Method for cultivating glyphosate-resistant wheat

Abstract

The invention discloses a method for cultivating glyphosate-resistant wheat, which is characterized in that any one of an endogenous EPSPS gene in a wheat 7A genome, an endogenous EPSPS gene in a wheat 4A genome and an EPSPS gene in a wheat 7D gene genome is mutated, so that proline in an EPSPS enzyme conserved region is mutated into serine, and a mutated wheat plant can tolerate glyphosate with high-power recommended dose. The glyphosate-resistant wheat obtained by the invention is high in resistance level and can tolerate 1383-1845 g a.e. / ha glyphosate, the resistance level of the glyphosate-resistant wheat is improved by 59-112% compared with the resistance level of the glyphosate-resistant wheat in the prior art, the commercial resistance level requirement is met, and an important method and gene resources are provided for cultivation of herbicide-resistant wheat varieties.

Description

Technical Field

[0001] The invention belongs to the field of agricultural biotechnology, and in particular relates to a method for cultivating glyphosate-resistant wheat. Background Art

[0002] Wheat is an important food crop. Farmland weeds are one of the adverse biological stresses that affect wheat yield and quality. Glyphosate is the most widely used herbicide in the world, which can effectively remove annual and perennial weeds. However, it has no selectivity for weeds and crops. Improper use can cause plant yield reduction or even failure. The development of glyphosate-resistant wheat can effectively achieve precise and efficient weed control and has broad market value.

[0003] Under natural conditions, no natural mutants of wheat resistant to glyphosate have been found. Currently, glyphosate-resistant wheat is mainly bred through transgenic overexpression and EMS mutagenesis.

[0004] Canada discovered an unauthorized release of a transgenic wheat line, MON71200, which is glyphosate-resistant wheat and contains a microbial-derived CP4-EPSPS protein (Gagnon, M.-C., Duceppe, M.-O., Colville, A., Pope, L., M.-J.and Ogunremi,D.(2024)An integrated strategy involving high-throughput sequencing to characterize an unknown GM wheat event in Canada.Plant Biotechnol.J,22:904-914.https: / / doi.org / 10.1111 / pbi.14232). The unauthorized commercial production of GM wheat will affect global trade and local economies. In addition, the safety of GM wheat has also attracted much attention from consumers.

[0005] The TIPS homozygous mutation of wheat A and D subgroup EPSPS obtained by EMS iterative mutagenesis can tolerate 869 g a.e. / ha of glyphosate, which is close to 1 times the recommended field dose. However, the TIPS mutation and the whole genome random mutation caused by EMS mutagenesis also affect the fruit set rate and other agronomic traits, making it difficult to use directly. It requires multiple generations of backcrossing and breeding to eliminate other harmful background mutations before it can be used (Moehs CP, Austill WJ, Facciotti D, Holm A, Loeffler D, et al. (2021) Development of non-transgenic glyphosate tolerant wheat by TILLING. PLOS ONE 16(9): e0245802. https: / / doi.org / 10.1371 / journal.pone.0245802).

[0006] Therefore, it is necessary to create highly glyphosate-resistant wheat without genetically modified food safety concerns and without adverse effects on yield and other agronomic traits.

[0007] The EPSPS gene is the target of glyphosate, and using EPSPS gene mutation to create glyphosate-resistant crops is a feasible technical approach. However, the mutation method, whether the EPSPS mutant amino acid has glyphosate resistance, and whether the resistance level can reach the field practical level required for commercialization require a lot of specific scientific research to determine its function and beneficial effects. Summary of the invention

[0008] Purpose of the invention: The technical problem to be solved by the present invention is to provide a method for cultivating glyphosate-resistant wheat.

[0009] Technical solution: In order to solve the above technical problems, the present invention provides a method for cultivating glyphosate-resistant wheat, wherein the method uses gene editing technology to mutate the proline P in the conservative amino acid sequence region LFLGNAGTAMRPL of the EPSPS protein encoded by the endogenous EPSPS gene of wheat to serine S.

[0010] Among them, the gene editing technology includes guided gene editing technology.

[0011] The guided gene editing technology includes designing and synthesizing a protospacer, an RT template and a PBS sequence and constructing them to obtain a gene editing vector, and then transferring the gene editing vector into Agrobacterium and then transforming wheat immature embryos.

[0012] The protospacer sequence is: AAGCTCTTCTTGGGTAATGC

[0013] The RT template sequence is: gctgccgtcagGCTCCGCATTGCAGTtccagca

[0014] The PBS sequence is: ttacccaagaa.

[0015] Wherein, the construction method of the guide gene editing vector is as follows:

[0016] (1) Design and synthesize primers F1: ttcgattcccggctggtgcaaagctcttcttgggtaatgcGTTTTAGAGCTAGA, wherein the F1 primer contains a protospacer sequence; R1: actagatagaaccgcgtcaattcttgggtaatgctggaAcTGCAATGCGGAGCctgacggcagcGCACCGACTC GGTGCC, wherein the R1 primer contains an RT template and a PBS sequence;

[0017] (2) Using the gRNA scalffold fragment (sequence: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAA AAGTGGCACCGAGTCGGTGC) as a template, PCR amplification was performed with the F1 primer and the R1 primer to obtain a PCR product;

[0018] (3) Connect the PCR product to the vector to obtain the guide editing vector.

[0019] The method comprises mutating the proline P to serine S in the conservative amino acid sequence region LFLGNAGTAMRPL of at least one EPSPS gene among the three endogenous EPSPS genes of wheat.

[0020] The three endogenous EPSPS genes of wheat include the endogenous EPSPS gene in the wheat 7A genome, the endogenous EPSPS gene in the wheat 4A genome and the endogenous EPSPS gene in the wheat 7D genome.

[0021] The endogenous EPSPS gene in the wheat 7A genome encodes a mutant EPSPS protein in which the proline P at position 172 of the amino acid sequence is mutated to serine S, and the amino acid sequence thereof is shown in SEQ ID NO.1.

[0022] Among them, the endogenous EPSPS gene in the wheat 4A genome encodes a mutant EPSPS protein in which the proline P at position 140 is mutated to serine S, and its amino acid sequence is shown as follows.

[0023] The endogenous EPSPS gene in the wheat 7D genome encodes a mutant EPSPS protein in which the proline P at position 172 of the amino acid sequence is mutated to serine S, and the amino acid sequence is shown in SEQ ID NO.3.

[0024] Among them, the endogenous EPSPS gene in the wheat 7A genome, the endogenous EPSPS gene in the wheat 4A genome and the endogenous EPSPS gene in the wheat 7D genome mutated proline P to serine S in the conserved amino acid sequence region LFLGNAGTAMRPL of their EPSPS proteins, the proline P at the 172nd position of the amino acid sequence of the EPSPS-7A protein mutated to serine S, the proline P at the 140th position of the amino acid sequence of the EPSPS-4A protein mutated to serine S, and the proline P at the 172nd position of the amino acid sequence of the EPSPS-7D protein mutated to serine S.

[0025] Among them, the sequences of the endogenous EPSPS gene in the wheat 7A genome, the endogenous EPSPS gene in the wheat 4A genome and the endogenous EPSPS gene in the wheat 7D genome are shown as SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6 respectively.

[0026] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0027] 1) Compared with the EMS mutagenesis method, which produces many random gene mutations and requires a long backcrossing cycle for many years to stabilize agronomic traits, the method of the present invention has the advantages of precise site-directed mutation, no effect on other agronomic traits, and a short cultivation cycle of only one year.

[0028] 2) The resistance level of the TIPS mutant induced by EMS is only 869 g ae / ha of glyphosate, which is close to 1 times the recommended dose; the glyphosate-resistant wheat obtained by the present invention has a high resistance level and can tolerate 1383-1845 g ae / ha of glyphosate, which is 59-112% higher than the resistance level of the prior art and meets the requirements of commercial resistance levels, providing an important method and gene resource for the breeding of herbicide-resistant wheat varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1The figure is the conservative sequence result in the multiple alignment analysis of the plant EPSPS amino acid sequence in Example 1; the NCBI accession number of the plant EPSPS protein amino acid sequence and its corresponding plant: XP_015643046.1_rice [Oryza sativa], XP_044425014.1_wheat [Triticum aestivum] (7A), XP_044366289.1_wheat [Triticumaestivum] (4A), XP_044439315.1_wheat [Triticum aestivum] (7D), XP_008659331.2_corn [Zea mays], XP_040962591.1_cotton [Gossypium hirsutum] (D12), XP_016735170.2_cotton [Gossypium hirsutum] (A12).

[0030] Figure 2 The location of the protospacer (referred to as spacer) targeted sequence, PBS, and RT template used to guide editing, as well as the sequence information of the expression frame, and the SNP difference map of the three subgroups of EPSPS genes in the conserved region.

[0031] Figure 3 This is the electrophoresis diagram of the endogenous EPSPS gene fragment of wheat T0 generation single plant amplified by PCR; the markers from top to bottom are 5000bp, 3000bp, 2000bp, 1000bp, 750bp, 500bp, 250bp, and 100bp. Sample order: the first row of markers are No. 1-24 from left to right, the second row of markers are No. 25-48 from left to right, and the third row of markers are No. 49-65 from left to right.

[0032] Figure 4 This is the Sanger sequencing result of the universal primers simultaneously amplifying the EPSPS gene fragments of the three subgroups of T0 generation wheat. The arrows on both sides of the box indicate the SNP differences in the conservative region of the EPSPS genes of the three subgroups.

[0033] Figure 5 The diagram shows the Sanger sequencing results of EPSPS gene fragments of three subgroups of T0 generation wheat amplified by specific primers.

[0034] Figure 6The glyphosate resistance identification results of T1 generation seedlings. #13, #43, #27, etc. are strain numbers, and the EPSPS genotypes are in brackets below the strain numbers. Among them, WT is wheat TaEPSPS without editing, 7A, 4A, and 7D represent TaEPSPS-7AP172S, TaEPSPS-4A P140S, and TaEPSPS-7D P172S mutations, respectively. The genotypes of TaEPSPS gene editing are detailed in Tables 2-10.

[0035] Figure 7 This is the result of glyphosate resistance identification of T2 generation seedlings in the field.

[0036] Figure 8 This is the result of glyphosate resistance identification of T2 generation seedlings in the artificial climate chamber.

[0037] Fig. 9 This is the result of glyphosate resistance identification of T2 generation seedling detached leaf discs.

[0038] Fig.10 This is a graph showing the agronomic traits of T2 generation wheat. DETAILED DESCRIPTION

[0039] The embodiments of the present invention will be described in detail below in conjunction with the examples, but it will be appreciated by those skilled in the art that the following examples are only used to illustrate the present invention and should not be considered to limit the scope of the present invention. If the specific conditions are not specified in the examples, they are carried out according to conventional conditions or the conditions recommended by the manufacturer. If the manufacturer is not specified for the reagents or instruments used, they are all conventional products that can be obtained commercially. All gene fragments, primers, etc. in the present invention are synthesized by a commissioned company.

[0040] Example 1 Multiple alignment analysis of amino acid sequences in the conserved region of plant EPSPS

[0041] The amino acid sequences of multiple plant EPSPS proteins were obtained from the NCBI website, including rice (XP_015643046.1), corn (XP_008659331.2), cotton (XP_016735170.2, XP_040962591.1), and wheat (XP_044439315.1, XP_044366289.1, XP_044425014.1). Multiple comparisons of amino acid sequences revealed that the conserved amino acid regions were Figure 1 As shown by the underline, the wild-type amino acid sequence of the conserved region is LFLGNAGTAMRPLTAA.

[0042] Example 2 Comparison and analysis of wheat EPSPS genomic DNA sequences

[0043] According to the wheat EPSPS protein amino acid sequences XP_044439315.1, XP_044366289.1, and XP_044425014.1 in Example 1, the corresponding genomic DNA nucleotide sequences LOC123165688 (named EPSPS-7D), LOC123088173 (named EPSPS-4A, derived from 7B translocation), and LOC100192183 (named EPSPS-7A) were obtained respectively.

[0044] DNA sequence comparison analysis revealed that the three subgroup genes of wheat EPSPS-7D, EPSPS-4A, and EPSPS-7A had SNP differences in their amino acid conservative regions LFLGNAGTAMRPLTAA, such as Figure 2 As shown, based on the consistency of the three DNA sequences, the same gene editing target can be designed to perform gene editing on the three subgroups of EPSPS genes, and the three subgroups of EPSPS genes and their gene editing conditions can also be effectively distinguished based on SNPs.

[0045] Example 3 Design of guide editing vector for wheat EPSPS gene

[0046] We used optimized prime editing technology to edit the endogenous EPSPS gene of wheat. The optimized prime editing vector was constructed based on the pCAMBIA1300 vector backbone. The pCAMBIA1300 plasmid was double-digested with EcoRI and HindIII, and then the gene fragment containing the PEmax expression frame and the epegRNA expression frame (sequence as shown in SEQ ID NO.7) was inserted into the digested plasmid to obtain the PE2max vector. Among them, epegRNA is composed of 5 parts, including the gene-specific target site protospacer, the reverse transcription template (RT template) storing the target site editing information, the primer binding site (Prime Binding Site, PBS) and the protection element that protects the 3' end sequence of epegRNA from degradation. The sequences of gRNA scalffold and protection elements are fixed, while protospacer, RT template and PBS vary with the editing target site, and the three of them jointly determine the gene editing results. Therefore, to edit the endogenous EPSPS of wheat, we only need to design the corresponding protospacer, RT template and PBS.

[0047] like Figure 2 As shown in the figure, based on the consistency of the three endogenous EPSPS DNA sequences of wheat, the same gene editing target protospacer was designed to perform gene editing on the three subgroups of EPSPS genes, specifically:

[0048] protospacer:AAGCTCTTCTTGGGTAATGC

[0049] RT template: gctgccgtcagGCTCCGCATTGCAGTtccagca

[0050] PBS: ttacccaagaa

[0051] The process of constructing the guide editing vector is as follows:

[0052] (1) Design and synthesize primers F1: ttcgattcccggctggtgcaaagctcttcttgggtaatgcGTTTTAGAGCTAGA, wherein the F1 primer contains a protospacer sequence; R1: actagatagaaccgcgtcaattcttgggtaatgctggaAcTGCAATGCGGAGCctgacggcagcGCACCGACTC GGTGCC, wherein the R1 primer contains an RT template and a PBS sequence;

[0053] (2) Using the gRNA scalffold fragment (sequence: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAA AAGTGGCACCGAGTCGGTGC) as a template and F1+R1 as primers, amplification was performed using the high-fidelity enzyme phanta (Nanjing Novogene Biotech Co., Ltd.) to obtain a 180 bp fragment; the PCR reaction system was as follows: 2×PhantaMax Buffer 10 μL, dNTP Mix (10 mM each) 0.4 μL, 10 μM forward primer 0.5 μL, 10 μM reverse primer 0.5 μL, gRNA scalffold fragment 1 μL, Phanta Max Super-Fidelity DNA Polymerase (1 U / μL) 0.2 μL, and sterile water to make up to 20 μL. The PCR amplification reaction procedure was as follows: pre-denaturation: 95°C for 3 min; 35 cycles: denaturation at 95°C for 30 sec; annealing at 58°C for 30 sec, extension at 72°C for 1 min; insulation: 72°C for 5 min. The product was cleaned and recovered using a PCR cleaning kit (purchased from Axygen).

[0054] (3) The 180bp gene fragment was cloned into the PE2max vector digested with BsaI using the ClonExpress II One Step Cloning Kit from Novogene. The homologous ligation system was as follows: 2μL 5×CEII buffer, 1μL Exnase, 4μL PCR product, 3μL linearized vector after 75-100ng digestion, a total of 10μL. The above system was mixed and reacted at 37°C for 30min. Then, the full amount of 10μL ligation product was added to 30μL E. coli DH5α competent cells, gently mixed, left at room temperature for 5min, and then heat-shocked to transform E. coli. The cells were plated on LB plates containing 50mg / L kanamycin and cultured overnight. The next day, clones that were positive after PCR verification were sent to Qingke Biotechnology Co., Ltd. for sequencing, and the guide editing vector PE2max-TaP106S was obtained.

[0055] (4) The epegRNA expression cassette in the successful guide editing vector PE2max-TaP106S was constructed as follows Figure 2 As shown (SEQID NO.8), it contains the protospacer, RT template and PBS corresponding to editing wheat endogenous EPSPS.

[0056] The expected editing results are as follows:

[0057] The DNA sequence of the partial segment of the mutant EPSPS of wheat subgroup 7D is derived from the wild type ACTGCAATGCG TCCAT Mutation to ACTGCAATGCG GAGCC , resulting in the mutation of the encoded protein from proline P at position 172 of the wild type to serine S.

[0058] The DNA sequence of the partial segment of the mutant EPSPS of wheat subgroup 7A is changed from wild type ACTGCAATGCG GCCAC Mutation to ACTGCAATGCG GAGCC , resulting in the mutation of the encoded protein from proline P at position 172 of the wild type to serine S.

[0059] The DNA sequence of the partial segment of the wheat 4A subgroup mutant EPSPS is derived from the wild type ACTGCAATGCG GCCAT Mutation to ACTGCAATGCG GAGCC , resulting in the mutation of the encoded protein from proline P at position 140 of the wild type to serine S.

[0060] Example 4 Mixed detection of EPSPS genotypes of three subgroups of wheat T0 generation regenerated seedlings

[0061] The constructed gene editing vector PE2max-TaP106S was transformed into wheat embryos by Agrobacterium, and the method of transforming wheat embryos by Agrobacterium is a conventional technique in the art. The method described in the reference was used to transform the wheat variety Fielder (Sadiye Hayta, Mark A. Smedley, Selcen U. Demir, Robert Blundell, Alison Hinchliffe, Nicola Atkinson, Wendy A. Harwood. An efficient and reproducible Agrobacterium-mediated transformation method for hexaploid wheat (Triticum aestivum L.). Plant Methods, 2019, 15: 121).

[0062] 67 regenerated wheat T0 seedlings were obtained, DNA was extracted, and PCR was performed with universal primers TA980-F: tatttatagtaagatgagaaattggagc and TA1400-R: aagtcaccaataggtcgctccc to amplify 469 bp of the EPSPS gene fragments of wheat 7D, 7A, and 4A subgroups. The target editing site was located within the 469 bp segment. The PCR results are shown in Figure 2. Figure 3 As shown in Figure 1, a total of 59 DNA samples from T0 generation regenerated seedlings amplified a specific 469 bp bright band. The obtained PCR products were sent to Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results are shown in Figure 1. Figure 4 As shown:

[0063] (1) Since the PCR product fragments of the three subgroups of EPSPS genes contain SNP differences, the PCR product Sanger sequencing peak graph shows a double peak at the SNP sites of the three subgroups of EPSPS genes. The actual sequencing results are shown by the arrows on both sides of the box, and the results are in line with expectations.

[0064] (2) If the three bases CCA encoding proline Pro shown in the box show a single peak, it indicates that they are all wild-type bases, there is no mutation, and no editing has occurred; if there are double peaks, it indicates that wild-type and mutant bases coexist, gene editing has occurred, and the expected results of the experimental design have been achieved.

[0065] (3) Since the sequenced PCR product contains gene fragments of three subgroups of EPSPS, namely 7A, 4A, and 7D, further specific detection of the three subgroups is required to determine which subgroup of EPSPS or all three subgroups of EPSPS have mutated.

[0066] According to statistics, among the 59 T0 regenerated seedlings tested, 11 plants had proline P mutation to serine S in the EPSPS conservative amino acid region LFLGNAGTAMRPLTAA, and the mutation rate was 18.6%.

[0067] Example 5 Specific detection of EPSPS genotypes in three subgroups of wheat T0 generation regenerated seedlings

[0068] The 11 T0 strains obtained in Example 4 with Pro site mutation in the EPSPS amino acid conservative region LFLGNAGTAMRPLTAA were further amplified using the specific primer combination shown in Table 1 for the three subgroup EPSPS gene fragments of 7A, 4A, and 7D.

[0069] Table 1 Primer combinations for specific amplification of EPSPS gene fragments from three subgroups of wheat

[0070]

[0071] The obtained PCR product was sent to Qingke Biotechnology Co., Ltd. for sequencing. The sequencing peak graph results are as follows Figure 5 As shown, the EPSPS of the three subgroups 7A, 4A, and 7D can be correctly distinguished based on the SNPs specific to each subgroup.

[0072] The genotype sequencing results of the 11 strains are shown in Table 2. None of the 11 tested T0 strains had mutations in the EPSPS genes of the three subgroups 7A, 4A, and 7D at the same time, nor did any two subgroups of EPSPS have mutations at the same time. Instead, only one of the three subgroups of EPSPS genes had a proline P to serine S mutation, and the genotypes were all heterozygous. Among them, one strain had a P172S mutation in the TaEPSPS-7D subgroup, five strains had a P172S mutation in the TaEPSPS-7A subgroup, and five strains had a P140S mutation in the TaEPSPS-4A subgroup (Table 2).

[0073] Table 2 Mutation of EPSPS genes in three subgroups of wheat T0 plants

[0074]

[0075]

[0076] Example 6 Identification of glyphosate resistance in wheat T1 seedlings

[0077] Wheat T0 plants were harvested, and T1 seeds were subsequently sown in nutrient soil in plastic cups and grown in an artificial climate chamber (28°C, 16 / 8 h photoperiod, light intensity 500 μmol m -2 s -1). 14 days after sowing, the T1 seedlings had 3-4 leaves and were sprayed with 1383g aeha on the stems and leaves. -1 Glyphosate herbicide. The glyphosate herbicide is Monsanto's 41% isopropylamine salt solution produced in Malaysia. The recommended dosage per mu is 150-250mL, which is equivalent to a recommended dosage of 922-1537 g.e.ha. -1 , such as 922g aeha -1 As 1 times the recommended field dose, 1383g AEHA -1 Equivalent to 1.5 times the recommended field dose.

[0078] In 1383g aeha -1 Six days after glyphosate treatment, the leaves of the wild-type seedlings had turned yellow and slightly wilted, while the mutant seedlings had no obvious herbicide symptoms. Figure 6 As shown in Figure 3, after 12 days of glyphosate treatment, most of the wild-type seedlings turned yellow and died, and a small number of mutant seedlings turned yellow and died, but most of the seedlings were green, which was consistent with the expectation of resistance and sensitivity separation in the T1 generation seedling population. After 22 days of glyphosate treatment, the resistant seedlings separated by the mutant strains were still green and growing normally. The statistical resistance ratio is shown in Table 3. The proportion of resistant seedlings in the mutant strains is 30-100%. The resistance ratio of most mutant strains is not 100% because there is still genetic separation of resistance and sensitivity in the T1 population, while the resistance ratio of the wild-type strain is 0%, indicating that the TaEPSPS-7D P172S, TaEPSPS-7A P172S, and TaEPSPS-4A P140S mutations give wheat a high resistance to glyphosate.

[0079] Table 3 Isolation and identification of glyphosate-resistant phenotypes of T1 strains

[0080]

[0081]

[0082] Example 7 Specific detection of EPSPS genotypes of three subgroups of glyphosate-resistant wheat T1 plants

[0083] After glyphosate screening, resistant plants were obtained in the T1 generation, and total DNA from leaves was extracted. The specific primer combinations shown in Table 1 were used to amplify the EPSPS gene fragments of the three subgroups 7A, 4A, and 7D, respectively. The products obtained by PCR were sent to Qingke Biotechnology Co., Ltd. for sequencing. The results showed that each glyphosate-resistant T1 plant was consistent with the T0 plant, and only one of the three subgroups of EPSPS genes had a mutation, but the genotype was homozygous or heterozygous (Tables 4-10), indicating that the TaEPSPS-7DP172S, TaEPSPS-7A P172S, and TaEPSPS-4A P140S mutations were homozygous or heterozygous, which gave wheat a high resistance to glyphosate.

[0084] Table 4 EPSPS genotypes of glyphosate-resistant plants in the T1 population of line 15

[0085]

[0086] Table 5 EPSPS genotypes of glyphosate-resistant plants in the T1 population of line 20

[0087]

[0088] Table 6 EPSPS genotypes of glyphosate-resistant plants in the T1 population of line 23

[0089]

[0090]

[0091] Table 7﹟EPSPS genotypes of glyphosate-resistant plants in the T1 population of strain 27

[0092]

[0093] Table 8 EPSPS genotypes of glyphosate-resistant plants in the T1 population of strain 53

[0094]

[0095] Table 9 EPSPS genotypes of glyphosate-resistant plants in the T1 population of strain 62

[0096]

[0097] Table 10 EPSPS genotypes of glyphosate-resistant plants in the T1 population of strain 63

[0098]

[0099] Example 8 Identification of glyphosate resistance in wheat T2 generation in the field

[0100] After the glyphosate-resistant T1 plants were harvested in the artificial climate chamber, the T2 generation seeds and wild-type recipient seeds were sown in the field during the wheat growth season. 34 days after sowing, the wheat seedlings had 4-5 leaves and were sprayed with 461g aeha on the stems and leaves. -1 Glyphosate herbicide (equivalent to 0.5 times the recommended field dose), during this period, the daytime temperature was 7-11°C, and the nighttime temperature was -3-4°C. 22 days after glyphosate treatment, the wild-type recipient seedlings turned green and yellow, and the plants collapsed to the ground, while the TaEPSPS-7AP172S, TaEPSPS-4AP140S, and TaEPSPS-7D P172S mutants were still normal green, and the plants grew firmly ( Figure 7 ), indicating that the TaEPSPS-7AP172S, TaEPSPS-4A P140S, and TaEPSPS-7D P172S mutants significantly improved their resistance to glyphosate.

[0101] Example 9 Indoor glyphosate resistance assessment of wheat T2 generation

[0102] 34 days after sowing, the 4-5 leaf wheat seedlings in Example 8 were transplanted to an artificial climate chamber for growth (28°C, 16 / 8 h photoperiod, light intensity 500 μmol m -2 s -1 ), and 1383 and 1845 ga.e.ha were sprayed on stems and leaves after 3 days of adaptive growth. -1 Glyphosate herbicide (equivalent to 1.5 and 2 times the recommended field dose, respectively). Figure 8 As shown, 12 days after treatment with the two glyphosate doses, the wild-type recipient plants completely wilted and died, while the TaEPSPS-7A P172S, TaEPSPS-4AP140S, and TaEPSPS-7D P172S mutants were still alive and green, with only some leaves at the base or tips dying, indicating that they had significantly improved resistance to glyphosate.

[0103] Example 10 Identification of glyphosate resistance in wheat T2 generation detached leaf discs

[0104] Under glyphosate inhibition, the EPSPS enzyme activity in the plant is inhibited and shikimate accumulates. Therefore, the accumulation of shikimate is negatively correlated with the level of plant glyphosate resistance. We used the in vitro leaf disc method (Shaner Dale L., Nadler-Hassar Talia, Henry W. Brien, et al. (2005) A rapid in vivo shikimate accumulation assay with excised leaf discs. Weed Sci., 53: 769-774), soaked T2 generation wheat seedlings in vitro leaf discs (7 mm in diameter) with 225 μM glyphosate solution, and measured the shikimate content produced in the leaf discs. The results are as follows Fig. 9 As shown, the shikimic acid content in the leaf discs of the TaEPSPS-7A P172S, TaEPSPS-4A P140S, and TaEPSPS-7D P172S mutants was only 34.25%, 39.20%, and 22.50% of that of the wild-type receptor control, indicating that these mutants significantly improved their resistance to glyphosate.

[0105] Example 11 Investigation of agronomic traits of wheat T2 generation

[0106] After the glyphosate-resistant T1 plants were harvested in the artificial climate chamber, T2 seeds and wild-type recipient seeds were sown in plastic cups with nutrient soil and grown in an artificial climate chamber (28°C, 16 / 8 h photoperiod, light intensity 500 μmol m -2 s -1 ) and unified water and fertilizer management. At maturity, the agronomic traits such as plant height, number of effective tillers, ear length, number of grains per ear, and thousand-grain weight were examined. Fig.10 As shown, compared with the wild-type receptor, the TaEPSPS-7A P172S, TaEPSPS-4AP140S, and TaEPSPS-7DP172S mutations had no obvious negative effects on the above-mentioned agronomic traits, and even had a certain promoting effect on ear length, indicating that they enhanced glyphosate resistance without causing negative effects on agronomic traits such as yield.

Claims

1. A method for cultivating glyphosate-resistant wheat, characterized in that: The method uses gene editing technology to make wheat endogenous EPSPS The proline P in the conserved amino acid sequence region LFLGNAGTAMRPL of the EPSPS protein encoded by the gene was mutated to serine S.

2. The method for cultivating glyphosate-resistant wheat according to claim 1, characterized in that: The gene editing technology includes guided gene editing technology.

3. The method for cultivating glyphosate-resistant wheat according to claim 1, characterized in that: The guided gene editing technology includes designing and synthesizing a protospacer, an RT template and a PBS sequence and constructing them to obtain a gene editing vector, and then transferring the gene editing vector into Agrobacterium, and then transforming wheat immature embryos.

4. The method for cultivating glyphosate-resistant wheat according to claim 1, characterized in that: The method comprises making three endogenous EPSPS At least one of the genes EPSPS The proline P in the conserved amino acid sequence region LFLGNAGTAMRPL of the gene's EPSPS protein was mutated to serine S.

5. The method for cultivating glyphosate-resistant wheat according to claim 4, characterized in that: The three endogenous EPSPS Genes including endogenous EPSPS Gene, endogenous in wheat 4A genome EPSPS endogenous genes in the wheat 7D genome EPSPS Gene.

6. The method for cultivating glyphosate-resistant wheat according to claim 5, characterized in that: The endogenous EPSPS The gene encodes a mutant EPSPS protein in which the proline P at position 172 of the amino acid sequence is mutated to serine S, and its amino acid sequence is shown in SEQ ID NO.

1.

7. The method for cultivating glyphosate-resistant wheat according to claim 5, characterized in that: The endogenous EPSPS The proline P at position 140 of the amino acid sequence of the gene-encoded mutant EPSPS protein is mutated to serine S, and its amino acid sequence is shown in SEQ ID NO.

2.

8. The method for cultivating glyphosate-resistant wheat according to claim 5, characterized in that: The endogenous EPSPS The proline P at position 172 of the amino acid sequence of the gene-encoded mutant EPSPS protein is mutated to serine S, and its amino acid sequence is shown in SEQ ID NO.

3.

9. The method for cultivating glyphosate-resistant wheat according to any one of claims 4 to 8, characterized in that: The endogenous EPSPS Gene, endogenous in wheat 4A genome EPSPS endogenous genes in the wheat 7D genome EPSPS The proline P in the conserved amino acid sequence region LFLGNAGTAMRPL of the EPSPS protein of the gene mutated to serine S, the proline P at position 172 of the amino acid sequence of the EPSPS-7A protein mutated to serine S, the proline P at position 140 of the amino acid sequence of the EPSPS-4A protein mutated to serine S, and the proline P at position 172 of the amino acid sequence of the EPSPS-7D protein mutated to serine S.

10. The method for cultivating glyphosate-resistant wheat according to claim 5, characterized in that: The endogenous EPSPS Gene, endogenous in wheat 4A genome EPSPS endogenous genes in the wheat 7D genome EPSPS The gene sequences are shown in SEQ ID NO. 4, SEQ ID NO. 5, and SEQ ID NO. 6, respectively.

Images