SiRNA for inhibiting TLR4 gene expression and application thereof in breast cancer cells

Abstract

The invention discloses siRNA (small interfering Ribonucleic Acid) for specifically inhibiting human TLR4 (Toll-Like Receptor 4) gene expression and a preparation and screening method thereof. Three recombinant lentiviruses containing siRNA fragments are constructed by taking a TLR4 gene as a target sequence and respectively selecting an interference target at the upstream, the middle and the downstream. The siRNA recombinant lentivirus is transferred into breast cancer cell lines MDA-MB-231 and HCC1806, and a siRNA fragment capable of obviously inhibiting the expression of the TLR4 gene is finally screened out by utilizing a DNA (Deoxyribonucleic Acid) mediated RNA interference technology. Experimental results show that the siRNA screened by the invention can specifically and efficiently inhibit the expression of the TLR4 gene, thereby inhibiting the proliferation and metastasis of breast cancer cells. The siRNA screened by the invention provides a new way for preparing related drugs for targeted therapy of breast cancer, and shows a good application prospect.

Description

Technical Field

[0001] The present invention belongs to the field of medical molecular biology, and specifically relates to the construction and screening of siRNA expression vectors targeting human TLR4 gene and their application in inhibiting the expression level of TLR4 gene in breast cancer cells. In particular, it relates to the use of siRNA to specifically inhibit TLR4 gene expression through RNA interference pathway and its use in killing breast cancer cells and inhibiting cell metastasis. Background Art

[0002] Breast cancer is one of the most common malignant tumors in women. Every year, about 1.3 million women worldwide develop breast cancer and 500,000 women die from it. Its incidence rate has been on the rise, especially in the past 20 years. The occurrence of breast cancer involves the imbalance of cell apoptosis and proliferation, cell differentiation disorder, dysfunction of oncogenes and tumor suppressor genes, and abnormalities in related signal transduction systems. With the rapid progress of modern molecular biology, molecular immunology, tumor immunology, and bioengineering research, research on breast cancer has entered an active stage.

[0003] At present, the treatment of breast cancer mainly adopts surgery, supplemented by chemotherapy, radiotherapy and endocrine therapy. In recent years, with the deepening of tumor molecular biology research, gene therapy of tumors has opened up a new world for the treatment of breast cancer with its high specificity and relatively low toxic side effects. Therefore, finding biomarkers that can be used for diagnosis and prognosis, and thus deriving new therapeutic targets, is an important part of current oncology research.

[0004] Gene therapy is the process of introducing normal exogenous genes into human target cells or tissues to replace defective genes, and achieve the purpose of treating genetic diseases through their normal expression. As a new means of treating diseases, gene therapy is gaining more and more attention and concern. At present, gene therapy mainly involves malignant tumors, cardiovascular and cerebrovascular diseases, genetic diseases and certain infectious diseases, among which malignant tumors are the main treatment targets. It has opened up a new path for tumor treatment, and with the deepening of research, gene therapy may become the golden key to fundamentally solve the tumor problem. Gene therapy for tumors is a biological treatment method and a general term for a large class of treatment strategies. According to different treatment mechanisms, it can be divided into at least the following six categories: 1. Immunogeneous gene therapy, therapeutic genes include tumor-associated antigen genes, cytokine (such as IL-2, TNF, etc.) genes or MHC genes, etc. 2. Tumor suppressor gene therapy, the introduction of wild-type tumor suppressor genes in vivo to replace missing or abnormal tumor suppressor gene expression can achieve the effect of inhibiting tumor cell proliferation. At present, the tumor suppressor gene therapy that has been studied more deeply mainly uses p53, p16, RB genes, etc. 3. Anti-angiogenesis gene therapy: by introducing and expressing genes, a certain level of angiogenesis inhibitors is maintained in the body for a long time, inhibiting the formation of tumor blood vessels, thereby inhibiting the proliferation, recurrence and metastasis of tumors. 4. Transgenic systems that regulate toxin expression: using plant or bacterial immunotoxins, such as diphtheria toxin and pseudomonas endotoxin, to connect normal or mutated toxin genes with monoclonal antibody cytokines or growth factors, and introduce toxin genes into tumor cells to cause tumor cell death; 5. Antisense oncogene therapy: by complementary binding of artificially synthesized oligonucleotides to mRNA encoded by oncogenes, the transcription of mRNA can be inhibited to achieve the purpose of blocking oncogenes. 6. RNA interference (RNAi): refers to the introduction of double-stranded RNA (dsRNA) homologous to a certain sequence of endogenous mRNA into cells, which can cause the specific degradation of the mRNA and lead to the silencing of gene expression. Through RNA interference, factors related to tumor cell growth and metastasis are silenced, thereby achieving anti-tumor effects.

[0005] In normal organisms, double-stranded RNA (dsRNA, more than 38 bases) in cells is cut into double-stranded small interfering RNA (siRNA, 21-25 bases) by the ribonuclease Dicer under ATP-dependent conditions. The structure of siRNA is critical to the gene silencing effect. (1) There are two strands in siRNA, one is the sense strand and the other is the antisense strand. The antisense strand can bind to a variety of nucleases to form a silencing complex (RISC). At the same time, because the antisense strand is homologous to the coding region of a certain mRNA, it can complementarily bind to this coding region, thereby guiding RISC to bind to mRNA. Then, the siRNA double strand is unwound by the ATP-dependent helicase, and its sense strand is replaced with the target mRNA, that is, the mRNA replaces the sense strand and complements the antisense strand. Then, the nuclease cuts the mRNA into small fragments of 21-23 nt, and the cutting site is approximately in the middle of the sequence paired with the siRNA antisense strand. As a result, the mRNA is degraded, resulting in silencing of gene expression and interfering with the expression of the target gene. (2) RdRP (RNA-dependent RNA polymerase) in RISC uses the antisense strand of siRNA as a primer and the target mRNA as a template to synthesize new dsRNA, which is then cut by Dicer to produce new siRNA. The new siRNA then recognizes a new group of mRNAs and produces new siRNA. After several cycles of synthesis-cutting, the silencing signal will continue to amplify and even cross cell boundaries, being transmitted and maintained over long distances between different cells.

[0006] RNAi has many characteristics and advantages that cannot be matched by traditional methods. RNAi has the following characteristics: (1) Anti-interference: RNAi is a PTGS mechanism mediated by dsRNA, and translation inhibitors have no effect on RNAi; (2) Specificity: RNAi has high specificity. RNAi can only specifically degrade the mRNA of a single endogenous gene corresponding to its sequence, while the expression of other mRNAs is not affected; (3) Catalyticity: RNAi has a high efficiency in inhibiting gene expression, and is carried out in a catalytic amplification manner. A relatively small amount of dsRNA molecules can completely inhibit the expression of the corresponding gene; (4) Transmissibility: The effect of RNAi on inhibiting gene expression can cross cell boundaries, be transmitted and maintained over long distances between different cells or even organisms, and can be passed on to offspring; (5) Length restriction: The dsRNA that triggers effective RNAi must not be shorter than 21 bp, and dsRNA greater than 30 bp does not induce specific RNAi, but causes nonspecific and comprehensive gene expression inhibition and apoptosis of cells. Generally speaking, the dsRNA that triggers effective RNAi is required to be between 21 and 23 bp. bp; (6) Dual dependence on concentration and time: the intensity of RNAi effect induced by dsRNA increases with the increase of its concentration; (7) ATP dependence: in the sample without ATP, RNAi phenomenon decreases or disappears, indicating that RNAi is an ATP-dependent process, which may be caused by the fact that the enzyme cleavage reaction of Dicer and RISC must be provided by ATP. Based on the above characteristics, siRNA is far superior to antisense oligonucleotides, ribozymes, etc., and RNAi can effectively make up for the shortcomings of antisense oligonucleotide technology and gene knockout technology.

[0007] RNA interference is a post-transcriptional gene silencing (PTGS) mechanism. Compared with traditional gene silencing technologies such as gene knockout, RNAi technology has the advantages of low investment and simple operation. Therefore, people have shifted their attention from antisense RNA technologies such as ribozymes and oligodeoxynucleotides to RNAi, which has played an important role in gene function research and gene therapy. Since Fire first reported in 1998 that double-stranded RNA can specifically silence gene expression, RNAi has been widely used in various fields, especially in the field of tumor treatment, and has shown great potential. In recent years, there have been increasing reports on the successful use of RNAi in the construction of transgenic animal models, indicating that RNAi technology will become an indispensable method for studying gene function and conducting gene therapy. The continuous maturity of RNAi technology has enabled it to develop rapidly in the medical field, especially in cancer treatment. As a gene therapy method, RNAi has shown great prospects and is expected to play an important role in tumor gene therapy, genetic diseases and viral infection treatment.

[0008] The Toll-like receptor family (TLR) belongs to the pattern recognition receptors in the body's innate immune system. They play a role in recognizing pathogen-related molecular patterns and damage-related molecular patterns in the body, inducing the body to initiate innate immunity through downstream signals and make immune responses. In 1997, Janeway et al. discovered the first TLR in mammals: TLR4. So far, a total of 11 human TLRs have been discovered, which are widely distributed in various tissues. Among them, TLR4 has been the most widely studied. It not only mediates the body's inflammatory response, but is also closely related to the occurrence and development of tumors.

[0009] TLR4 is a single transmembrane protein. The extracellular region consists of a horseshoe-shaped domain composed of leucine-rich repeat sequences, which plays a role in recognizing ligands. The transmembrane region is a cysteine-rich domain, which is related to subcellular localization. The intracellular region is composed of TIR domains and is a key element involved in downstream signal transduction. TLR4 is mainly expressed in epithelial cells, endothelial cells, mononuclear macrophages, NK cells, neutrophils, eosinophils, and T lymphocytes. After TLR4 recognizes PAMPs with the assistance of MD-2, it dimerizes. Recruit downstream MyD88, TRAM, and TRIF molecules. Activate transcription factors NF-κB, AP-1, and IRF3 to regulate gene expression. According to different adaptor proteins, it can be divided into MyD88-dependent pathway and TRIF-dependent pathway. In the MyD88-dependent pathway, TLR4 activates MyD88, recruits IL-1R-related kinases such as IRAK4, and then activates TRAF6, TAK1, followed by IKK and MKKs. It promotes the activation of NF-κB or AP-1 and the production of inflammatory factors. In the TRIF-dependent pathway, TLR4 connects with TRIF through TRAM, and also activates TRAF6, which in turn activates TRAF3, and then activates IRF3 to promote the production of type I interferon. The combined action of the above pathways affects the tumor microenvironment and participates in tumor proliferation, apoptosis and immune escape.

[0010] The expression of TLR4 in breast cancer tissue is significantly enhanced compared with adjacent tissues and benign breast tumors. Highly expressed TLR4 was also found in breast cancer cell lines MDA-MB-231 and MCF-7, and the expression level of TLR4 was positively correlated with the metastatic ability of breast cancer cells. LPS stimulation activates the tumor TLR4 signal transduction pathway, and the expression of MMP-2, MMP-9 and VEGF in cancer tissue is upregulated. These molecules can also promote tumor metastasis. Therefore, further clarifying the role of TLR4 in tumor occurrence and development will provide a new direction for tumor prevention and treatment. Summary of the invention

[0011] The object of the present invention is to provide a siRNA sequence for specifically inhibiting human TLR4 gene, characterized in that its base sequence is: UAUUCAAAGAUACACCAGC. The TLR4 gene target sequence is: GCTGGTGTATCTTTGAATA.

[0012] Another object of the present invention is to provide a method for preparing siRNA that specifically inhibits the expression of human TLR4 gene.

[0013] The present invention designs siRNA sequences based on the TLR4 gene (NM_138554) sequence. RNAi online design software is used to search for RNA interference target sequences with higher scores in common sequences. After BLAST comparison, target sequences that may hybridize with other non-related genes are removed, and finally a target sequence with higher scores and good specificity is selected in the upper, middle and downstream of the sequence. Finally, a recombinant lentivirus carrying the siRNA sequence is constructed with the screened target sequence, and breast cancer cells are stably transfected, and finally siRNA with interference activity is expressed in the cells.

[0014] The present invention also provides a DNA sequence encoding the siRNA precursor and a recombinant siRNA expression vector pGV493 containing the coding sequence. The recombinant lentivirus containing the siRNA expression vector can directly express siRNA in cells, thereby inhibiting TLR4 gene expression and achieving the purpose of inhibiting cancer cell proliferation and metastasis.

[0015] The siRNA expression vector pGV493 used in the present invention contains a U6 promoter with a fixed transcription start site (G) and a termination site (TTTTTT) that can be used to stably express siRNA. The U6 promoter on the expression vector can transcribe a siRNA precursor with a specific sequence, shRNA (short hairpin RNA), which does not encode amino acids, but automatically forms an shRNA with a stem loop in the cell. The shRNA is recognized by the nuclease Dicer in the cell and cut into a siRNA with a length of about 21-25 nt and two nucleotide protrusions at the 3' end. This mature siRNA is used as a guide sequence to guide RISC (RNA-induced silencing complex) to recognize the target gene mRNA sequence complementary to the siRNA. Then the siRNA and mRNA are transposed in the complex, and the nuclease Dicer cuts the mRNA into 21-23 nt fragments to specifically inhibit the expression of the target gene. The newly generated siRNA fragments can again guide RISC to form a complex with the target gene mRNA, continue to degrade the target gene mRNA, thereby generating a cascade amplification effect, so that the expression of the target gene is almost completely specifically inhibited.

[0016] Another object of the present invention is to provide a method for specifically inhibiting human TLR4 gene expression. The method provided by the present invention for inhibiting the expression level of TLR4 gene in human breast cancer cells is to use DNA-mediated RNA interference technology to clone the siRNA encoding gene that inhibits the expression of the gene into the siRNA expression vector, and then use the recombinant lentivirus to introduce it into breast cancer cells. The recombinant lentivirus expresses siRNA that can inhibit TLR4 gene mRNA in the cell, so that the TLR4 gene in the breast cancer cell is inhibited at the transcription level.

[0017] The present invention also provides the use of the siRNA in preparing anti-tumor drugs for inhibiting breast cancer cell proliferation and metastasis.

[0018] The above-mentioned object of the present invention is achieved by the following technical solutions: (1) Search the mRNA of human TLR4 gene in the GenBank database, sequence number: NM_138554. Use the siDirect online website to select the RNA interference target sequence with the highest score. After BLAST comparison, remove the target sequence that may hybridize with other non-related genes, and finally select a target sequence with high score and good specificity in the upstream, middle and downstream of the sequence.

[0019] (2) The determined target sequence is Age Ⅰ+Sense+Loop+AntiSense+Termination Signal+ Eoc The siDNA sequence encoding the stem-loop RNA was designed in the form of a restriction site I. The chemically synthesized siDNA fragment was connected to the siRNA expression vector pGV493 to construct a recombinant siRNA expression vector pGV493-TLR4-1 / 2 / 3.

[0020] (3) The recombinant siRNA expression vector pGV493-TLR4-1 / 2 / 3 was delivered to GeneCare Genetech (Shanghai, China) for lentiviral packaging. The lentivirus was named LV-TLR4 KD-1 / 2 / 3. The lentivirus with a titer of 9E+8 TU / mL was obtained and used to infect breast cancer cells MDA-MB-231 and HCC1806, respectively. Puromycin was used to select the stable cell lines MDA-MB-231 / LV-TLR4 KD-1 / 2 / 3 and HCC1806 / LV-TLR4 KD-1 / 2 / 3 that could stably express green fluorescent protein.

[0021] (4) Total RNA and total protein were extracted from the stably transfected cell lines MDA-MB-231 / LV-TLR4 KD-1 / 2 / 3 and HCC1806 / LV-TLR4 KD-1 / 2 / 3, and fluorescence quantitative PCR and Western Blot were performed to determine the changes in the expression of the TLR4 gene at the mRNA level and protein level. The cell growth curve was drawn by the MTT method and the plate cloning experiment was used to detect the changes in cell proliferation ability.

[0022] The present invention finally screened out a recombinant lentivirus that can significantly inhibit the expression of human TLR4 gene, thereby inhibiting the proliferation and metastasis of breast cancer cells. The experimental results of the present invention show that after the screened recombinant lentivirus LV-TLR4 KD infects breast cancer cells, the expression of TLR4 gene is significantly reduced by fluorescence quantitative PCR and Western Blot detection; MTT and plate cloning experiments show that cell proliferation is significantly inhibited, Transwell and migration experiments show that cell invasion and metastasis ability are also significantly inhibited, and in vivo tumor formation experiments also prove that the proliferation and metastasis ability of tumor cells are significantly inhibited. It shows that after LV-TLR4 KD inhibits the expression of TLR4 gene in breast cancer cells, it will inhibit the proliferation and metastasis of cancer cells, and finally play a role in inhibiting tumor metastasis and killing cancer cells.

[0023] Beneficial results of the present invention: The present invention uses DNA-mediated RNA interference technology, takes the TLR4 gene highly expressed in breast cancer cells as the target, and designs small interfering RNA (siRNA) for its gene coding sequence. The recombinant siRNA expression vector capable of encoding the siRNA is introduced into the cell, and the degradation of the endogenous TLR4 mRNA is mediated by the exogenously introduced siRNA, thereby leading to the silencing of the TLR4 gene in the cell. The present invention screened out an siRNA that can significantly inhibit the expression of the TLR4 gene through experiments. The siRNA can be used to observe the changes in expression and signal pathways when the TLR4 gene in the cell is specifically inhibited, and provides an effective tool for studying the function of the TLR4 gene at the molecular and cellular levels. At the same time, it also provides a new way for gene therapy of breast cancer, and shows good application prospects in the field of targeted treatment of tumors related to the TLR4 gene.

[0024] Compared with the prior art, the present invention has the following advantages and effects: (1) The siRNA expression vector used in the present invention controls the transcription of siRNA using the U6 promoter in the RNA polymerase III family, which has a defined transcription start site and transcription stop site, making it easy to design the siDNA sequence encoding siRNA. It can also express small RNA at a high level, resulting in a higher accumulation of siRNA in cells and a more obvious inhibitory effect.

[0025] (2) The siRNA expression vector used in the present invention carries an antibiotic resistance gene and a gene encoding green fluorescent protein. The puromycin resistance gene can be used for puromycin screening, facilitating the establishment of a stable cell line. Green fluorescent protein can be directly observed under a fluorescence microscope, enabling rapid and accurate tracking of transfection efficiency.

[0026] (3) In the process of constructing the recombinant siRNA expression vector, the present invention utilizes two primers to anneal and extend each other, and the obtained annealing product does not need to be digested and purified, and can be directly connected to the processed vector. This experimental design greatly simplifies the experimental process, improves experimental efficiency, and reduces experimental costs.

[0027] (4) The siRNA selected by the present invention has a more significant inhibitory effect on the human TLR4 gene. The present invention designed interference targets for the upstream, midstream and downstream of the human TLR4 gene, and selected siRNA with a higher inhibitory efficiency on the TLR4 gene from the experiment.

[0028] (5) The recombinant siRNA expression vector for inhibiting the TLR4 gene constructed by the present invention can significantly inhibit the proliferation of tumor cells. It can be used to further study the function of the TLR4 gene and its role in the signal pathway for activating TLR4 expression, the target genes regulated by TLR4, and the interaction with other genes.

[0029] (6) The present invention uses RNA interference technology to directly reduce the expression of TLR4 gene mRNA at the transcriptional level, and directly leads to a decrease in the accumulation of TLR4 protein, thereby inhibiting the TLR4 signaling pathway. Compared with traditional techniques and methods for treating tumors by inhibiting protein signal transduction pathways, such as antisense oligonucleotides, gene knockout, and receptor neutralizing antibodies, the present invention has the characteristics of simple operation, high specificity, strong targeting, cascade amplification, and more sustained effects. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The relative expression results of TLR4 gene mRNA in cells transfected with LV-TLR4 KD-1 / 2 / 3 and LV-NC groups in the present invention are shown in FIG. Figure 2 The Western Blot test results of the present invention are for the expression of TLR4 gene protein in cells transfected with LV-TLR4 KD-1 / 2 / 3 and LV-NC groups; Figure 3 The MTT method of the present invention is used to draw the growth curve of MDA-MB-231 cells transfected with LV-TLR4 KD-1 / 2 / 3, LV- NC group and untransfected blank group; Figure 4The growth curve of HCC1806 cells transfected with LV-TLR4 KD-1 / 2 / 3, LV-NC group and untransfected blank group were drawn for the MTT method of the present invention; Figure 5 The results of the clone formation rate of MDA-MB-231 cells and HCC1806 cells transfected with LV-TLR4 KD-1 and LV-NC groups respectively in the present invention; Figure 6 The figure shows the number of invasive cells of MDA-MB-231 cells and HCC1806 cells transfected with LV-TLR4 KD-1 and LV-NC groups, respectively; Figure 7 The figure is the migration rate result of MDA-MB-231 cells and HCC1806 cells transfected with LV-TLR4 KD-1 and LV-NC groups respectively in the present invention; Figure 8 The graph is a result of the growth curve of nude mouse transplanted tumors of MDA-MB-231 cells transfected with LV-TLR4 KD-1, LV-NC groups and untransfected MDA-MB-231 cells in the present invention. DETAILED DESCRIPTION

[0031] The present invention is further described in detail below in conjunction with the accompanying drawings and examples, but the scope of protection of the present invention is not limited to the above contents, and the methods used in the present invention are conventional methods unless otherwise specified. The quantitative experiments in the following examples were repeated three times, and the results were averaged.

[0032] Example 1: Construction of recombinant lentivirus targeting human TLR4 gene 1. Synthesis of siDNA gene fragment targeting human TLR4 gene The human TLR4 mRNA sequence was searched in the gene database GenBank on the NCBI website, and the gene accession number is: NM_138554. The online RNAi design website siDirect (http: / / sidirect2.rnai.jp / ) was used to find the highest-scoring siRNA target sequences. Finally, the designed siRNA target sequences were compared by BLAST in GenBank to eliminate sequences that may hybridize with other non-related genes. Finally, the target sequences at the upstream, middle, and downstream positions of the mRNA were selected, and the following sequences were obtained: TLR4-1: GCTGGTGTATCTTTGAATA; TLR4-2: CTGCTGGATGGTAAATCAT; TLR4-3: AAGTAGTCTAGCTTTCTTA. At the same time, a scrambled siRNA target sequence was set as a negative control group, in which the scrambled siRNA target sequence was: TTCTCCGAACGTGTCACGT.

[0033] Since siRNA must be cleaved from double-stranded RNA (dsRNA) into active double-stranded small interfering RNA (siRNA) in the host cell by Dicer, a nuclease in the RNaseIII family, it is necessary to design a double-stranded RNA that can form a stem-loop structure after being transcribed into RNA. The basic structure of the siRNA encoding siRNA designed in the present invention is the restriction site Apa Ⅰ+Sense+Loop+AntiSense+Termination Signal+ EcoR I restriction site. Sense is the siDNA sequence encoding siRNA, the sequence of the Loop ring is 5'-CTCGAG-3', AntiSense is the reverse complementary sequence of the siDNA encoding siRNA, and the termination signal sequence is 5'-TTTTT-3'.

[0034] The final synthesized siDNA sequence and complementary sequence were determined as follows: TLR4-1A: GGGCCCGCTGGTGTATCTTTGAATACTCGAGTATTCAAAGATACACCAGCTTTTTGAATTC; TLR4-1B:GAATTCAAAAAGCTGGTGTATCTTTGAATACTCGAGTATTCAAAGATACACCAGCGGGCCC; TLR4-2A: GGGCCCCTGCTGGATGGTAAATCATTTCAAGAGAATGATTTACCATCCAGCAGTTTTTGAATTC; TLR4-2B:GAATTCAAAAACTGCTGGATGGTAAATCATTCTCTTGAAATGATTTACCATCCAGCAGGGGCCC; TLR4-3A: GGGCCCAAGTAGTCTAGCTTTCTTATTCAAGAGATAAGAAAGCTAGACTACTTTTTTTGAATTC; TLR4-3B:GAATTCAAAAAAAGTAGTCTAGCTTTTCTTATCTCTTGAATAAGAAAGCTAGACTACTTGGGCCC; Scramble-A: GGGCCCTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATTTTTGAATTC; Scramble-B: GAATTCAAAAATTCTCCGAACGTGTCACGTTCTCTTGAAACGTGACACGTTCGGAGAAGGGCCC.

[0035] The above sequences were sent to the company for synthesis in the form of primers.

[0036] 2. Construction of siRNA recombinant expression vector targeting human TLR4 gene 2.1 Annealing of siDNA oligonucleotide fragments to form a double-stranded structure: Add the corresponding amount of sterile ultrapure water to dilute the synthesized oligonucleotide fragments to 10μM / L according to the instructions. Take 2μl of each of the two diluted complementary siRNA target sequence fragments, 2μl of 10×T4 buffer, add water to a total volume of 20μl, put them in a 200μl PCR tube, place them in a PCR instrument, and set the reaction program as follows: 95 degrees for 5min, 80 degrees, 70 degrees, 60 degrees, 50 degrees, 40 degrees, 30 degrees, 20 degrees, 10 degrees, 4 degrees for 2min each. After the two complementary oligonucleotides are annealed and complemented, a complete double-stranded siRNA target sequence fragment with a sticky end of the corresponding restriction site is formed, which can eventually be connected to the siRNA expression vector.

[0037] 2.2 Double restriction enzyme digestion of siRNA expression vector pGV493: Apa I and EcoR Ⅰ Double restriction enzyme digestion of siRNA expression vector pGV493 (purchased from Shanghai Gene Gene Co., Ltd.). Add 30 μl of siRNA expression vector pGV493 into a 200 μl PCR reaction tube; Apa I enzyme (10 U / μl) 2 μl; EcoR Ⅰ (10U / μl) 2μl; 10× enzyme digestion buffer 5μl, ddH2O 11μl, after the above system is configured, react at 37℃ for 4 hours. All the digestion products are loaded for 1% agarose gel electrophoresis, voltage 110V, 20 minutes, the pGV493 expression vector is double digested and the target band appears at about 10.9 kb. The target band is gel-cut and purified, and the steps are carried out according to the instructions of Tiangen centrifugal column DNA purification kit.

[0038] 2.3 Construction of siRNA recombinant expression vector: The double-stranded siDNA fragment formed after annealing of the oligonucleotides was connected to the pGV493 vector to construct the corresponding pGV493-TLR4-1 (containing the target sequence TLR4-1), pGV493-TLR4-2 (containing the target sequence TLR4-2), pGV493-TLR4-3 (containing the target sequence TLR4-3), and pGV493-NC (containing the negative control of the scrambled sequence) recombinant siRNA expression vectors. Prepare the following connection system in a 200μl PCR tube: pGV493 / Apa I / EcoR Ⅰ Large fragment of vector 1μl; double-stranded siDNA fragment DNA 5ul; T4 DNA ligase 1ul; 10×T4 DNA ligasebuffer 1ul; ddH2O 2μl. After the above system is prepared, put it into the metal bath and react at 16℃ for 4 hours. Add all the ligation products to 100μl DH5α competent medium and ice bath for 30 minutes. Heat shock at 42℃ for 90 seconds and then immediately ice bath for 90 seconds. Add 900μl LB liquid culture medium and shake and culture at 37℃, 80rpm for 1 hour. Take 200μl of culture and spread it on LB / Amp plate and invert and culture at 37℃ for 10 hours.

[0039] 2.4 Identification of positive clones: Pick a single colony from the LB / Amp plate, inoculate it into 5 ml of liquid LB / Amp medium, and culture it in a 37°C constant temperature shaker at 150 rpm for 8-10 hours until the OD of the bacterial solution reaches 600 Stop the culture when the value is about ≈0.8. Take all the bacterial liquid to extract the plasmid. The extraction steps are carried out according to the instructions of the Tiangen Plasmid Extraction Kit. Sequence the extracted recombinant plasmid, and select the recombinant siRNA expression vector containing the target siDNA fragment without mutation for lentiviral packaging experiment.

[0040] 3. Packaging of recombinant lentivirus targeting human TLR4 gene The three plasmid DNAs in the lentiviral packaging system (pGV493-TLR4-1 / 2 / 3 / NC, pHelper 1.0, pHelper 2.0, all of which were from Shanghai Jikai Gene Co., Ltd.) were extracted using Qiagen's plasmid extraction kit. The plasmid DNA was dissolved in sterilized TE and its concentration and purity were determined by ultraviolet absorption to ensure that the A260 / A280 of the extracted plasmid DNA was between 1.8 and 2.0. 24 h before transfection, 293T cells in the logarithmic growth phase were digested with trypsin and the cell density was adjusted to about 5×10 cells / mL with a medium containing 10% serum. 6cells / 15 ml, re-inoculated in a 10 cm cell culture dish, and cultured in a 37°C, 5% CO2 incubator. When the cell density reaches 70%-80% in 24 hours, it can be used for transfection; replace with serum-free medium 2 hours before transfection; add the prepared DNA solutions (20μg of GV recombinant vector plasmid, 15μg of pHelper1.0 vector plasmid, 10μg of pHelper 2.0 vector plasmid) to the sterilized centrifuge tube, mix evenly with the corresponding volume of Jikai transfection reagent, adjust the total volume to 1 ml, and incubate at room temperature for 15 min. The mixed solution is slowly added dropwise to the 293T cell culture medium, mixed evenly, and cultured in a 37°C, 5% CO2 cell culture incubator; after 6 hours of culture, the culture medium containing the transfection mixture is discarded, and 10 ml of PBS solution is added to wash once; slowly add 20 ml of cell culture medium containing 10% serum, and continue to culture in a 37°C, 5% CO2 incubator for 48-72 hours. According to the cell status, the supernatant of 293T cells 48 hours after transfection was collected; centrifuged at 4°C and 4000 g for 10 minutes to remove cell debris; the supernatant was filtered through a 0.45μm filter into a 40 ml ultracentrifuge tube; the ultracentrifuge tubes with viral supernatant were placed one by one into the Beckman ultracentrifuge, and the centrifugation parameters were set to 25000 rpm, the centrifugation time was 2 hours, and the centrifugation temperature was controlled at 4°C. After the centrifugation, the supernatant was discarded, PBS was added, and the suspension was gently blown repeatedly; after sufficient dissolution, the supernatant was centrifuged at 10000 rpm for 5 minutes, and the supernatant was divided into 1.5 ml centrifuge tubes and frozen in a -80°C refrigerator. The virus titer was determined by fluorescence method, and four recombinant lentiviruses were finally obtained: LV-TLR4 KD-1 / 2 / 3 and LV-NC.

[0041] Example 2: Inhibitory effect of recombinant siRNA lentivirus on TLR4 gene in breast cancer cell lines MDA-MB-231 and HCC1806 and its effect on cell biological characteristics 1. Construction of MDA-MB-231 / HCC1806 stable cell line with stable knockdown of TLR4 gene The breast cancer MDA-MB-231 and HCC1806 cell suspensions were inoculated into 6-cm dishes containing 3 mL of complete culture medium, shaken gently and placed in a 37°C, 5% CO2 incubator. When the cell confluence reached about 80%, trypsin was used for digestion, and complete culture medium (10% fetal bovine serum + high glucose DMEM medium) was used to make 6×10 4 / mL cell suspension. Take 500μl of cell suspension and inoculate it into a 48-well plate and continue to culture. On the second day after plating, change the medium and add puromycin with final concentrations of 0μg / ml, 0.5μg / ml, 1μg / ml, 2μg / ml, 4μg / ml, 6μg / ml, 8μg / ml, and 10μg / ml to 8 wells, respectively. Observe the cell state under a microscope 48 hours after adding puromycin (the cell density of the group without drug addition is between 60% and 90%). At this time, the cells in the high concentration of puromycin group should be dead. By observing the cell state, the lowest concentration that causes complete cell death is determined as the optimal concentration for puromycin screening of the cell. This experiment determined that the minimum screening concentration of puromycin for MDA-MB-231 and HCC1806 cells is 2μg / ml. The cells in the logarithmic growth phase were trypsinized and the complete culture medium was made into 5×10 4 / mL cell suspension, and take 2mL of cell suspension and add it to a 6-well plate, and continue to culture to ensure that the cell amount reaches about 15%-30% during infection. Dilute the Jikai gene infection reagent Hitrans GP and complete culture medium at 1:24, and add 1ml of infection medium to each well. That is: add 960ul complete culture medium and 40ul Hitrans GP infection reagent to each well, mix well and add. According to the virus titer, add 8 ul of recombinant virus to each well. 16h after adding virus infection, replace it with regular complete culture medium and continue to culture. After 72h of infection, observe the cell state and observe the infection efficiency by fluorescence microscopy. It is required that the cell state is good and there is no large-scale death phenomenon, especially to ensure that the cell state of the NC group and the non-transfected group is equivalent. After 72h of infection, add puromycin with a final concentration of 2ug / ml and maintain screening for at least 48h. When the fluorescence efficiency reaches 100%, reduce the puromycin concentration to 1ug / ml to maintain culture.

[0042] When the number of cells reached the requirement, the cells were collected for downstream qPCR and WB detection (identification of target gene and protein expression levels). This transfection was divided into four groups, of which there were three experimental groups, namely Group A: transfection with LV-TLR4 KD-1 recombinant lentivirus containing the target sequence TLR4-1; Group B: transfection with LV-TLR4 KD-2 recombinant lentivirus containing the target sequence TLR4-2; Group C: transfection with LV-TLR4 KD-3 recombinant lentivirus containing the target sequence TLR4-3; The blank control group was the NC group: transfection with LV-NC recombinant lentivirus containing a scrambled sequence.

[0043] 2. Detection of TLR4 gene mRNA expression by fluorescence quantitative PCR The four stable cell groups in the previous step and the untransfected MDA-MB-231 / HCC1806 cells (blank group) were inoculated into 6-well plates. When the cells reached the logarithmic growth phase, the culture medium was discarded and centrifuged to collect the cells, and the cell pellet was resuspended in D-Hanks solution. The total RNA of the cells was extracted using the Trizol method. The specific steps of the extraction refer to the Molecular Cloning Guide (3rd Edition). The electrophoresis diagram of the total RNA extraction of the cells is attached. Figure 4 . Reverse transcription was performed using a reverse transcription kit purchased from Fermentas. For specific steps, refer to the instruction manual. The reverse transcription product was used for fluorescent quantitative PCR to determine the expression of the TLR4 gene in different transfection groups. Primer TLR4f: TCCCTGAACCCTATGAACTTTATC; TLR4r: AACCAGCCAGACCTTGAATAC; GAPDH was selected as the internal reference gene, primer GAPDHf: TGACAACAGCTCAAGAT; GAPDHr: GAGTCCTTCCACGATACC. The reaction system and conditions refer to the SYBR R Premix Ex Taq TM Kit instructions.

[0044] The experiment was carried out according to the above five groups, with three replicates in each group. The results of fluorescence quantitative PCR showed that the amplification efficiency of the primers was roughly the same, and 2 －△△Ct The mRNA expression levels of TLR4 gene and internal reference gene GAPDH were analyzed by relative quantitative analysis. Among them, △Ct = Ct value of target gene - Ct value of GAPDH, △△Ct = △Ct of experimental group - △Ct of blank group, target gene of experimental group / target gene of blank group = 2 －△△Ct The results of fluorescence quantitative PCR showed that in MDA-MB-231 cells, compared with the uninfected negative group, the mRNA expression of TLR4 gene in the infected blank control group NC and the negative control group had no significant change; the mRNA expression level of TLR4 gene in the infected LV-TLR4 KD-1 group decreased by 76.6% ( P <0.05); the mRNA expression levels of TLR4 gene in the transfected LV-TLR4 KD-2 group and LV-TLR4 KD-3 group decreased by 70.2% and 40.4%, respectively ( P <0.05). In HCC1806 cells, compared with the uninfected negative group, the mRNA expression of TLR4 gene in the infected blank control NC group and the negative control group did not change significantly; the mRNA expression level of TLR4 gene in the infected LV-TLR4 KD-1 group decreased by 74.3% ( P<0.05); the mRNA expression levels of TLR4 gene in the transfected LV-TLR4 KD-2 group and LV-TLR4 KD-3 group decreased by 72.2% and 32.1%, respectively ( P <0.05). The results showed that the recombinant lentivirus LV-TLR4KD-1 / LV-TLR4 KD-2 containing the target sequences of TLR4-1 and TLR4-2 could significantly inhibit the expression of TLR4 gene mRNA in breast cancer cells MDA-MB-231 and HCC1806, but the LV-TLR4 KD-1 group had the strongest TLR4 gene inhibition effect. The results are shown in the attached Figure 1 .

[0045] 3. Western Blot detection of TLR4 protein expression in cells Four stable cell groups, LV-TLR4 KD-1 / 2 / 3 and LV-NC, were cultured in 100 ml culture flasks. When the cell confluence rate reached 80-90%, the total protein of each group of cells was extracted and collected, and the protein content was determined by BCA protein quantification kit (purchased from ThermoScientific). 50 μg of total protein from each group was separated by 12% SDS-PAGE gel electrophoresis, and the protein was transferred to PVDF by semi-dry electrotransfer, and then blocked with a blocking solution containing 5% skim milk powder at room temperature for 2 hours. Anti-TLR4 antibody (purchased from Cell Signaling, clone number: E5D8T) was used as the primary antibody for incubation at room temperature for 2 hours, and then Horseradish Peroxidase (HRP)-labeled goat anti-rabbit IgG (purchased from Beijing Zhongshan Jinqiao Company) was used as the secondary antibody for incubation at room temperature for 2 hours. Finally, the bands were developed by chemiluminescence (ECL), and GAPDH was used as the internal reference. The results are attached. Figure 2 .

[0046] The Western Blot results showed that the TLR4 protein in the LV-NC transfection group was expressed normally; there was basically no band in the LV-TLR4KD-1 and LV-TLR4 KD-2 transfection groups, indicating that the TLR4 protein was almost not expressed; the band in the LV-TLR4 KD-3 transfection group was weaker than that in the LV-NC group, indicating that the protein expression was decreased but not completely inhibited. The WB results showed that the LV-TLR4 KD-1 and LV-TLR4 KD-2 transfection groups could almost completely inhibit the expression of TLR4 protein, and the inhibitory effect was significant compared with the LV-TLR4KD-3 transfection group.

[0047] 4. Draw cell growth curve using MTT method The above four stable cell groups of MDA-MB-231 and HCC1806 LV-TLR4 KD-1 / 2 / 3, LV-NC and normal MDA-MB-231 and HCC1806 cells were made into single cell suspensions with 2×10 cells per well. 3 Each well was inoculated with 200 μl cells. A zeroing well was set up with only culture medium added but no cells. Three replicate wells were set up for each test time point in each group. The culture medium was changed once a day for 7 consecutive days. 20 μl of MTT (5 mg / ml) solution was added to each well and incubated for 4 hours. The culture was terminated, the supernatant was discarded, and 150 μl of DMSO was added to each well. The plates were shaken for 10 minutes to fully dissolve the crystals. The absorbance was detected at 490 nm using an enzyme-labeled instrument and tested every 24 hours. The growth curves of each group of cells were drawn with the culture time as the horizontal axis and the light absorption value as the vertical axis. The results are shown in the attached figure. Figure 3 , Attachment Figure 4 .

[0048] The growth curves show that the absorbance of the LV-TLR4 KD-1 and LV-TLR4 KD-2 transfected groups was significantly lower than that of the untransfected blank group after 3 days of inoculation, regardless of whether it was MDA-MB-231 cells or HCC1806 cells ( P <0.01); the absorbance of the LV-TLR4 KD-3 group was lower than that of the blank group without transfection 4 days after inoculation ( P <0.05); while there was no significant difference in absorbance between the NC group and the untransfected blank group ( P >0.05), indicating that the recombinant plasmid transfected into cells had no significant effect on the growth of breast cancer cells. The results showed that the transfected LV-TLR4 KD-1 / 2 / 3 groups had growth inhibition effects on breast cancer cells MDA-MB-231 and HCC1806, among which the LV-TLR4 KD-1 group had a more obvious inhibitory effect on cells, the LV-TLR4 KD-3 group had a relatively weak inhibitory effect, and the NC group had basically no inhibition of cell growth.

[0049] 5. Detection of cell proliferation ability The cells in this experiment included MDA-MB-231 and HCC1806 cells, two stably transfected MDA-MB-231 and HCC1806 cell groups transfected with LV-TLR4 KD-1 and LV-NC, and normal MDA-MB-231 and HCC1806 cells. 0.25% trypsin was used to digest the adherent cells in the logarithmic growth phase in the 6-well plate, and the cells were suspended in RPMI 1640 (purchased from Hyclone) culture medium containing 20% ​​fetal bovine serum (purchased from Gibco) to make a single cell suspension, which was inoculated in a 6-well plate with a density gradient of 500 cells. Each sample was repeated 3 times and cultured for 2 weeks. When the clones visible to the naked eye appeared, the culture was terminated. The cells were rinsed with PBS buffer, fixed with methanol, and stained with Giemsa stain. The number of clones greater than 50 cells was counted under a microscope, and the clone formation rate was calculated. The effects of siRNA expressed after transfection with different recombinant siRNA expression vectors on cell proliferation were analyzed and compared.

[0050] The six groups of cells were inoculated into 6-well plates and cultured for 2 weeks, and all of them had clone formation. The clone formation rates of MDA-MB-231 and HCC1806 cells transfected with LV-TLR4 KD-1 were 18.53% and 25.32%, respectively, and the clone formation rates of MDA-MB-231 and HCC1806 cells transfected with LV-NC were 43.76% and 53.97%, respectively, which were lower than those of the control group ( P <0.01). The clone formation rates of untransfected MDA-MB-231 and HCC1806 cells were 48.63% and 58.23%, respectively. The results showed that the clone formation ability of breast cancer cells MDA-MB-231 and HCC1806 cells transfected with LV-TLR4KD-1 recombinant virus was significantly reduced, and the cell proliferation activity was inhibited. The results are shown in the attached Figure 5 .

[0051] Cloning rate (%) = number of clones / number of inoculations × 100%.

[0052] 6. Detection of cell invasion ability One day before the experiment, place a tube of Matrigel (purchased from Corning) from -20℃ into a 4℃ refrigerator overnight, and the Matrigel will melt from solid to liquid. Hydrate the basement membrane: add 50μL of 10g / L BSA serum-free culture medium to each well, 37℃, 30min. Coat the basement membrane: discard the culture medium in the upper chamber, dilute the Matrigel at 1:8, add 100ul of the diluted Matrigel to each upper chamber to coat the upper chamber surface of the bottom membrane of the transwell chamber, and solidify the gel at 37℃ for 1 hour. The cells (MDA-MB-231, HCC1806, LV-TLR4 KD-1 / MDA-MB-231, LV-NC / MDA-MB-231, LV-TLR4 KD-1 / HCC1806, LV-NC / HCC1806) were routinely trypsinized and washed 1-2 times with PBS to remove the effect of serum. The cells were resuspended in serum-free medium and the cell density was adjusted to 5×10 5 / mL. Take 200μL of cell suspension and add it to the upper chamber of the Transwell chamber, and add 600μL of 10% FBS culture medium to the lower chamber of the 24-well culture plate. Be careful not to generate bubbles between the lower culture medium and the chamber. The culture plate was placed in a CO2 incubator at 37°C and cultured for 36h depending on the invasion ability of tumor cells. Take out the chamber, discard the liquid in the upper chamber, rinse with PBS twice, carefully wipe the cells in the upper layer of the microporous membrane of the chamber with a cotton swab, fix with methanol in a 24-well plate for 30 min, and stain with 0.5% crystal violet solution for 15 min. Take pictures under an inverted microscope, randomly count 10 fields of view for each sample, take the average value, and perform statistical analysis.

[0053] Transwell assay showed that the number of cells that passed through the basement membrane in the LV-TLR4 KD-1 / MDA-MB-231 and LV-TLR4 KD-1 / HCC1806 groups was significantly lower than that in the control group (P < 0.05). The average number of cells that passed through the basement membrane in each 20X field of view in the LV-TLR4 KD-1 / MDA-MB-231 and LV-TLR4 KD-1 / HCC1806 groups was 46 and 57, respectively. Figure 6 .

[0054] 7. Detection of cell migration Normal MDA-MB-231, LV-TLR4 KD-1 / MDA-MB-231, LV-NC / MDA-MB-231, HCC1806, LV-TLR4 KD-1 / HCC1806, and LV-NC / HCC1806 cells were cultured in 2 ml of medium containing 5 × 10 5The cells were plated in a 6-well plate and cultured overnight in a 37°C, 5% CO2 cell culture incubator. After 24 hours, when the cell fusion rate reached 100%, the cells were taken out and scratched vertically with a 200ul pipette tip in the clean bench. The healing of the cells after scratching was observed under a microscope at 0h, 24h, and 48h, and photographed. The results showed that at 48h, the cell migration rates of the LV-TLR4 KD-1 / MDA-MB-231 group and the LV-TLR4 KD-1 / HCC1806 group were 32.53% and 39.41%, respectively, the cell migration rates of the LV-NC / MDA-MB-231 group and the LV-NC / HCC1806 group were 64.97% and 69.53%, respectively, and the cell migration rates of the MDA-MB-231 group and the HCC1806 group were 62.24% and 66.35%, respectively. The results showed that the migration rate of MDA-MB-231 and HCC1806 cells transfected with LV-TLR4 KD-1 recombinant lentivirus was significantly inhibited. The results are shown in the appendix of the instruction manual. Figure 7 .

[0055] 8. Growth of transplanted tumors in nude mice Eighteen SPF female BALB / c nude mice (Vital River Laboratories, Beijing) were purchased. They were 4 weeks old and kept in an animal room. The three human breast cancer cell lines MDA-MB-231, LV-TLR4 KD-1 / MDA-MB-231, and LV-NC / MDA-MB-231 were inoculated in T75 culture flasks, and the cells were subcultured when the confluence reached 70%-80%. The cells were digested and collected with 0.25% trypsin, and the cells were rinsed with PBS for 3 times and diluted to 2×10 7 After mixing with matrix gel (Corning) at a ratio of 1:1, 200ul of the mixture was inoculated subcutaneously into the right breast pad of nude mice. The size of the subcutaneous tumor was observed every 4 days. The tumor growth was dynamically observed with a caliper, and the calculation formula was volume = 1 / 2 (short diameter 2 × long diameter). After 40 days of observation, the tumor growth curve was drawn and the mice were euthanized by rapid cervical dislocation. HE sections were made by taking tissues from various organs of the mice to observe the metastasis of the tumor in the mice.

[0056] The tumor growth curve shows that the growth rate of the transplanted tumor in the LV-TLR4 KD-1 / MDA-MB-231 group was significantly lower than that in the LV-NC / MDA-MB-231 group and the MDA-MB-231 group. The results show that knocking down TLR4 can effectively inhibit the growth of breast cancer cell MDA-MB-231 nude mouse transplanted tumors. The results are shown in the attached manual. Figure 8HE sections of mice in each group showed that 5 mice in the LV-NC / MDA-MB-231 group had tumor metastases in the lungs and lymph nodes, with a metastasis rate of 83%, and 6 mice in the MDA-MB-231 group had tumor metastases in the lungs and lymph nodes, with a metastasis rate of 100%. Only 2 mice in the LV-TLR4 KD-1 / MDA-MB-231 group had tumor metastases in the lymph nodes, with a metastasis rate of 33%. The above results show that knocking down the TLR4 gene can significantly inhibit the metastasis of mouse transplanted tumors in vivo.

Claims

1. A siRNA for inhibiting TLR4 gene expression, characterized in that: The nucleotide sequence thereof is shown in SEQ ID NO:

1.

2. The siRNA according to claim 1, characterized in that The siRNA is transcribed from a DNA oligonucleotide chain as shown in SEQ ID NO: 7 and cleaved by the nuclease Dicer in cells.

3. Use of the siRNA according to claim 1 in the preparation of drugs related to inhibiting cancer cell proliferation and metastasis.

4. The use of siRNA according to claim 3 in the preparation of drugs related to inhibiting cancer cell proliferation and metastasis, characterized in that: The cancer cells are breast cancer cell lines MDA-MB-231 and HCC1806.

Images