Nano antibody or antigen binding fragment aiming at porcine epidemic diarrhea virus and application of nano antibody or antigen binding fragment

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to a nano antibody or antigen binding fragment aiming at porcine epidemic diarrhea virus and application thereof. The nano antibody or the antigen binding fragment has excellent specificity and affinity to porcine epidemic diarrhea virus PEDV S protein.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a nano antibody or antigen-binding fragment targeting porcine epidemic diarrhea virus and an application thereof. Background Art

[0002] Porcine epidemic diarrhea (PED) is an acute, contact-transmitted enteric infectious disease of pigs caused by porcine epidemic diarrhea virus (PEDV). Clinical symptoms include watery diarrhea, vomiting, dehydration, metabolic acidosis, etc., and a high mortality rate. Pigs of all ages and breeds are susceptible, but there are large differences in clinical symptoms and mortality rates after infection among pigs of different ages. The morbidity and mortality rates are inversely proportional to the age of the pigs. As the age of the pigs increases, the morbidity and mortality rates gradually decrease. The disease is particularly harmful to suckling piglets, with an morbidity rate of 80% to 100% and a mortality rate of more than 90% for newborn piglets.

[0003] Sick pigs and infected pigs are the main sources of infection for the spread of the disease. The main transmission routes are oral and digestive tract transmission. The virus is directly transmitted or indirectly infected through direct contact or fecal-oral contact between healthy pigs and sick pigs. Semen and milk transmission are potential routes. The respiratory secretions discharged by sick pigs also have high levels of viruses. In farms with repeated epidemics and inadequate ventilation facilities, air transmission is also an influencing factor. Therefore, it is necessary to develop a product to prevent, diagnose or treat related diseases caused by porcine epidemic diarrhea virus infection.

[0004] Antibodies are proteins that can specifically recognize antigens. They can recognize and neutralize viruses by specifically recognizing viral envelope proteins, structural proteins or enzymes. They are currently one of the technical means for treating virus-related diseases. Therefore, the development of an antibody against porcine epidemic diarrhea virus is of great significance for the prevention, diagnosis or treatment of related diseases caused by porcine epidemic diarrhea virus infection. Summary of the invention

[0005] The present invention screens out a nano antibody or antigen-binding fragment against porcine epidemic diarrhea virus (PEDV), which has excellent specificity and affinity for porcine epidemic diarrhea virus PEDV S protein.

[0006] In order to achieve the above object, the present invention can adopt the following technical solutions:

[0007] On the one hand, the present invention provides a nanobody or antigen-binding fragment against porcine epidemic diarrhea virus (PEDV), the nanobody or antigen-binding fragment comprises CDR1, CDR2 and HCDR3, the amino acid sequence of CDR1 is shown in SEQ ID NO:1, the amino acid sequence of CDR2 is shown in SEQ ID NO:2, and the amino acid sequence of CDR3 is shown in SEQ ID NO:3.

[0008] Preferably, the above-mentioned Nanobody or antigen-binding fragment also includes a FR1 having at least 80% identity with the sequence shown in SEQ ID NO:4 and / or a FR2 having at least 80% identity with the sequence shown in SEQ ID NO:5 and / or a HFR3 having at least 80% identity with the sequence shown in SEQ ID NO:6 and / or a FR4 having at least 80% identity with the sequence shown in SEQ ID NO:7.

[0009] Preferably, the above-mentioned Nanobody or antigen-binding fragment comprises a variable region that has at least 70% identity with the sequence shown in SEQ ID NO:8.

[0010] Preferably, the above-mentioned Nanobody or antigen-binding fragment further comprises the CH2 region and CH3 region of mouse IgG1 subtype.

[0011] Preferably, the CH2 region comprises a sequence having at least 70% identity to the sequence shown in SEQ ID NO:9; and / or the CH3 region comprises a sequence having at least 70% identity to the sequence shown in SEQ ID NO:10.

[0012] On the other hand, the present invention provides any one of the following substances: (i) a polynucleotide molecule comprising a nucleotide sequence encoding a Nanobody or an antigen-binding fragment of the present invention; (ii) an expression vector comprising the polynucleotide molecule in (i); (iii) an engineered bacterium comprising the expression vector in (ii); (iv) a host cell comprising the expression vector in (ii); (v) a product for detecting porcine epidemic diarrhea virus, comprising the Nanobody or the antigen-binding fragment of the present invention or the polynucleotide molecule in (i) or the expression vector in (ii) or the engineered bacterium in (iii) or the engineered cell in (iv); (vi) a pharmaceutical composition comprising the Nanobody and / or the antigen-binding fragment of the present invention and / or the polynucleotide molecule in (i) or the expression vector in (ii) and / or the engineered bacterium in (iii) and / or the engineered cell in (iv); (vii) a pharmaceutical preparation comprising the Nanobody and / or the antigen-binding fragment of the present invention and / or the polynucleotide molecule in (i) and / or the expression vector in (ii) and / or the engineered bacterium in (iii) and / or the engineered cell in (iv) and / or the pharmaceutical composition in (vi).

[0013] Preferably, the pharmaceutical composition of the above substances is a bispecific antibody, a polyspecific antibody, an ADC or a fusion protein.

[0014] In another aspect, the present invention provides a use of the nanoantibody and / or antigen-binding fragment and / or the polynucleotide molecule in (i) and / or the expression vector in (ii) and / or the engineered bacteria in (iii) and / or the engineered cells in (iv) of the present invention in the preparation of a product for diagnosing porcine epidemic diarrhea virus infection.

[0015] In another aspect, the present invention provides a use of the nanoantibody and / or antigen-binding fragment and / or the polynucleotide molecule in (i) and / or the expression vector in (ii) and / or the engineered bacteria in (iii) and / or the engineered cells in (iv) of the present invention in the preparation of a medicament for preventing or treating porcine epidemic diarrhea virus infection.

[0016] Preferably, the porcine epidemic diarrhea virus infection disease is porcine epidemic diarrhea.

[0017] The beneficial effects of the present invention include: the nano-antibodies or antigen-binding fragments against porcine epidemic diarrhea virus (PEDV) provided by the present invention have excellent specificity and affinity for porcine epidemic diarrhea virus PEDV S protein. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The conditions for PCR amplification of PEDV S protein;

[0019] Figure 2 The purification of PEDV S protein by HisTrap Excel column;

[0020] Figure 3 The purification of PEDV S protein by HiLoad Superdex 200 10 / 300 gel chromatography column;

[0021] Figure 4 The SDS-PAGE protein identification gel was stained with Coomassie Brilliant Blue;

[0022] Figure 5 To identify the purified PEDV S protein by Western Blot;

[0023] Figure 6 Some PCR identification results of recombinant phages;

[0024] Figure 7 is the result of the amino sequence alignment of the Nanobody;

[0025] Figure 8 ELISA was used to verify the reactivity of prokaryotic expressed nanobodies;

[0026] Fig. 9 Western Blot identification of some prokaryotically expressed nanobodies;

[0027] Fig.10 For IFA identification of 18 nanobodies;

[0028] Fig.11 Flow cytometric identification of 18 nanobodies;

[0029] Fig.12 This is a virus microneutralization test of the nanobody 3Nb17;

[0030] Fig.13 SPR identification of nanobody 3Nb17. DETAILED DESCRIPTION

[0031] The examples are provided to better illustrate the present invention, but the present invention is not limited to the examples. Therefore, those skilled in the art may make non-essential improvements and adjustments to the implementation scheme according to the above invention content, which still fall within the protection scope of the present invention.

[0032] The terms used herein are only used to describe specific embodiments and are not intended to limit the present disclosure. Unless the context has a significantly different meaning, expressions in the singular include expressions in the plural. As used herein, it should be understood that terms such as "include", "have", "include" are intended to indicate the presence of features, numbers, operations, components, parts, elements, materials or combinations. The terms of the present invention are disclosed in the specification, and are not intended to exclude the possibility that one or more other features, numbers, operations, components, parts, elements, materials or combinations thereof may exist or may be added. As used herein, " / " may be interpreted as "and" or "or", depending on the circumstances.

[0033] In the present invention, the term "antigen-binding fragment" refers to antigen-binding fragments of antibodies and antibody analogs, which generally include at least part of the antigen-binding region or variable region of the parent antibody, such as one or more CDRs; antibody fragments retain at least some of the binding specificity of the parent antibody.

[0034] An embodiment of the present invention provides a nanobody or an antigen-binding fragment against porcine epidemic diarrhea virus (PEDV), the nanobody (hereinafter also referred to as 3Nb17) or the antigen-binding fragment comprises CDR1, CDR2 and HCDR3, the amino acid sequence of CDR1 is shown in SEQ ID NO: 1, the amino acid sequence of CDR2 is shown in SEQ ID NO: 2, and the amino acid sequence of CDR3 is shown in SEQ ID NO: 3.

[0035] It should be noted that the nanobodies in the present invention can be humanized antibodies or animal-derived antibodies, such as mouse-derived, rabbit-derived or camel-derived antibodies; in addition, the HCDR3 in the above-mentioned antibodies belongs to the hypervariable region of the heavy chain variable region, and its stability is weaker than that of HCDR1 and HCDR2.

[0036] In some specific examples, the above-mentioned nanoantibodies or antigen-binding fragments also include FR1 having at least 80% identity with the sequence shown in SEQ ID NO:4 and / or FR2 having at least 80% identity with the sequence shown in SEQ ID NO:5 and / or HFR3 having at least 80% identity with the sequence shown in SEQ ID NO:6 and / or FR4 having at least 80% identity with the sequence shown in SEQ ID NO:7.

[0037] It should be noted that the FR (FR1, FR2, FR3, FR4) of the above-mentioned nanoantibodies is a framework region, which is used to connect the CDR region and is relatively stable; in addition, the sequence of the FR region of the heavy chain in the above-mentioned antibody and the sequence of the CDR region can be arranged according to FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4, respectively constituting the heavy chain variable region of the above-mentioned two antibodies; in addition, the at least 80% identity in the present invention includes ≥80%, ≥85%, ≥90%, ≥95% or 100% identity, etc.

[0038] In some specific examples, the above-mentioned nanobody or antigen-binding fragment includes a variable region that has at least 70% identity with the sequence shown in SEQ ID NO:8.

[0039] It should be noted that the above-mentioned at least 70% identity refers to an identity ≥ 70%, such as 75%, 80%, 85%, 90%, 95% or 100%; of course, it should be understood that sequences with at least 70% identity have similar functions to the above-mentioned sequences.

[0040] In some specific examples, the above-mentioned nanobody or antigen-binding fragment also includes CH2 and CH3.

[0041] In some specific examples, the CH2 comprises a sequence having at least 70% identity with the sequence shown in SEQ ID NO:9; and / or CH3 comprises a sequence having at least 70% identity with the sequence shown in SEQ ID NO:10.

[0042] It should be noted that the nanobody or antigen-binding fragment of the present invention contains, in addition to the above-mentioned variable regions, CH2 and CH3, and the sources of CH2 and CH3 can be human or other animal sources (such as rabbit, pig and other animal sources).

[0043] It should also be noted that, as mentioned above, the above-mentioned at least 70% identity refers to an identity ≥ 70%, such as 75%, 80%, 85%, 90%, 95% or 100%; of course, it should be understood that sequences with at least 70% identity have similar functions to the above-mentioned sequences.

[0044] The present invention also provides any one of the following substances:

[0045] (i) a polynucleotide molecule comprising a nucleotide sequence encoding a Nanobody or an antigen-binding fragment of the invention; specifically, the polynucleotide molecule of the invention is obtained by translating the Nanobody or the antigen-binding fragment of the invention according to conventional methods; in addition, it may be a nucleotide sequence further modified from the sequence obtained after translation of the above amino acid sequence; the modification method is a nucleotide modification method known in the art to increase expression efficiency or for other purposes;

[0046] (ii) an expression vector, comprising the polynucleotide molecule in (i); specifically, the expression vector in the present invention can be selected from any one of a lentiviral expression vector, a retroviral expression vector, an adenoviral expression vector, an adeno-associated viral expression vector, a DNA vector, an RNA vector and a plasmid. The lentiviral vector can be selected from the following groups: human immunodeficiency virus 1 (HIV-1), human immunodeficiency virus 2 (HIV-2), visna-maedivirus (VMV), caprine arthritis-encephalitis virus (CAEV), equine infectious anemia virus (EIAV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV) and simian immunodeficiency virus (SIV);

[0047] (iii) engineered bacteria, including the expression vector in (ii); specifically, the engineered bacteria in the present invention refers to bacteria that can assist the above-mentioned expression vector in expression, such as Escherichia coli, and the Escherichia coli including the expression vector here refers to the Escherichia coli after the expression vector is transferred;

[0048] (iv) a host cell, including the expression vector in (ii); specifically, the host cell in the present invention refers to a cell that can assist the expression vector mentioned above in expression, such as a yeast cell;

[0049] (v) A product for detecting porcine epidemic diarrhea virus, comprising the Nanobody or antigen-binding fragment of the invention or the polynucleotide molecule in (i) or the expression vector in (ii) or the engineered bacteria in (iii) or the engineered cells in (iv); specifically, the Nanobody or antigen-binding fragment of the invention has a strong binding effect with the surface protein of porcine epidemic diarrhea virus, and a product for detecting porcine epidemic diarrhea virus can be prepared based on this; the product can be a detection reagent or a detection kit, such as a reagent or kit based on immunoblotting, or a reagent or kit based on immunoenzyme technology, etc.;

[0050] (vi) a pharmaceutical composition comprising the Nanobodies and / or antigen-binding fragments of the invention and / or the polynucleotide molecules of (i) or the expression vectors of (ii) and / or the engineered bacteria of (iii) and / or the engineered cells of (iv); specifically, as described above, based on the strong binding of the Nanobodies or antigen-binding fragments of the invention to the surface proteins of porcine epidemic diarrhea virus, a pharmaceutical composition for preventing or treating porcine epidemic diarrhea virus infection can be prepared; the pharmaceutical composition herein refers to a pharmaceutical composition composed of the Nanobodies or antigen-binding fragments of the invention in combination with other small molecule compounds, polypeptides, antibodies or proteins that can be effectively used to prevent or treat porcine epidemic diarrhea virus infection; such as bispecific antibodies or polyspecific antibodies combined with other antibodies, such as ADCs combined with small molecule compounds, and such as fusion proteins combined with other proteins; they can be selected and used according to the specific circumstances;

[0051] (vii) Pharmaceutical preparations, including the Nanobodies and / or antigen-binding fragments of the present invention and / or the polynucleotide molecules in (i) and / or the expression vectors in (ii) and / or the engineered bacteria in (iii) and / or the engineered cells in (iv) and / or the pharmaceutical compositions in (vi); specifically, the above-mentioned Nanobodies and / or antigen-binding fragments and the above-mentioned pharmaceutical compositions can be added with pharmaceutically acceptable carriers to prepare different dosage forms suitable for different clinical needs; the dosage forms can include sprays, oral liquids, tablets, atomizers, granules, capsules or ointments; of course, the choice of pharmaceutically acceptable carriers varies according to different dosage forms, and can be prepared according to methods known in the art.

[0052] The embodiments of the present invention also provide the use of the nanoantibodies and / or antigen-binding fragments and / or the polynucleotide molecules in (i) and / or the expression vectors in (ii) and / or the engineered bacteria in (iii) and / or the engineered cells in (iv) in the present invention in the preparation of products for diagnosing porcine epidemic diarrhea virus infection.

[0053] It should be noted that it should be understood that the detection of porcine epidemic diarrhea virus can be used for the diagnosis of porcine epidemic diarrhea virus infection diseases, that is, the product for detecting porcine epidemic diarrhea virus in the present invention is also suitable for the diagnosis of porcine epidemic diarrhea virus infection diseases, such as the diagnosis of porcine epidemic diarrhea; in addition, the product for detecting porcine epidemic diarrhea virus includes but is not limited to detection reagents, detection kits, reagent cards or microfluidic chips, etc.

[0054] The embodiments of the present invention also provide the use of the nanoantibody and / or antigen-binding fragment and / or the polynucleotide molecule in (i) and / or the expression vector in (ii) and / or the engineered bacteria in (iii) and / or the engineered cells in (iv) in the present invention in the preparation of a medicament for preventing or treating porcine epidemic diarrhea virus infection.

[0055] In some specific examples, the porcine epidemic diarrhea virus infection disease is porcine epidemic diarrhea.

[0056] In order to better understand the present invention, the content of the present invention is further explained below in conjunction with specific examples, but the content of the present invention is not limited to the following examples.

[0057] 1. Alpaca Immunity

[0058] (I) Preparation and purification of PEDV S protein

[0059] (1) Construction of pCAGGS-PEDV S gene recombinant plasmid and plasmid extraction

[0060] 1) Primer design: Based on the PEDV CH-HB2-2018 strain (GenBank No. MK606369) published on NCBI as a template, the PEDV S gene sequence was codon optimized, the Kozak sequence and human signal peptide were added to the N segment, the 8×His tag was added to the C segment, and EcoRⅠ and XhoⅠ restriction sites were added to the two segments. The gene was sent to the company for gene synthesis, and the pCAGGS-PEDV-S eukaryotic expression plasmid was constructed.

[0061] 2) PCR identification of plasmid: pCAGGS-PEDV-S plasmid was used as a template and PCR identification was performed using pCAGGS universal primers. The reaction system and amplification conditions are shown in Tables 1 and 2.

[0062] Table 1 PCR amplification reaction system

[0063]

[0064]

[0065] Table 2 PCR amplification reaction conditions

[0066]

[0067] The size of the amplified gene fragment is 4328 bp. Figure 1 As shown, the size of the amplified band is consistent with the expected target band size. Take 60ng of the vector and perform ligation transformation according to the pmol ratio of vector to target fragment of 1:3. Pick a single colony for sequencing, compare and analyze the sequencing results, and there is no base mutation. Glycerol bacteria are preserved and plasmids are extracted.

[0068] 3) Plasmid extraction: Inoculate the pCAGGS-PEDVS cloned bacterial solution into 200mL of LB liquid medium containing Amp resistance at a ratio of 1:1000, and culture it in a constant temperature shaker at 37℃ for 12-16h. Use an endotoxin-free plasmid extraction kit to extract the plasmid. Improve the experimental steps based on the instructions, pre-cool isopropanol at -80℃ for 30min, mix it with the plasmid extract, and place it at -20℃ for 1h to accelerate plasmid precipitation, which can significantly increase the amount of plasmid extraction. After measuring the plasmid concentration, freeze it at -20℃.

[0069] (2) Expression of PEDV S protein

[0070] HEK-293F cell culture flasks were placed in a constant temperature shaker at 37°C, 5% CO2, and 150-175 rpm. Cell counts were performed after 12 h, and the cell concentration was between 2.5 and 3.0 × 10 6 / mL for transfection; transfect 400mL of HEK-293F cells, dilute 400μg DNA with 150mM NaCl to a total volume of 10mL, and mix gently; dilute 2mL Sinofection transfection reagent with 150mM NaCl to a total volume of 10mL, and mix gently; let the diluted DNA and transfection reagent stand separately for about 5min; gently mix the plasmid and transfection reagent, the total volume is 20mL, and stand at room temperature for 20min. Add the mixed solution drop by drop to the cell culture medium, gently shake the culture bottle while adding, and put it back on the shaker to continue culturing after shaking, and tie the bottle mouth (that is, no longer introduce CO2 into the cell bottle). Loosen the bottle mouth 24h after transfection to meet the dissolved oxygen and CO2 emission requirements for subsequent high-density cell growth, to prevent the pH value of the culture medium from being too low (the culture medium is yellow) due to CO2 accumulation, which affects cell growth.

[0071] 14 mL of SMS293-SUPI feed solution was added 24 h after transfection, and feed solution (14 mL) was added every 48 h thereafter. Samples were collected 7 days after transfection.

[0072] (3) Purification of PEDV S recombinant protein

[0073] The PEDV S recombinant protein was expressed using the HEK-293F mammalian cell expression system and purified using a HisTrap Excel column. Figure 2 The PEDV S protein was further purified using a HiLoad Superdex 200 10 / 300 gel chromatography column, as shown in Figure 3 The sample purified by molecular sieve was identified by SDS-PAGE protein identification gel. The monomer size of the target protein was estimated to be about 180 kDa. The SDS-PAGE protein identification gel was stained with Coomassie brilliant blue. After decolorization, a clear protein band was seen at 180 kDa, as shown in Figure 1. Figure 4 As shown, protein samples 6 to 9 were concentrated and replaced with 100 kDa protein concentrators. Figure 5 As shown, the purified PEDV S protein was identified by Western Blot using mouse Anti-His tag antibody, and the His tag was detected at 100 kDa, which is consistent with the expected size of the target protein; the details are as follows:

[0074] The HEK-293F cell culture fluid was collected 7 days after transfection, and centrifuged at 8000rpm for 1h in a vertical high-speed low-temperature centrifuge at 4℃, then the HEK-293F suspended cell expression supernatant was collected, and the supernatant was filtered by negative pressure suction through a 0.22μm filter membrane to remove cell debris; the column was first rinsed with deionized water filtered by negative pressure suction through a 0.22μm filter membrane at a flow rate of 2mL / min, and then equilibrated with buffer A (20mmol / L Tris-HCl, 150mmol / L NaCl, pH 8.0) at the same flow rate for 3 to 5 column volumes; the expression supernatant of the PEDVS recombinant protein was filtered by negative pressure suction and transferred to the his column, and the supernatant was passed through at 2mL / min. Be careful not to let bubbles enter during this process; the A pump and B pump of the protein purification instrument were quickly rinsed with water and buffer A at a flow rate of 10mL / min in turn, and then the flow rate was adjusted to 2mL / min, and the HisTrap was connected. Excel column, rinse the protein purification instrument with 100% buffer A until the UV value is flat; elute with buffer B containing 50mmol / L, 100mmol / L, 250mmol / L, and 500mmol / L imidazole concentrations in sequence, collect the eluate for SDS-PAGE detection, transfer the eluate to a protein concentration tube, concentrate and wash it with sterile PBS buffer three times, and after elution, select a suitable molecular sieve according to the molecular weight and protein amount to purify the PEDV S protein; Use of superdex 200 molecular sieve: Before installing the column, first set the maximum alarm pressure and flow rate on Akta, the column pressure of the large column is: column front pressure (ie system pressure) + 0.15MPa, flow rate: 0.5-1mL / min, column volume is 120mL.

[0075] Before purifying the protein, 40 mL of water should be passed through, and then 80 mL of buffer (PBS with pH 7.4) should be passed through. After the UV value curve is stable, the loop should be loaded. According to the volume of the concentrated protein, the appropriate loop (1 / 2 / 5 mL) should be selected. After 3 volumes of PBS are rinsed with a syringe, the protein should be sucked into the loop, and inject should be clicked. After PBS passes through 3 volumes of the loop, load should be clicked. The corresponding volume can be found in the molecular sieve list according to the molecular weight of the protein. Set peak collection: 5mAU 0.8 mL per tube. Put the collected protein on ice, select the appropriate concentration tube for liquid change after identification with SDS-PAGE protein gel, and identify the purified PEDV S protein with anti-his tag antibody by protein immunoblotting.

[0076] (II) Animal Immunization

[0077] Immunization procedure: Alpacas were immunized three times with purified PEDV S protein, each time with an interval of 15 days. One week before cell sorting, a booster immunization was performed once, and the alpacas were immunized a total of 4 times (as shown in Table 3).

[0078] Table 3 Mouse immunization program

[0079] Immunization times Immunization dose (μg / mouse) Immunization methods Adjuvant One Free 400 Subcutaneous injection at the back Freund's complete adjuvant Second exemption 400 Subcutaneous injection at the back Freund's incomplete adjuvant Three exemptions 400 Subcutaneous injection at the back Freund's incomplete adjuvant Strengthen immunity 400 Subcutaneous injection at the back Freund's incomplete adjuvant

[0080] Before flow cytometry sorting of specific B lymphocytes, 5 mL of blood was collected from the alpaca's inner thigh vein; placed in a 4°C refrigerator overnight, centrifuged at 12,000 rpm for 1 min, and serum was collected. ELISA test was performed to test the immune effect, and 2-fold dilution was used to verify the serum neutralization effect. The results are shown in Table 4. After the alpaca serum was diluted 1024000 times, its OD 450nm >cut-off value and P / N≥2.

[0081] Table 4 Mouse serum antibody titer detection

[0082]

[0083] II. Isolation of Alpaca PBMC and RNA Extraction

[0084] (I) Acquisition of alpaca PBMC

[0085] (1) Take the alpaca immunized with PEDV S protein and collect blood (50 mL) from the inner thigh of the alpaca using an anticoagulant tube;

[0086] (2) Transfer the blood sample from the anticoagulant tube to a 15mL tube in a clean bench and centrifuge at 2000rpm for 10min. After centrifugation, the blood is divided into two layers, the upper layer is light yellow liquid, and the lower layer is red blood cells. Carefully aspirate the upper layer of liquid into a 1.5mL EP tube and store it at -80℃; take a 50mL tube, add a small amount of PBS to it, and then use a 10mL pipette to aspirate a small amount of PBS to rinse, insert it into the 15mL tube cell layer to aspirate the cells, and transfer them to the 50mL tube, ensuring that the final blood and PBS ratio is 1:1, and mix well.

[0087] (3) Take the same amount of 50mL tubes as used in the previous step, add 3 / 4 times diluted blood sample lymphocyte separation solution to each tube, tilt and rotate to allow the separation solution to fully infiltrate the tube wall. Then tilt the tubes with separation solution and blood samples as much as possible, dock the tube mouths, slowly spread the diluted blood sample on the surface of the separation solution, and then slowly tilt your hands toward the separation solution. Finally, the liquid is divided into two layers, with the blood sample on the top and the separation solution on the bottom, and it is better to have little miscibility. After balancing, steadily put the 50mL tube into the centrifuge, with an initial speed of 100rpm for 40min. Whenever the speed stabilizes, manually increase the speed by 100rpm until the final speed stabilizes to 2500rpm. Adjust the centrifugation time to 25min.

[0088] (4) When there are 5 minutes left in the centrifugation, start to manually slow down (the speed needs to be adjusted from 2500 rpm to 0 rpm within 5 minutes, so it is reduced by 100 rpm every 12 seconds). The frequency and time of speed reduction can be further extended in the last few hundred revolutions. After centrifugation, it can be observed that the liquid is divided into 3 layers. The upper layer is a light yellow clear liquid, the middle layer has a cloudy liquid which is the PBMC layer, and the lower layer is red and opaque which is the blood cell layer. Take a 15mL tube and add 1mL PBS in advance. Then insert a pipette into the PBMC layer and start to aspirate PBMC from top to bottom, rotating and aspirating, and transfer to a 15mL tube with 1mL PBS.

[0089] (5) Calculate the actual volume of PBMC and add PBS 3 times the volume of PBMC. If the volume of the 15 mL tube is insufficient, transfer to a 50 mL tube in advance. Gently invert the tube to mix, centrifuge at 2000 rpm for 5 min, and discard the supernatant. Resuspend the cells in 2 mL of PBS, transfer to a 15 mL tube, add PBS to 15 mL, gently invert the tube to mix, centrifuge at 2000 rpm for 5 min, discard the supernatant, and repeat this operation for a total of two washes.

[0090] (II) RNA extraction

[0091] After the cryopreserved alpaca B lymphocytes were revived, they were centrifuged and 1 mL of Trizol was added; vortexed for 30 seconds and allowed to stand at room temperature for 5 minutes; 0.2 mL of chloroform was added to 1 mL of Trizol, the EP tube lid was tightly closed, and it was shaken vigorously in the hand for 15 seconds, and then placed at room temperature for 5 minutes (do not vortex, because it will cause DNA breakage and RNA contamination, and two EP tube racks were clamped on the EP tube to mix vigorously); centrifuged at 4°C and 12000g for 15 minutes, and the upper aqueous phase (0.5 mL) was slowly taken and placed in a new EP tube, and an equal volume (0.5 mL) of isopropanol was added to the aqueous phase; the EP tube was clamped between two EP tube racks and mixed by inversion, and allowed to stand at room temperature for 10 minutes, and then centrifuged at 12000g (4°C) for 10 minutes, and the supernatant was discarded with a 1 mL range pipette, and 1 mL Wash with 75% ethanol, flick up the RNA at the bottom with your fingers, centrifuge at 7500g (4°C) for 5 min, discard the supernatant with a 1mL pipette (residual 10-50μL 75% ethanol), centrifuge briefly again, and remove the remaining 75% ethanol with a 100μL pipette; let the precipitated RNA dry naturally at room temperature; dissolve the RNA precipitate with 20-50μL RNase-free water.

[0092] 3. Amplification of Nanobodies

[0093] (I) Reverse transcription and gene enrichment (5′ Race)

[0094] 5′Race: First, pre-combine the RNA with the primers, take a PCR tube, add the following prepared solution (6μL system), then vortex to mix and centrifuge, incubate at 72℃ for 3min, 42℃ for 2min, and 4℃ forever, and place on ice for later use; 2μL of the above RNA; 2μL of 5'-RACE CDS Primer A; 2μL of dNTP mix (10mM each); the RT Mix configuration ratio is shown in Table 5.

[0095] Table 5 Mouse serum antibody titer detection

[0096]

[0097]

[0098] The RNA and primer pre-combined system was mixed with RT Mix, shaken and centrifuged, and the following operations were performed in a PCR instrument (as shown in Table 6).

[0099] Table 6 Mouse serum antibody titer detection

[0100]

[0101] The RT product was taken out as a template for amplification and enrichment of ds cDNA. The enrichment conditions are shown in Table 7. High-fidelity enzyme amplification program: 98℃30s; (98℃10s, 65℃15s, 72℃15s) 10 cycles; 72℃10min; 4℃Forever; amplify 3-5 tubes according to the above conditions. After the amplification, collect the enriched cDNAs in all positive wells as PCR1, vortex and mix, and use them as the template for the next round of PCR2.

[0102] Table 7 RT Mix configuration ratio

[0103] Element Volume (μL) Phusion DNA Ploymerase(2U / μL) 0.2 5×Phusion HF buffer 4 ss cDNA 5 dNTPs (10 μM) 0.4 Nested Universal Primer A 1 CALL002 / AL.CH2.2 / AL.CH2 (Table 18) 1 H2O 8.4 Total 20

[0104] (II) Nested PCR amplification of alpaca antibody VHH gene fragments

[0105] Primer selection: Using the first round PCR1 product as a template, perform nested PCR to amplify the VHH gene fragment. VHH gene amplification: 9 pairs of upstream primers and 6 pairs of downstream primers are randomly arranged and combined (Table 8) to amplify the VHH gene fragment. Prepare the PCR system according to Table 9. Amplification program: 98℃30s; (98℃10s, 65℃15s, 72℃15s) 30 cycles; 72℃10min; 4℃Forever gel running, PCR2 products are recovered from positive wells (mixed together after gel cutting).

[0106] Table 8 Alpaca Nanobody VHH Gene Amplification Primers

[0107]

[0108]

[0109] Table 9 PCR system configuration ratio

[0110] Element Volume (μL) Phusion DNA Ploymerase(2U / μL) 0.2 5*HF buffer 4 dNTP 5 Upstream primer (10 μM) 0.4 Downstream primer (10 μM) 1 cDNA template 1 Sterile ddH2O 8.4 Total volume 20

[0111] (III) Enzyme Digestion, Ligation and Transformation

[0112] The VHH fragments recovered from PCR2 and the pComb3XSS empty vector were double-digested with SfiⅠ endonuclease, and the digestion system was shown in Table 10, and then ligated with T4 DNA ligase. The ligation product was transformed into Top10 competent cells by heat shock method, and 4 tubes of Top10 competent cells were transformed repeatedly, and spread on a 15cm solid plate for culture, and 1mL of liquid culture medium was added. All colonies in 4 dishes were scraped off with a glass rod, rinsed and centrifuged to collect bacteria, and the supernatant was discarded and directly extracted. The extracted plasmid was dissolved in deionized water, and the concentration was about 1000ng / μL for 1-2mL, and the plasmid pComb3XSS-VHH was stored.

[0113] Table 10 Enzyme digestion system configuration ratio

[0114] Element Volume (μL) 10×Buffer 5 SfiⅠ 1 VHH fragment / pComb3XSS (500 ng / μL) 8 <![CDATA[Sterile ddH2O]]> 36 Total volume 50

[0115] (IV) Construction of phage antibody display library

[0116] (1) Two 0.2 cm electric rotating cups were first cleaned three times with alcohol, then washed three times with double distilled water, wrapped in paper and placed in an oven. After drying, the lids were covered and placed on ice.

[0117] (2) Take 30 μg of the plasmid (the volume should not exceed 30 μL) and add it to 200 μL of TG1 competent cells. Mix well and add it to the electroporation cup. Flick it gently and mark the two tubes.

[0118] (3) Prepare 1 mL of soc in the pipette tip and insert it into a 15 mL centrifuge tube for later use;

[0119] (4) Set the electroporator to EC2 1.8KV 4.9S interval, put the electroporator cup into the electroporator and run it. When you hear a normal beeping sound, quickly add the 1mL soc prepared in advance. Aspirate and add to a 15mL centrifuge tube (labeled in advance);

[0120] (5) After 40 min at 37°C and 180 rpm, add 10 mL of Amp medium (take out 1 mL and determine the phage titer according to step 6);

[0121] (6) After 1 hour, add 50 μL of help phage and let it act for 30 minutes;

[0122] (7) Transfer to medium bottle 300mL Amp + , Kan + 2YT medium, 4h;

[0123] (8) Add 1:3000 IPTG (2 mg / μL) and culture overnight at 30°C and 180 rpm.

[0124] (9) Centrifuge at 7000 g and 4 °C for 10 min and collect the supernatant (the precipitated bacteria can be used to extract the plasmid);

[0125] (10) Add 1 / 5 volume of PEG8000 to the supernatant obtained in the previous step and place on ice in a 4°C refrigerator or ice box for 4 h to precipitate the phages;

[0126] (11) Centrifuge at 16,000 g and 4°C for 20 min, discard the supernatant, and the resulting precipitate is the amplified phage;

[0127] (12) The resulting precipitate was fully resuspended in 20 mL of PBS;

[0128] (13) After resuspending for 1 h to dissolve, repeat centrifugation at 7000 g and 4 °C for 10 min, collect the supernatant, add 1 / 5 volume of PEG8000, and place on ice for 3–4 h to precipitate the phage;

[0129] (14) Centrifuge at 12,000 g and 4°C for 10 min, discard the supernatant, resuspend the precipitate in 10 mL of 50% glycerol PBS, mix thoroughly, and store in aliquots.

[0130] (V) Phage titer determination

[0131] Take 10 μL of amplified phage and add it to 990 μL of PBS (prepare 10 -2 Then take an eight-well row and add 180 μL of PBS to each well. -2 Take 20 μL of the phage dilution and add it to 180 μL of PBS in the first well. Then dilute it 10 times in sequence until the 8th well. Take the last 4 titers for infection test. Take 20 μL of the diluted phage and infect 180 μL of ss320 cells for 10 min. Only infect the last 4 wells and apply Amp + LB plate. Count: How many monoclonal bacteria are there on the last plate? The phage concentration is N*10 12 Pieces / mL.

[0132] (VI) Enrichment and screening of phage antibody library

[0133] The antigen used for enrichment and screening of phage antibody libraries is crucial. Generally speaking, the purified soluble protein has high purity and high content, and can be directly coated on ELISA plates, which is the best choice for screening specific antibodies. In addition, the virus particles purified by ultracentrifugation are conducive to retaining the conformation of the antigenic epitopes that produce neutralizing antibodies and removing the interference of cellular components. This is very helpful for us to find neutralizing antibodies and reduce non-specific reactions.

[0134] (1) Coating: Place the purified target protein in an ice box and slowly thaw it. After it is completely thawed, dilute it with coating solution at a ratio of 1:100 and coat the 96-well plate. Place the plate in a 4°C refrigerator overnight.

[0135] (2) Blocking: After overnight coating, discard the coating solution in each well (be careful not to cross the wells). Wash away the unabsorbed antigen with 0.1% PBST solution. Add 200 μL of 0.5% BSA (0.5 g BSA is added to 100 mL coating buffer, mixed and sterilized by filtration) to each well for blocking. After standing at room temperature for 1 hour, discard the blocking solution and wash the plate three times (add 0.1% PBST, stand for 10 minutes, shake at 500 rpm for 2 minutes, and discard);

[0136] (3) Binding: Take 1 mL of the purified phage from the previous round and dissolve it in 9 mL of 0.1% PBST, mix well, add 100 μL to each well with a dispenser, and incubate at room temperature. Shake the plate at 250 rpm for 120 min, discard the phage solution in the Elisa plate, and wash the plate 9 times with 0.1% PBST;

[0137] (4) Elution: Add 50 μL of elution buffer (50 mL of 0.2 mol / L glycine + 32.4 mL of 0.2 mol / HCl, pH = 2.2) to each well using a dispenser, shake at 450 rpm for 5-10 min, and prepare three 2 mL centrifuge tubes containing 300 μL of 1 M Tris (15.01 g of glycine + 1 L of water, 1.66 mL of HCl + 100 mL of water) during the waiting process;

[0138] (5) Mix the elution buffer in each 32 wells together to obtain 96 / 32 = 3 tubes with a volume of 50x32 = 1600 μL of phage. Mix each tube of phage with 300 μL of 1M Tris buffer prepared in the previous step and collect in a 2 mL centrifuge tube. Be sure to adjust the pH to 7;

[0139] (6) Determine the phage titer according to the above (V).

[0140] (VII) Expansion of phage antibody library

[0141] (1) Take one tube of XL1-Blue competent cells (about 100 μL) and inoculate it into 5 mL of liquid LB medium and shake until OD 600nm Stop when it is between 0.6 and 0.8;

[0142] (2) Add 2 mL of phage to 5 mL of bacterial solution, transfer to a 50 mL sterile centrifuge tube, inoculate at 220 rpm for 1 h at 37 °C, and let stand at room temperature for 30 min;

[0143] (3) Add 13 mL of LB Amp to the 50 mL tube. + (1 / 1000) liquid medium, the final volume reached 20 mL, inoculated at 220 rpm for 1 h at 37 °C, and shaken until OD 600nm The value is about 0.8;

[0144] (4) Add helper phage M13KO7 (9×10 12 pfu / mL) (20 μL), inoculated at 220 rpm for 30 min at 37 °C;

[0145] (5) Pour all the above bacterial solution into a 500 mL bacterial bottle (total liquid volume 80 mL), 60 mL LB (Amp+ / kan + / Tet + ), shake for 4 hours, OD 600nm =1, add IPTG (0.8 mol / mL, ratio 1:5000) and incubate at 30°C overnight;

[0146] (6) Centrifuge at 5000 g for 20 min at 4°C and collect the supernatant (the precipitated bacteria can be used to extract the plasmid);

[0147] (7) Add 4 mL of PEG8000 to the supernatant obtained in the previous step and place in a 4°C refrigerator or ice box overnight to precipitate the phages;

[0148] (8) Centrifuge at 8000 g for 20 min at 4°C and discard the supernatant. The resulting precipitate is the amplified phage.

[0149] (9) The resulting precipitate was fully resuspended in 2 mL of PBS and then divided into 1.5 mL centrifuge tubes;

[0150] (10) Centrifuge at 12000g for 10 min at room temperature, discard the precipitate, transfer the supernatant to a 2 mL centrifuge tube, add 200–300 μL PEG8000 to precipitate the phage, and place in a 4°C refrigerator or ice box for 6–8 h or overnight;

[0151] (11) Centrifuge at 8000 g for 20 min at room temperature, discard the supernatant, and resuspend the precipitate in 200-500 μL PBS;

[0152] (12) Determine the phage concentration.

[0153] The PEDV S protein was used as the coating antigen for solid phase affinity screening using a phage antibody library. After three rounds of panning, a recombinant phage solution was obtained. The recombinant phage was diluted and plated before and after each round of panning to determine the titer. The input and output of each round of phage panning were calculated to obtain the phage yield of each round of panning (as shown in Table 11). The recombinant phage expanded and concentrated in the third round of panning was infected with logarithmic phase SS320 and plated on Amp + From the LB solid plate, single colonies with regular shapes were picked, and the 192 single clones picked were named (3Nb1, 3Nb2, 3Nb3, ..., 3Nb192).

[0154] Table 11 Phage titer determination before and after enrichment

[0155]

[0156] (VIII) Colony PCR Identification

[0157] (1) After the colonies grow, select an appropriate number of single colonies (e.g., 70 in the second round and 100 in the third round), transfer them into a 2 mL EP tube (containing 600 μL Amp resistance LB medium), and inoculate at 37°C for about 2 h;

[0158] (2) Bacterial liquid PCR reaction system: 20 μL system, PCR reaction conditions as shown in Table 12, primers used as shown in Table 13;

[0159] (3) 1% agarose gel electrophoresis to identify PCR products: If there is a band at 1000 bp, it can be preliminarily considered as a positive clone; the positive clone is sent for testing, preservation, and inoculation;

[0160] The positive results of recombinant phage were detected by colony PCR. The target band was positive at 750bp, and negative otherwise. Figure 6 , 184 positive colonies were found among the 192 clones selected, with a positive rate of 95.83%. The data showed that a good enrichment effect was achieved.

[0161] Table 12 Colony PCR identification system

[0162] Element Volume (μL) 2×PCR Mixer 7.5 template 1 ss320F(10uM)(Table 22) 0.6 ss320R(10uM)(Table 22) 0.6 <![CDATA[Sterile ddH2O]]> 10.3 Total volume 20

[0163] Table 13 VHH gene identification primers and eukaryotic plasmid construction primers

[0164] Primer name Base sequence (5'-3') ss320F TATGTTGTGTGGAATTGTGAGCGG ss320R GTTTGCCATCTTTTCATAATCAAAATCAC VHH-1-F CCTGTGGGTTTTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACGAGGTGCAGCTGGTGG VHH-1-R TGAGTTTTGTCACAAGATTTGGGCTCTGAGGAGACGGTGACCTG VHH-2-F CCTGTGGGTTTTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACGAGGTGCAGCTGGTGG VHH-2-R TGAGTTTTGTCACAAGATTTGGGCTCTGAGGAGACGGTGACCTG VHH-3-F CCTGTGGGTTTTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACCAGGTGCAGGTGGTGG VHH-3-R TGAGTTTTGTCACAAGATTTGGGCTCTGAGGAGACAGTGACCTG VHH-6-F CCTGTGGGTTTTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACCAGGTGCAGGTGGTGG VHH-6-R TGAGTTTTGTCACAAGATTTGGGCTCTGAGGAGACAGTGACCTG VHH-10-F CCTGTGGGTTTTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACGAGGTGCAGGTGGTGG VHH-10-R TGAGTTTTGTCACAAGATTTGGGCTCTGAGGAGACAGTGACCTG VHH-11-F CCTGTGGGTTTTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACCAGGTGCAGGTGGTGG VHH-11-R TGAGTTTTGTCACAAGATTTGGGCTCTGAGGAGACAGTGACCTG VHH-14-F CCTGTGGGTTTTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACGCTACCGTGGCCCAGG VHH-14-R TGAGTTTTGTCACAAGATTTGGGCTCTGAGGAGACGGTGACCAG VHH-21-F CCTGTGGGTTTTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACCAGGTGCAGCTGGTGG VHH-21-R TGAGTTTTGTCACAAGATTTGGGCTCTGAGGAGACAGTGACCAG VHH-39-F CCTGTGGGTTTTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACGAGGTGCAGCTGGTGG VHH-39-R TGAGTTTTGTCACAAGATTTGGGCTCTGAGGAGACAGTGACCTG VHH-42-F CCTGTGGGTTTTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACGAGGTGCAGGTGGTGG VHH-42-R TGAGTTTTGTCACAAGATTTGGGCTCTGAGGAGACAGTGACCTG VHH-74-F CCTGTGGGTTTTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACGAGGTGCAGGTGGTGG VHH-74-R TGAGTTTTGTCACAAGATTTGGGCTCTGAGGAGACGGTGACCTG VHH-90-F CCTGTGGGTTTTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACGAGGTGCAGCTGGTGG VHH-90-R TGAGTTTTGTCACAAGATTTGGGCTCTGAGGAGACAGTGACCTG VHH-96-F CCTGTGGGTTTTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACGCTACCGTGGCCCAGG VHH-96-R TGAGTTTTGTCACAAGATTTGGGCTCTGAGGAGACAGTGACCTG

[0165] (VIII) Nanobody Sequence Analysis

[0166] Subsequently, 184 PCR-positive single phage clones were incubated and sent to Qingke for sequencing analysis. The sequencing results were analyzed by IMGT, confirming that the sequences of these 184 antibody strains were all alpaca VHH base sequences. The amino acid sequences of these 184 different nanoantibodies were compared and analyzed using MEGA 11 sequence analysis software, and finally 138 nanoantibodies with different amino acid sequences were identified (such as Figure 7 shown).

[0167] (IX) Phage ELISA Identification

[0168] After panning, there are about 12mL of phages, which are divided into 6 2mL EP tubes. Take 1mL from each tube and mix into 6mL and put into a 15mL centrifuge tube for subsequent experiments. The other phages are preserved; 2mL of the 6mL mixed phages are taken for subsequent amplification experiments. Take 20μL for culture expansion sequencing, add 180μL of sterilized PBS to each well in the 8-row array, take 20μL of the mixed phages for 10-fold dilution, and then go to another 8-row array, add 180μL of ss320 competent medium to each well, take 20μL of the phages diluted in the previous step and add them to 180μL of ss320 competent medium, infect for 10min, take 100μL of the infected ss320 competent medium, spread it on 8 Amp plates, and culture for 10h. After picking a single clone, add it to a 15mL EP (4mL Amp LB) tube for expansion culture for 10 hours, take 10μL and add it to 2mL Amp LB for IPTG induction expression (1:1000), take 500μL of bacteria after induction expression, centrifuge and take the supernatant, and perform ELISA identification. The specific steps are as follows:

[0169] (1) Coating: Place the purified target protein in an ice box and slowly melt it. After it is completely melted, add the target protein to an appropriate volume of coating buffer so that the concentration of the dissolved protein E is 2 mg / L; use a spray gun to add 100 μL of coating buffer containing the target protein to the high-binding Elisa plate so that the target protein content in each well is 200 ng. Coating is carried out overnight in a 4°C refrigerator;

[0170] (2) Blocking: After overnight coating, discard the coating solution in each well (be careful not to cross-well). Add 200 μL of 0.5% BSA (0.5 g BSA is added to 100 mL coating buffer, mixed and then sterilized by filtration) to each well to block the non-specific binding sites of Phage pIII. After standing at room temperature for 1 hour, discard the blocking solution and wash the plate three times (add 0.1% PBST, stand for 10 minutes, shake at 500 rpm for 2 minutes, and discard);

[0171] (3) Binding: Add 100 μL of phage PBST solution to each well in sequence. Add 6 wells to each sample. The phage content should reach 1×10 12 pfu / mL. Record the loading order. Stand at 37°C for 3 h and shake at 500 rpm for 2 min every 0.5 h.

[0172] (4) Elution: 100 μL 0.1% PBST solution, shake at 500 rpm for 2 min, discard; wash 3 times;

[0173] (5) Incubation with primary antibody: dilute the primary antibody (mouse anti-Phage pIII) in 0.1% PBST at a ratio of 1:2500 and store in a dark place. Use a spray gun to add 100 μL of primary antibody dilution to each well and incubate at room temperature for 1 h.

[0174] (6) Elution: same as step (4);

[0175] (7) Incubation with secondary antibody: Same as step (5), the secondary antibody is goat anti-mouse IgG-HRP;

[0176] (8) Elution: same as step (4);

[0177] (9) Color development: Add 50 μL of TMB colorimetric solution to each well and react at 37°C for 20 min until appropriate color is developed. Immediately add 50 μL of 2 M concentrated HCl to terminate the color development reaction.

[0178] (10) Measure the OD of each well using a spectrophotometer 450nm value and record the result.

[0179] The results are as follows Figure 8 As shown, 106 of the 138 Nanobodies were reactive with PEDV S protein (S / N>2.1).

[0180] (X) Expression and verification of recombinant nanobodies

[0181] (1) Western Blot Identification

[0182] After IMGT sequence comparison and analysis of 138 nanoantibodies, 70 nanoantibodies with different CDR3 regions were screened for subsequent verification. First, the monoclonal strains expressing these 70 nanoantibodies were expanded and cultured, IPTG was induced for prokaryotic expression, and the antibody-containing bacterial supernatant was obtained after ultrasonic disruption; the expression of prokaryotic induced nanoantibodies was detected by Western Blot. The results are as follows Fig. 9 As shown, 67 of the 70 nanoantibodies could be observed to have a relatively clear and single target band, with a size of approximately 15 kDa, which is consistent with the molecular size of the target nanoantibody, indicating that the nanoantibody can be successfully expressed.

[0183] (2) Indirect immunofluorescence test

[0184] From the 106 nanoantibodies, 18 strains (3Nb8, 3Nb17, 3Nb19, 3Nb20, 3Nb40, 3Nb47, 3Nb62, 3Nb71, 3Nb72, 3Nb77, 3Nb78, 3Nb87, 3Nb100, 3Nb108, 3Nb118, 3Nb124, 3Nb137 and 3Nb164) were selected. Nanoantibodies with high expression and strong reactivity were constructed on the pCAGGS-mIgH eukaryotic expression plasmid. These 18 nanoantibody eukaryotic expression plasmids were transfected into HEK-293T cells, and the expression supernatant was collected as the primary antibody. The reactivity of PEDV with the nanoantibodies was verified on Vero cells infected with PEDV. The results are as follows: Fig.10 As shown in the figure, AR: 18 strains of PEDV nanobodies (3Nb8, 3Nb17, 3Nb19, 3Nb20, 3Nb40, 3Nb47, 3Nb62, 3Nb71, 3Nb72, 3Nb77, 3Nb78, 3Nb87, 3Nb100, 3Nb108, 3Nb118, 3Nb124, 3Nb137, and 3Nb164); S: PEDV negative serum control; T: PEDV positive serum control; Twelve of the 18 selected nanoantibodies (3Nb17, 3Nb20, 3Nb40, 3Nb62, 3Nb71, 3Nb72, 3Nb77, 3Nb87, 3Nb118, 3Nb124, 3Nb137 and 3Nb164) can cross-react with PEDV.

[0185] (3) Flow cytometry

[0186] Use 10cm 2 Two plates of Vero cells were cultured. After the cells were fully grown, they were digested and set aside. PEDV S protein was incubated with different PEDV antibodies on ice for 30 min. Then, the protein-antibody complex was incubated into Vero cells (5×10 5 ), incubated on ice for 30 min, incubated with Anti-His FITC (1:200) and Anti-Mouse IgG APC (1:200) fluorescent antibodies on ice for 30 min, discarded the incubated antibodies, washed three times with PBST, and detected by flow cytometry.

[0187] Flow cytometry results Fig.11As shown in the figure, AR: 18 strains of PEDV nanoantibodies (3Nb8, 3Nb17, 3Nb19, 3Nb20, 3Nb40, 3Nb47, 3Nb62, 3Nb71, 3Nb72, 3Nb77, 3Nb78, 3Nb87, 3Nb100, 3Nb108, 3Nb118, 3Nb124, 3Nb137 and 3Nb164); S: PEDV negative serum control; T: PEDV positive serum control; 8 of the 18 nanoantibodies (3Nb17, 3Nb20, 3Nb40, 3Nb71, 3Nb72, 3Nb87, 3Nb124 and 3Nb137) can block PEDV Among the binding of S protein and Vero cells, the blocking effects of the four nanoantibodies 3Nb17, 3Nb20, 3Nb40, and 3Nb124 were the best.

[0188] (4) Virus microneutralization experiment with nanoantibodies

[0189] Resuscitated Vero cells and passaged to 15 cm 2 After the cells are fully spread, wash the cell plate with PBS three times, take 100μL of PEDV CH-HB2-2018 virus seed and dilute it into 20mL DMEM, add it to the cell plate, incubate it in a 37℃, 5% CO2 incubator for 1h, and wash it with PBS three times. Add 10μg / mL pancreatin in DMEM maintenance solution, collect the sample after 48h, freeze and thaw it repeatedly in a -80℃ refrigerator for 3 times, and collect the virus. Virus TCID 50 For the assay, place an appropriate amount of Vero cells in a 96-well plate, wait until the cells are fully grown, dilute the virus 10-fold in an EP tube, wash the 96-well plate cells three times, and add the diluted virus solution to the 96-well plate cells in sequence. Observe the cytopathic effect after 48 hours and calculate the TCID of the virus 50 . Inoculate an appropriate amount of Vero cells in a 96-well plate and wait for the cells to grow completely. Add purified PEDV antibodies and virus solution (200 TCID 50 ) and incubate in a 37°C, 5% CO2 incubator for 1 hour. Wash the 96-well plate cells with PBS 3 times, add the antibody-virus mixture to the 96-well plate, and incubate in a 37°C, 5% CO2 incubator for 1 hour. After washing with PBS 3 times, add 10 μg / mL pancreatin in DMEM maintenance solution, and observe the neutralization results after 48 hours.

[0190] Virus neutralization assay Fig.12 As shown in the figure, the eight selected nanoantibodies were able to neutralize the PEDV CH-HB2-2018 strain, among which 3Nb17 nanoantibody had the highest neutralization titer, with a half inhibitory concentration (IC 50 ) was as high as 0.03271 μg / mL, which was consistent with the results of flow cytometry.

[0191] (5) SPR identification of nanobodies

[0192] Surface plasmon resonance experiments can be used to detect in vitro protein-protein interactions and obtain the kinetic parameters of the interaction, including dissociation constant (affinity), association rate and dissociation rate. The kinetic parameters of the in vitro binding of PEDV S protein and its antibodies were determined using BIAcore3000:

[0193] 1) Replace the two proteins whose interactions need to be studied into the HEPES buffer used in the SPR experiment (0.01M HEPES, pH 7.4, 0.15M NaCl, 3mM EDTA, 0.005% v / v surfactant P20). The HEPES buffer needs to be degassed by ultrasonication before the experiment.

[0194] 2) The concentrations of the stationary phase and mobile phase were set to 10 μg / mL and 1 μM to 100 μM, respectively;

[0195] 3) The stationary phase is coupled to one channel in the chip, and bovine serum albumin (BSA) is coupled to another channel as a background control. In some cases, a blank channel can also be used as a background control. When coupling proteins, the machine flow rate is generally set to 5 μL / min.

[0196] 4) Estimate the affinity range of the research object, which can generally be divided into nanomolar and micromolar levels. Binding experiments can be performed using 1nM and 1μM mobile phase proteins to determine the affinity range;

[0197] 5) Within the affinity range obtained in the previous step, design a series of concentration gradients, dilute the mobile phase protein in multiples, and conduct a complete on-machine binding experiment; we generally select the KINJECT mode for kinetic parameter determination, the machine flow rate is 30μL / min, the sample injection binding time is generally 1-2min (the required time is determined based on whether the binding curve is saturated), and the dissociation curve acquisition time is generally 1-5min (the specific time setting is adjusted based on the speed of dissociation);

[0198] 6) Use BIAevaluation software to analyze the kinetic parameters of the research subjects and draw graphs.

[0199] SPR results are as follows Fig.13 As shown in the figure, among the eight selected nanoantibodies (3Nb17, 3Nb20, 3Nb40, 3Nb71, 3Nb72, 3Nb87, 3Nb124 and 3Nb137), nanoantibody 3Nb17 has the strongest binding affinity to PEDV S protein, with a dissociation rate constant (kD) of 7.57×10 -10 .

[0200] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the purpose and scope of the technical solution of the present invention, which should be covered by the scope of the claims of the present invention.

Claims

1. A nanobody or antigen-binding fragment against porcine epidemic diarrhea virus (PEDV), characterized in that The nanobody or antigen-binding fragment includes CDR1, CDR2 and HCDR3, the amino acid sequence of CDR1 is shown in SEQ ID NO: 1, the amino acid sequence of CDR2 is shown in SEQ ID NO: 2, and the amino acid sequence of CDR3 is shown in SEQ ID NO:

3.

2. The nanobody or antigen-binding fragment according to claim 1, characterized in that The nanobody or antigen-binding fragment also includes a FR1 that has at least 80% identity with the sequence shown in SEQ ID NO:4 and / or a FR2 that has at least 80% identity with the sequence shown in SEQ ID NO:5 and / or a HFR3 that has at least 80% identity with the sequence shown in SEQ ID NO:6 and / or a FR4 that has at least 80% identity with the sequence shown in SEQ ID NO:

7.

3. The nanobody or antigen-binding fragment according to claim 1, characterized in that The Nanobody or antigen-binding fragment comprises a variable region that is at least 70% identical to the sequence shown in SEQ ID NO:

8.

4. The Nanobody or antigen-binding fragment according to any one of claims 1 to 3, characterized in that The nanobody or antigen-binding fragment also includes the CH2 region and CH3 region of the mouse IgG1 subtype.

5. The nanobody or antigen-binding fragment according to claim 4, characterized in that The CH2 region comprises SEQ ID The sequence shown in NO:9 has at least 70% identity; and / or the CH3 region comprises a sequence having at least 70% identity to the sequence shown in SEQ ID NO:

10.

6. Any of the following substances: (i) a polynucleotide molecule comprising a nucleotide sequence encoding a Nanobody or antigen-binding fragment according to any one of claims 1 to 5; (ii) an expression vector comprising the polynucleotide molecule described in (i); (iii) an engineered bacterium, comprising the expression vector in (ii); (iv) a host cell, comprising the expression vector in (ii); (v) a product for detecting porcine epidemic diarrhea virus, comprising a Nanobody or antigen-binding fragment as described in any one of claims 1 to 5 or a polynucleotide molecule in (i) or an expression vector in (ii) or an engineered bacterium in (iii) or an engineered cell in (iv); (vi) a pharmaceutical composition comprising a Nanobody and / or an antigen-binding fragment as claimed in any one of claims 1 to 5 and / or a polynucleotide molecule in (i) or an expression vector in (ii) and / or an engineered bacterium in (iii) and / or an engineered cell in (iv); (vii) a pharmaceutical preparation comprising a Nanobody and / or an antigen-binding fragment as described in any one of claims 1 to 5 and / or a polynucleotide molecule in (i) and / or an expression vector in (ii) and / or an engineered bacterium in (iii) and / or an engineered cell in (iv) and / or a pharmaceutical composition in (vi).

7. The substance according to claim 6, characterized in that The pharmaceutical composition is a bispecific antibody, a polyspecific antibody, an ADC or a fusion protein.

8. Use of the Nanobody and / or antigen-binding fragment and / or the polynucleotide molecule in (i) and / or the expression vector in (ii) and / or the engineered bacteria in (iii) and / or the engineered cells in (iv) as described in any one of claims 1 to 5 in the preparation of a product for diagnosing porcine epidemic diarrhea virus infection.

9. Use of the Nanobody and / or antigen-binding fragment and / or the polynucleotide molecule in (i) and / or the expression vector in (ii) and / or the engineered bacteria in (iii) and / or the engineered cells in (iv) as described in any one of claims 1 to 5 in the preparation of a medicament for preventing or treating porcine epidemic diarrhea virus infection.

10. The use according to claim 8 or 9, characterized in that: The disease caused by porcine epidemic diarrhea virus infection is porcine epidemic diarrhea.

Images