule in which one or more components of the nucleic acid (i.e., sugar, base, and phosphate moiety) are different from naturally occurring components. Compared with naturally occurring oligonucleotides based on ribonucleotides or deoxyribonucleotides, such molecules have at least one modified internucleoside bond and / or at least one sugar modification and / or at least one base modification. The modified internucleoside bond indicates that there is a phosphodiester that is not a naturally occurring modified form in RNA and DNA. Examples of internucleoside bond modifications are and particularly include phosphoramide, phosphorodiamidate, thiophosphate, dithiophosphate, H-phosphonate, methylphosphonate, and methylthiophosphate. Sugar modification means that there is a modified form of the ribosyl moiety (i.e., furanosyl moiety) as naturally occurring in RNA and DNA, such as bicyclic sugars, tetrahydropyrans, morpholinos, 2'-modified sugars, 3'-modified sugars, 4'-modified sugars, 5'-modified sugars, and 4'-substituted sugars. Examples of suitable sugar modifications are known to those skilled in the art and include, but are not limited to, 2'-O-modified RNA nucleotide residues, such as: 2'-O-alkyl or 2'-O-(substituted)alkyl, e.g., 2'-O-methyl, 2'-O-(2-cyanoethyl), 2'-O-(2-methoxy)ethyl (2'-MOE), 2'-O-(2-thiomethyl)ethyl; 2'-O-(haloalkoxy)methyl, e.g., 2'-O-(2-chloroethoxy)methyl (MCEM), 2'-O-(2,2-dichloroethoxymethyl (DCEM); 2'-O-alkoxycarbonyl, e.g., 2'-O-[2-(methoxycarbonyl)ethyl] (MOCE), 2'-O-[2-(N-methylcarbamoyl)ethyl] (MCE), 2'-O-[2-(N,N-dimethylcarbamoyl)ethyl] (DMCE), particularly 2'-O-methyl or 2'- O-(2-methoxy)ethyl (2'-MOE). Another important modification includes a sugar moiety modified by a bridged or bicyclic nucleic acid (BNA), such as the sugar moieties present in a locked nucleic acid (LNA), a dimethylbenzene-LNA, α-L-LNA, β-D-LNA, cEt (2'-O, 4'-C constrained ethyl) LNA, cMOEt (2'-O, 4'-C constrained methoxyethyl) LNA, ethylene bridged nucleic acid (ENA), hexitol nucleic acid (ETNA), fluorinated HNA (F-HNA), pyranosyl-RNA (p-RNA), 3'-deoxypyranosyl-DNA (p-DNA); or other modified sugar moieties, such as morpholino (PMO), cationic morpholino (PMOPlus) or PMO-X. As used herein, the term "base modification" refers to the modification of naturally occurring bases (i.e., pyrimidine or purine bases) in RNA and / or DNA.Base modifications include, but are not limited to, modified forms of natural purine and pyrimidine bases (e.g., adenine, uracil, guanine, cytosine and thymine), such as hypoxanthine, pseudouracil, pseudothymine, 2-thiopyrimidine (e.g., 2-thiouracil, 2-thiothymine), 2,6-diaminopurine, 5-substituted pyrimidines (e.g., 5-halouracil, 5-methyluracil, 5-methylcytosine), 7-deazaguanine, 7-deazapurine, 7-aza-2,6-diaminopurine, 8-aza-7-deazaguanine, 8-aza-7-deazaadenine or 8-aza-7-deaza-2,6-diaminopurine. It is also contemplated that the oligonucleotide comprises more than one identical or different internucleoside linkage modification, sugar modification and / or base modification.

[0043] The term "adenine base editor" or "ABE" refers to a base editor that mediates the conversion of adenosine to guanosine (i.e., AT to GC) through an inosine intermediate. Many ABEs are known in the art, including but not limited to ABE7.10, ABE6.3, ABE7.8, and ABE7.9.

[0044] As used herein, the term "isolated polynucleotide" or "isolated nucleic acid sequence" refers to a nucleic acid that is substantially free of cellular material or culture medium when produced by recombinant DNA techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.

[0045] As used herein, the term "recombinant nucleic acid" or "engineered nucleic acid" refers to a nucleic acid or polynucleotide that does not exist in a biological organism. For example, a recombinant nucleic acid can be formed by laboratory genetic recombination methods (such as molecular cloning) to produce a sequence that does not exist in nature. Recombinant nucleic acids can also be produced by chemical synthesis or other known protocols for producing nucleic acids. Unless otherwise indicated, the definitions and embodiments described in this section and other sections are intended to apply to all embodiments and aspects of the application described herein, as those to which they apply as will be understood by those skilled in the art.

[0046] As used herein, the term "polypeptide" or "protein" describes an amino acid chain. The polypeptide or protein of the present disclosure may be a peptide, which generally describes an amino acid chain of 2 to about 30 amino acids. The term protein as used herein also describes an amino acid chain having more than 30 amino acids, and may be a fragment or domain of a protein or a full-length protein. In addition, as used herein, the term protein may refer to a linear amino acid chain, or it may refer to an amino acid chain that has been processed and folded into a functional protein. However, it should be understood that 30 is an arbitrary number with respect to distinguishing between peptides and proteins, and these terms may be used interchangeably for amino acid chains. The protein of the present disclosure may be obtained by isolating and purifying proteins from cells that naturally produce proteins, by enzymatic (e.g., proteolytic) cleavage, and / or by expressing nucleic acids encoding proteins or fragments of the present disclosure for recombinant. The protein and / or fragment of the present disclosure may also be obtained by chemical synthesis or other known schemes for producing proteins and fragments.

[0047] The term "isolated polypeptide" refers to a polypeptide that is substantially free of cellular material or culture medium when produced by recombinant DNA techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.

[0048] The term "vector" as used herein refers to a polynucleotide that can be used to deliver nucleic acid to the interior of a cell. In one embodiment, a vector is an expression vector comprising an expression control sequence (e.g., a promoter) operably linked to a nucleic acid to be expressed in a cell. Vectors known in the art include, but are not limited to, plasmids, bacteriophages, cosmids, and viruses.

[0049] The terms "recipient," "individual," "subject," "host," and "patient" are used interchangeably herein and refer to any mammalian subject, particularly a human, in need of diagnosis, treatment, or therapy.

[0050] As used herein, in some embodiments, the terms "treatment", "treating", and the like refer to the administration of an agent or the performance of a procedure for the purpose of obtaining an effect. The effect may be preventive in terms of completely or partially preventing a disease or its symptoms, and / or may be therapeutic in terms of affecting a partial or complete cure of a disease and / or symptoms of a disease. The term includes treating a disease or condition (e.g., inflammation) in a mammal, particularly a human, and includes: (a) preventing the occurrence of a disease or a symptom of a disease in a subject who may be susceptible to a disease (e.g., including a disease that may be associated with or caused by a primary disease) but has not yet been diagnosed with the disease; (b) inhibiting the disease, i.e., preventing its development; and (c) alleviating the disease, i.e., causing regression of the disease. The treatment or improvement of symptoms is based on one or more objective or subjective parameters; including the results of a doctor's examination. Therefore, the term "treatment" includes administering a compound or agent of the present invention to prevent, delay, alleviate, prevent or inhibit the development of symptoms or conditions associated with a disease (e.g., inflammation).

[0051] The term "therapeutic effect" refers to the reduction, elimination or prevention of a disease, a symptom of a disease or a side effect of a disease in a subject.

[0052] In the context of CAR-T cells, the term "signaling domain" or "intracellular signaling domain" refers to the intracellular domain of the CAR that transduces the activation signal. The signaling domain may be an effector domain that, when receiving an appropriate signal, can directly or indirectly promote a biological or physiological response in a cell. The effector domain can directly promote a cell response. The effector domain can also indirectly promote a cell response by associating with one or more other proteins (such as costimulatory domains) that promote cell response. The effector domain can provide activation of at least one function of the modified cell when combined with a cell marker expressed by a cancer cell. The activation of modified cells may include differentiation, proliferation and / or activation or one or more of other effector functions. In a specific embodiment, the effector domain may include an intracellular signaling component, including a T cell receptor and a costimulatory domain, which may include a cytoplasmic sequence from a co-receptor or a costimulatory molecule. The effector domain may include a receptor signaling domain, an intracellular signaling component (e.g., a cytoplasmic signaling sequence), a costimulatory domain, or a combination thereof. Exemplary effector domains include signaling and stimulatory domains selected from the group consisting of 4-1BB (CD137), CARD11, CD3γ, CD3δ, CD3ε, CD3ζ, CD27, CD28, CD79A, CD79B, DAP10, FcRa, FcRp (FcsRIb), FcRy, Fyn, HVEM (LIGHTR), ICOS, LAG 3, LAT, Lck, LRP, NKG2D, NOTCH1, pTα, PTCH2, OX40, ROR2, Ryk, SLAMF1, Slp76, TCRα, TCRβ, TRIM, Wnt, Zap70, or any combination thereof.Exemplary effector domains include signaling and co-stimulatory domains selected from the group consisting of CD86, FcγRIla, DAP12, CD30, CD40, PD-1, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, a ligand that specifically binds to CD83, CDS, ICAM-1, GITR, BAFFR, SLAMF7, NKp80 (KLRF1), CD127, CD160, CD19, CD4, CD8α, CD8β, IL2Rβ, IL2Rγ, IL7Rα, ITGA4, VLA1, CD49a, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103, I TGAL, CD11a, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, ITGB7, TNFR2, TRANCE / RANKL, DNAM1(CD226), SLAMF4(CD244, 2B4), CD84, CD96(Tactile), CEACAM1, CR TAM, Ly9(CD229), PSGL1, CD100(SEMA4D), CD69, SLAMF6(NTB-A, Ly108), SLAM(CD150, IPO-3), BLAME(SLAMF8), SELPLG(CD162), LTBR, ​​GADS, PAG / Cbp, NKp44, NKp30 or NKp46.

[0053] In the context of a polypeptide or a domain of a polypeptide, the terms "is", "are", "is derived from" and "are derived from" refer to the amino acid sequence of the polypeptide or the domain of the polypeptide, and indicate that the amino acid sequence is identical to the native form of the polypeptide or the domain of the polypeptide, or is identical to a variant of the polypeptide or the domain of the polypeptide that is functionally indistinguishable from the native form of the polypeptide or the domain of the polypeptide.

[0054] As used herein, the term "immune cell" refers to any cell of the hematopoietic lineage involved in regulating an immune response to an antigen (e.g., an autoantigen). In various embodiments, the immune cell is, for example, a T cell, a B cell, a dendritic cell, a monocyte, a natural killer cell, a macrophage, a Langerhans cell, or a Kupffer cell. Preferred immune cells are T cells, such as CD8 positive T cells.

[0055] The term "recombinant" as used herein refers to a molecule or cell that is prepared, generated or produced by recombinant means, such as genetic engineering or molecular biotechnology. Recombinant molecules do not occur naturally in nature. For example, a recombinant polypeptide or recombinant nucleic acid refers to a polypeptide (or nucleic acid) that has been modified or placed in another environment (e.g., by cloning it behind certain regulatory elements (such as a promoter)) compared to the corresponding wild-type molecule. Recombinant immune cells (such as recombinant T cells) contain recombinant polypeptides and / or recombinant nucleic acids.

[0056] The term "cancer" as used herein, in its broadest sense, refers to a disease in which abnormal cells divide without control.

[0057] As used herein, the term "blood cancer" refers to cancer of the blood, and includes leukemia, lymphoma, and myeloma, etc. "Leukemia" refers to a blood cancer in which too many white blood cells that are ineffective in fighting infection are produced, thereby squeezing out other parts of the blood, such as platelets and red blood cells. It should be understood that leukemia cases are divided into acute or chronic. As a non-limiting example, some forms of leukemia include acute lymphocytic leukemia (ALL); acute myeloid leukemia (AML); chronic lymphocytic leukemia (CLL); chronic myeloid leukemia (CML); myeloproliferative disorders / neoplasms (MPDS); and myelodysplastic syndrome. "Lymphoma" may refer to Hodgkin's lymphoma, indolent and aggressive non-Hodgkin's lymphoma, Burkitt's lymphoma, and follicular lymphoma (small cells and large cells), etc. Myeloma may refer to multiple myeloma (MM), giant cell myeloma, heavy chain myeloma, and light chain myeloma or Bence-Jones myeloma.

[0058] As used herein, the term "solid tumor" or "solid cancer" refers to a tumor that does not typically contain cysts or fluid areas. As used herein, solid tumors include sarcomas and carcinomas, such as breast tumors, ovarian tumors, stomach tumors, lung tumors, pancreatic tumors, prostate tumors, melanoma tumors, colorectal tumors, lung tumors, head and neck tumors, bladder tumors, esophageal tumors, liver tumors, thyroid tumors, non-small cell lung cancer (NSCLC) and kidney tumors. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] Figure 1 Shown are the expression levels of miR155 and seven SNPs of miR155 compared with the housekeeping gene U6.

[0060] Figure 2 It was shown that SNP4 triggered STAT5 signaling significantly more strongly than wild-type miR155 and control miR.

[0061] Figure 3Compared with the control miR, the expression of miR155 or SNP4 increased the expression of CD8 + Downregulation (panel A) and upregulation (panel B) of the most deregulated genes in T cells.

[0062] Figure 4 The effect of expression of various miRs on T cell metabolic fitness is shown. Extracellular acidification rate (ECAR; left) and oxygen consumption rate (OCR; right) were measured. Arrows indicate the time of addition of the corresponding compounds.

[0063] Figure 5 The cytotoxic potential of CAR T cells upon expression of various miRs is shown.

[0064] Figure 6 The functions induced by various miRs in T cells were summarized. The multifunctional strength index was calculated.

[0065] Figure 7 Shown in more detail are those combinations of cytokines produced simultaneously by subsets of cells in CD19-specific CAR T cells overexpressing control miR, miR-155, and SNP4. The color intensity shows the percentage of the subset in each sample.

[0066] Figure 8 CAR T cell-mediated anti-tumor immunity in mice according to the expression of various miRs is shown. DETAILED DESCRIPTION

[0067] Nucleic acid encoding SNP 4 (rs377265631)

[0068] The present invention is based on the following surprising discovery: a specific SNP of miR155 (referred to herein as SNP4) is beneficial in anti-cancer therapy. SNP4 can enhance the anti-tumor activity of other components (such as CAR-T cells). The expression of SNP4 in such cells leads to the enhancement of anti-tumor immunity.

[0069] In certain embodiments, the present disclosure relates to a recombinant nucleic acid comprising a nucleic acid sequence of SEQ ID No.2 or SEQ ID No.5 for use in medicine. The recombinant nucleic acid may be a precursor of mature miR SNP4, i.e., a nucleic acid comprising a nucleic acid sequence of SEQ ID No.5. The precursor miR is processed by cells to produce mature miR. Therefore, in certain embodiments, the present disclosure relates to a recombinant nucleic acid comprising a nucleic acid sequence of SEQ ID No.5 for use in medicine. In other embodiments, the present disclosure relates to a recombinant nucleic acid consisting of a nucleic acid sequence of SEQ ID No.5 for use in medicine. Alternatively, the recombinant nucleic acid may be a mature miR SNP4, i.e., a nucleic acid comprising a nucleic acid sequence of SEQ ID No.2. Therefore, in certain embodiments, the present disclosure relates to a recombinant nucleic acid comprising a nucleic acid sequence of SEQ ID No.2 for use in medicine. In other embodiments, the present disclosure relates to a recombinant nucleic acid consisting of a nucleic acid sequence of SEQ ID No.2 for use in medicine.

[0070] In certain embodiments of the present disclosure, the nucleic acid molecule comprising or consisting of the nucleic acid sequence of SEQ ID No.2 or SEQ ID No.5 is DNA. In other embodiments of the present disclosure, the nucleic acid molecule comprising or consisting of the nucleic acid sequence of SEQ ID No.2 or SEQ ID No.5 is RNA. In a preferred embodiment, the nucleic acid molecule comprising or consisting of the nucleic acid sequence of SEQ ID No.2 or SEQ ID No.5 is DNA. In certain embodiments of the present disclosure, the nucleic acid molecule comprising or consisting of the nucleic acid sequence of SEQ ID No.2 or SEQ ID No.5 is a modified DNA. In certain embodiments of the present disclosure, the nucleic acid molecule comprising or consisting of the nucleic acid sequence of SEQ ID No.2 or SEQ ID No.5 is a modified RNA.

[0071] In yet other embodiments of the present disclosure, the nucleic acid molecule comprising or consisting of the nucleic acid sequence of SEQ ID No. 2 or SEQ ID No. 5 further contains a regulatory sequence, preferably 5' to the nucleic acid sequence encoding SNP4.

[0072] In certain embodiments of the present disclosure, a nucleic acid sequence comprising SEQ ID No.2 or SEQ ID No.5 or a nucleic acid molecule consisting thereof is integrated into the genome of a host cell. In order to integrate the nucleic acid into the genome, various techniques known to those skilled in the art are available. Such techniques include Crispr-Cas9 gene editing, and base editing or primer editing. For example, since SNP4 differs from miR155 by a single nucleotide exchange from A to G, the wild-type miR155 sequence can be directly converted to SNP4 via an adenine base editor.

[0073] In another embodiment of the present disclosure, a nucleic acid molecule comprising or consisting of a nucleic acid sequence of SEQ ID No. 2 or SEQ ID No. 5 is integrated into an extrachromosomal vehicle or vector, such as a plasmid. In yet another embodiment of the present disclosure, a nucleic acid molecule comprising or consisting of a nucleic acid sequence of SEQ ID No. 2 or SEQ ID No. 5 is administered to a cell as a free nucleic acid molecule. In such cases, the nucleic acid molecule may be administered together with an additional component for increasing the uptake and / or stability of the nucleic acid.

[0074] In certain embodiments of the present disclosure, a nucleic acid molecule comprising or consisting of a nucleic acid sequence of SEQ ID No. 2 or SEQ ID No. 5 is operably linked to a promoter.

[0075] In certain embodiments of the present disclosure, a nucleic acid molecule comprising or consisting of a nucleic acid sequence of SEQ ID No. 2 or SEQ ID No. 5 is encoded on an expression vector. In certain embodiments, the expression vector is a viral vector or a plasmid. In certain embodiments, the expression vector is a viral vector. In certain embodiments, the expression vector is a plasmid.

[0076] In certain embodiments of the present disclosure, the nucleic acid molecule comprising or consisting of the nucleic acid sequence of SEQ ID No.2 or SEQ ID No.5 is an isolated or purified nucleic acid. In certain embodiments of the present disclosure, the nucleic acid molecule comprising or consisting of the nucleic acid sequence of SEQ ID No.2 or SEQ ID No.5 is an isolated nucleic acid. In certain embodiments of the present disclosure, the nucleic acid molecule comprising or consisting of the nucleic acid sequence of SEQ ID No.2 or SEQ ID No.5 is a purified nucleic acid.

[0077] Immune cells expressing SNP4

[0078] In certain embodiments, the present disclosure relates to recombinant immune cells expressing SNP4. The multifunctional beneficial effects of SNP4 are thus directly triggered in immune cells involved in fighting cancer tissue. Therefore, in certain embodiments, the present disclosure relates to recombinant immune cells expressing nucleic acids comprising nucleic acid sequences of SEQ ID No.2 or SEQ ID No.5. In certain embodiments, the present disclosure relates to recombinant immune cells expressing nucleic acids comprising nucleic acid sequences of SEQ ID No.2. In other embodiments, the present disclosure relates to recombinant immune cells expressing nucleic acids comprising nucleic acid sequences of SEQ ID No.5. In still other embodiments, the present disclosure relates to recombinant immune cells expressing nucleic acids consisting of nucleic acid sequences of SEQ ID No.2. In still other embodiments, the present disclosure relates to recombinant immune cells expressing nucleic acids consisting of nucleic acid sequences of SEQ ID No.5.

[0079] Immune cells can be any cells of the hematopoietic lineage that participate in regulating immune responses to antigens. Certain preferred immune cells are T cells. Therefore, in certain embodiments, the present disclosure relates to recombinant T cells expressing nucleic acids comprising nucleic acid sequences of SEQ ID No.2 or SEQ ID No.5. In certain embodiments, the present disclosure relates to recombinant T cells expressing nucleic acids comprising nucleic acid sequences of SEQ ID No.2. In other embodiments, the present disclosure relates to recombinant T cells expressing nucleic acids comprising nucleic acid sequences of SEQ ID No.5. In yet other embodiments, the present disclosure relates to recombinant T cells expressing nucleic acids consisting of nucleic acid sequences of SEQ ID No.2. In yet other embodiments, the present disclosure relates to recombinant T cells expressing nucleic acids consisting of nucleic acid sequences of SEQ ID No.5.

[0080] In certain preferred embodiments, the T cell is a T cell that is positive for the T cell marker CD8. Therefore, in certain embodiments, the present disclosure relates to recombinant CD8-positive T cells expressing a nucleic acid comprising a nucleic acid sequence of SEQ ID No.2 or SEQ ID No.5. In certain embodiments, the present disclosure relates to recombinant CD8-positive T cells expressing a nucleic acid comprising a nucleic acid sequence of SEQ ID No.2. In other embodiments, the present disclosure relates to recombinant CD8-positive T cells expressing a nucleic acid comprising a nucleic acid sequence of SEQ ID No.5. In yet other embodiments, the present disclosure relates to recombinant CD8-positive T cells expressing a nucleic acid consisting of a nucleic acid sequence of SEQ ID No.2. In yet other embodiments, the present disclosure relates to CD8-positive recombinant T cells expressing a nucleic acid consisting of a nucleic acid sequence of SEQID No.5. In certain embodiments, the CD8-positive T cells are tumor infiltrating lymphocytes (TILs) or peripheral blood lymphocytes (PBLs) isolated from patients with cancer.

[0081] Immune cells expressing SNP4 can also express additional recombinant proteins or polypeptides. For example, immune cells expressing SNP4 can also express CAR. Therefore, in certain preferred embodiments, the present disclosure relates to recombinant CAR-T cells expressing nucleic acids comprising nucleic acid sequences of SEQ ID No.2 or SEQ ID No.5. In certain embodiments, the present disclosure relates to recombinant CAR-T cells expressing nucleic acids comprising nucleic acid sequences of SEQ ID No.2. In other embodiments, the present disclosure relates to recombinant CAR-T cells expressing nucleic acids comprising nucleic acid sequences of SEQ ID No.5. In yet other embodiments, the present disclosure relates to recombinant CAR-T cells expressing nucleic acids consisting of nucleic acid sequences of SEQ ID No.2. In yet other embodiments, the present disclosure relates to recombinant CAR-T cells expressing nucleic acids consisting of nucleic acid sequences of SEQ ID No.5.

[0082] In other embodiments, immune cells expressing SNP4 may also express T cell receptors. Therefore, in certain preferred embodiments, the present disclosure relates to recombinant T cells expressing T cell receptors and nucleic acids comprising the nucleic acid sequence of SEQ ID No.2 or SEQ ID No.5. In certain embodiments, the present disclosure relates to recombinant T cells expressing T cell receptors and nucleic acids comprising the nucleic acid sequence of SEQ ID No.2. In other embodiments, the present disclosure relates to recombinant T cells expressing T cell receptors and nucleic acids comprising the nucleic acid sequence of SEQ ID No.5. In still other embodiments, the present disclosure relates to recombinant T cells expressing T cell receptors and nucleic acid sequences of SEQID No.2. In still other embodiments, the present disclosure relates to recombinant T cells expressing T cell receptors and nucleic acid sequences of SEQID No.5.

[0083] In certain embodiments, the immune cell expressing the nucleic acid comprising the nucleic acid sequence of SEQ ID No. 2 or SEQ ID No. 5 is located in the coding region of a chimeric antigen receptor or a T cell receptor, such as within the intracellular portion of a chimeric antigen receptor or a T cell receptor. In certain embodiments, the chimeric antigen receptor or the T cell receptor is specific for a cancer antigen.

[0084] In certain embodiments of the present disclosure, the immune cell is an isolated or purified immune cell. In certain embodiments, the immune cell is an isolated immune cell. In certain embodiments, the immune cell is a purified immune cell. In certain embodiments, the immune cell is a human immune cell.

[0085] In certain embodiments, the disclosure relates to a population of cells comprising at least one immune cell described herein. In certain embodiments, the disclosure relates to a composition comprising at least one immune cell described herein and a pharmaceutically acceptable carrier.

[0086] Therapeutic Uses

[0087] The expression of SNP4 causes beneficial effects in anticancer therapy. The expression of SNP4 also leads to enhanced anti-tumor activity of other components (such as CAR-T cells). Therefore, in certain embodiments, the present disclosure relates to the recombinant nucleic acid of the present disclosure for use in the treatment of cancer. In other embodiments, the present disclosure relates to a recombinant nucleic acid comprising a nucleic acid sequence of SEQ ID No.2 or SEQ ID No.5 for use in the treatment of cancer.

[0088] Various types of cancers, such as blood cancers or solid cancers, can be treated with the inventive concepts disclosed herein. Therefore, in certain embodiments, the present disclosure relates to the recombinant nucleic acids of the present disclosure for use in treating blood cancers. In other embodiments, the present disclosure relates to recombinant nucleic acids comprising a nucleic acid sequence of SEQ ID No.2 or SEQ ID No.5 for use in treating blood cancers. In other embodiments, the present disclosure relates to recombinant nucleic acids of the present disclosure for use in treating solid cancers. In other embodiments, the present disclosure relates to recombinant nucleic acids comprising a nucleic acid sequence of SEQ ID No.2 or SEQ ID No.5 for use in treating solid cancers. In other embodiments, the present disclosure relates to recombinant nucleic acids comprising a nucleic acid sequence of SEQ ID No.2 or SEQ ID No.5 for use in treating melanoma. In other embodiments, the present disclosure relates to recombinant nucleic acids comprising a nucleic acid sequence of SEQ ID No.2 or SEQ ID No.5 for use in treating cervical cancer. In certain embodiments, the cervical cancer is HPV-related cervical cancer. In other embodiments, the present disclosure relates to recombinant nucleic acids comprising a nucleic acid sequence of SEQ ID No.2 or SEQ ID No.5 for use in treating HPV-related cancers. In other embodiments, the present disclosure relates to a recombinant nucleic acid comprising a nucleic acid sequence of SEQ ID No. 2 or SEQ ID No. 5 for use in treating acute lymphoblastic leukemia (ALL). In other embodiments, the present disclosure relates to a recombinant nucleic acid comprising a nucleic acid sequence of SEQ ID No. 2 or SEQ ID No. 5 for use in treating sarcoma. In other embodiments, the present disclosure relates to a recombinant nucleic acid comprising a nucleic acid sequence of SEQ ID No. 2 or SEQ ID No. 5 for use in treating non-small cell lung cancer (NSCLC).

[0089] In certain embodiments, the present disclosure relates to a method of reducing tumor size in a mammal, the method comprising administering to the mammal a recombinant nucleic acid comprising the nucleic acid sequence of SEQ ID No. 2 or SEQ ID No. 5 in an amount effective to reduce tumor size in the mammal.

[0090] In certain embodiments, the disclosure relates to a method of reducing tumor size in a mammal, the method comprising administering to the mammal a recombinant immune cell comprising a nucleic acid of SEQ ID No. 2 or SEQ ID No. 5 in an amount effective to reduce tumor size in the mammal. In certain embodiments, the immune cell is autologous to the mammal. In other embodiments, the immune cell is allogeneic to the mammal.

[0091] In certain embodiments, the present disclosure relates to a method for increasing T cell-mediated immunity in a subject suffering from a disease state, the method comprising: isolating a population of immune cells from the subject; introducing a nucleic acid molecule encoding a chimeric antigen receptor or a T cell receptor and a nucleic acid comprising a nucleic acid sequence of SEQ ID No. 2 or SEQ ID No. 5 into the isolated immune cells; and reintroducing the immune cells into the subject.

[0092] In certain embodiments, the disclosure relates to a method for increasing CD8+T cell-mediated immunity in a subject with a disease state, the method comprising: isolating a population of immune cells of a subject; introducing a nucleic acid molecule encoding a SNP4 transcript into an isolated immune cell; and reintroducing the immune cell into the subject. In certain embodiments, the nucleic acid is introduced into the immune cell by transduction or transfection. In certain embodiments, the immune cell is autologous to a mammal. In certain embodiments, the immune cell is isolated from the blood of a subject.

[0093] In certain embodiments, the disclosure relates to recombinant immune cells, cell populations or compositions according to the disclosure for use in medicine. In certain embodiments, the use in medicine is for use in the treatment of cancer. In certain embodiments, the cancer is melanoma, NSCLC, sarcoma or HPV-related cancer.

[0094] Example

[0095] Example 1: Materials and Methods

[0096] Ethics Statement

[0097] Peripheral blood mononuclear cells for T cell enrichment were isolated from the peripheral blood of healthy donors. Immune cells were collected from these donors in compliance with the Declaration of Helsinki after ethical approval by the local ethics committee (National Institutes of Health Clinical Center, reference number NCT00001846 or University of Regensburg, reference number 20-2040-101) and written informed consent.

[0098] Peripheral blood mononuclear cell isolation and blood lymphocyte pre-enrichment

[0099] To isolate T cells from human blood, a leukocyte reduction chamber was used. The blood was first diluted with PBS and the resulting blood and PBS mixture was divided into four parts and washed with equal amounts of Ficoll-Paque TMPlus (Cytiva, Sweden). The samples were centrifuged at 700×g for 20 min at room temperature with the acceleration set to 9 and the brake set to 0. The PBMC layer was separated and washed twice with PBS by centrifugation at 300×g for 10 min. The samples were centrifuged with EasySep according to the manufacturer's protocol. TM Human Naive CD8+ T Cell Isolation Kit II is used to enrich naive CD8+ T cells.

[0100] CD8 overexpression of miRNA + Generation of T cells

[0101] To generate T cells overexpressing miRNA, EasySep was used according to the manufacturer's protocol. TM Naive human CD8+ T cells were enriched using the Human Naive CD8+ T Cell Isolation Kit II (Stemcell Technologies). Negatively enriched naive human CD8+ T cells were cultured in AIM V medium using aCD3 / CD28 Dynabeads (Thermo Fisher Scientific). + Cells were activated for two days in AIM V medium supplemented with 5% FBS (Cytiva), 100 U / ml penicillin, 100 μg / ml streptomycin, 2 mM Glutamax, 10 mM HEPES (Thermo Fisher Scientific) and 40 IU / ml IL-2 (Miltenyi biotec). To generate cells overexpressing miRNAs, activated cells were transduced with gamma retroviral vectors overexpressing control miR, miR-155 or SNP4 and NGFR (CD271) selection markers. After transduction, cells were cultured in 300 IU / mL IL-2 AIM V medium for 7 days. CD271 EasySep TM Transduced cells were enriched using the Human CD271 Positive Selection Kit II (StemCell Technologies).

[0102] CD19-specific CAR CD8 overexpressing miRNA + Generation of T cells

[0103] To generate CD19-specific CAR T cells overexpressing miRNA, cells were enriched and activated as described above. Two days after activation, cells were co-transduced with a γ-retroviral vector (J Immunother. 2009 Sep; 32 (7): 689-702) overexpressing CD19-CAR constructs and a γ-retroviral vector overexpressing control miR, miR-155 or SNP4 and NGFR selection markers. The transduced cells were cultured in AIMV complete medium supplemented with 300 IU / ml IL-2. CD271 EasySep TMTransduced cells were enriched using the Human CD271 Positive Selection Kit II (StemCell Technologies).

[0104] Mouse

[0105] Animal studies were performed under protocols approved by the NCI Bethesda Animal Care and Use Committee. NOD scidγ, NOD.Cg-Prkdcscid Il2rgtm1Wjl / SzJ (NSG) mice were purchased from Jackson Laboratory. Two million NALM6-GL were injected IV, and 7.5 × 10 5 CD19-specific CAR CD8 overexpressing control miR, miR-155, or SNP4 + T cells. Recombinant human IL-15 (NCI) was injected intraperitoneally every other day (1 μg per mouse). Tumor burden was measured using Xenogen IVIS Lumina (Caliper Life Sciences). NSG mice were injected intraperitoneally with 3 mg D-luciferin (Caliper Life Sciences), and 4 minutes after injection, anesthetized mice were imaged at an exposure time of 30 seconds. The bioluminescent signal (in photons / s / cm2) of each mouse was analyzed using Living Image Version 4.1 software (Caliper Life Sciences). 2 / sr).

[0106] Cell lines

[0107] NALM6-GL (acute lymphoblastic leukemia cell line stably transfected with green fluorescent protein and luciferase) and CD19-K562 (chronic myeloid leukemia cells stably expressing CD19 antigen; J Immunother. 2009 Sep; 32(7): 689-702) were cultured in RPMI 1640 medium supplemented with 10% heat-inactivated fetal bovine serum (Cytiva), 100 U / mL penicillin, 100 μg / mL streptomycin, 2 mM glutamax, and 1 mM sodium pyruvate (Thermo Fisher Scientific).

[0108] Flow cytometry

[0109] Cells were filtered using a 40 μm filter unit and analyzed on a BD FACSymphony TM BD FACSCelesta TM or BD FACSFusion TMCells were acquired on a flow cytometer (both from Becton Dickinson, Franklin Lakes / NJ, USA). BD CS&T beads were used to verify the machine function. AbC staining with the corresponding antibodies was used. TM Fluorescence spillover compensation was performed using the Total Antibody Compensation Bead Kit (Thermo Fisher Scientific). TM (Version 10.6.2) to analyze flow cytometry data.

[0110] Samples were stained in FACS buffer (1% FCS in PBS) in 5 ml polystyrene tubes or 96-well plates. TM Fixable dead cell stain (Thermo Fisher Scientific) was used to distinguish dead cells. The following antibodies were used for surface staining of human CD8 T cell samples: anti-CD3 (SK7), anti-CD8 (SK1), anti-NGFR (ME20.4), anti-CD45RA (MEM-56), anti-CD45RO (UCHL1), anti-CD62L (DREG-56), anti-CCR7 (150503), anti-CD25 (BC96), pStat5 (SRBCZX), and anti-CD19 CAR (KIP-1).

[0111] Example 2: Overexpression of miR155 SNP4 in human CD8-positive T cells

[0112] In humans, CD8 + The expression of miR155 and multiple SNPs of miR155 were tested in T cells (enriched and transduced as described in Example 1) after transduction of human CD8 T cells with gamma-retroviral vectors expressing control miR, miR155 or SNP4. The SNPs analyzed are shown in the following table:

[0113] Table 2 (mature miRs are underlined; nucleic acid exchange is indicated in bold italics):

[0114]

[0115] Expression levels were normalized to U6 (a common housekeeping noncoding RNA). To quantify miR-155 and U6, we isolated total RNA containing small RNAs from cells using the RNeasy Plus Mini Kit (Qiagen). cDNA was synthesized using the miRCURY LNA RT Kit (Qiagen). miRNA Green PCR assay (Qiagen) was used for qPCR. We used the hsa-miR-155-5p miRCURY LNA primer set to quantify miR155 and the hsa-6-snRNA miRCURY LNA primer set to quantify U6.

[0116] The results are shown in Figure 1 Among all the SNPs tested, SNP4 showed the highest expression level. The average expression level of SNP4 was within the range of wild-type miR155, but SNP4 showed a high degree of variability in expression, especially at higher expression levels. This finding prompted us to further investigate SNP4 and its role in CD8 T cell biology and anti-tumor function.

[0117] Example 3: SNP4 triggers stronger STAT5 signaling than wild-type miR155

[0118] Next, we investigated the effect of SNP4 on STAT5 signaling compared to wild-type miR155 and control miR. As control miR (Ctrl miR), a scrambled (missense) control miR (tebubio, France, catalog number 217CmiR0001-MR04) was used. The Ctrl miR has a scrambled miR sequence:

[0119]

[0120] To measure STAT5 phosphorylation, human naive CD8 T cells were transduced as described above. Seven days after transduction, cells were starved of cytokines for 24 hours, then cytokines were added back for 20 minutes before pStat5 levels were measured by flow cytometry.

[0121] The results are shown in Figure 2 Compared with wild-type miR155 and compared with control miR, SNP4 triggered significantly increased STAT5 phosphorylation. This suggests that SNP4 effectively increases T cell activation in response to cytokine stimulation.

[0122] Example 4: SNP4 downregulates miR155 target genes more robustly than wild-type miR155

[0123] Next, we studied the transcriptional changes caused by SNP4 compared to miR155 and control miR (SEQ ID No.12). As described above, human CD8+T cells overexpressing control miR, miR-155 or SNP4 were generated by transducing human naive CD8+T cells. Transduced cells were enriched on day 6. NGFR-enriched cells were lysed with RLT buffer (Qiagen) on day 9 (day 7 after transduction), lysates were frozen at -80°C, and stored until total RNA isolation for total RNA sequencing.

[0124] The most significantly deregulated genes were selected. The deregulated levels of these genes were Figure 3 Interestingly, the genes deregulated by SNP4 appear to be the same as those deregulated by miR155. Even more interestingly, for SNP4, the level of deregulation (downregulation, e.g. Figure 3 As seen in part A, and upregulated, such as Figure 3 This means that SNP4 causes the same transcriptional changes, but to a greater extent, further suggesting a potential beneficial role for SNP4 expression in cancer treatment.

[0125] Example 5: SNP4 enhances the metabolic adaptability of T cells

[0126] In this experiment, we tested the metabolic fitness of T cells after overexpression of wild-type miR155, SNP4, and a control miR. + T cells were activated, transduced and cultured. On day 6 after activation, CD271EasySep TM Transduced cells were enriched by human CD271 positive selection kit II (StemCell Technologies). At day 9 after activation, the metabolism of NGFR-enriched cells was studied by Agilent Seahorse XF glycolysis stress test (GST) and mitochondrial stress test (MST). The basal medium was prepared by supplementing serum-free DMEM medium with 143mM NaCl, 3mg / l phenol red and then adjusting the pH to 7.35. For GST experiments, T cells were resuspended in basal medium supplemented with 2mM L-glutamine. For MST, the test cells were resuspended in basal medium supplemented with 1mM sodium pyruvate and 25mM glucose.

[0127] In the GST experiment, the transduced CD8 + T cells were treated with 8 mM glucose and then Figure 4) were treated with 3.9 μM oligomycin and 122 mM 2DG at the time points indicated on the graph. In the MST experiment, cells were treated with 3.75 μM oligomycin and then Figure 4 ) were treated with 0.35 μM FCCP and 1.22 μM rotenone plus 1.22 μM antimycin A at the indicated time points ( Figure 4 The extracellular acidification rate (ECAR) and oxygen consumption rate (OCR) were measured respectively.

[0128] The results are shown in Figure 4 In line with their enhanced effector functions, cells overexpressing wt miR-155 or SNP4 were more glycolytic than control cells. Interestingly, cells overexpressing SNP4 had higher oxygen consumption rates compared with the other two cell types, suggesting their higher ability to generate energy under conditions of increased stress. Together, these data confirm the metabolic advantage of T cells expressing SNP4.

[0129] Example 6: SNP4-engineered CAR T cells exhibit enhanced cytotoxic function

[0130] In this experiment, we tested whether SNP4 could also enhance the cytotoxic potential of CD19-specific CAR T cells. CAR T cells were engineered to express miR155, SNP4, or a control miR as described above. Six days after activation, CD271 EasySep TM NGFR-transduced cells were enriched using the Human CD271 Positive Selection Kit II (StemCell Technologies). On day 9 after activation, miRNA-overexpressing CAR T cells were incubated with Nalm6-GL cells at an E:T ratio of 1:20 and analyzed by the Incucyte Live Cell Analysis System (Sartorius).

[0131] The results are shown in Figure 5 In. Nalm6-GL cells co-incubated with untransduced cells continued to grow, as indicated by increased GFP intensity. The GFP intensity of cells co-incubated with T cells transfected with CAR constructs decreased. CD19-specific CAR T cells expressing SNP4 showed significantly stronger cytotoxicity compared to CD19-specific CAR T cells expressing wild-type miR155 or control miR.

[0132] This experiment demonstrated that SNP4 can enhance the cytotoxic function of anticancer agents such as CAR-expressing T cells.

[0133] Example 7: SNP4-engineered CAR T cells exhibit enhanced multifunctionality

[0134] In this experiment, the polyfunctionality of CAR T cells overexpressing miRNA was tested. Cells were transduced as described above. On day 6 after activation, CD271 EasySep TM The cells were enriched using the Human CD271 Positive Selection Kit II (StemCell Technologies). On day 9 after activation, the cells were incubated with CD19-K562 target cells for 16 h. After 16 h, target cells were depleted by CD235a magnetic labeling (Miltenyi biotec) and T cells were analyzed by IsoLight technology.

[0135] Figure 6 A bar graph is shown summarizing the individual functions triggered by the various constructs by means of a multifunctional intensity index, which is calculated by multiplying the mean fluorescence intensity of the secreted cytokine by the percentage of multifunctional cells. CAR T cells expressing miR155 and SNP4 triggered a strongly increased multifunctionality compared to CAR T cells expressing a control miR. CAR T cells expressing SNP4 exhibited the highest PSI. Figure 7 The combination of cytokines produced simultaneously by cell subsets present in three groups of CD19-specific CAR T cells is shown. Overexpression of SNP4 resulted in CD19-specific CAR T cells with the highest polyfunctionality, resulting in the simultaneous production of up to eight different cytokines.

[0136] In conclusion, this experiment confirms the beneficial function of T cells expressing SNP4. It also shows that this is mainly a stimulatory effect triggered by SNP4.

[0137] Example 8: SNP4 further enhances CD8 + CAR T cell anti-tumor immunity

[0138] In this experiment, we tested whether SNP4 could enhance CAR T cell anti-tumor immunity in mice. + T cells were co-transduced with a gamma-retroviral vector overexpressing CD19-CAR and a gamma-retroviral vector overexpressing a control miR, miR-155, or SNP4 and NGFR selection markers. Seven days after transduction, CD271 EasySep TM NGFR-transduced cells were enriched using the Human CD271 Positive Selection Kit II (StemCell Technologies). Three days after the intravenous injection of 2 million NALM6-GL leukemia cells, 750,000 99% NGFR / 70% CD19-specific CD8 + CAR cells, and 1 μg of rhIL-15 cytokine support was administered intraperitoneally every other day during the experiment.

[0139] The results are shown in Figure 8 Fifteen days after administration, all untreated mice had died, while all three CAR T cell types mediated a strong anti-tumor response (as shown by a reduction in bioluminescent signals derived from tumor cells). After 35 days, mice implanted with CAR T cells expressing miR155 and SNP4 showed a significant reduction in cancer cells, with the reduction being particularly pronounced in SNP4 mice. After 65 days, the effect was even more pronounced, and the effect on cancer cells was strongly visible between miR155 mice and SNP4 mice.

Claims

1. A recombinant immune cell expressing the nucleic acid of SEQ ID No. 2 or SEQ ID No. 5 for use in medicine.

2. The recombinant immune cell according to claim 1, wherein The nucleic acid is operably linked to a promoter.

3. The recombinant immune cell according to claim 1 or 2, wherein The recombinant nucleic acid is encoded on an expression vector, preferably a viral vector or a plasmid.

4. The recombinant immune cell according to claim 3, wherein A high level of expression of the nucleic acid of SEQ ID No. 2 or SEQ ID No. 5 is triggered in the expression vector.

5. The recombinant immune cell according to any one of claims 1 to 4, wherein The immune cell further comprises a nucleic acid encoding a chimeric antigen receptor or a T cell receptor.

6. The recombinant immune cell according to claim 5, wherein The nucleic acid comprising the nucleic acid sequence of SEQ ID No. 2 or SEQ ID No. 5 is located within the coding region of the chimeric antigen receptor or the T cell receptor, preferably within the intracellular part of the chimeric antigen receptor or the T cell receptor.

7. The recombinant immune cell according to claim 5 or 6, wherein The chimeric antigen receptor or the T cell receptor is specific for a cancer antigen.

8. The recombinant immune cell according to any one of claims 1 to 7, wherein The use in medicine is use in the treatment of cancer, preferably the treatment of melanoma, NSCLC, sarcoma or HPV-related cancer.

9. The recombinant immune cell according to any one of claims 1 to 8, wherein The recombinant immune cells are T cells isolated from a patient suffering from cancer, preferably CD8-positive T cells, and more preferably tumor-infiltrating lymphocytes (TIL) or peripheral blood lymphocytes (PBL).

10. The recombinant immune cell according to any one of claims 1 to 9, wherein The immune cells are isolated or purified immune cells, preferably isolated or purified human immune cells.

11. A cell population comprising at least one recombinant immune cell according to any one of claims 1 to 10.

12. A composition comprising at least one recombinant immune cell according to any one of claims 1 to 10 or the cell population according to claim 11 and a drug carrier.

Images