Recombinant expression plasmid of neurospora crassa catalase gene, recombinant trichoderma reesei engineering bacterium and construction method and application of recombinant expression plasmid and recombinant trichoderma reesei engineering bacterium

Abstract

The invention discloses a recombinant expression plasmid of a neurospora crassa catalase gene, a recombinant trichoderma reesei engineering bacterium as well as a construction method and application of the recombinant expression plasmid and the recombinant trichoderma reesei engineering bacterium. The cdna1 promoter and the cbh1 signal peptide, the catalase gene cat-3, the cbh2 gene terminator and the 2000bp sequence at the downstream of the cel3c gene needing to be replaced are sequentially contained in the sequence of the cdna1 promoter and the cbh1 signal peptide, and the catalase gene cat-3 and the cbh2 gene terminator are sequentially contained in the sequence of the 2000bp at the upstream of the cel3c gene needing to be replaced. The recombinant Trichoderma reesei engineering bacteria are obtained by transforming recombinant expression plasmids into Trichoderma reesei and screening. According to the invention, the neurospora crassa catalase gene cat-3 is heterologously expressed at the trichoderma reesei cel3c site, so that the beta-glucosidase is increased, and the defects existing when the trichoderma reesei is fermented to produce the cellulase are overcome; and the expression strain has good stability and protein secretion ability.

Description

Technical Field

[0001] The invention belongs to the technical field of gene engineering, and particularly relates to a recombinant expression plasmid of Neurospora crassa catalase gene, a recombinant Trichoderma reesei engineering bacterium, and a construction method and application thereof. Background Art

[0002] The filamentous fungus Trichoderma reesei is a mesophilic saprophytic filamentous fungus and the main industrial production strain of cellulase and hemicellulase. Trichoderma reesei is a food-safe industrial production strain certified by the US FDA. It has the advantages of fast growth, strong reproduction and good biosafety, making it an important microbial resource in the field of biotechnology. It is often developed as a production strain of industrial enzyme preparations and recombinant proteins, and is widely used in food, feed and textiles.

[0003] Catalase (CAT) is an oxidoreductase widely distributed in plants, animals and microorganisms, which can decompose H2O2 into H2O and O2. As the main component of intracellular reactive oxygen species (ROS), H2O2 generally affects cell survival by damaging nucleic acids, lipids and proteins. However, in aerobic organisms, oxygen is essential for efficient energy production. Cellular energy metabolism and oxygen consumption are combined with the production of ROS, resulting in chronic toxic stress in cells. So although ROS play a key role in cell signal transduction and homeostasis, they can also pose a serious threat to cells if the intracellular ROS level deviates from the optimal amount. In order to offset the destructive effects of ROS, eukaryotic cells have evolved various antioxidant strategies to convert harmful ROS into components that are harmless to cells. Compared with other antioxidant enzymes, CAT plays a huge role in reducing hydrogen peroxide content, and its protein activity can help cells reduce oxidative damage.

[0004] Cellulases are a class of enzymes that can hydrolyze cellulose. They work synergistically to degrade cellulose into small molecular compounds such as short-chain cellulose, cellobiose, and glucose. Cellulases are widely present in nature, and cellulases produced by Trichoderma reesei are highly favored for their high efficiency and stability. Cellulases mainly include three types: endoglucanase (EG), exoglucanase (CBH), and β-glucosidase (BG). Among them, endoglucanase can randomly cut the β-1,4-glycosidic bonds inside the cellulose molecule to produce shorter cellulose chains; exoglucanase starts cutting from the non-reducing end of the cellulose chain to produce cellobiose; and β-glucosidase further hydrolyzes cellobiose into glucose.

[0005] Cellulase has a wide range of applications in many fields, such as improving feed digestibility in the feed industry, improving textile quality in the textile industry, and converting lignocellulose into biofuels in bioenergy production. In addition, cellulase can also be used in juice processing and Chinese medicine extraction to optimize the production process by increasing juice yield and extraction rate. However, the high cost of cellulase production remains the main obstacle to the scale-up of lignocellulose bioconversion. Among the cellulase systems secreted by Trichoderma reesei, endoglucanases and exoglucanases account for a high proportion, and the production of β-glucosidase is very low, so its efficiency in cellulose hydrolysis is limited. Strategies to increase cellulase production and efficiency are of great value for the efficient utilization of lignocellulose and the reduction of cellulase costs.

[0006] A Chinese patent application with application number CN202111278695.6 discloses a method for culturing Trichoderma reesei with high production of β-glucosidase. The Trichoderma reesei PB3 is deposited in the China Center for Type Culture Collection (CCTCC) with a deposit number of CCTCC NO: M2021474. The culturing method includes the step of inducing enzyme production using a solid-liquid combined inducer during the culturing process. The solid-liquid combined inducer includes glucose, sophorose and cellulose. The initial concentrations of the above inducers during the culturing are 5-15 g / L, 1.25-3.75 g / L and 10-30 g / L, respectively. This patent application uses a solid-liquid combined inducer to induce enzyme production. During the process of inducing enzyme production in the strain cells, the liquid and solid inducers enter the cell membrane, organelles and cytoplasm through different mass transfer mechanisms, achieving the combined induction of multiple induction pathways, so that the enzyme production efficiency of the final strain is much higher than that of the wild strain. However, the process of inducing enzyme production is relatively cumbersome and difficult to control, and the stable high production of β-glucosidase cannot be guaranteed, and the application cost of cellulase is increased. Therefore, it is urgent to develop a Trichoderma reesei that can efficiently produce β-glucosidase and apply it in the field of cellulose degradation. Summary of the invention

[0007] In order to solve the above problems, the present invention provides a recombinant expression plasmid of the Neurospora crassa catalase gene, a recombinant Trichoderma reesei engineered bacteria and a construction method and application thereof, which can solve the problem of low production of β-glucosidase in cellulase expressed in Trichoderma reesei at present. The recombinant Trichoderma reesei of the present invention improves β-glucosidase by heterologously expressing the Neurospora crassa catalase gene cat-3, and can be used for the production of cellulase.

[0008] The technical solution of the present invention is as follows:

[0009] One of the purposes of the present invention is to provide a recombinant expression plasmid of Neurospora crassa catalase gene, wherein the recombinant expression plasmid comprises Neurospora crassa catalase gene cat-3, and the nucleotide sequence of Neurospora crassa catalase gene cat-3 is shown in SEQ ID NO.1.

[0010] Furthermore, the recombinant expression plasmid sequentially comprises a 2000 bp sequence upstream of the desired substituted cel3c gene, a pry4 selection marker, a cdna1 promoter and a cbh1 signal peptide, a catalase gene cat-3, a cbh2 gene terminator, and a 2000 bp sequence downstream of the desired substituted cel3c gene;

[0011] Wherein, the nucleotide sequence of the 2000 bp sequence upstream of the cel3c gene is shown in SEQ ID NO.2, which serves as the left homology arm;

[0012] The nucleotide sequence of the pry4 selection marker is shown in SEQ ID NO.3;

[0013] The nucleotide sequence of the cdna1 promoter and cbh1 signal peptide is shown in SEQ ID NO.4;

[0014] The nucleotide sequence of the cbh2 gene terminator is shown in SEQ ID NO.5;

[0015] The nucleotide sequence of the 2000 bp sequence downstream of the cel3c gene is shown in SEQ ID NO.6, which serves as the right homology arm.

[0016] The second object of the present invention is to provide a method for constructing a recombinant expression plasmid of the catalase gene of Neurospora crassa. The genomic DNA of Trichoderma reesei is used as a template to amplify a 2000bp sequence upstream of the cel3c gene, a pry4 screening marker, a cdna1 promoter and a cbh1 signal peptide, a cbh2 gene terminator and a 2000bp sequence downstream of the cel3c gene. The 2000bp sequence upstream of the cel3c gene, the pry4 screening marker, the cdna1 promoter and the cbh1 signal peptide, the Neurospora crassa catalase gene cat-3, the cbh2 gene terminator and the 2000bp sequence downstream of the cel3c gene are connected to the expression plasmid to construct a recombinant expression plasmid of the catalase gene of Neurospora crassa.

[0017] The third object of the present invention is to provide a method for constructing a recombinant Trichoderma reesei engineering bacterium, wherein any one of the above-mentioned recombinant expression plasmids is transformed into Trichoderma reesei, and the recombinant Trichoderma reesei engineering bacterium is obtained through screening.

[0018] A fourth object of the present invention is to provide a recombinant engineered bacterium of Trichoderma reesei, wherein the recombinant engineered bacterium of Trichoderma reesei is constructed by the above method.

[0019] A fifth object of the present invention is to provide a use of a recombinant engineered bacterium of Trichoderma reesei in producing catalase.

[0020] The sixth object of the present invention is to provide an application of a recombinant expression plasmid in the production of β-glucosidase and cellulase.

[0021] The seventh object of the present invention is to provide an application of a recombinant Trichoderma reesei engineered bacterium in the production of β-glucosidase and cellulase.

[0022] An eighth object of the present invention is to provide a method for producing β-glucosidase, wherein the β-glucosidase is obtained by fermentation using the above-mentioned recombinant expression plasmid or recombinant Trichoderma reesei engineered bacteria, wherein the amino acid sequence of the β-glucosidase is shown in SEQ ID NO.7.

[0023] The ninth object of the present invention is to provide an application of β-glucosidase in the industrial production of cellulase.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] 1. The present invention utilizes homologous recombination technology to increase the expression level of β-glucosidase by heterologously expressing the Neurospora crassa catalase gene cat-3 at the Trichoderma reesei cel3c site, thereby making up for the low expression level when Trichoderma reesei is fermented to produce cellulase, and innovating the production method of Trichoderma reesei cellulase, which can be applied to the production of cellulase.

[0026] 2. In the present invention, the method for constructing the recombinant engineering strain is reasonable and efficient, which lays a good foundation for the large-scale production and application of Trichoderma reesei cellulase. The recombinant engineering strain of the present invention increases the expression of β-glucosidase-1, i.e., BGL1, and the expression strain has good stability and protein secretion ability, which is more conducive to expanding the application field and application mode of Trichoderma reesei cellulase, and has strong industrial application potential. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is a schematic diagram of the vector of the recombinant expression plasmid of Neurospora crassa catalase gene constructed in Example 1 of the present invention;

[0028] Figure 2 This is a genotype verification diagram of the recombinant Trichoderma reesei engineered bacteria in Example 2 of the present invention;

[0029] Figure 3This is the SDS-PAGE electrophoresis diagram of the fermentation of the recombinant Trichoderma reesei engineered bacteria in Example 3 of the present invention. DETAILED DESCRIPTION

[0030] The following is combined with the preferred embodiment and with reference to the attached Figure 1-3 , the present invention is further described. The endpoints and any values ​​of the ranges disclosed in the present invention are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values; for numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, and these numerical ranges should be regarded as specifically disclosed herein; the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial channels; the experimental methods in the following examples, unless otherwise specified, are all conventional methods.

[0031] The quantitative tests in the following examples were all repeated three times, and the results were averaged.

[0032] In order to better understand the content of the present invention, the filamentous fungus Trichoderma reesei Tu6Δku70Δpry4 is taken as the starting strain for further description of specific examples.

[0033] The Trichoderma reesei QM6a used in the embodiments of the present invention was purchased from the American Type Culture Collection, with the strain accession number being ATCC 13631, and Trichoderma reesei Tu6Δku70Δpyr4 (published in Improved Production of Majority Cellulases in Trichoderma reesei by Integration of cbh1 Gene From Chaetomium thermophilum, 2020) was used as the host strain for the expression of the catalase gene cat-3 of Neurospora crassa.

[0034] The plasmid extraction kit and gel recovery kit used in the examples of the present invention are purchased from OMEGA, and similar products from other companies may also be used instead.

[0035] In an embodiment of the present invention, the formula of the culture medium and reagents is as follows:

[0036] Fermentation medium:

[0037] Luria Bertani (LB) medium formula: yeast powder: 5g, peptone: 10g, sodium chloride: 10g, tap water to 1L, natural pH.

[0038] PDA medium (1L): 200g potato, 20g glucose, 20g agar. Sterilize at 121℃ for 20min, natural pH.

[0039] Fermentation medium 1L: 10mL each of 60g / L MgSO4·7H2O, 60g / L CaCl2·2H2O, 1mL each of 3.7g / LCoCl2·6H2O, 1.4g / L ZnSO4·7H2O, 5g / L FeSO4·7H2O, 1.6g / L MnSO4·H2O, 5g(NH4)2SO4, 15gKH2PO4, 20g bagasse, 5g peptone, natural pH.

[0040] Example 1

[0041] This embodiment provides a method for constructing a recombinant expression plasmid of Neurospora crassa catalase gene, the construction method comprising the following steps:

[0042] 1. Using the genomic DNA of Trichoderma reesei as a template, amplify the 2000bp sequence upstream of the cel3c gene, the pry4 screening marker, the cdna1 promoter and cbh1 signal peptide, the cbh2 gene terminator and the 2000bp sequence downstream of the cel3c gene:

[0043] 1) Cloning of the catalase gene of Neurospora crassa: The nucleotide sequence of the catalase gene registered in Genebank (accession number NC_026503.1) was sent to Beijing Qingke Biotechnology Co., Ltd. for synthesis; the synthetic plasmid was used as a template and the primers cat3-F and cat3-R were used to amplify the cat-3 gene. The nucleotide sequence of the catalase gene cat-3 of Neurospora crassa is shown in SEQ ID NO.1.

[0044] Wherein, the primer sequences used in step 1) are as follows:

[0045] cat3F: gccacagctcgtgctgcatgcccctttgccga;

[0046] cat3R: tgaagcccggtcacgaaagccttatactcctcatcatcgccat.

[0047] 2) Plasmid vector fragment amplification: Using the genome of the wild-type Trichoderma reesei strain QM6a as a template, the 2000 bp homology arm sequence upstream of the cel3c gene, the pry4 selection marker, the cdna1 promoter and cbh1 signal peptide, the cbh2 gene terminator, the 2000 bp homology arm sequence downstream of the cel3c gene and the pBluescript II SK(+) vector backbone fragment containing the Amp selection marker were amplified in sequence.

[0048] Use primers 5cel3cF and 5cel3cR to amplify the 2000 bp homology arm sequence upstream of the cel3c gene:

[0049] 5cel3cF:gaccggcagcggccgcgggacacgtgcaacagt;

[0050] 5cel3cR:ggatggtttggatgcagttggatggaaggactggatgacaa.

[0051] Primers pry4F and pry4R were used to amplify the Trichoderma reesei orotidine-5'-phosphate decarboxylase gene pry4 as a screening marker:

[0052] pry4F:ttgtcatccagtccttccatccaactgcatccaaaccatcc;

[0053] pry4R: gctgctaccatcattgtctgccccaaagtcgcaatatcgg.

[0054] Use primers cdna1F and cdna1R to amplify the cdna1 promoter and cbh1 signal peptide sequence:

[0055] cdna1F:ccgatattgcgactttggggcagacaatgatggtagcagc;

[0056] cdna1R:tcggcaaaggggcatgcagcacgagctgtggc.

[0057] Amplify the cbh2 gene terminator using primers cbh2F and cbh2R:

[0058] cbh2F: atggcgatgatgaggagtaaggctttcgtgaccgggcttca;

[0059] cbh2R:gccaaagatgatgcacgactgcggaatcattatcatctgc.

[0060] Use primers 3cel3cF and 3cel3cR to amplify the 2000 bp homology arm sequence downstream of the cel3c gene:

[0061] 3cel3cF: gcagatgataatgattccgcagtcgtgcatcatctttggc;

[0062] 3cel3cR:gcactgcgaggggcctatcagggtggccacgctttgtcga.

[0063] Use primers backboneF and backboneR to amplify the pBluescript II SK(+) vector backbone fragment containing the Amp selection marker:

[0064] backboneF:tcgacaaagcgtggccaccctgataggcccctcgcagtgc;

[0065] backboneR: actgttgcacgtgtcccgcggccgctgccggtc.

[0066] PCR amplification conditions: 98°C for 30 seconds; 98°C for 10 seconds, 60°C for 20 seconds, 72°C for 2 minutes, 30 cycles; 72°C for 3 minutes. After PCR was completed, 1% agarose gel electrophoresis was performed and the product was recovered using a DNA gel recovery kit.

[0067] 2. Connecting the 2000bp sequence upstream of the cel3c gene, the PYR4 screening marker, the cdna1 promoter and the cbh1 signal peptide, the cat-3 gene of Neurospora crassa peroxidase, the cbh2 gene terminator and the 2000bp sequence downstream of the cel3c gene to the expression plasmid to construct a recombinant expression plasmid of the Neurospora crassa peroxidase gene;

[0068] Wherein, the nucleotide sequence of the 2000 bp sequence upstream of the cel3c gene is shown in SEQ ID NO.2, which serves as the left homology arm;

[0069] The nucleotide sequence of the PYR4 screening marker is shown in SEQ ID NO.3;

[0070] The nucleotide sequence of the cdna1 promoter and cbh1 signal peptide is shown in SEQ ID NO.4;

[0071] The nucleotide sequence of the cbh2 gene terminator is shown in SEQ ID NO.5;

[0072] The nucleotide sequence of the 2000 bp sequence downstream of the cel3c gene is shown in SEQ ID NO.6, which serves as the right homology arm;

[0073] Specifically, fragments from different sources were connected by Gibson, transformed into E. coli T1, and single clones were verified using primers Vcdna1F and Vcat3R. The clones that were verified correctly were selected and shaken in LB+Amp. The plasmids were extracted using a plasmid extraction kit and sent for sequencing. The one that was sequenced correctly was pBluescript SK-cat3. In this embodiment, the vector schematic diagram is shown in the figure below. Figure 1 shown.

[0074] Among them, the primer sequences used in step 2 are as follows:

[0075] Vcdna1F:gcgctcttcgcctaacca;

[0076] Vcat3R: actgttcctcaatgttgc;

[0077] The recombinant plasmid constructed in this example is as follows Figure 1 As shown, the recombinant expression plasmid sequentially comprises a 2000bp sequence upstream of the desired cel3c gene to be replaced, a PYR4 screening marker, a cdna1 promoter and a cbh1 signal peptide, the Neurospora crassa catalase gene cat-3, a cbh2 gene terminator and a 2000bp sequence downstream of the desired cel3c gene to be replaced.

[0078] Example 2

[0079] This example provides a method for constructing a recombinant Trichoderma reesei engineering bacterium. The construction method comprises: transforming the recombinant expression plasmid prepared in Example 1 into Trichoderma reesei, and screening to obtain the recombinant Trichoderma reesei engineering bacterium. The specific process is as follows:

[0080] 1. Electroporation of Trichoderma reesei Tu6Δku70Δpry4:

[0081] 1) Inoculate the Trichoderma reesei Tu6Δku70Δpry4 strain onto a PDA+U solid plate and culture for 5-7 days to allow the strain to grow and produce spores;

[0082] 2) using 1 M ice-cold Sorbitol to wash the spores of Trichoderma reesei Tu6Δku70Δpry4 strain, filter the mycelium, and collect the spore suspension;

[0083] 3) After centrifugation, discard the supernatant and add ice-cold Sorbitol to resuspend the spore suspension. Repeat this process several times and dilute the spore suspension to contain 108 spores per 100 μL volume.

[0084] 4) adding pBluescript SK-cat3 prepared in Example 1 to the spore suspension, and mixing by pipetting;

[0085] 5) The spore suspension was mixed evenly with the pBluescript SK-cat3 prepared in Example 1 and added to a pre-cooled sterilized electroporation cup, and electroshocked at a voltage of 1.6 kV, a capacitance of 25 μF, and a resistance of 600 Ω;

[0086] 6) After the electroporation is completed, quickly add ice-cold Sorbitol to the electroporation cup and mix the spore suspension in the electroporation cup by blowing;

[0087] 7) The electroporated spore suspension was transferred to a centrifuge tube containing YPD liquid medium for overnight culture.

[0088] 8) Centrifuge the cultured spore suspension, discard the supernatant, add MM + 2% glucose liquid medium, centrifuge again, discard the supernatant, and wash the remaining YPD medium;

[0089] 9) Mix the MM+2% glucose solid culture and the spore suspension evenly, pour them onto a cooled MM+2% glucose solid plate, and spread them evenly for culture;

[0090] 2. Homokaryon screening:

[0091] (1) The mycelium grown on the plate was picked up and cultured on a PDA solid plate. After the strain produced spores, it was inoculated on a solid plate containing 2% agar and single distilled water for culture;

[0092] (2) Wash the spores on the solid plate with sterile water, count them, dilute and plate them on a solid plate containing MM medium supplemented with 2% glucose and 0.1% Triton, and culture them;

[0093] (3) Pick the single colonies grown on the solid plate and culture them on the PDA solid plate. After the colonies grow and produce spores, extract the genomic DNA and perform PCR verification to screen out the positive homokaryon strains, which are the recombinant engineered strains.

[0094] In this example, the screening results of the recombinant Trichoderma reesei homokaryon are as follows: Figure 2 As shown, using primers Vcat3-F and Vcel3cR for verification, the recombinant Trichoderma reesei engineered bacteria will amplify the target band of 3950bp, while the wild-type Trichoderma reesei strain QM6a does not, and the recombinant Trichoderma reesei engineered bacteria heterologously expressing the Neurospora crassa catalase gene cat-3 were successfully screened.

[0095] The primer sequences used in this example are as follows:

[0096] Vcat3-F: caaccagaccgtcggccgc;

[0097] Vcel3cR: ccatcgctatcgctcatgat.

[0098] Example 3

[0099] This example provides an application of a recombinant Trichoderma reesei engineered bacterium in the production of β-glucosidase, and the specific process is as follows:

[0100] 1. The recombinant Trichoderma reesei engineered bacteria constructed in Example 2 and the uracil auxotrophic complementation strain Cpyr4 were simultaneously inoculated on a PDA solid plate, cultured at 28° C. for 7 days, and fermented after green spores were produced;

[0101] 2. Use a 250 mL Erlenmeyer flask filled with 50 mL MM + 2% bagasse liquid culture medium for fermentation;

[0102] 3. Wash the recombinant Trichoderma reesei engineered bacteria and the control strain Cpyr4 with sterile water, filter the mycelium through a magic filter cloth, store the spore suspension in a 15 mL centrifuge tube, count the spores of the recombinant Trichoderma reesei engineered bacteria and the control strain, add samples according to the spore amount of 106 / mL per bottle, and shake the flask for fermentation at 28°C and 220rpm for 168h;

[0103] 4. After the fermentation, the fermentation broth was collected and centrifuged at 13000rpm for 10min. The supernatant of the fermentation broth was subjected to SDS-PAGE electrophoresis. The results were as follows: Figure 3 shown.

[0104] 5. The results of SDS-PAGE showed that the recombinant Trichoderma reesei engineered bacteria had a β-glucosidase-1 (BGL1) band with a theoretical molecular mass of 78.45 kDa, while the Cpyr4 strain did not have the target band. After protein sequencing, it was determined to be the β-glucosidase-1 (BGL1) of Trichoderma reesei itself, and the amino acid sequence of the β-glucosidase described in this example is shown in SEQ ID NO.7.

[0105] It can be seen from the above examples that the present invention successfully constructs a strain capable of increasing the production of β-glucosidase in Trichoderma reesei by heterologously expressing the catalase gene cat-3 of Neurospora crassa in the Trichoderma reesei strain. This makes up for the deficiencies and limitations of Trichoderma reesei in the production of cellulase by fermentation, and the experiment confirms the potential of recombinant engineered bacteria to produce β-glucosidase by fermentation, providing an excellent strain for the industrial production of cellulase, and also providing a new method for the production of β-glucosidase by microbial fermentation.

[0106] The above is only a preferred embodiment of the present invention. It should be pointed out that a person skilled in the art can make several modifications and improvements without departing from the inventive concept of the present invention, which all belong to the protection scope of the present invention.

Claims

1. A recombinant expression plasmid of Neurospora crassa catalase gene, characterized in that: The recombinant expression plasmid contains the Neurospora crassa catalase gene cat-3, and the nucleotide sequence of the Neurospora crassa catalase gene cat-3 is shown in SEQ ID NO.

1.

2. The recombinant expression plasmid of Neurospora crassa catalase gene according to claim 1, characterized in that: The recombinant expression plasmid sequentially comprises a 2000 bp sequence upstream of the cel3c gene to be replaced, a pry4 screening marker, a cdna1 promoter and a cbh1 signal peptide, a catalase gene cat-3, a cbh2 gene terminator and a 2000 bp sequence downstream of the cel3c gene to be replaced; Wherein, the nucleotide sequence of the 2000 bp sequence upstream of the cel3c gene is shown in SEQ ID NO.2, which serves as the left homology arm; The nucleotide sequence of the pry4 selection marker is shown in SEQ ID NO.3; The nucleotide sequence of the cdna1 promoter and cbh1 signal peptide is shown in SEQ ID NO.4; The nucleotide sequence of the cbh2 gene terminator is shown in SEQ ID NO.5; The nucleotide sequence of the 2000 bp sequence downstream of the cel3c gene is shown in SEQ ID NO.6, which serves as the right homology arm.

3. The method for constructing the recombinant expression plasmid of Neurospora crassa catalase gene according to claim 2, characterized in that: The genomic DNA of Trichoderma reesei was used as a template to amplify a 2000bp sequence upstream of the cel3c gene, a pry4 screening marker, a cdna1 promoter and a cbh1 signal peptide, a cbh2 gene terminator and a 2000bp sequence downstream of the cel3c gene; the 2000bp sequence upstream of the cel3c gene, the pry4 screening marker, the cdna1 promoter and the cbh1 signal peptide, the Neurospora crassa catalase gene cat-3, the cbh2 gene terminator and the 2000bp sequence downstream of the cel3c gene were connected to an expression plasmid to construct a recombinant expression plasmid of the Neurospora crassa catalase gene.

4. A method for constructing a recombinant Trichoderma reesei engineered bacterium, characterized in that: The recombinant expression plasmid described in claim 1 or 2 or the recombinant expression plasmid constructed by the method described in claim 3 is transformed into Trichoderma reesei, and the recombinant Trichoderma reesei engineered bacteria are obtained through screening.

5. The recombinant Trichoderma reesei engineered bacteria constructed according to the method of claim 4.

6. Use of the recombinant Trichoderma reesei engineered bacteria according to claim 5 in producing catalase.

7. Use of the recombinant expression plasmid according to claim 1 or 2, or the recombinant expression plasmid constructed according to the method according to claim 3 in the production of β-glucosidase and cellulase.

8. Use of the recombinant Trichoderma reesei engineered bacteria according to claim 5 in the production of β-glucosidase and cellulase.

9. A method for producing β-glucosidase, characterized in that: β-glucosidase is produced by fermentation using the recombinant expression plasmid according to claim 1 or 2 or the recombinant expression plasmid constructed according to the method of claim 3, wherein the amino acid sequence of the β-glucosidase is shown in SEQ ID NO.

7.

10. The β-glucosidase produced by the method for producing β-glucosidase according to claim 9 is used for industrial production of cellulase.

Images