A strain of desulfurizing Vibrio and its application in the remediation of sulfate and halogenated hydrocarbon contamination

By using desulfuric vibrio Co to oxidize organic matter and sulfate under anaerobic conditions, the problem of low degradation efficiency in environments where sulfate and halogenated hydrocarbons coexist was solved, achieving efficient degradation of sulfate and 1,1,1-trichloroethane and providing resources for pollution remediation.

CN119709508BActive Publication Date: 2026-06-30SHENYANG INST OF APPL ECOLOGY CHINESE ACAD OF SCI

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SHENYANG INST OF APPL ECOLOGY CHINESE ACAD OF SCI
Filing Date
2024-12-19
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

In existing technologies, sulfate-reducing bacteria have difficulty effectively cometolytically degrading saturated halogenated hydrocarbons such as 1,1,1-trichloroethane. Furthermore, in environments where sulfate and halogenated hydrocarbons coexist, the degradation efficiency of the two pollutants is affected by competition for nutrients within the bacterial community.

Method used

A strain of desulfurizing Vibrio Co was used to prepare a microbial agent for pollution remediation by oxidizing organic matter and degrading sulfate sulfides and haloalkanes, especially 1,1,1-trichloroethane, under anaerobic conditions using sulfate as an electron acceptor.

Benefits of technology

This strain can completely reduce sulfate oxidized sulfides to hydrogen sulfide within 15-20 days and degrade 50-60% of 1,1,1-trichloroethane to 1,1-dichloroethane, providing an in-situ remediation resource for sulfate and halohydrocarbon contaminated sites.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119709508B_ABST
    Figure CN119709508B_ABST
Patent Text Reader

Abstract

This invention relates to the field of environmental bioremediation, specifically to a novel strain of *Desulfovibrio* Co. and its application in reducing sulfate-oxidizing sulfides and degrading and converting 1,1,1-trichloroethane. The *Desulfovibrio* Co. strain was deposited on February 24, 2024, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, 100101, China, accession number CGMCCNo. 41182.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of environmental bioremediation, specifically to a strain of desulfurizing Vibrio and its application in the remediation of sulfate (sulfate oxides) and halogenated hydrocarbon pollution (1,1,1-trichloroethane). Background Technology

[0002] Sulfates, sulfites, and thiosulfates (collectively referred to as sulfate sulfides in this article) are an important class of inorganic compounds widely used in chemical synthesis and industrial production activities such as fertilizers, pesticides, metal smelting, and petroleum refining. The widespread use of sulfate sulfides in industrial production leads to their ubiquitous presence in the environment. These compounds can react with various harmful heavy metal ions to form stable salts, thereby exacerbating environmental pollution. Sulfate reduction refers to the biochemical reaction process in which sulfate-reducing bacteria reduce sulfate sulfides to hydrogen sulfide under anaerobic conditions. This is an important component of the Earth's sulfur cycle and is widely present in marine sediments, wetlands, swamps, groundwater, and other environmental media. Halogenated hydrocarbons are also common organic compounds in sediments and groundwater environments. Halogenated hydrocarbon emissions from industrial and agricultural production cause significant environmental pollution. In my country, chloroalkanes, including trichloroethane and dichloroethane, are the most serious sources of halogenated hydrocarbon pollution in groundwater environments. Halogenated hydrocarbons are primarily degraded and transformed in anaerobic environments through reductive dehalogenation reactions, driven mainly by a class of obligate organohalogen-respiring bacteria. The coexistence of sulfate and halogenated hydrocarbon pollutants is common in anaerobic environments such as groundwater. When sulfate-reducing bacteria and organohalogen-respiring bacteria exert their catalytic reduction activities, these two different microbial communities compete for carbon and electron donors under coexisting conditions, affecting the degradation efficiency of both pollutants.

[0003] Besides their primary role in catalyzing sulfate reduction, sulfate-reducing bacteria often exhibit a wider range of metabolic activities. In anaerobic environments, they not only directly participate in sulfur conversion but are also closely involved in organic matter degradation. Utilizing sulfate as an electron acceptor, sulfate-reducing bacteria oxidize organic matter, producing mineralized products such as carbon dioxide. This not only contributes to the degradation of organic matter in anaerobic environments but also indirectly influences the global carbon cycle. Furthermore, while reducing sulfate, sulfate-reducing bacteria can also degrade some organic pollutants, such as aromatic compounds and halogenated hydrocarbons, through cometabolism, converting them into more readily degradable, less toxic, or low-halogenated compounds. This simultaneous sulfate reduction and degradation of halogenated hydrocarbons overcomes the degradation efficiency reduction caused by nutrient competition within the bacterial community, playing a crucial role in pollutant removal and environmental remediation.

[0004] Reports indicate that some sulfate-reducing bacteria, such as *Desulfovibrio*, *Desulfobacter*, and *Desulforomonas*, can cometobolize dechlorinated halogenated hydrocarbons, but only chlorinated alkenes, such as tetrachloroethylene and trichloroethylene. Halogenated hydrocarbons are classified into saturated and unsaturated types. Unsaturated halogenated hydrocarbons, such as halogenated alkenes, contain carbon-carbon double bonds, are highly reactive, and readily degraded and transformed through chemical and biological reactions. Saturated halogenated hydrocarbons, such as halogenated alkanes, have their atoms bonded together by strong δ-bonds, making them highly stable and less susceptible to degradation and transformation. Currently, there are no reports of sulfate reduction and cometobolism of chlorinated alkanes; no strains in the *Desulfovibrio* genus have been found capable of cometobolically degrading chlorinated alkanes. Summary of the Invention

[0005] The purpose of this invention is to provide a strain of desulfurizing Vibrio and its application in the remediation of sulfate (sulfate oxides) and halogenated hydrocarbon contamination (1,1,1-trichloroethane).

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0007] A strain of Desulfovibrio sp. was deposited on February 24, 2024, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, 100101, China, accession number CGMCC No. 41182.

[0008] The strain Co is a Gram-negative bacterium, and its 16S rRNA gene sequence has a similarity of 98.95% to that of strain ALA-3 of the aminophilus species of the genus *Desulfovibrio*. Therefore, strain Co is identified as belonging to *Desulfovibrio*.

[0009] An application of the aforementioned desulfurizing Vibrio, specifically the application of strain Co in the degradation of sulfate sulfides and haloalkanes.

[0010] Application of the strain in the degradation of sulfate sulfides and haloalkanes in environmental systems such as water and soil.

[0011] Application of strain Co in the reduction of sulfate-based sulfides.

[0012] The sulfate-type sulfide oxides are one or more of sulfates, sulfites, and thiosulfates.

[0013] Application of strain Co in the dechlorination and degradation of haloalkanes.

[0014] The haloalkane is 1,1,1-trichloroethane.

[0015] A microbial agent for degrading pollutants, the microbial agent containing the aforementioned Vibrio desulfurans Co strain.

[0016] The bacterial agent is one or more of the following: culture, suspension, concentrate, and separation liquid of the bacterial strain.

[0017] The strain was cultured by adding a carbon source, electron donor, and electron acceptor to an anaerobic inorganic salt medium, and then inoculating the *Desulfovibrio* Co strain at pH 7.2, 37°C, and incubating in the dark. The carbon source and electron donor were lactate; the electron acceptor was sulfate, sulfite, or thiosulfate.

[0018] The obtained culture was centrifuged to collect the precipitate, which was then resuspended to obtain a resuspended solution; the liquid phase was the separation solution; the culture was concentrated to obtain a concentrate.

[0019] The application of a microbial agent for degrading pollutants, wherein the microbial agent is used in the degradation of sulfate sulfides and haloalkanes.

[0020] Advantages of this invention:

[0021] The Co strain obtained in this invention is a desulfurization Vibrio strain screened from polluted river sediment.

[0022] Strain Co is a Gram-negative bacterium. Through 16S rRNA gene sequence similarity comparison, it showed a species similarity of 98.95% with strain ALA-3 of the aminophilus species in the genus Desulfovibrio, thus identifying strain Co as Desulfovibrio.

[0023] Strain Co, growing at 37°C and pH 7.2, can degrade sulfate, sulfite, and thiosulfate into hydrogen sulfide, and can tolerate sulfate concentrations up to 20 mM. Furthermore, this strain can degrade most of the added 88 μmol of 1,1,1-trichloroethane into 1,1-dichloroethane. These degradation capabilities of strain Co provide an important microbial resource for the in-situ remediation of sulfate and 1,1,1-trichloroethane contaminated sites. Attached image description:

[0024] Figure 1 This is a scanning electron microscope image of the cell morphology of strain Co provided in an embodiment of the present invention;

[0025] Figure 2 The degradation curve of sodium sulfate by strain Co provided in this embodiment of the invention;

[0026] Figure 3 The degradation curve of sodium sulfite by strain Co provided in this embodiment of the invention;

[0027] Figure 4 The degradation curve of sodium thiosulfate by strain Co provided in the embodiments of the present invention;

[0028] Figure 5 The degradation curve of 1,1,1-trichloroethane by strain Co provided in this embodiment of the invention. Detailed implementation method:

[0029] The technical solution of the present invention will be further explained below with reference to specific embodiments, but it should not be construed as a limitation of the present invention.

[0030] Example 1: Isolation, purification and identification of strains

[0031] (1) Prepare the basic culture medium:

[0032] The anaerobic inorganic salt culture medium consists of: NaCl 1.0 g / L, MgCl2·6H2O 0.5 g / L, KH2PO4 0.2 g / L, NH4Cl 0.3 g / L, KCl 0.3 g / L, CaCl2·2H2O 0.015 g / L, FeCl2·4H2O 1.5 mg / L, CoCl2·6H2O 190 μg / L, MnCl2·4H2O 100 μg / L, ZnCl2 70 μg / L, H3BO3 6 μg / L, Na2MoO4·2H2O 36 μg / L, NiCl2·6H2O 24 μg / L, CuCl2·2H2O 2 μg / L, Na2SeO3·5H2O 6 μg / L, and Na2WO4·2H2O. Add 8 μg / L resazu indicator 0.025% (w / v), L-cysteine ​​24 mg / L, dithiothreitol 38.5 mg / L, and NaHCO3 2.52 g / L (30 mM) to adjust the pH to 7.2-7.3. After autoclaving at 121℃ for 15 minutes, add compound vitamins. The final concentrations of various vitamins in the culture medium are as follows: biotin 20 μg / L, folic acid 20 μg / L, pyridoxine hydrochloride 100 μg / L, riboflavin 50 μg / L, thiamine 50 μg / L, pantothenic acid 50 μg / L, nicotinic acid 50 μg / L, vitamin B12 50 μg / L, para-aminobenzoic acid 50 μg / L, and lipoic acid 50 μg / L.

[0033] (2) Enrichment by sulfate-reducing anaerobic degrading bacteria:

[0034] Dispense 80 mL of the anaerobic inorganic salt culture medium described in step (1) into a 120 mL serum bottle, add 20 mM sodium lactate as a carbon source and electron donor, and 5 mM Na2SO4 as an electron acceptor. The headspace gas is N2 / CO2 (80 / 20, v / v). In an anaerobic glove box, inoculate 3 mL of sediment mud suspension (collected from Xihe River, Shenyang, Liaoning) and seal the serum bottle with a blue rubber stopper and aluminum cap to establish an enrichment culture system. Incubate at pH 7.2, 37℃, and in the dark. Monitor the hydrogen sulfide generation process using a methylene blue spectrophotometer. Calculate the mass balance. After sodium sulfate is completely converted to hydrogen sulfide, repeatedly transfer the culture to the enrichment system in step (2) at an inoculation rate of 3% (v / v), for a total of 5 transfers.

[0035] (3) Isolation of sulfate-reducing anaerobic degrading bacteria:

[0036] Dispense 9 mL of the inorganic culture medium described in step (1) into a 20 mL culture flask. The headspace gas is N2 / CO2 (80 / 20, v / v). After sealing with a blue rubber stopper and aluminum cap, add 5 mM Na2SO4 through a microsyringe. Transfer 1 mL of the enriched culture of the sulfate-reducing anaerobic degrading bacteria from the 120 mL serum bottle in step (2) into the culture flask to establish a 10-year culture. -1 Dilute bottles, and so on, repeat the above 10-fold serial dilution operation until a 10-fold serial dilution is established. -10 Dilution bottle. Wait 10... -10 After the Na2SO4 in the diluted culture medium was completely degraded to hydrogen sulfide, approximately 50 μL of the culture medium was spread onto a petri dish containing 20 mM sodium lactate and 5 mM Na2SO4 (the solid culture medium was prepared by adding 2% agar powder to the liquid culture medium in step (1) above). The petri dishes were transferred to an anaerobic glove box and incubated at 37°C in the dark for 10-20 days. Single colonies were picked and inoculated into a liquid culture medium containing 5 mM Na2SO4 and 20 mM sodium lactate, and then incubated statically at pH 7.2 and 37°C in the dark. The Na2SO4-degrading bacteria were isolated and purified by monitoring the degradation of Na2SO4.

[0037] (4) Identification of strains:

[0038] The Na2SO4-degrading strains obtained through the above screening process have smooth, white colonies. The bacterial cells are arc-shaped and Gram-negative (see [link to relevant documentation]). Figure 1 The genome was extracted using a soil genomic DNA extraction kit. PCR amplification was performed using universal primers 27F (5'-AGAGTTTGATCCTGGCTCAG-3') and 1492R (5'-GGTTACCTTGTTACGACTT-3') for the bacterial 16S rRNA gene. The amplified products were then submitted to a sequencing company for sequencing.

[0039] The 16S rRNA gene sequence is:

[0040] TTTCAACTGGAGAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCGT

[0041] GCTTAACACATGCAAGTCGTGCGAGAAAGGTTCCTTCGGGGACTGAG

[0042] TAGAGCGGCGCACGGGTGAGTAACGCGTGGGTGACCTACCCAGGAG

[0043] ACCGGGATAACAGTGGGAAACTGCTGCTAATACCGGGTACGCTTCATA

[0044] TTTCACGTATGGGGGAAAGGCGGCCTCTGCTTGCAAGCTGCCACTCTT

[0045] GGATGGGCCCGCGTCTCATTAGCTTGTTGGTAGGGTAACGGCCTACCA

[0046] AGGCGACGATGAGTAGCTGGTCTGAGAGGATGATCAGCCACACTGGG

[0047] ACTGGAACACGGCCCAGACTCCTACGGGAGGCAGCAGTGGGGAATAT

[0048] TGCGCAATGGGCGAAAGCCTGACGCAGCGACGCCGCGTGAGGGAAG

[0049] AAGGCCTTCGGGTCGTAAACCTCTGTCAGGAGGGAAGAAACCATGGG

[0050] [[ID=​​​​​​​​GATGTGAAAGCCCTCGGCTCAACCGGGGAACTGCATTCGATACTGCG

[0054] GTGCTTGAGTGTCGGAGAGGGTGGCGGAATTCCAGGTGTAGGAGTGA

[0055] AATCCGTAGATATCTGGAGGAACACCAGTGGCGAAGGCGGCCACCTG

[0056] GCCGACAACTGACGCTGAGGTGCGAAAGCGTGGGGATCAAACAGGA

[0057] TTAGATACCCTGGTAGTCCACGCTGTAAACGATGGATGCTAGGTGTCG

[0058] GGGGTTTACCCTCGGTGCCGCAGTTAACGCGTTAAGCATCCCGCCTGG

[0059] GGAGTACGGTCGCAAGGCTGAAACTCAAAGGAATTGACGGGGGCCC

[0060] GCACAAGCGGTGGAGTATGTGGTTTAATTCGATGCAACGCGAAGAAC

[0061] CTTACCTGGGTTTGACATCCCGCGAATCCCTATGAAAATAGGGAGTGC

[0062] CCTTCGGGGAGCGCGGAGACAGGTGCTGCATGGCTGTCGTCAGCTCG

[0063] TGCCGTGAGGTGTTGGGTTAAGTCCCGCAACGAGCGCAACCCTTGTT

[0064] GCCAGTTGCTACCAGGTAATGCTGGGCACTCTGGCGAGACTGCCCGG

[0065] GTCAACCGGGAGGAAGGTGGGGACGACGTCAAGTCATCATGGCCCTT

[0066] ACATCCAGGGCTACACACGTACTACAATGGCAGGTACAAAGGGTTGC

[0067] CAAGCCGCGAGGCCGCGCTAATCCCAGAAAGCCTGTCTCAGTCCGGA

[0068] TTGCAGTCTGCAACTCGACTGCATGAAGCTGGAATCGCTAGTAATCCC

[0069] GGATCAGCATGCCGGGGTGAATACGTTCCCGGGCCTTGTACACACCGC

[0070] CCGTCACACCACGAAAGCTGGTTTTACCCGAAGCCGGCGGACTAACC

[0071] GCAAGGGGGTAGCCGTCTACGGTAGGACCGGTGATTGGGGTGAAGTC

[0072] GTAACAAGGTAGCCGTAGGGGAACCTGCGGCTGGATCACCTCCTTTA

[0073] AA

[0074] BLAST analysis of the 16S rRNA gene sequence of this strain showed that it shared 98.95% species homology with ALA-3 strain from the genus *Desulfovibrio* (aminophilus). This strain was classified as *Desulfovibrio* and named Co., and is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, 100101, China, accession number CGMCC 41182.

[0075] Example 2: Identification of sulfate degradation performance of strain Co

[0076] Add 20 mM sodium lactate to the 80 mL anaerobic inorganic salt basal medium described in step (1) above. Sodium lactate serves as both a carbon source and an electron donor, and 5 mM Na2SO4 is added simultaneously as an electron acceptor. Inoculate pure Co bacteria at 1% (v / v) and incubate statically at pH 7.2 and 37°C in the dark. Use a UV spectrophotometer (UH5300 UV / VIS) to detect S... 2-The generated curve represents the sulfate reduction process. The UV spectrophotometer parameters are as follows: absorbance / transmittance measurement, data mode selected as Abs, wavelength 480nm. Measurement procedure: Solution 1: a mixture of hydrochloric acid (50mM) and copper sulfate (5mM) as the measurement group; Solution 2: hydrochloric acid (50mM) as the control group. Add 0.1mL of culture supernatant to each of 3.9mL solutions 1 and 2, mix immediately, and quickly measure the absorbance of solution 1 at 480nm with solution 2 as the substrate control. Subtract the measurement result of solution 2 from the measurement result of solution 1. Based on the measured S... 2- Concentration values ​​are used to detect sulfate reduction (see...) Figure 2 ).

[0077] Analysis showed that the Co strain could completely reduce 5 mM Na2SO4 to hydrogen sulfide in about 15 days.

[0078] Example 3: Identification of the degradation performance of strain Co on Na2SO3

[0079] Add 20 mM sodium lactate to the 80 mL anaerobic inorganic salt basal medium described in step (1) above. Sodium lactate serves as both a carbon source and an electron donor, and 5 mM Na2SO3 is added simultaneously as an electron acceptor. Inoculate pure Co bacteria at 1% (v / v) and incubate statically at pH 7.2 and 37°C in the dark. Quantitatively monitor S using the above ultraviolet spectrophotometric conditions. 2- Concentration (see) Figure 3 ).

[0080] Analysis showed that the Co strain could completely degrade 5 mM Na2SO3 to hydrogen sulfide in about 15 days.

[0081] Example 4: Identification of the degradation performance of strain Co on Na2S2O3

[0082] Using 20 mM sodium lactate as both carbon source and electron donor, and simultaneously adding 5 mM Na₂S₂O₃ as electron acceptor, pure Co culture was inoculated at 1% (v / v) and cultured statically at pH 7.2, 37°C, and in the dark. S was quantitatively monitored using the above UV spectrophotometric conditions. 2- Concentration (see) Figure 4 ).

[0083] Analysis showed that the Co strain could completely degrade 5 mM Na2S2O3 to hydrogen sulfide in about 20 days.

[0084] Example 5: Ability of strain Co to degrade 1,1,1-trichloroethane (1,1,1-TCA)

[0085] 6 μL (0.52 mM liquid concentration) of 1,1,1-TCA was added to 80 mL of the inorganic salt basal medium described in step (1) using a microsyringe. 20 mM sodium lactate was used as the carbon source and electron donor, and 5 mM sodium sulfate as the electron acceptor. The Co strain was inoculated at 1% (v / v) and cultured statically at pH 7.2, 37°C, and in the dark for 40 days to remove the adsorption effect of the rubber stopper. 50-60% of the 1,1,1-TCA in the culture system was reduced and degraded to 1,1-dichloroethane (1,1-DCA).

[0086] The detection method for 1,1,1-TCA / 1,1-DCA is as follows: Gas chromatography (Agilent 7890B) with a flame ionization detector (FID) mounted on an Agilent DB-624 capillary column (60 m × 0.32 mm × 1.8 μm) was used to determine 1,1,1-TCA and its degradation products. The gas chromatography parameters were as follows: injection port temperature 200 °C; temperature program: 60 °C, hold for 2 min; then increase to 200 °C at a rate of 25 °C / min, hold for 1 min; carrier gas: helium, column flow rate 3 mL / min; FID detector temperature 300 °C; fuel gas: hydrogen, flow rate 30 mL / min; combustion oxidizer: syngas, flow rate 350 mL / min; make-up gas: nitrogen, flow rate 25 mL / min. Manual injection was used, and qualitative and quantitative analysis of the parent compound and degradation products was performed based on retention times and peak areas at 5.7 min and 5.0 min (see [link to relevant documentation]). Figure 5 ).

[0087] In summary, the desulfurizing Vibrio Co strain provided by this invention can completely reduce 5mM Na2SO4 and 5mM Na2SO3 to hydrogen sulfide in about 15 days; completely reduce 5mM Na2S2O3 to hydrogen sulfide in about 20 days; and dechlorinate and reduce 50-60% of the initially added 88μmol 1,1,1-TCA in the system to 1,1-DCA in about 30 days.

[0088] The bacterial agent was prepared according to the above description, for example, by adding a carbon source, electron donor, and electron acceptor to an inorganic salt culture medium, and inoculating the sulfate-reducing desulfurizing Vibrio Co strain at pH 7.2, 37°C, and in the dark for 10-20 days; wherein the carbon source and electron donor are lactate; 20 mM sodium lactate was added to each 80 mL of inorganic salt culture medium, and the Co strain was inoculated at a rate of 1% (v / v); the resulting culture was centrifuged, the precipitate was collected, and resuspended to obtain a resuspended solution; the liquid phase was the separation liquid; the culture was concentrated to obtain a concentrate, which is the bacterial agent. Its application in the environment or soil shows good application prospects for the bioremediation of sulfate-oxidized sulfides and 1,1,1-TCA contaminated sites.

[0089] The above-described embodiments are preferred application examples of this invention, but do not constitute any limitation on this invention. In practical applications, without departing from the scope of the technical solution of this invention, some modifications or alterations can be made to the disclosed technical content to create equivalent embodiments.

Claims

1. A strain of desulfurizing Vibrio, characterized by: Desulfurization Vibrio ( Desulfovibrio The strain (sp.)Co was deposited on February 24, 2024, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, 100101, China, accession number: CGMCCNo.41182.

2. The application of the desulfurizing Vibrio according to claim 1, characterized in that: Application of the Co strain in the degradation of sulfate sulfides and haloalkanes; The sulfate-type sulfide oxides are one or more of sulfates, sulfites, and thiosulfates. The haloalkane is 1,1,1-trichloroethane.

3. The application of the desulfurizing Vibrio according to claim 2, characterized in that: Application of the Co strain in the reduction of sulfate-oxidized sulfides.

4. The application of the desulfurizing Vibrio according to claim 2, characterized in that: Application of the Co strain in the dechlorination and degradation of haloalkanes.

5. A microbial agent for degrading pollutants, characterized in that: The microbial agent contains the desulfurized Vibrio Co strain as described in claim 1.

6. The microbial agent for degrading pollutants according to claim 5, characterized in that: The bacterial agent is one or more of the strain's culture, bacterial suspension, or concentrate.

7. The application of the microbial agent for degrading pollutants as described in claim 6, characterized in that: The application of the bacterial agent in the degradation of sulfate sulfides and haloalkanes.