Bac-to-Bac baculovirus expression system and application thereof in preparation of recombinant adeno-associated virus

Abstract

The invention discloses a Bac-to-Bac baculovirus expression system and an application of the Bac-to-Bac baculovirus expression system in preparation of a recombinant adeno-associated virus. The Bac-to-Bac baculovirus expression system disclosed by the invention comprises donor plasmids and DH10Bac competent bacteria, wherein the donor plasmids and the DH10Bac competent bacteria are used for expressing The donor plasmid comprises a temperature-sensitive replicon control element, a Rep gene expression cassette, a Cap gene expression cassette and a recombinant adeno-associated virus core expression element ITR-GOI with a heterologous functional gene segment; the DH10Bac competent bacteria comprise a baculovirus genome plasmid bacmid and a helper plasmid, and the helper plasmid comprises a temperature-sensitive replicon control element and a Tn7 transposase expression cassette. The recombinant rod grain prepared on the basis of the Bac-to-Bac baculovirus expression system disclosed by the invention is purer, does not contain invalid plasmids, and has higher plasmid transfection efficiency, filial generation BEV yield and rAAV yield.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a Bac-to-Bac baculovirus expression system and an application thereof in preparing a recombinant adeno-associated virus. Background Art

[0002] Recombinant adeno-associated virus (rAAV) has the characteristics of high safety, low immunogenicity, wide host range, and the ability to mediate long-term stable expression of exogenous genes in animals. It has important applications in basic research and gene therapy. AAV belongs to the genus Dependoviridae of the family Parvoviridae. Its genome size is about 4.7kb, mainly including two inverted terminal repeats (ITRs) of about 145bp distributed at both ends of the genome and the Rep gene and Cap gene in the middle. After AAV infects cells, it cannot replicate alone and can only participate in replication in the presence of helper viruses (such as adenovirus). The Rep gene and Cap gene in the AAV genome are removed and exogenous genes are inserted. At the same time, the reverse compensation Rep gene, Cap gene and helper virus elements are used to finally package recombinant AAV virus particles (rAAV) carrying exogenous genes in cell lines.

[0003] The preparation of rAAV based on the Bac system mediated by baculovirus expression vector (BEV) is one of the main methods for preparing rAAV. The Bac system can be divided into three baculovirus systems (ThreeBac), two baculovirus systems (TwoBac) and one baculovirus system (OneBac) according to the number of baculoviruses that infect insect cells. The process of producing rAAV in the OneBac system is to introduce the donor plasmid carrying the Cap gene expression cassette of AAV, the Rep gene expression cassette of AAV and the ITR core expression element into DH10 Bac bacteria (containing the baculovirus genome bacmid and the auxiliary plasmid expressing Tn7 transposase (pMON7124), and integrate the above elements into the baculovirus genome (BEV / Cap-ITR-GOI-Rep) by Tn7 recombination, and then use one baculovirus to infect insect cells to prepare rAAV (Wu et al., 2018). The OneBac system has advantages in efficiency and large-scale preparation for producing rAAV.

[0004] Currently in the OneBac system, the donor plasmid (Donor) carrying the AAV packaging element and the baculovirus genome (bacmid) are recombined with the help of the helper plasmid (pMON7124) to obtain a recombinant bacmid containing an exogenous gene expression frame, and then the recombinant bacmid is transfected into insect cells to rescue the infectious BEV, and the BEV is used to infect insect cells to prepare rAAV. In this process, the helper plasmid and the donor plasmid play a role by providing transposase and donor DNA fragments respectively, and the two plasmids become invalid plasmids after recombination. However, the recombinant bacmid prepared based on the above method is a mixed bacmid containing invalid plasmids, the transfection efficiency is not high, and it is easy to recombine in the cells, which ultimately affects the yield of rAAV. Summary of the invention

[0005] In view of the above defects or improvement needs of the existing OneBac system for producing rAAV technology, the present invention provides a Bac-to-Bac baculovirus expression system and its application in preparing recombinant adeno-associated virus. Its purpose is to construct a controllable donor plasmid and helper plasmid based on a temperature-sensitive element, which can be lost in bacteria after completing Tn7 transposase-mediated recombination, thereby improving the purity of the extracted recombinant bacmid, increasing the transfection efficiency and the yield of progeny BEV, and improving the yield of rAAV produced by the OneBac system.

[0006] The specific technical solutions of the present invention are as follows:

[0007] On the one hand, the present invention provides a Bac-to-Bac baculovirus expression system, which comprises a donor plasmid and a DH10Bac competent bacterium; the donor plasmid comprises a temperature-sensitive replicon control element, a Rep gene expression cassette, a Cap gene expression cassette and a recombinant adeno-associated virus core expression element ITR-GOI with a heterologous functional gene fragment; the DH10 Bac competent bacterium comprises a baculovirus genome plasmid bacmid and a helper plasmid, and the helper plasmid comprises a temperature-sensitive replicon control element and a Tn7 transposase expression cassette.

[0008] Further, the temperature-sensitive replicon control element is selected from a temperature-sensitive RK2 plasmid, the temperature-sensitive RK2 plasmid is obtained by mutation of the trfA protein sequence of the RK2 plasmid, and the temperature-sensitive replicon control element is composed of oriV and trfA gene expression frames of the temperature-sensitive RK2 plasmid;

[0009] Preferably, the trfA protein sequence mutation of the RK2 plasmid is 235G, 163C, 171W, 173K, 203L, 213S, 230V, 247C, 254D, 313L, 316V, 332F or 374 deletion mutation;

[0010] Preferably, the nucleotide sequence of the temperature-sensitive replicon control element is shown in SEQ ID NO.1.

[0011] Furthermore, the donor plasmid is obtained by replacing pFast.Bac.Dual, pFastBac TM 1 or pFastBac TM The pUC ori in the HTA plasmid was replaced with the temperature-sensitive replicon control element to construct;

[0012] Preferably, the donor plasmid is constructed by replacing the pUC ori in the pFast.Bac.Dual plasmid with a temperature-sensitive replicon control element;

[0013] The helper plasmid was constructed by replacing the pUC ori in the pMON7124 plasmid with a temperature-sensitive replicon control element.

[0014] Furthermore, the recombinant adeno-associated virus core expression element ITR-GOI with heterologous functional gene fragments is constructed by ITR and heterologous functional gene fragments;

[0015] Preferably, the heterologous functional gene fragment is selected from one of EGFP, RFP and BFP.

[0016] Furthermore, the structure of the Rep gene expression cassette, the Cap gene expression cassette and the recombinant adeno-associated virus core expression element ITR-GOI carrying the heterologous functional gene fragment is Cap-ITR(GOI)-Rep.

[0017] Furthermore, the promoter of the Rep gene expression cassette is the PH promoter; and the promoter of the Cap gene expression cassette is the P10 promoter.

[0018] Furthermore, the Rep gene, Cap gene and ITR are selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVDJ, AAV-retro, AAV-PHP.eB, AAV-PHP.pB, and AAV-CAP-B10.

[0019] The present invention also provides a recombinant bacmid, which is prepared based on the Bac-to-Bac baculovirus expression system, specifically: a donor plasmid is transferred into DH10 Bac competent bacteria, cultured at 30°C to allow the donor plasmid and the bacmid plasmid to recombine, and then the recombinants are picked and identified by blue-white screening and colony PCR methods, and the positive recombinants are then cultured at 37°C and contain only Kan +The culture is carried out under the conditions of antibiotic medium, so that the auxiliary plasmid and the donor plasmid that are not fully utilized in the recombinant bacteria are actively lost in the bacteria, and the recombinant bacmid is extracted.

[0020] The present invention also provides the use of the Bac-to-Bac baculovirus expression system or the recombinant bacmid in preparing a recombinant adeno-associated virus.

[0021] The present invention also provides a method for preparing a recombinant adeno-associated virus, comprising the steps of:

[0022] (1) transfecting insect cells with the recombinant bacmid to obtain progeny BEV;

[0023] (2) The progeny BEV is used to infect insect cells and rAAV is purified;

[0024] Preferably, the insect cells in step (1) and step (2) are Sf9, ExpiSf9 or Hi-five;

[0025] Preferably, the insect cells in step (1) and step (2) are selected from ExpiSf9 cells;

[0026] Preferably, the recombinant bacmid transfection of insect cells in step (1) is carried out by adherent transfection or suspension transfection.

[0027] The beneficial effects of the present invention are:

[0028] Compared with the existing OneBac system, the OneBac system based on the present invention RK2-ts The recombinant bacmid prepared by the system is purer, does not contain invalid plasmids, and has higher plasmid transfection efficiency, progeny BEV yield and rAAV production. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 It is a schematic diagram of the temperature-sensitive donor plasmid and helper plasmid in the present invention.

[0030] Figure 2 It is a schematic diagram of the preparation of pure recombinant bacmid free of invalid plasmids according to the present invention.

[0031] Figure 3 This is a schematic diagram of the present invention using the OneBac system to prepare rAAV.

[0032] Figure 4 The OneBac system and the OneBac RK2-ts Figure 1. Recombinant bacmid DNA extracted from the system.

[0033] Figure 5 The OneBac system and OneBacRK2-ts The recombinant bacmid of the system and the obtained progeny BEV diagram; the cell transfection diagram on the left and the P1 generation BEV titer diagram on the right.

[0034] Figure 6 The suspension transfection OneBac system and OneBac RK2-ts The recombinant bacmid of the system and the obtained progeny BEV titer graph; cell transfection graph on the left, P1 generation BEV titer graph on the right.

[0035] Figure 7 In Example 2, the OneBac system and the OneBac RK2-ts Yield chart of rAAV produced by the system. DETAILED DESCRIPTION

[0036] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention. In addition, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as the specifications do not conflict with each other.

[0037] Autographa californica multinucleopolyhedrosis virus (AcMNPV) is a baculovirus with a genome length of about 134kb. The Bac-to-Bac system is developed based on AcMNPV. The Bac-to-Bac baculovirus expression system is the most widely used insect baculovirus expression system and is widely used in heterologous protein expression, vaccine and antibody production, and large-scale preparation of recombinant adeno-associated viruses. The Bac-to-Bac baculovirus expression system contains a donor plasmid and DH10Bac bacteria. The donor plasmid contains two target sites for the Escherichia coli Tn7 transposon, with multiple cloning sites and resistance selection marker genes between the target sites. The DH10 Bac bacteria contain a baculovirus shuttle plasmid (bacmid) and a helper plasmid pMON7124; bacmid is a bacmid, which refers to a plasmid with a baculovirus genome that can shuttle between bacteria and insect cells. The helper plasmid provides the Tn7 transposase required for transposition to help complete the transposition process.

[0038] In the Bac-to-Bac baculovirus expression system, the donor plasmid carrying the target gene is introduced into DH10 Bac bacteria to obtain a recombinant bacmid. The specific steps are as follows:

[0039] First, the exogenous gene is cloned into the multiple cloning site of the donor plasmid; then, the donor plasmid is transformed into DH10 Bac bacteria containing a baculovirus shuttle plasmid and a helper plasmid using the ordinary CaCl2 method; under the action of the Tn7 transposase provided by the helper plasmid, the exogenous gene is transposed to the gene fragment of the baculovirus shuttle plasmid, and the recombinant bacmid is obtained by blue-white screening.

[0040] Since the helper plasmid only provides Tn7 transposase and does not directly participate in recombination, the recombinant bacmid extracted in the above steps is a mixed plasmid containing a large amount of helper plasmid and non-recombined donor plasmid.

[0041] The Sf9 insect cell line is derived from the ovarian tissue of female Spodoptera frugiperda cell pupae. It is a cloned isolate of IPLB-Sf-21-AE. The cells are sensitive to nuclear polyhedrosis virus and St. Louis encephalitis virus. Sf9 cells are cultured in air at 28°C. They grow in static culture or in suspension. They can also be cultured in shake flasks. SF9 cells can be used to replicate baculovirus expression vectors and are a suitable transfection host. ExpiSf9 cells are non-engineered derivatives of Sf9 insect cells and have a higher ability to express foreign proteins than Sf9.

[0042] The recombinant bacmid was transfected into ExpiSf9 insect cells to rescue the AcMNPV virus (i.e., progeny BEV) with infectious activity and carrying the elements required for AAV production. The progeny BEV was used to infect ExpiSf9 insect cells. Under the strong promoter ability of the promoter (PH or P10), the structural protein Cap and non-structural protein Rep of AAV were efficiently expressed, and the assembly of the capsid and genome was completed in the cell to produce rAAV virus particles. After cell lysis and virus purification, the recombinant adeno-associated virus rAAV with infectious activity and efficient expression of exogenous gene products was finally obtained.

[0043] In a specific embodiment, the present invention provides a Bac-to-Bac baculovirus expression system, which includes a donor plasmid and a DH10 Bac competent bacterium; the donor plasmid contains a temperature-sensitive replicon control element, a Rep gene expression cassette, a Cap gene expression cassette and a recombinant adeno-associated virus core expression element ITR-GOI with a heterologous functional gene fragment; the DH10 Bac competent bacterium contains a baculovirus genome plasmid bacmid and a helper plasmid, and the helper plasmid contains a temperature-sensitive replicon control element and a Tn7 transposase expression cassette.

[0044] RK2 plasmid is a temperature-sensitive low-copy plasmid. Its replication is affected by the ambient temperature and is often used as a tool for traceless elimination in genetic modification (Wang et al., 2014). The protein expressed by the trfA gene on the RK2 plasmid acts in trans on the oriV region to control the replication of the plasmid (Haugan et al., 1992). Mutated trfA proteins (such as 235G synonymous mutations) are sensitive to temperature and have the characteristic of not being expressed at high temperatures (Karunakaran et al., 1998). Therefore, when the ambient temperature is too high, the RK2 plasmid in the bacteria will be gradually lost. In a specific embodiment, the temperature-sensitive replicon control element is selected from the temperature-sensitive RK2 plasmid, the temperature-sensitive RK2 plasmid is obtained by mutation of the trfA protein sequence of the RK2 plasmid, and the temperature-sensitive replicon control element is composed of the oriV and trfA gene expression frames of the temperature-sensitive RK2 plasmid. Preferably, the trfA protein sequence of the RK2 plasmid is mutated to 235G, 163C, 171W, 173K, 203L, 213S, 230V, 247C, 254D, 313L, 316V, 332F or a deletion mutation of 374. Preferably, the nucleotide sequence of the temperature-sensitive replicon control element is shown in SEQ ID NO.1.

[0045] In a specific embodiment, the donor plasmid is obtained by combining pFast.Bac.Dual, pFastBac TM 1 or pFastBac TM The pUC ori in the HT A plasmid is replaced with a temperature-sensitive replicon control element, preferably the pFast.Bac.Dual plasmid.

[0046] In a specific embodiment, the helper plasmid is constructed by replacing the pUC ori in the pMON7124 plasmid with a temperature-sensitive replicon control element.

[0047] In a specific embodiment, the recombinant adeno-associated virus core expression element ITR-GOI with a heterologous functional gene fragment is constructed by ITR and a heterologous functional gene fragment; preferably, the heterologous functional gene fragment is selected from one of EGFP, RFP, and BFP.

[0048] In a specific embodiment, the structure of the Rep gene expression cassette, the Cap gene expression cassette and the recombinant adeno-associated virus core expression element ITR-GOI carrying a heterologous functional gene fragment is Cap-ITR(GOI)-Rep.

[0049] In a specific embodiment, the promoter of the Rep gene expression cassette is the PH promoter; the promoter of the Cap gene expression cassette is the P10 promoter.

[0050] In a specific embodiment, the Rep gene, Cap gene and ITR are selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVDJ, AAV-retro, AAV-PHP.eB, AAV-PHP.pB, AAV-CAP-B10; preferably, the Rep gene, Cap gene and ITR are selected from AAV2 or AAV9.

[0051] In a specific embodiment, the present invention provides a recombinant bacmid, which is prepared based on the above-mentioned Bac-to-Bac baculovirus expression system, and specifically comprises the following steps:

[0052] (1) Preparation of DH10 Bac competent bacteria

[0053] Based on the baculovirus expression system Bac-to-Bac, DH10 Bac bacteria (containing the baculovirus genome bacmid (containing the kanamycin resistance gene, Kan + ) and pMON7124 helper plasmid (containing tetracycline resistance gene, Tet + ), and obtain competent bacteria DH10-bacmid containing only bacmid plasmid by the method of plasmid extraction-retransformation-resistance screening. Then, the temperature-sensitive auxiliary plasmid is electrotransformed into DH10-bacmid competent bacteria to prepare DH10 Bac competent bacteria.

[0054] (2) Preparation of pure recombinant bacmid free of infectious plasmid

[0055] The temperature-sensitive donor plasmid was electroporated into the DH10 Bac competent bacteria in step (1) and cultured at 30°C for 12 hours to allow the donor plasmid to recombine with the bacmid plasmid. The recombinants were then picked and identified using blue-white screening and colony PCR. The positive recombinants were then cultured at 37°C containing only Kan + The cells were cultured under antibiotic medium for 16 hours, and then the recombinant bacmid was extracted using a Bac plasmid extraction kit. The extracted recombinant bacmid was identified using pulsed field gel electrophoresis.

[0056] In a specific embodiment, the present invention provides a method for preparing a recombinant adeno-associated virus, comprising the following steps:

[0057] (1) Transfection of recombinant bacmid into Sf9 insect cells

[0058] Recombinant bacmid was transfected into Sf9 insect cells through two cell transfection protocols, adherent transfection and suspension transfection, as follows:

[0059] The extracted recombinant bacmid was ReagentMirus transfection reagent (ratio of 1 μg plasmid / 5 μL transfection reagent) was added to the adherent cultured ExpiSf9 insect cells (cell number 2×10 6 Each well was cultured for 24 hours and the medium was replaced with fresh medium. The fluorescence expression was observed every day. The supernatant was collected after 72 hours, which was the P1 generation BEV. The titer of the P1 generation BEV under adherent culture conditions was determined by QPCR.

[0060] The extracted recombinant bacmid was mixed with PEI Max ((Polyethylenimine Linear, MW 40000)) transfection reagent (ratio of 1 μg plasmid / 6 μL transfection reagent) and added to the suspension cultured ExpiSf9 insect cells (cell density of 2×10 6 The supernatant was collected after 72 hours, which was the P1 generation BEV. The titer of the P1 generation BEV under suspension culture conditions was determined by QPCR.

[0061] (2) Preparation of rAAV

[0062] ExpiSf9 cells (cell density 2×10 6 The cells were centrifuged and collected 72 hours later. The cells were lysed by repeated freezing and thawing with liquid nitrogen, and rAAV was purified by iodixanol density gradient centrifugation. The rAAV virus titer was determined by QPCR.

[0063] Example 1: Preparation of pure recombinant bacmids containing no invalid plasmids and carrying the elements required for AAV packaging

[0064] This embodiment provides a method for preparing a recombinant bacmid, comprising the following steps:

[0065] (1) Preparation of temperature-sensitive donor plasmid

[0066] A donor plasmid containing the RK2 temperature-sensitive replicon (RK2-ts, whose nucleotide sequence is shown in SEQ ID NO.1), the rAAV core expression element ITR-GOI and the AAV Rep-Cap gene expression cassette was constructed.

[0067] The pFast.Bac.Dual (pFD) donor plasmid in the baculovirus expression system Bac-to-Bac was used. Based on the Rep gene of type 2 AAV and the Cap gene of type 2 AAV, they were placed under the regulation of the Polh and P10 promoters, respectively. The ITR core expression element, ITR selected the ITR nucleic acid sequence of type 2 AAV, and the core expression element of ITR used the green fluorescent protein (GFP) expression frame. The expression of GFP was controlled by the CMV promoter to facilitate the detection of rAAV activity. The Rep gene expression frame, the Cap gene expression frame, and the ITR-GOI were connected to the pFBD backbone plasmid by homologous recombination to construct the pFD-Cap2-(ITR-EGFP)-Rep2 donor plasmid. In order to make the donor plasmid sensitive to temperature, the nucleotide sequences of the oriV and trfA genes in the temperature-sensitive RK2 plasmid were selected as replicons (the nucleotide sequences are shown in SEQ ID NO.1), the oriV and trfA sequences were amplified by PCR, and the pFD was constructed by gibson assembly. RK2-ts -Cap2-ITR(GOI)-Rep2 temperature-sensitive donor plasmid, see Figure 1 and Figure 3 .

[0068] (2) Preparation of temperature-sensitive helper plasmid

[0069] A helper plasmid containing a temperature-sensitive replicon (RK2-ts, the nucleotide sequence of which is shown in SEQ ID NO.1) and a Tn7 transposase gene expression cassette was constructed.

[0070] The pMON7124 auxiliary plasmid in the baculovirus expression system Bac-to-Bac was used. The nucleotide sequences of oriV and trfA genes in the temperature-sensitive RK2 plasmid were selected as replicons (the nucleotide sequence of which is shown in SEQ ID NO.1), oriV and trfA sequences were amplified by PCR, and pMON7124 was constructed by gibson assembly. RK2-ts Temperature-sensitive helper plasmids, see Figure 1 and Figure 3 .

[0071] (3) Preparation of DH10 Bac RK2-ts Competent bacteria

[0072] Based on the baculovirus expression system Bac-to-Bac, DH10 Bac bacteria (containing the baculovirus genome bacmid (containing the kanamycin resistance gene, Kan + ) and pMON7124 helper plasmid (containing tetracycline resistance gene, Tet +), and through the method of plasmid extraction-retransformation-resistance screening, the competent bacteria DH10-bacmid containing only the bacmid plasmid was obtained. RK2-ts The temperature-sensitive auxiliary plasmid was electroporated into DH10-bacmid competent bacteria to prepare DH10Bac RK2-ts Electroporation competent bacteria. RK2-ts -Cap2-ITR(GOI)-Rep2 temperature-sensitive donor plasmid and DH10Bac RK2-ts The competent bacteria constitute the baculovirus expression system Bac-to-Bac of the present invention, denoted as OneBac RK2-ts system.

[0073] (4) Preparation of recombinant bacmid

[0074] Construction of recombinant bacmids, strategy see Figure 2 and Figure 3 . Insert the temperature-sensitive donor plasmid pFD RK2-ts -Cap2-ITR(GOI)-Rep2 electroporated into DH10 Bac RK2-ts Competent bacteria were cultured at 30°C for 12 hours to allow the donor plasmid to recombine with the bacmid plasmid, and then the recombinants were picked and identified by blue-white screening and colony PCR. The positive recombinants were then cultured at 37°C containing only Kan + The cells were cultured for 16 hours under antibiotic medium conditions to allow the auxiliary plasmids and incompletely utilized donor plasmids in the recombinant bacteria to be actively lost in the bacteria, and then the pure recombinant bacmid carrying the rAAV core expression element ITR-GOI and the Rep-Cap gene expression frame of type 2 AAV without invalid plasmids was extracted using the Bac plasmid extraction kit. The extracted recombinant bacmid was identified by pulsed field gel electrophoresis.

[0075] Based on the above method, a pure recombinant bacmid carrying the rAAV core expression element ITR-GOI and the Rep-Cap gene expression frame of type 9 AAV was prepared without containing invalid plasmids.

[0076] At the same time, based on the above method, the baculovirus expression system Bac-to-Bac constructed without temperature-sensitive replicons is recorded as OneBac system. Using the OneBac system, based on the above method, recombinant bacmids carrying rAAV core expression element ITR-GOI and Rep-Cap gene expression cassettes of type 2 AAV, and recombinant bacmids carrying rAAV core expression element ITR-GOI and Rep-Cap gene expression cassettes of type 9 AAV are prepared.

[0077] Pulsed-field gel electrophoresis was used to identify the extracted recombinant bacmids. The results showed that the recombinant bacmids were obtained by OneBac RK2-ts The plasmid extracted by the system contains only recombinant bacmids, and contains no or very little interfering plasmids such as auxiliary plasmids and donor plasmids. Figure 4 .

[0078] The sequence of the RK2 replicon is as follows:

[0079] ggccgccggcgttgtggatacctcgcggaaaacttggccctcactgacagatgaggggcggacgttgacacttgaggggccgactca

[0080] cccggcgcggcgttgacagatgaggggcaggctcgatttcggccggcgacgtggagctggccagcctcgcaaatcggcgaaaacgcctgat

[0081] tttacgcgagtttcccacagatgatgtggacaagcctggggataagtgccctgcggtattgacacttgaggggcgcgactactgacagatgagg

[0082] ggcgcgatccttgacacttgaggggcagagtgctgacagatgaggggcgcacctattgacatttgaggggctgtccacaggcagaaaatcca

[0083] gcatttgcaagggtttccgcccgtttttcggccaccgctaacctgtcttttaacctgcttttaaaccaatatttataaaccttgtttttaaccagggctgc

[0084] gccctgtgcgcgtgaccgcgcacgccgaaggggggtgcccccccttctcgaaccctcccggcccgctaacgcgggcctcccatccccccag

[0085] gggctgcgcccctcggccgcgaacggcctcaccccaaaaatggcagcgctggcagtccttgccattgccgggatcggggcagtaacgggat

[0086] gggcgatcagcccgagcgcgacgcccggaagcattgacgtgccgcaggtgctggcatcgacattcagcgaccaggtgccgggcagtgagg

[0087] gcggcggcctgggtggcggcctgcccttcacttcggccgtcggggcattcacggacttcatggcggggccggcaatttttaccttgggcattctt

[0088] ggcatagtggtcgcgggtgccgtgctcgtgttcgggggtgaattaattccccggatccgtcagcttcacgctgccgcaagcactcagggcgca

[0089] agggctgctaaaggaagcggaacacgtagaaagccagtccgcagaaacggtgctgaccccggatgaatgtcagctactgggctatctggaca

[0090] agggaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgatagctagactgggcggttttatggacagcaagcga

[0091] accggaattgccagctggggcgccctctggtaaggttgggaagccctgcaaagtaaactggatggctttcttgccgccaaggatctgatggcgc

[0092] aggggatcaagatcgacggatccggggaattccggggcaatcccgcaaggagggtgaatgaatcggacgtttgaccggaaggcatacaggc

[0093] aagaactgatcgacgcggggttttccgccgaggatgccgaaaccatcgcaagccgcaccgtcatgcgtgcgccccgcgaaaccttccagtcc

[0094] gtcggctcgatggtccagcaagctacggccaagatcgagcgcgacagcgtgcaactggctccccctgccctgcccgcgccatcggccgccg

[0095] tggagcgttcgcgtcgtctcgaacaggaggcggcaggtttggcgaagtcgatgaccatcgacacgcgaggaactatgacgaccaagaagcg

[0096] aaaaaccgccggcgaggacctggcaaaacaggtcagcgaggccaagcaggccgcgttgctgaaacacacgaagcagcagatcaaggaaa

[0097] tgcagctttccttgttcgatattgcgccgtggccggacacgatgcgagcgatgccaaacgacacggcccgctctgccctgttcaccacgcgcaa

[0098] caagaaaatcccgcgcgaggcgctgcaaaacaaggtcattttccacgtcaacaaggacgtgaagatcacctacaccggcgtcgagctgcggg

[0099] ccgacgatgacgaactggtgtggcagcaggtgttggagtacgcgaagcgcacccctatcggcgagccgatcaccttcacgttctacgagcttt

[0100] gccaggacctgggctggtcgatcaatggtcggtattacacgaaggccgaggaatgcctgtcgcgcctacaggcgacggcgatgggcttcacg

[0101] tccgaccgcgttgggcacctggaatcggtgtcgctgctgcaccgcttccgcgtcctggaccgtggcaagaaaacgtcccgttgccaggtcctg

[0102] atcgacgaggaaatcgtcgtgctgtttgctggcgaccactacacgaaattcatatgggagaagtaccgcaagctgtcgccgacggcccgacgg

[0103] atgttcgactatttcagctcgcaccgggagccgtacccgctcaagctggaaaccttccgcctcatgtgcggatcggattccacccgcgtgaaga

[0104] agtggcgcgagcaggtcggcgaagcctgcgaagagttgcgaggcagcggcctggtggaacacgcctgggtcaatgacctggtgcattgcaa

[0105] acgctag (SEQ ID NO.1)

[0106] Example 2: Using OneBac RK2-ts System for efficient production of rAAV2-CMV-EGFP virus and rAAV9-CMV-EGFP

[0107] Virus

[0108] Leveraging OneBac RK2-ts The system prepares rAAV virus, comprising the following steps:

[0109] (1) Transfection of recombinant bacmid into Sf9 insect cells

[0110] Recombinant bacmid was transfected into Sf9 insect cells through two cell transfection protocols, adherent transfection and suspension transfection, as follows:

[0111] The extracted recombinant bacmid was ReagentMirus transfection reagent (ratio of 1 μg plasmid / 5 μL transfection reagent) was added to the adherent cultured ExpiSf9 insect cells (cell number 2×10 6 Each well was cultured for 24 hours and the culture medium was replaced with fresh medium. The fluorescence expression was observed every day. The supernatant was collected after 72 hours and centrifuged at 500 g for 5 min to obtain the P1 generation BEV. The titer of the P1 generation BEV under adherent culture conditions was determined by QPCR.

[0112] The extracted recombinant bacmid was mixed with PEI Max (Polyethylenimine Linear, MW 40000) transfection reagent (ratio: 1 μg plasmid / 6 μL transfection reagent) and added to the suspension cultured ExpiSf9 insect cells (cell density: 2×10 6 The supernatant was collected after 72 hours and centrifuged at 2500 rpm for 10 min to obtain the P1 generation BEV. The titer of the P1 generation BEV under suspension culture conditions was determined by QPCR.

[0113] See Figure 5 and Figure 6 The results showed that compared with the OneBac-rAAV system, the OneBac RK2-ts The recombinant bacmid carrying the elements required for AAV2 packaging extracted by the -rAAV system has higher transfection efficiency and yield of progeny BEV.

[0114] (2) Preparation of rAAV

[0115] ExpiSf9 insect cells (cell density 2×10 6 / mL, 50mL volume), centrifuged and collected cells after 72 hours, and centrifuged at 2500rpm for 10min. The cells were lysed by repeated freezing and thawing of liquid nitrogen, and rAAV2-CMV-EGFP virus and rAAV9-CMV-EGFP virus were purified by iodixanol density gradient centrifugation. The titers of rAAV2-CMV-EGFP virus and rAAV9-CMV-EGFP virus were determined by QPCR.

[0116] See Figure 7 The results showed that when ExpiSf9 cells were infected at the same MOI, OneBac RK2-ts -rAAV system has similar rAAV yields as OneBac-rAAV system. RK2-ts The system can obtain more progeny BEVs than the OneBac system. Based on this, it can be inferred that the OneBac RK2-ts The system has higher rAAV production efficiency.

[0117] Based on the above data, the baculovirus expression system Bac-to-Bac based on temperature-sensitive replicon RK2-ts , which can effectively obtain pure recombinant bacmids that do not contain invalid plasmids such as donor plasmids and helper plasmids, and produce rAAV more efficiently.

[0118] The specific embodiments described above are only preferred implementations of the present invention. It should be pointed out that a person skilled in the art can make several improvements or substitutions without departing from the principles of the present invention. These improvements or substitutions should also be regarded as within the scope of protection of the present invention.

Claims

1. A Bac-to-Bac baculovirus expression system, characterized in that: The invention comprises a donor plasmid and a DH10 Bac competent bacterium; the donor plasmid comprises a temperature-sensitive replicon control element, a Rep gene expression frame, a Cap gene expression frame and a recombinant adeno-associated virus core expression element ITR-GOI with a heterologous functional gene fragment; the DH10 Bac competent bacterium comprises a baculovirus genome plasmid bacmid and an auxiliary plasmid, and the auxiliary plasmid comprises a temperature-sensitive replicon control element and a Tn7 transposase expression frame.

2. The Bac-to-Bac baculovirus expression system according to claim 1, characterized in that The temperature-sensitive replicon control element is selected from a temperature-sensitive RK2 plasmid, the temperature-sensitive RK2 plasmid is obtained by mutation of the trfA protein sequence of the RK2 plasmid, and the temperature-sensitive replicon control element is composed of oriV and trfA gene expression frames of the temperature-sensitive RK2 plasmid; Preferably, the trfA protein sequence mutation of the RK2 plasmid is 235G, 163C, 171W, 173K, 203L, 213S, 230V, 247C, 254D, 313L, 316V, 332F or 374 deletion mutation; Preferably, the nucleotide sequence of the temperature-sensitive replicon control element is shown in SEQ ID NO.

1.

3. The Bac-to-Bac baculovirus expression system according to claim 1, characterized in that The donor plasmid was prepared by combining pFast.Bac.Dual, pFastBac TM 1 or pFastBac TM The pUC ori in the HT A plasmid was replaced with a temperature-sensitive replicon control element to construct; Preferably, the donor plasmid is constructed by replacing the pUC ori in the pFast.Bac.Dual plasmid with a temperature-sensitive replicon control element; The helper plasmid was constructed by replacing the pUC ori in the pMON7124 plasmid with a temperature-sensitive replicon control element.

4. The Bac-to-Bac baculovirus expression system according to claim 1, characterized in that The recombinant adeno-associated virus core expression element ITR-GOI with heterologous functional gene fragments is constructed by ITR and heterologous functional gene fragments; Preferably, the heterologous functional gene fragment is selected from one of EGFP, RFP and BFP.

5. The Bac-to-Bac baculovirus expression system according to claim 1, characterized in that The structure of the Rep gene expression frame, the Cap gene expression frame and the recombinant adeno-associated virus core expression element ITR-GOI with a heterologous functional gene fragment is Cap-ITR (GOI)-Rep.

6. The Bac-to-Bac baculovirus expression system according to claim 1, characterized in that The promoter of the Rep gene expression cassette is the PH promoter; the promoter of the Cap gene expression cassette is the P10 promoter.

7. The Bac-to-Bac baculovirus expression system according to claim 1, characterized in that The Rep gene, Cap gene and ITR are selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVDJ, AAV-retro, AAV-PHP.eB, AAV-PHP.pB, and AAV-CAP-B10.

8. A recombinant bacmid, characterized in that: The Bac-to-Bac baculovirus expression system according to claim 1 is prepared by: transferring the donor plasmid into DH10 Bac competent bacteria, culturing at 30°C to allow the donor plasmid and the bacmid plasmid to recombine, then picking and identifying the recombinants by blue-white screening and colony PCR, and then incubating the positive recombinants at 37°C containing only Kan + The culture is carried out under the conditions of antibiotic medium, so that the auxiliary plasmid and the donor plasmid that are not fully utilized in the recombinant bacteria are actively lost in the bacteria, and the recombinant bacmid is extracted.

9. Use of the Bac-to-Bac baculovirus expression system according to claim 1 or the recombinant bacmid according to claim 8 in preparing a recombinant adeno-associated virus.

10. A method for preparing a recombinant adeno-associated virus, characterized in that: Includes steps: (1) transfecting insect cells with the recombinant bacmid described in claim 8 to obtain progeny BEV; (2) The progeny BEV is used to infect insect cells and rAAV is purified; Preferably, the insect cells in step (1) and step (2) are Sf9, ExpiSf9 or Hi-five; Preferably, the insect cells in step (1) and step (2) are selected from ExpiSf9 cells; Preferably, the recombinant bacmid transfection of insect cells in step (1) is carried out by adherent transfection or suspension transfection.

Images