Binding protein specifically binding to glomerular basement membrane, preparation method and application

Abstract

The invention provides a binding protein specifically bound with a glomerular basement membrane, a preparation method and application, and relates to the technical field of biology. The binding protein contains a heavy chain variable region and a light chain variable region, wherein a complementary determining region of the heavy chain variable region comprises amino acid sequences consistent with VH-CDR1, VH-CDR2 and VH-CDR3 of the heavy chain variable region shown as SEQ ID NO.1; the complementarity determining region of the light chain variable region comprises amino acid sequences which are consistent with the amino acid sequences of VL-CDR1, VL-CDR2 and VL-CDR3 of the light chain variable region as shown in SEQ ID NO.2. The binding protein has good specific binding capacity with a glomerular basement membrane antigen, and can be used for identification of an anti-glomerular basement membrane antibody or the glomerular basement membrane antigen, and diagnosis and detection of anti-glomerular basement membrane antibody positive diseases and / or vasculitis or auxiliary diagnosis and detection of the anti-glomerular basement membrane antibody positive diseases and / or vasculitis.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a binding protein specifically binding to glomerular basement membrane, a preparation method and application thereof. Background Art

[0002] The following statements merely provide background information related to the present disclosure and do not necessarily constitute prior art.

[0003] Anti-glomerular basement membrane (GBM) antibody disease is an autoimmune vasculitis disease characterized by the deposition of anti-GBM antibodies in the kidney or alveolar basement membrane. The typical clinical manifestations are acute renal failure with or without diffuse alveolar hemorrhage. The main basis for diagnosis is the detection of anti-GBM antibodies in serum or tissue. The disease has an acute onset, rapid progression, poor prognosis, and high mortality rate. Most untreated patients rapidly progress to end-stage renal disease (ESRD) in the early stages of the disease. Anti-GBM antibodies can be detected in about 1 / 3 of patients. Therefore, anti-GBM antibody detection plays a very important role in the diagnosis of vasculitis diseases. Small vasculitis can be diagnosed and treated early to limit its potential damage to other organs.

[0004] At present, most of the anti-GBM antibodies in common detection kits are human positive serum, but the serum source is difficult and there are large differences between batches. In addition, there are rabbit or mouse monoclonal antibodies produced by hybridoma technology, as well as polyclonal antibodies purified from positive serum of immune animals and then coupled to human IgG. The operation is complicated, time-consuming and costly. Therefore, it is of great significance and value to develop recombinant monoclonal antibodies against GBM that are easy to obtain, can be mass-produced, and widely used, especially those with high affinity that can be used in clinical detection kits.

[0005] In view of this, the present invention is proposed. Summary of the invention

[0006] The object of the present invention is to provide a binding protein that specifically binds to the glomerular basement membrane, and the binding protein has good specific binding ability with the glomerular basement membrane antigen. Based on the binding protein provided by the present invention, the object of the present invention is also to provide its application. Another object of the present invention is to develop a binding protein that specifically binds to the glomerular basement membrane with good binding activity in a simpler method, which can be used for the identification of glomerular basement membrane antigens, and for conducting or assisting in the diagnosis and detection of anti-glomerular basement membrane antibody-positive diseases and / or vasculitis.

[0007] In order to solve the above technical problems, the present invention particularly adopts the following technical solutions:

[0008] Definition of terms:

[0009] The glomerular basement membrane (GBM) is an important component of the kidney glomerulus and is crucial for maintaining the normal filtration function of the kidney. The glomerular basement membrane can be divided into three layers from the inside to the outside under an electron microscope, including an inner loose layer, a dense layer and an outer loose layer, with a thickness of approximately 240 to 370 nm. The glomerular basement membrane is mainly composed of matrix and negatively charged proteoglycans, including type IV collagen, laminin and other proteoglycan substances. In this article, "glomerular basement membrane antigen" and "GBM antigen" refer to antigens of the glomerular basement membrane that can be bound by natural anti-glomerular basement membrane antibodies, which can be a complete glomerular basement membrane or a partial component from the glomerular basement membrane. The binding protein that specifically binds to the glomerular basement membrane provided by the present invention (hereinafter also referred to as "GBM binding protein") can bind to the above-mentioned glomerular basement membrane antigen.

[0010] The technical term "binding protein" herein refers to a protein that binds to a specific antigen, and generally refers to all proteins and protein fragments that contain a complementary determining region (CDR region). The binding protein can be an antibody, and the terms "antibody" and "full-length antibody" include polyclonal antibodies and monoclonal antibodies. In addition, the term "antibody" includes naturally occurring antibodies as well as non-naturally occurring antibodies, including, for example, chimeric, bifunctional and humanized antibodies, and related synthetic isoforms. Non-naturally occurring antibodies are also referred to herein as "recombinant antibodies", and the term "antibody" can be used interchangeably with "immunoglobulin".

[0011] The binding protein may also be an antigen-binding fragment comprising part or all of the antibody CDR, which lacks at least some of the amino acids present in the full-length chain of the antibody but is still able to specifically bind to the antigen. Such fragments are biologically active because they bind to the target antigen and can compete with other antigen-binding molecules (including intact antibodies) for binding to a given epitope. Such fragments are selected from, but not limited to, F(ab')2, Fab', Fab, Fv (composed of VH and VL), ScFv (single-chain antibody, VH and VL are connected by a connecting peptide), dsFv (disulfide stabilized Fv fragments, dsFv), bispecific antibodies, nanobodies, and any one of the minimum recognition units of antibodies. In addition to the above functional fragments, any fragments with increased half-life are also included.

[0012] The term "variable region" or "variable domain" refers to the domain of the amino terminus of the heavy chain or light chain of an antibody that recognizes and binds to an antigen. The composition and arrangement of the amino acids in this segment determine the specificity of the antibody in recognizing an antigen. The heavy chain variable domain may be referred to as "VH". The light chain variable domain may be referred to as "VL". The variable domain contains an antigen binding site. The variable regions of the heavy and light chains are each composed of three complementarity-determining regions (CDRs) (also known as hypervariable regions) connected by four framework regions (FRs). The extent of the framework region and CDR has been precisely defined, for example, in Kabat (see Sequences of Proteins of Immunological Interest, E. Kabat et al.) and Chothia. Any CDR determination method well known in the art, including a combination of methods, can identify the CDRs of the variable domain. The CDRs in each chain are held together closely by FRs to form the variable region. Generally, the variable regions VL / VH of the heavy and light chains can be obtained by arranging and connecting the following numbered CDRs and FRs in the following combinations: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4.

[0013] The term "constant region" or "constant domain" refers to the constant region of an antibody light chain or the constant region of an antibody heavy chain, either alone or in combination. The heavy chain of an antibody has one variable domain (VH), followed by a number of constant domains or regions, such as one or more of hinge, CH1, CH2, CH3 and CH4, the CH1 domain being adjacent to the VH domain and at the amino terminus of the hinge region of the antibody heavy chain, and not forming part of the Fc region of the antibody; the hinge region includes the portion of the heavy chain molecule that connects the CH1 domain to the CH2 domain; the N-terminus of CH2 is usually the CH3 domain, which usually forms the C-terminal portion of the antibody, and in some antibody types, such as IgM and IgE, the constant region also includes the CH4 domain. The constant region of an antibody can be derived from IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE and IgD, as well as subclasses and mutant forms of the constant regions thereof.

[0014] The present invention does not limit the method of obtaining GBM binding proteins. In some optional embodiments, the corresponding antibodies can be obtained by connecting the polynucleotide encoding the binding protein to the vector and expressing it in the cell. The above-mentioned vector can be introduced into eukaryotic cells, especially mammalian cells, to construct a protein capable of expressing the binding protein. In other optional embodiments, the binding protein can also be obtained by recombinant genetic techniques known to those skilled in the art or by peptide synthesis, such as an automatic peptide synthesizer (for example, an automatic peptide synthesizer sold by Applied BioSystems, etc.); the antigen-binding fragment can also be optionally produced by enzymatic cleavage of the antigen-binding molecule (including intact antibodies), such as pepsin or papain cleavage; or chemical cleavage, such as obtaining the above-mentioned antigen-binding fragment by chemical reduction splitting disulfide bonds.

[0015] The terms "specific recognition", "selective binding", "selectively binds" and "specifically binds" or similar expressions refer to the binding of a binding protein to an epitope on a predetermined antigen. Typically, the binding protein is expressed in an amount of less than about 10 -5 M, for example, less than about 10 -5 M, 10 -6 M, 10 -7 M, 10 -8 M, 10 -9 M or 10 -10 M or smaller K D The K value of an antibody can be determined using methods well established in the art. D Other standard assays for evaluating the binding ability of a ligand, such as an antibody, to a target are known in the art and include, for example, ELISA, Western blot, RIA, and flow cytometry analysis.

[0016] The term "signal substance" herein refers to a substance that can provide a detectable signal, which can be directly observed by the naked eye or detected by conventional instruments acceptable in the art; the signal substance can directly provide a signal, such as color (such as colloidal gold, colored microspheres), fluorescence (fluorescent molecules), magnetism, radiation or luminescence; it can also provide a signal indirectly through a subsequent reaction in which the signal substance participates, such as catalyzing a specific substrate reaction to produce any of the above signals.

[0017] The term "polynucleotide" herein refers to a polymer form of nucleotides of any length, including ribonucleotides and / or deoxyribonucleotides. Examples of polynucleotides include, but are not limited to, single-stranded, double-stranded or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural or derived nucleotide bases. The polynucleotide encodes the above-mentioned binding protein, and the encoding is optionally encoding a sense strand or an antisense strand. The polynucleotide can be naturally occurring, synthetic, recombinant, or any combination thereof. The terms "polynucleotide" and "nucleic acid" are used interchangeably herein.

[0018] The term "vector" as used herein refers to a nucleic acid delivery vehicle into which a polynucleotide can be inserted. When a vector can express a protein encoded by the inserted polynucleotide, the vector is called an expression vector. A vector can be introduced into a cell by transformation, transduction or transfection so that the genetic material elements it carries are expressed in the cell.

[0019] The vector is well known to those skilled in the art, including but not limited to: plasmid, episomal plasmid, minicircle DNA, phagemid, cosmid; artificial chromosome, such as yeast artificial chromosome (YAC), bacterial artificial chromosome (BAC) or P1-derived artificial chromosome (PAC); bacteriophage such as λ phage or M13 phage and animal virus, etc. Animal viruses that can be used as vectors include but are not limited to retrovirus (including lentivirus), adenovirus, adeno-associated virus, herpes virus (such as herpes simplex virus), poxvirus, baculovirus, papillomavirus, papillomavirus. In some embodiments, the vector of the present invention contains regulatory elements commonly used in genetic engineering, such as enhancers, promoters, internal ribosome entry sites (IRES) and other expression control elements (such as transcription termination signals, or polyadenylation signals and poly-U sequences, etc.).

[0020] As used herein, the expressions "cell", "cell line" and "cell culture" are used interchangeably, and all such names include progeny. Progeny may not necessarily be identical to the primary cell due to natural, accidental or deliberate mutations, and may differ from the primary cell in morphology and / or in genomic DNA. "Transformants" and "transformed cells" include primary test cells and cultures derived therefrom. Cells may be prokaryotic or eukaryotic cells, such as but not limited to Escherichia coli, Bacillus or Staphylococcus. Eukaryotic cells include but are not limited to mammalian cells, insect cell lines, plant cells and fungal cells. Mammalian host cells include humans, mice, rats, dogs, monkeys, pigs, goats, cattle, horses and hamster cells, including but not limited to Chinese hamster ovary (CHO) cells, NSO, HeLa cells, baby hamster kidney (BHK) cells, monkey kidney cells (COS), human hepatocellular carcinoma cells (e.g., Hep G2), A549 cells, 3T3 cells and HEK-293 cells.

[0021] As used herein, the term "purified" or "isolated" in connection with a polypeptide or nucleic acid means that the polypeptide or nucleic acid is not in its natural medium or natural form. Thus, the term "isolated" includes a polypeptide or nucleic acid removed from its original environment, such as if it is naturally present, from its natural environment. For example, an isolated polypeptide is generally free of at least some proteins or other cellular components that are normally associated with it or are normally mixed with it or in solution. Isolated polypeptides include naturally produced polypeptides contained in cell lysates, polypeptides in purified or partially purified form, recombinant polypeptides, polypeptides expressed or secreted by cells, and polypeptides in heterologous cells or cultures. In connection with nucleic acids, the term isolated or purified indicates, for example, that the nucleic acid is not in its natural genomic context (e.g., in a vector, as an expression cassette, connected to a promoter, or artificially introduced into a heterologous cell).

[0022] As used herein, "anti-glomerular basement membrane antibody-positive disease" refers to a disease that can cause a patient's anti-glomerular basement membrane antibody levels to be higher than the level when the patient is not suffering from the disease. Exemplary anti-glomerular basement membrane antibody-positive diseases include, but are not limited to, anti-glomerular basement membrane (anti-GBM) disease in small vessel vasculitis (also known as Goodpasture syndrome, anti-basement membrane glomerulonephritis, Goodpasture's syndrome, or Goodpasture's disease).

[0023] In this document, unless otherwise stated, arbitrary numbering is used to distinguish one entity or behavior from another entity or behavior, and does not necessarily require or imply any actual relationship, order, or importance between these entities or behaviors, such as numbers (I), (II)...(VII).

[0024] As used herein, unless otherwise stated, "optionally", "optional", "optional" or "optional" means that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs or does not occur.

[0025] Herein, the terms "comprise" or "comprising" are intended to include stated elements, integers or steps, but not to exclude any other elements, integers or steps.

[0026] In a first aspect, a GBM binding protein is provided, which comprises a heavy chain variable region and a light chain variable region.

[0027] The heavy chain variable region includes complementary determining regions VH-CDR1, VH-CDR2 and VH-CDR3; the light chain variable region includes complementary determining regions VL-CDR1, VL-CDR2 and VL-CDR3;

[0028] The VH-CDR1 includes an amino acid sequence consistent with VH-CDR1 of the heavy chain variable region shown in SEQ ID NO.1, the VH-CDR2 includes an amino acid sequence consistent with VH-CDR2 of the heavy chain variable region shown in SEQ ID NO.1, and the VH-CDR3 includes an amino acid sequence consistent with VH-CDR3 of the heavy chain variable region shown in SEQ ID NO.1; and, the VL-CDR1 includes an amino acid sequence consistent with VL-CDR1 of the light chain variable region shown in SEQ ID NO.2, the VL-CDR2 includes an amino acid sequence consistent with VL-CDR2 of the light chain variable region shown in SEQ ID NO.2, and the VL-CDR3 includes an amino acid sequence consistent with VL-CDR3 of the light chain variable region shown in SEQ ID NO.2.

[0029] It is understood that the amino acid sequences of other regions in the variable region shown in SEQ ID NO.1 or 2 except the CDR region are not used to limit the GBM binding protein provided by the present invention. For example, if the GBM binding protein provided in the present application contains a framework region, it may be different from the framework region in the variable region shown in SEQ ID NO.1 or 2. The CDR region in the variable region shown in SEQ ID NO.1 or 2 can be divided according to an optional method known in the art. Optionally, VH-CDR1, VH-CDR2, VH-CDR3, VL-CDR1, VL-CDR2 and VL-CDR3 of the variable region are defined by any one of the systems of Kabat, Chothia, IMGT, ABM or Contact or a combination of multiple definition systems. Taking the definition methods of Kabat, Chothia, IMGT, ABM or Contact as examples, the amino acid sequences of CDRs are shown in Table 1:

[0030] Table 1 Heavy chain CDR of VH shown in SEQ ID NO.1

[0031]

[0032] Table 2 Light chain CDR of VL shown in SEQ ID NO.2

[0033]

[0034] In an optional embodiment, the GBM binding protein has VH-CDR1, VH-CDR2 and VH-CDR3 of the heavy chain variable region defined in Table 1, and VL-CDR1, VL-CDR2 and VL-CDR3 of the light chain variable region defined in Table 2. Taking the IMGT definition as an example: the amino acid sequence of the VH-CDR1 is shown in SEQ ID NO.11, the amino acid sequence of the VH-CDR2 is shown in SEQ ID NO.16, and the amino acid sequence of the VH-CDR3 is shown in SEQ ID NO.19; the amino acid sequence of the VL-CDR1 is shown in SEQ ID NO.22, the amino acid sequence of the VL-CDR2 is RVS, and the amino acid sequence of the VL-CDR3 is shown in SEQ ID NO.25.

[0035] In an optional embodiment, the species from which the remaining sequence of the antibody minus the CDR region originates include one or more of rabbits, cows, horses, dairy cows, pigs, sheep, goats, rats, mice, dogs, cats, camels, donkeys, deer, minks, chickens, ducks, geese, turkeys, fighting cocks, humans, and their mutants.

[0036] In an optional embodiment, the heavy chain variable region further contains at least one framework region, such as one framework region, two framework regions, three framework regions or four framework regions.

[0037] In an alternative embodiment, the light chain variable region further comprises at least one framework region, such as one framework region, two framework regions, three framework regions or four framework regions.

[0038] In an optional embodiment, the framework region VH-FR1 of the heavy chain variable region includes an amino acid sequence consistent with VH-FR1 of the heavy chain variable region shown in SEQ ID NO.1; and / or, the framework region VH-FR2 includes an amino acid sequence consistent with VH-FR2 of the heavy chain variable region shown in SEQ ID NO.1; and / or, the framework region VH-FR3 includes an amino acid sequence consistent with VH-FR3 of the heavy chain variable region shown in SEQ ID NO.1; and / or, the framework region VH-FR4 includes an amino acid sequence consistent with VH-FR4 of the heavy chain variable region shown in SEQ ID NO.1.

[0039] In an optional embodiment, the framework region VL-FR1 of the light chain variable region includes an amino acid sequence consistent with VL-FR1 of the light chain variable region shown in SEQ ID NO.2; and / or, the framework region VL-FR2 includes an amino acid sequence consistent with VL-FR2 of the light chain variable region shown in SEQ ID NO.2; and / or, the framework region VL-FR3 includes an amino acid sequence consistent with VL-FR3 of the light chain variable region shown in SEQ ID NO.2; and / or, the framework region VL-FR4 includes an amino acid sequence consistent with VL-FR4 of the light chain variable region shown in SEQ ID NO.2.

[0040] In an optional embodiment, the amino acid sequence of the heavy chain variable region of the GBM binding protein is shown as SEQ ID NO.1, and the amino acid sequence of the light chain variable region is shown as SEQ ID NO.2.

[0041] In alternative embodiments, the GBM binding protein is an antibody or antigen binding fragment comprising a constant region.

[0042] In alternative embodiments, at least a portion of the constant region sequence of the GBM binding protein is a human constant region sequence.

[0043] In an optional embodiment, the constant region sequence of the GBM binding protein is selected from the sequence of a portion or all of the constant region of any one of IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE or IgD, wherein the IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE or IgD include their subclasses and mutant forms.

[0044] In an alternative embodiment, the GBM binding protein contains a heavy chain constant region.

[0045] In an optional embodiment, the heavy chain constant region sequence of the GBM binding protein is selected from a portion or all of the constant region sequence of human IgG1, preferably including CH1, CH2 and CH3 of the constant region of human IgG1.

[0046] In an optional embodiment, the amino acid sequence of the heavy chain constant region is shown in SEQ ID NO.3.

[0047] In an alternative embodiment, the GBM binding protein contains a light chain constant region.

[0048] In an optional embodiment, the light chain constant region sequence is selected from the light chain constant region of a mouse.

[0049] In an optional embodiment, the amino acid sequence of the light chain constant region is as shown in SEQ ID NO.4.

[0050] In an optional embodiment, the GBM binding protein is a human-mouse chimeric antibody, the heavy chain amino acid sequence of the GBM binding protein is shown in SEQ ID NO.5, and the light chain amino acid sequence is shown in SEQ ID NO.6.

[0051] In the second aspect, a biological material is also provided, including a polynucleotide, a vector or a cell; wherein the polynucleotide encodes the above-mentioned GBM-binding protein; the vector carries the polynucleotide; the cell carries the polynucleotide, or contains the vector or is capable of expressing the GBM-binding protein.

[0052] After the polynucleotide encoding the GBM binding protein is connected to the vector, the vector can be introduced into eukaryotic cells, especially mammalian cells, to construct a cell line capable of expressing the GBM binding protein, and the corresponding protein can be obtained by cell expression.

[0053] In an alternative embodiment, the cells used to express the GBM-binding protein are 293 cells (human kidney epithelial cell line), preferably 293F cells.

[0054] In an alternative embodiment, the cells used to express the GBM binding protein are CHO cells (Chinese Hamster Ovary cells).

[0055] In a third aspect, a method for preparing the GBM-binding protein of the first aspect is also provided, comprising culturing cells capable of expressing the GBM-binding protein.

[0056] In an optional embodiment, the preparation method further comprises transforming the polynucleotide encoding the GBM-binding protein into cells and expressing the polynucleotide, and obtaining the GBM-binding protein by purification.

[0057] In an optional embodiment, the preparation method further comprises synthesizing a polynucleotide containing the gene encoding the GBM-binding protein as needed, and / or preparing a suitable expression vector as needed, transforming the expression vector into the desired cells and expressing it, and the GBM-binding protein can be obtained by purification.

[0058] In an optional embodiment, the cell is prepared by transforming a polynucleotide encoding a GBM-binding protein as described in the first aspect into the cell, the polynucleotide includes a heavy chain expression plasmid and a light chain expression plasmid, and the transformation includes co-transforming the heavy chain expression plasmid and the light chain expression plasmid into the cell.

[0059] In an optional embodiment, the constant region fragment is fused to the C-terminus of the heavy chain variable region to construct a complete heavy chain expression plasmid.

[0060] In an optional embodiment, the constant region fragment includes one or more of CH1, CH2 and CH3, preferably includes CH1, CH2 and CH3.

[0061] In an optional embodiment, the cell is a eukaryotic cell, preferably a mammalian cell.

[0062] In an optional embodiment, the mammalian cells include 293 cells or CHO cells, preferably 293F cells.

[0063] In a fourth aspect, there is also provided a use of the GBM binding protein of the first aspect or the biomaterial of the second aspect in any one of the following (I) to (VIII):

[0064] (I) Detection of anti-glomerular basement membrane antibodies for non-diagnostic and therapeutic purposes;

[0065] (II) Preparation of products for detecting anti-glomerular basement membrane antibodies;

[0066] (III) Preparation of products for diagnosis and / or auxiliary diagnosis of anti-glomerular basement membrane antibody-positive diseases;

[0067] (IV) preparing products for diagnosis and / or aiding diagnosis of vasculitis;

[0068] (V) Detection of glomerular basement membrane antigen for non-diagnostic and therapeutic purposes;

[0069] (VI) preparing products for detecting glomerular basement membrane antigen;

[0070] (VII) for separating, enriching and / or purifying glomerular basement membrane antigens;

[0071] (VIII) preparing a product for isolating, enriching and / or purifying glomerular basement membrane antigens.

[0072] In the applications of aspects (I) to (IV) above, the GBM-binding protein can be used as a standard and / or quality control product during detection to provide a reliable reference for the detection results, and can also be used to construct a standard curve.

[0073] In an optional embodiment, the anti-GBM antibody-positive disease and vasculitis independently include but are not limited to anti-glomerular basement membrane (anti-GBM) disease in small vessel vasculitis (also known as Goodpasture syndrome, anti-basement membrane glomerulonephritis, Goodpasture's disease or Goodpasture's disease).

[0074] In an optional embodiment, the vasculitis includes anti-neutrophil cytoplasmic antibody-associated vasculitis. Since the clinical symptoms of anti-glomerular basement membrane (anti-GBM) disease are extremely similar to the auxiliary diagnosis of anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis (AAV), it can also be used for its auxiliary diagnosis to distinguish whether the subject has anti-glomerular basement membrane disease or anti-neutrophil cytoplasmic antibody-associated vasculitis.

[0075] The applications of aspects (V) to (VIII) above can utilize the ability of GBM binding proteins to specifically target and bind to GBM antigens to achieve detection, separation, enrichment and / or purification of GBM antigens. In an optional embodiment, when the GBM binding protein is an immunoconjugate, for example, connected to a signal substance, the positioning or real-time detection of GBM antigens can be achieved by detecting the signal substance. In an optional embodiment, the detection, separation, enrichment and / or purification of GBM antigens is achieved by separating the anti-GBM antibody-GBM antigen immune complex.

[0076] In an optional embodiment, in the above aspects (II), (III), (IV), (VI) or (VIII), those skilled in the art can prepare corresponding products (such as the above-mentioned immunoconjugates) according to actual uses, and select other reagents in the product, including but not limited to one or more of signal substances, solid phase carriers, buffer reagents, salts, secondary antibodies, chromogenic substrates, blocking solutions, washing solutions, solvents, eluents, coupling agents, negative controls, positive controls, standards, quality control products and markers.

[0077] In the fifth aspect, a reagent or a kit is also provided, wherein the reagent or the kit comprises the GBM-binding protein of the first aspect or the biological material of the second aspect.

[0078] In an optional embodiment, the kit is used to detect anti-glomerular basement membrane antibodies, or for diagnosing and / or assisting in the diagnosis of anti-glomerular basement membrane antibody-positive diseases or anti-neutrophil cytoplasmic antibody-associated vasculitis; the kit includes standard substances and / or quality control substances, and the standard substances and / or the quality control substances contain the GBM binding protein.

[0079] In an optional embodiment, the kit is used for diagnosing and / or assisting in the diagnosis of anti-glomerular basement membrane (anti-GBM) disease.

[0080] In an optional embodiment, the kit further comprises a detection reagent, wherein the detection reagent comprises an anti-GBM antibody detection reagent.

[0081] In an optional embodiment, the kit is used for diagnosing and / or assisting in the diagnosis of anti-neutrophil cytoplasmic antibody-associated vasculitis, and the kit further comprises detection reagents for anti-myeloperoxidase antibodies and / or anti-proteinase 3 antibodies.

[0082] In an optional embodiment, the kit further comprises a solid phase carrier.

[0083] In an optional embodiment, the GBM binding protein in the reagent or kit is coupled to a solid phase carrier; or the GBM binding protein in the reagent or kit and the solid phase carrier are packaged separately. By coupling the GBM binding protein to a solid phase carrier, it can be used to capture GBM antigens in a sample to be tested. Or by coupling the GBM binding protein to a solid phase carrier, it can be used to purify GBM antigens.

[0084] In an optional embodiment, the anti-GBM antibody detection reagent includes a solid phase carrier coupled to a GBM antigen.

[0085] In an optional embodiment, the kit further comprises a signal substance.

[0086] In an optional embodiment, the GBM binding protein in the reagent or kit is coupled to a signal substance; or the GBM binding protein and the signal substance in the reagent or kit are packaged separately. By coupling the GBM binding protein to the signal substance, it can be used to locate and detect GBM antigens or detect GBM antigens in samples by Western blotting.

[0087] The above reagents or kits may also optionally include reagents and / or consumables used in the art for detection reactions or protein purification, which are well known to those skilled in the art, including but not limited to one or more of buffer reagents, salts, secondary antibodies, chromogenic substrates, blocking solutions, washing solutions, solvents, eluents, coupling agents, negative controls, positive controls, standards, quality control products and markers.

[0088] The above reagents or kits can be used in general immunoassay methods acceptable in the art, including but not limited to immunofluorescence staining, flow sorting, immunoblotting, immunohistochemistry, ELISA, immunochromatography or immunomagnetic beads. Those skilled in the art can prepare reagents or other reagents in the kit according to the corresponding detection means, and the present invention is not limited to this.

[0089] The signal substance in any of the above embodiments includes, but is not limited to, one or more of enzymes, luminescent labels, fluorescent microspheres, colored microspheres, latex microspheres, colloidal gold, quantum dots, biotin, streptavidin, radionuclides, radiocontrast agents, paramagnetic ions, metals and photosensitizers.

[0090] Examples of enzymes include, but are not limited to, alkaline phosphatase or horseradish peroxidase. Examples of luminescent labels include, but are not limited to, fluorescent proteins, synthetic small molecules or polymer dyes, and specific examples include, but are not limited to, Alexa350, Alexa 405, Alexa430, Alexa 488, Alexa 555, Alexa 647, AMCA, aminoacridine, BODIPY630 / 650, BODIPY650 / 665, BODIPY-FL, BODIPY-R6G, BODIPY-TMR, BODIPY-TRX, 5-carboxy-4′,5′-dichloro-2′,7′-dimethoxyfluorescein, 5-carboxy-2′,4′,5′,7′-tetrachlorofluorescein, 5-carboxyfluorescein, 5-carboxyrhodamine, 6-carboxyrhodamine, 6-carboxytetramethylrhodamine, Cascade Blue, Cy2, Cy3, Cy5, Cy7, 6-FAM, dansyl chloride, fluorescein, HEX, 6-JOE, NBD (7-nitrobenzo-2-oxa-1,3-oxadiazole), Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, phthalic acid, terephthalic acid, isophthalic acid, cresol fast violet, cresol blue violet, brilliant cresol blue, p-aminobenzoic acid, erythrosine, phthalocyanine, azomethine, cyanine, xanthine, succinylfluorescein, rare earth metal cryptates, trisbipyridyl diamine europium, europium cryptates or chelates, diamines, bicyanines, LaJolla blue dye, allophycocyanin, allococyanin One or more of B, phycocyanin C, phycocyanin R, thiamine, phycoerythrin, phycoerythrin R, REG, rhodamine green, rhodamine isothiocyanate, rhodamine red, ROX, TAMRA, TET, TRIT (tetramethylrhodamine isothiol), tetramethylrhodamine and Texas Red. Fluorescent microspheres, colored microspheres and latex microspheres are independently selected from products acceptable in the art, such as commercially available products. Radionuclides include but are not limited to 110 In, 111 In, 177 Lu, 18 F. 52 Fe, 62 Cu, 64 Cu, 67 Cu, 67 Ga, 68 Ga, 86 Y. 90 Y. 89 Zr, 94 mTc, 94 Tc, 99 mTc, 120 I.123 I. 124 I. 125 I. 131 I. 154-158 Gd, 32 P. 11 C. 13 N. 15 O. 186 Re, 188 Re, 51 Mn, 52 mMn, 55 Co. 72 As, 75 Br, 76 Br, 82 mRb and 83 Paramagnetic ions include, but are not limited to, one or more of chromium (III), manganese (II), iron (III), iron (II), cobalt (II), nickel (II), copper (II), neodymium (III), samarium (III), ytterbium (III), gadolinium (III), vanadium (II), terbium (III), dysprosium (III), holmium (III) and erbium (III).

[0091] The solid phase carrier in any of the above embodiments includes but is not limited to microtubes, columns, microparticles, nitrocellulose membranes, chromatography matrices or lateral flow devices; more specifically, for example, but not limited to, enzyme-labeled wells, immunochromatographic test strips or magnetic beads. The chromatography matrix can be any known chromatography matrix acceptable in the art, including but not limited to polystyrene, polysaccharide polymers or silica gel. In an optional embodiment, the chromatography matrix includes gel particles.

[0092] The present invention discloses a GBM binding protein, and further prepares a human-mouse chimeric recombinant monoclonal antibody. The present invention has the following beneficial effects:

[0093] (1) The present invention provides a GBM-binding protein with a known sequence and a preparation method thereof, which can be recombinantly expressed in vitro, is simple to operate, takes a short time, has a controllable production process, has a small difference between product batches, and has a good application prospect.

[0094] (2) The binding protein provided by the present invention has good affinity, and the affinity constant can reach 5.01E-10, and can specifically bind to glomerular basement membrane antigen. It can be used for the detection of glomerular basement membrane or its components, including but not limited to the use of liquid phase chip, immunofluorescence staining, flow sorting, fluorescent microspheres and other technologies to identify glomerular basement membrane antigen; the binding protein can also be coupled to the chromatography matrix for immunoaffinity chromatography purification of glomerular basement membrane antigen to improve the purity of the antigen.

[0095] (3) The binding protein can be used for anti-GBM antibody detection, anti-GBM antibody-positive diseases or antibodies in diagnostic / auxiliary diagnostic products for vasculitis-related diseases (such as anti-GBM disease in small vessel vasculitis), for example, as a quality control product and / or standard for anti-GBM antibody detection products; when the binding protein is used as a quality control product in a test kit, it can alleviate the problems of cumbersome immune polyclonal antibody operation and low subsequent coupling efficiency; it can reduce production costs, stabilize product quality, and significantly improve reaction values; on the other hand, compared with the direct use of human serum, it can also avoid the problems of difficult sample sources and high costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0096] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0097] Figure 1 The nucleic acid electrophoresis diagram of the heavy chain (Fd) and light chain (VL) used to construct the library in Example 1;

[0098] Figure 2 This is the nucleic acid electrophoresis diagram of the Fab gene fragment used to construct the library in Example 1;

[0099] Figure 3 It is the SDS-PAGE protein electrophoresis diagram of the four anti-GBM recombinant monoclonal antibodies in Example 2. GBM-Ab-non-reduced represents the result of non-reduced SDS-PAGE electrophoresis, with a size of about 150 kDa, GBM-Ab-reduced represents the result of reduced SDS-PAGE electrophoresis, with a heavy chain and a light chain of 50 kDa and 25 kDa, respectively, GBM-Ab-1 represents recombinant antibody No. 1, GBM-Ab-2 represents recombinant antibody No. 2, GBM-Ab-3 represents recombinant antibody No. 3, and GBM-Ab-4 represents recombinant antibody No. 4;

[0100] Figure 4 is a line graph of recombinant antibody No. 1 in Example 4;

[0101] Figure 5 The affinity of a recombinant antibody to GBM protein was determined by the SPR method in Example 5. DETAILED DESCRIPTION

[0102] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0103] In all the following examples, GBM antigen was purchased from Wuhan Biobio Biotechnology Co., Ltd., with the code number PB-GBM.

[0104] Example 1 Screening of GBM-binding proteins

[0105] (I) Preparation of phage display library

[0106] 1) The spleen of mice immunized with GBM antigen was removed, and lymphocytes were separated using mouse lymphocyte separation medium.

[0107] 2) Extract RNA: Extract total RNA from lymphocytes.

[0108] 3) Reverse transcription: The extracted total RNA is reverse transcribed to synthesize cDNA.

[0109] 4) Antibody gene fragment amplification: Using cDNA as a template, specific amplification primers are used to amplify the antibody's κ, λ light chains and the VH-CH1 (Fd) region of the heavy chain.

[0110] 20μL reaction system: 1μL cDNA, 0.8μL Prime F, 0.8μL Prime R, 10μL 2× phantamax master mix, 7.4μL Nuclease-Free Water; reaction procedure: melting at 95℃ for 30s, annealing at 55℃ for 30sec, extension at 72℃ for 45s, 30 cycles.

[0111] After the reaction, loading buffer was added to the system and 1% agarose gel electrophoresis was performed. The electrophoresis pattern was as follows: Figure 1 shown.

[0112] The target band was cut out and the antibody heavy chain (Fd, about 750 bp) gene fragment and light chain gene fragment (VL, about 350 bp) were recovered respectively.

[0113] 5) The antibody light chain and heavy chain gene fragments are combined into a complete Fab gene fragment through overlapping PCR.

[0114] 25μL reaction system and procedure: 30ng light chain, 4.3ng CL+linker, 30ng heavy chain, 0.5μL sfiⅠF (upstream primer), 0.5μL sfiⅠR (downstream primer), 12.5μL 2×phantamax master mix, and Nuclease-Free Water to make up the total system to 25μL.

[0115] Reaction program: melting at 95°C for 30 s, annealing at 55°C for 30 sec, extension at 72°C for 90 s, for 30 cycles.

[0116] After the reaction, loading buffer was added to the system and 1% agarose gel electrophoresis was performed. The electrophoresis pattern was as follows: Figure 2 As shown, the target band is about 1500 bp. The target band is cut out and the antibody Fab fragment is recovered.

[0117] Upstream primer sfiIF: 5'>GAGCAGGAGCATAGGAGGATCGGGCGGCGGCC<3' (SEQ ID NO. 27);

[0118] Downstream primer sfiI R: 5'>CCATGGCAATGGTGATTCTGCTGCGCGGCCTGGCC<3' (SEQ ID NO. 28).

[0119] 6) Plasmid construction: The antibody Fab fragment and pComb3xSS plasmid were digested with sfiⅠ enzyme, respectively, and the digested fragments were mixed at a molar ratio of 3:1 to plasmid. T4 DNA ligase was added and ligated at 16°C overnight.

[0120] 7) Library construction: Recover the ligation product in the previous step. Take 1.5 μL of the recovered product, add TG1 competent medium, mix well and transfer to the electroporation cup for electroporation, parameter selection: Bac-Ec1. After electroporation, activate and culture at 37°C for 1 hour, transfer the activated bacterial solution to 200 ml 2×YT medium, add 1 / 1000 ampicillin antibiotics and a final concentration of 2% glucose solution, and culture at 37°C and 220rpm until OD600 = 0.6. Add 20 times the number of bacteria of the helper phage M13K07. After mixing, place it in a 37°C shaker for static infection for 45 minutes. Centrifuge for 15 minutes to collect the bacteria, resuspend the precipitate with 200 mL of new 2×YT+Amp+Kana medium, and shake the bacteria at 30°C and 220rpm for 14 hours for phage amplification. Centrifuge and collect the supernatant the next day, add 1 / 4 volume of 20% PEG6000 to precipitate the phage, and resuspend it with PBS to obtain a phage display library.

[0121] (II) Selection of anti-GBM antibodies using phage display library

[0122] 1) GBM protein coupled with biotin was used as the target antigen. After incubation with SA magnetic beads for 1 hour, 1×10 12 The phages obtained in the previous step were incubated for 1 hour, and the specific phages were captured by the antigens. The phages were washed with PBST (PBS + 0.05% Tween-20).

[0123] 2) Add the antigen-bound magnetic beads to the TG1 bacterial solution, incubate at 37°C for 45 minutes, and then activate and culture at 37°C, 220 rpm for 1 hour. Take an appropriate amount of the bacterial solution after static infection and apply gradient dilutions to the ampicillin plate. Add glucose (final concentration of 2%) and 1 / 1000 ampicillin antibiotic to the remaining bacterial solution and shake at 37°C, 220 rpm for 3 hours.

[0124] 3) Add 10 μL M13K07 to the bacterial solution and incubate at 37°C for 45 min for infection.

[0125] 4) Centrifuge at 6000×g for 10 min, resuspend in 10 mL 2×YT+Amp+kana medium, and shake at 30°C, 220 rpm for 14 h to amplify phages. Centrifuge the next day, collect the supernatant, add 1 / 4 volume of 20% PEG6000 to precipitate the phages, and resuspend in PBS to obtain the phages for the first round of screening.

[0126] 5) Using the phages obtained in the first round of screening, repeat steps 1 to 4 to perform the second round of screening.

[0127] 6) Identification of single clones: Single clones were selected from the second round of screening on the coated plates and placed in 96-well deep-well plates, and phages were amplified overnight by shaking.

[0128] Coating: GBM antigen was coated on the ELISA plate, and BSA was used as the control protein to coat the plate at 4°C overnight.

[0129] Blocking: The next day, discard the coating solution, wash the plate with PBST, pat dry, add 3% milk, and block at 37°C for 2 h.

[0130] Primary antibody preparation: Centrifuge the 96-well deep-well plate, take the supernatant and dilute it in milk with a final concentration of 1%, mix well and use as the primary antibody.

[0131] Primary antibody incubation: discard the blocking solution, wash the plate with PBST, pat dry, add primary antibody, and incubate at 37°C for 2 h.

[0132] Secondary antibody incubation: discard the primary antibody, wash the plate with PBST, pat dry, add 1:5000 diluted Anti-M13 Antibody (HRP) secondary antibody, and incubate at 37℃ for 1h. Discard the secondary antibody, wash the plate with PBST, pat dry, add the color substrate for color development, add the stop solution after 15min to stop the reaction, and read the results with an ELISA reader.

[0133] 7) Select clones with high read values ​​(GBM antigen well OD value>1) and low non-specific binding (BSA control protein well OD value<0.5) for sequencing.

[0134] Light chain sequencing primer: Bomp: 5′>GTGTGGAATTGTGAGCGG<3′ (SEQ ID NO. 29);

[0135] Heavy chain sequencing primer: PELB: 5'>ACCTATTGCCTACGGCAGCCG<3' (SEQ ID NO. 30).

[0136] A total of 20 monoclones were selected for sequencing, and the sequencing results showed a total of 4 different GBM-binding protein sequences including antigen-binding domains.

[0137] Example 2: Expression and purification of anti-GBM recombinant monoclonal antibodies

[0138] After sequencing the candidate antibody Fab region sequence, gene synthesis is performed:

[0139] The vector selected was the pTT5 plasmid, with EcoRI+BamHI as the cloning site, and the light chain gene fragment was inserted. The light chain constant region sequence is shown in SEQ ID NO.4, which is a mouse sequence.

[0140] The CH1 of the heavy chain was replaced with the CH1 of human IgG1, and the Fc of human IgG1 was fused at the C-terminus. The complete heavy chain fragment was inserted into the pTT5 plasmid using EcoRI+BamHI as cloning sites. The heavy chain constant region sequence is shown in SEQ ID NO.3, which is a human sequence.

[0141] The gene was expressed using the mammalian cell 293F expression system.

[0142] 1) Plasmid extraction: The gene-synthesized plasmids were transformed into TOP10 competent cells, activated for 1 hour, transferred to LB medium, cultured at 37°C overnight, and extracted using an endotoxin-free plasmid extraction kit the next day to obtain the corresponding heavy chain plasmid and light chain plasmid.

[0143] 2) One day before transfection, 293F cells were inoculated into a suspension cell culture flask and the cell density was controlled to be 1×10 6 Pieces / mL.

[0144] 3) The next day, dilute 40 μg of heavy chain plasmid and 80 μg of light chain plasmid in 6 mL of transfection buffer and mix gently, add 480 μL of PEI and mix gently, incubate at room temperature for 20 minutes, add dropwise to the cells, place the cells in an incubator, and culture them in suspension at 98 rpm, 37°C, and 5% CO2.

[0145] 4) After 6 days, the culture supernatant was collected, IgG was purified using rProteinA filler, eluted with 0.1M Glycine (pH 3.0), and neutralized by adding 1M Tris (pH 8.0). After elution, the ultrafiltration centrifuge tube was replaced with PBS buffer and concentrated, the protein concentration was determined, and further concentrated to 1 mg / mL.

[0146] The purity was verified by SDS-PAGE. Figure 3 shown.

[0147] Example 3 Chemiluminescence determination of the binding activity of recombinant monoclonal antibodies to GBM antigens

[0148] The detection performance of the four recombinant monoclonal antibodies was further tested as follows:

[0149] 1) The four recombinant antibodies were diluted 20, 100, 200, 500, and 1000 times respectively and tested on the machine (repeated 3 times).

[0150] 2) Calculate the concentration value at the mean of each point and make an evaluation.

[0151] 3) The average value of the detected concentration was fitted with the theoretical concentration using the least squares method to obtain a linear regression equation and examine the linearity.

[0152] The test results are shown in Table 3.

[0153] Table 3 Binding activity of antibodies No. 1 to 4 to GBM antigens

[0154]

[0155] *Concentration value unit LU / mL Antibody No. 1 linearity is shown in Table 4 and Figure 4 shown.

[0156] Table 41 Antibody Linearity

[0157]

[0158]

[0159] According to the results, the titer and linearity of antibody No. 1 were qualified.

[0160] According to the sequencing results, the heavy chain variable region sequence of antibody No. 1 is shown in SEQ ID NO. 1, and the light chain variable region sequence is shown in SEQ ID NO. 2. Further analysis shows that the antigen binding domain includes the following light chain and heavy chain CDRs, and the corresponding light chain complete sequence of the recombinant monoclonal antibody is shown in SEQ ID NO. 6, and the heavy chain complete sequence is shown in SEQ ID NO. 5.

[0161] Table 1 Heavy chain CDR of VH shown in SEQ ID NO.1

[0162]

[0163] Table 2 Light chain CDR of VL shown in SEQ ID NO.2

[0164]

[0165] Example 4 Determination of the affinity of recombinant monoclonal antibody No. 1 to GBM antigen by SPR method

[0166] The affinity of the screened recombinant antibody No. 1 to GBM protein was further determined:

[0167] 1) Ligand preparation: Dilute the antibody to 10 μg / mL with sample diluent.

[0168] 2) Analyte preparation: Dilute GBM antigen to 32 μg / mL with sample diluent.

[0169] 3) Chip cleaning: Wash twice with 150 μl / well of regeneration solution, sample diluent, and ultrapure water, and pat dry.

[0170] 4) Ligand fixation: Set the ligand fixation parameters, and add 50 μL / well of sample diluent to run the baseline according to the prompts. After the baseline is run, take out the chip board from the instrument and spin dry, then add 50 μL / well of the prepared ligand solution to the chip board to fix the ligand.

[0171] 5) Affinity determination: After the ligand is fixed, remove the chip immediately, pour out the ligand solution, and pat dry. Set the affinity detection parameters, and add 50 μL / well of the prepared analyte for binding and dissociation operations according to the prompts.

[0172] 6) Data processing: Set calculation parameters and calculate antigen-antibody affinity. Figure 5 The affinity constant of recombinant antibody No. 1 to GBM antigen is 5.01E-10.

[0173] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A binding protein that specifically binds to the glomerular basement membrane, characterized in that: comprising a heavy chain variable region and a light chain variable region; The heavy chain variable region includes complementary determining regions VH-CDR1, VH-CDR2 and VH-CDR3; the light chain variable region includes complementary determining regions VL-CDR1, VL-CDR2 and VL-CDR3; The VH-CDR1, VH-CDR2 and VH-CDR3 include amino acid sequences consistent with VH-CDR1, VH-CDR2 and VH-CDR3 of the heavy chain variable region shown in SEQ ID NO.1; The VL-CDR1, VL-CDR2 and VL-CDR3 include amino acid sequences consistent with VL-CDR1, VL-CDR2 and VL-CDR3 of the light chain variable region shown in SEQ ID NO.

2.

2. The binding protein according to claim 1, characterized in that The VH-CDR1, VH-CDR2, VH-CDR3, VL-CDR1, VL-CDR2 and VL-CDR3 of the binding protein are defined by any one system or a combination of multiple definition systems of Kabat, Chothia, IMGT, ABM or Contact; Optionally, according to the IMGT definition: the amino acid sequence of the VH-CDR1 is shown in SEQ ID NO.11, the amino acid sequence of the VH-CDR2 is shown in SEQ ID NO.16, and the amino acid sequence of the VH-CDR3 is shown in SEQ ID NO.19; Optionally, the amino acid sequence of the VL-CDR1 is as shown in SEQ ID NO.22, the amino acid sequence of the VL-CDR2 is RVS, and the amino acid sequence of the VL-CDR3 is as shown in SEQ ID NO.

25.

3. The binding protein according to claim 1, characterized in that The remaining sequence of the binding protein except the CDR region is derived from one or more species of rabbit, cattle, horse, dairy cow, pig, sheep, goat, rat, mouse, dog, cat, camel, donkey, deer, mink, chicken, duck, goose, turkey, fighting cock, human and their mutants; Optionally, the heavy chain variable region further comprises a framework region, and / or the light chain variable region further comprises a framework region; Optionally, at least one framework region of the heavy chain variable region comprises an amino acid sequence consistent with the framework region of the heavy chain variable region shown in SEQ ID NO.1; Optionally, at least one framework region of the light chain variable region comprises an amino acid sequence consistent with the framework region of the light chain variable region shown in SEQ ID NO.2; Optionally, the amino acid sequence of the heavy chain variable region of the binding protein is shown as SEQ ID NO.1, and the amino acid sequence of the light chain variable region is shown as SEQ ID NO.

2.

4. The binding protein according to any one of claims 1 to 3, characterized in that The binding protein is a complete antibody, F(ab')2, Fab', Fab, Fv, scFv, dsFv, bispecific antibody or the minimum recognition unit of an antibody; Optionally, the binding protein further comprises a constant region; Optionally, at least a portion of the constant region sequence is a human constant region sequence; Optionally, the constant region sequence is selected from a sequence of a partial or complete constant region of any one of IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE or IgD; Optionally, the binding protein contains a heavy chain constant region, and the heavy chain constant region sequence is selected from a human heavy chain constant region; Optionally, the amino acid sequence of the heavy chain constant region is shown in SEQ ID NO.3; Optionally, the binding protein contains a light chain constant region; Optionally, the light chain constant region sequence is selected from the light chain constant region of a mouse, and the amino acid sequence of the light chain constant region is shown in SEQ ID NO.

4.

5. The binding protein according to claim 4, characterized in that The binding protein is a complete antibody, the heavy chain amino acid sequence is shown in SEQ ID NO.5, and the light chain amino acid sequence is shown in SEQ ID NO.

6.

6. Biomaterial, characterized in that including a polynucleotide, a vector or a cell; The polynucleotide encodes the binding protein according to any one of claims 1 to 5; The vector carries the polynucleotide; The cell carries the polynucleotide, or contains the vector, or is capable of expressing the binding protein according to any one of claims 1 to 5.

7. The method for preparing the binding protein according to any one of claims 1 to 5, characterized in that: Comprising culturing the cell as claimed in claim 6; Optionally, the cell is obtained by transforming a polynucleotide encoding the binding protein according to any one of claims 1 to 5 into a cell, wherein the polynucleotide comprises a heavy chain expression plasmid and a light chain expression plasmid, and the transformation comprises co-transforming the heavy chain expression plasmid and the light chain expression plasmid into the cell; Optionally, the cell is a eukaryotic cell, preferably a mammalian cell; Optionally, the mammalian cells include 293 cells or CHO cells, preferably 293F cells.

8. Use of the binding protein according to any one of claims 1 to 5, or the biomaterial according to claim 6 in any one of the following (I) to (VIII): (I) Detection of anti-glomerular basement membrane antibodies for non-diagnostic and therapeutic purposes; (II) Preparation of products for detecting anti-glomerular basement membrane antibodies; (III) Preparation of products for diagnosis and / or auxiliary diagnosis of anti-glomerular basement membrane antibody-positive diseases; (IV) preparing products for diagnosis and / or aiding diagnosis of vasculitis; (V) Detection of glomerular basement membrane antigen for non-diagnostic and therapeutic purposes; (VI) preparing products for detecting glomerular basement membrane antigen; (VII) for separating, enriching and / or purifying glomerular basement membrane antigens; (VIII) preparing products for isolating, enriching and / or purifying glomerular basement membrane antigens; Optionally, the anti-glomerular basement membrane antibody-positive disease and vasculitis each independently include anti-glomerular basement membrane disease in vasculitis; Optionally, the vasculitis comprises anti-neutrophil cytoplasmic antibody-associated vasculitis; Optionally, in any one of (I) to (IV), the binding protein is used as a standard or quality control substance.

9. A reagent or a kit, characterized in that The reagent or kit comprises the species-specific binding protein to the glomerular basement membrane according to any one of claims 1 to 5, or the biomaterial according to claim 6.

10. The reagent or kit according to claim 9, characterized in that The kit is used for detecting anti-glomerular basement membrane antibodies, or for diagnosing and / or assisting in the diagnosis of anti-glomerular basement membrane antibody-positive diseases or vasculitis; the kit comprises a standard substance and / or a quality control substance, and the standard substance and / or the quality control substance contain the binding protein; Optionally, the kit is used for diagnosing and / or assisting in the diagnosis of anti-neutrophil cytoplasmic antibody-associated vasculitis, and the kit further comprises detection reagents for anti-myeloperoxidase antibodies and / or anti-proteinase 3 antibodies.

Images