Use of arylsulfatase K in the preparation of a medicament for preventing, delaying or treating chronic obstructive pulmonary disease

Abstract

The present invention belongs to the field of biomedical technologies and discloses the use of arylsulfatase K in the preparation of drugs for preventing, delaying or treating chronic obstructive pulmonary disease. The present invention has for the first time discovered the role of ARSK (arylsulfatase K) in inhibiting mitophagy and delaying the senescence of airway epithelial cells, and further determined the key role of ARSK in the occurrence and development of COPD, which can provide a new target for the prevention and treatment of COPD. The present invention has determined that ARSK can slow down the process of lung senescence by alleviating the process of mitophagy, inhibiting the senescence of airway epithelial cells, thereby providing a new treatment strategy for COPD.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technologies, and particularly relates to the application of arylsulfatase K in the preparation of drugs for preventing, delaying or treating chronic obstructive pulmonary disease. Background Art

[0002] Chronic obstructive pulmonary disease (COPD) is a chronic and progressive lung disease, which is a common respiratory disease mainly characterized by airway (bronchitis, bronchiolitis) and / or alveolar abnormalities (emphysema). This disease can lead to persistent airflow limitation and corresponding respiratory symptoms (dyspnea, cough, expectoration). The occurrence of COPD is usually related to exposure to harmful particles or gases, and cigarette smoke exposure is the main factor among them. In addition, many host factors such as genetic susceptibility, abnormal inflammatory responses, and abnormal lung development are involved in the pathogenesis.

[0003] In recent years, COPD has been considered as a disease of accelerated lung aging. Cellular senescence, especially airway epithelial cell senescence, is a driving mechanism for the pathogenesis of COPD. Cellular senescence is an irreversible state of cell cycle arrest, usually caused by factors such as telomere attrition, DNA damage, and oxidative stress. Senescent cells secrete a series of inflammatory mediators, called senescence-associated secretory phenotype (SASP), and these mediators can further promote senescence through autocrine and paracrine ways, leading to the occurrence and development of COPD. As the first line of defense for lung tissue to respond to external stimuli, airway epithelium plays a key role in the pathogenesis of COPD. More and more evidence indicates that the stimulation of cigarette smoke causes airway epithelial cells to show severe accelerated senescence, which in turn participates in the destruction of lung tissue structure and the occurrence of airway inflammation in COPD.

[0004] Currently, the clinical treatment options for COPD are still very limited. The treatment of COPD includes smoking cessation, inhalation of bronchodilators and / or glucocorticoids, and supportive treatment (such as oxygen therapy, pulmonary rehabilitation therapy). The main purpose of the treatment is to relieve symptoms, reduce the risk and severity of acute exacerbation, but it cannot cure the disease fundamentally. Therefore, it is urgent to deeply study the pathogenesis of airway epithelial cell senescence in COPD, find intervention targets for lung aging, and fully combine the latest progress in molecular biology to provide a theoretical basis for the development of new and effective therapeutic drugs.

[0005] Aryl sulfatase K (ARSK) is a member of the aryl sulfatase family and can hydrolyze the sulfate group on sulfated substrates, thereby promoting sulfate metabolism. Deficiency or mutation of members of the aryl sulfatase family is associated with the occurrence of some age-related diseases such as Alzheimer's disease and Parkinson's disease. Previous studies have reported that sulfate metabolites may play a role in the senescence of human colonic epithelial cells. In addition, it has been observed that the expression of the family member aryl sulfatase A (ARSA) is altered in senescent fibroblasts and promotes the production of the senescence-associated secretory phenotype. However, the expression and function of ARSK in chronic obstructive pulmonary disease (COPD) have not been reported. Summary of the Invention

[0006] Aiming at the problems existing in the prior art, the purpose of the present invention is to provide the application of aryl sulfatase K in the preparation of drugs for preventing, delaying or treating chronic obstructive pulmonary disease, so as to provide a new intervention target for developing new and effective therapeutic drugs for chronic obstructive pulmonary disease.

[0007] In order to achieve the above purpose, the present application adopts the following technical solutions:

[0008] In the first aspect, the present invention provides a biomarker for diagnosing or assisting in diagnosing chronic obstructive pulmonary disease in a subject, and the biomarker is aryl sulfatase K.

[0009] In the above technical solution, the chronic obstructive pulmonary disease is chronic obstructive pulmonary disease induced by cigarette smoke or cigarette smoke extract.

[0010] In the second aspect, the present invention provides the application of aryl sulfatase K in the preparation of products for diagnosing chronic obstructive pulmonary disease, and the products include foods, health products or drugs.

[0011] In the third aspect, the present invention provides the application of aryl sulfatase K in the preparation of drugs for preventing, delaying or treating chronic obstructive pulmonary disease.

[0012] In the above technical solution, a reagent that enhances or promotes the expression of aryl sulfatase K can inhibit the senescence of airway epithelial cells, thereby preventing, delaying or treating chronic obstructive pulmonary disease.

[0013] In the fourth aspect, the present invention provides the application of aryl sulfatase K in the preparation of products for inhibiting mitophagy, and the products include foods, health products or drugs.

[0014] In the above technical solution, a reagent that enhances or promotes the expression of aryl sulfatase K can reduce the expression of mitophagy proteins PINK1, Parkin, LC3, and p-DRP1, thereby inhibiting mitophagy.

[0015] Fifth aspect, the present invention provides the use of arylsulfatase K in the preparation of a product for delaying the senescence of airway epithelial cells, and the product includes food, health products or drugs.

[0016] In the above technical solutions, the reagent that enhances or promotes the expression of arylsulfatase K delays the senescence of airway epithelial cells by increasing the expression of arylsulfatase K, reducing the expression of cell senescence-related proteins p21 and p53, and inhibiting mitophagy.

[0017] Sixth aspect, the present invention provides a kit for diagnosing chronic obstructive pulmonary disease, including a reagent for detecting arylsulfatase K.

[0018] The beneficial effects of the present invention are as follows: The present invention first discovers the role of ARSK (arylsulfatase K) in inhibiting mitophagy and thus delaying the senescence of airway epithelial cells, further determines the key role of ARSK in the occurrence and development of COPD, and can provide a new target for the prevention and treatment of COPD. The present invention determines that ARSK can inhibit the senescence of airway epithelial cells by alleviating the process of mitophagy, thereby slowing down the process of lung senescence, and thus provides a new treatment strategy for COPD.

[0019] The present invention determines that the expression of ARSK in the lung tissues of COPD patients and COPD model mice is significantly reduced by analyzing the content of ARSK in different populations, different mice and different airway epithelial cells; through experimental analysis of overexpressing ARSK in cells and mice, it is determined that overexpression of ARSK can reduce the expression of mitophagy proteins PINK1, Parkin, LC3, p-DRP1, inhibit mitophagy, thereby inhibiting the levels of ROS in cells and mitochondria, alleviating the decline of mitochondrial membrane potential and ATP, and further reducing the expression of cell senescence-related proteins p21 and p53, and further slowing down the senescence of airway epithelial cells; the present invention overexpresses ARSK in the lung tissues of mice by airway injection of ARSK-AAV, alleviates the senescence phenotype of COPD airway epithelial cells, successfully improves the pathophysiological state of COPD, and further determines the key role of ARSK in the occurrence and development of COPD. Description of the Drawings

[0020] Figure 1 It is the basic expression map of ARSK at the human, animal and cell levels; wherein: Figure 1 a is the RNA level expression of ARSK in the lung tissues of non-smoking people (n = 18), healthy smoking people (n = 18) and COPD people (n = 20); Figure 1 b is the FISH staining of human lung tissue sections to explore the expression of ARSK in airway epithelium; Figure 1c represents the ARSK RNA levels in the lung tissues of control mice and COPD model mice; Figure 1 d is the FISH staining of mouse lung tissue sections to explore the expression of ARSK in mouse airway epithelium; Figure 1 e, Figure 1 f shows the RNA expression levels of ARSK in human bronchial epithelial cells (HBE) after being stimulated with cigarette smoke extract (CSE) at different concentrations and for different times; where, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001;

[0021] Figure 2 is the detection graph of cell senescence in HBE cells after transfection with ARSK overexpression plasmid and stimulation with CSE for 24 h; where: Figure 2 a is the verification graph of successful overexpression of ARSK protein level; Figure 2 b is the expression graph of HBE cells for senescence marker proteins P21 and P53, Figure 2 c, Figure 2 d is Figure 2 the statistical graph of b; Figure 2 e, Figure 2 f is the expression of HBE cells for senescence-associated secretory phenotype factors IL-6, IL-8 and IL-1β at the RNA and protein levels; Figure 2 g is the staining graph of senescent cells; where, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001;

[0022] Figure 3 is the detection graph of mitophagy in HBE cells after transfection with ARSK overexpression plasmid and stimulation with CSE for 24 h; where: Figure 3 a, Figure 3 b is the expression and statistical graph of mitophagy-related proteins in HBE cells; where, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001;

[0023] Figure 4 is the detection graph of mitophagy and cell senescence in HBE cells after transfection with ARSK small interference and addition of mitophagy inhibitor liensinine; where: Figure 4 a is the CCK8 graph of cells after adding different concentrations of mitophagy inhibitor, Figure 4 b, Figure 4 c is the detection and statistical graph of mitophagy and cell senescence in HBE cells after adding mitophagy inhibitor; Figure 4 d is the staining graph of senescent cells; Figure 4e represents the expression of senescence-associated secretory phenotype factors IL-6, IL-8, and IL-1β at the protein level in HBE cells; where, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001;

[0024] Figure 5 was for the detection of lung function and lung senescence in mice with overexpression of ARSK in the lungs after exposure to cigarette smoke (CS) for modeling; where: Figure 5 a is a statistical chart of the lung function results of mice; Figure 5 b is a HE staining image of mouse lung tissue sections and a statistical chart of airway inflammation scores around the airways; Figure 5 c represents the expression of senescence-associated secretory phenotype factors IL-6, KC, and IL-1β at the RNA level in mouse lung tissue; Figure 5 d is a statistical chart of the concentrations of IL-6, KC, and IL-1β proteins contained in the BALF supernatant; Figure 5 e is an image of the results of detecting airway epithelial senescence by β-galactosidase staining of frozen mouse lung sections; Figure 5 f represents the expression of senescence marker proteins p21 and p53 in mouse lung tissue and the corresponding statistical chart; where, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. Detailed implementation manners

[0025] To better illustrate the purpose, technical solution, and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. The present invention can be implemented in many different forms and should not be construed as limited to the embodiments set forth herein. On the contrary, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the concept of the present invention to those skilled in the art. The present invention will be limited only by the claims.

[0026] Example 1: Determine the expression differences of ARSK in COPD patients, lung tissues of cigarette-smoked mice, and airway epithelial cells stimulated by cigarette smoke

[0027] 1. Human experiment: Recruit COPD patients and healthy volunteers. According to lung function and smoking history, the enrolled samples are divided into 3 groups: 18 non-smoking healthy control group (NS group), 18 smoking non-COPD group (HS group), and 20 smoking COPD group (COPD group). Collect the lung tissues of the subjects and detect the expression of ARSK.

[0028] 1.1. Extract lung tissue RNA and detect the expression of ARSK by PCR method.

[0029] Take an appropriate amount of tissue and place it in a 2 ml EP tube. Add 500 μl of Trizol to submerge the tissue and grind the tissue (20 - 30 s) with a grinder (3rd gear) until it is pulverized. Transfer it to a 1.5 ml RNase-free EP tube and add an additional 500 μl of Trizol. Place it on ice for 5 minutes for lysis, then add 200 μl of chloroform, shake vigorously (milky red), and let it stand on ice for 10 minutes. Centrifuge in a pre-cooled centrifuge (4°C, 12,000 rpm, 15 minutes). After centrifugation, carefully transfer the upper aqueous phase (about 1 / 2 the volume of Trizol) to a new EP tube, add an equal volume of isopropanol, shake, and let it stand at room temperature for 5 - 10 minutes. Then centrifuge at 12,000g at 4°C, add 1 ml of 75% ethanol (prepared with DEPC-treated water) to wash the precipitate. Add at least 1 ml of ethanol for every 1 ml of Trizol used, centrifuge at 10,000 rpm at 4°C for 10 minutes, discard the supernatant, let it air-dry at room temperature, add an appropriate amount of DEPC water (30 - 100 μl of water according to experimental needs), pipette a few times with a pipette tip to fully dissolve the RNA. Subsequently, use the cDNA RT PCR kit from Takara to perform reverse transcription. Use SYBR Premix Ex Taq from Takara for quantitative RT-PCR. The relative expression level of the target gene is normalized to the β-Actin gene.

[0030] As Figure 1 shown in

[0031] 1.2. Perform FISH staining on lung tissue sections to detect the expression of ARSK.

[0032] Fluorescence in situ hybridization (FISH) was performed at Wuhan Pinuofei Biotechnology Co., Ltd. (Wuhan, China) to evaluate the expression of the ARSK gene in fixed human and mouse lung sections. A digoxigenin-labeled locked nucleic acid (LNA) probe targeting ARSK with the sequence UUGUCCACGCUUCCACACGAUUA was used. After a series of horseradish peroxidase (HRP)-mediated tyramide signal amplification (TSA) reactions, the probe / target complex was visualized.

[0033] As Figure 1 shown in

[0034] 2. Animal experiments: A mouse model of COPD was constructed using the method of passive smoking. After the model was successfully established, the lung function of the mice was detected. RNA was extracted from the lung tissue of the mice, and the expression of ARSK was detected by PCR. FISH staining was performed on lung tissue sections to detect the expression of ARSK.

[0035] 2.1 Construction of a mouse model of COPD

[0036] All mice (8 - 12 weeks old, male) were housed in SPF - level animal isolation cages in Tongji Hospital and raised according to a 12 - hour light - dark cycle. They were exposed to indoor air or a smoke environment for about 3 hours every day (burning 12 cigarettes each time, exposing for 45 minutes, 4 times a day), 5 days a week for 3 months, using Hongjinlong cigarettes.

[0037] 2.2 Extract RNA from mouse lung tissue and detect the expression of ARSK by PCR.

[0038] Extract RNA from mouse lung tissue as described above and detect the expression of ARSK by PCR.

[0039] As Figure 1 shown in c, the RNA content of ARSK in the lung tissue of COPD model mice was significantly higher than that of control mice, indicating that the expression of ARSK was significantly decreased after being stimulated by cigarette smoke.

[0040] 2.3 Perform FISH staining on lung tissue sections to detect the expression of ARSK.

[0041] Perform FISH experiments as described above to detect the expression of ARSK in mouse lung sections.

[0042] As Figure 1 shown in d, the red color in the section is the in - situ ARSK, and the blue color is the nuclear DAPI. It can be seen that the red fluorescence intensity in the lung sections of COPD model mice is significantly higher than that of control mice, indicating that the expression of ARSK is significantly decreased after being stimulated by cigarette smoke.

[0043] 3. Cell experiments: Using human airway epithelial cells HBE4 - E6 / E7 (ATCC, CRL - 2078) as the research object, different concentrations of cigarette smoke extract (CSE) were used to stimulate for different time periods, and no CSE was added as the control group for in vitro experimental research. Subsequently, cell RNA was extracted and the expression of ARSK was detected by PCR.

[0044] 3.1 Cell culture

[0045] Human bronchial epithelial cells HBE4-E6 / E7 (ATCC, CRL-2078) were cultured in DMEM medium containing 10% fetal bovine serum. The cells were maintained in a humidified incubator at 37°C with 5% CO2, seeded in 12-well plates and exposed to different concentrations of CSE (cigarette smoke extract) for different times.

[0046] 3.2 Extract cellular RNA and detect the expression of ARSK by PCR

[0047] Add 1 ml of Trizol to each well, pipette repeatedly and transfer to a 1.5 ml RNase-free EP tube. Add 200 μl of chloroform, shake vigorously (milky red), and let stand on ice for 10 minutes. Centrifuge in a pre-cooled centrifuge (4°C, 12,000 rpm, 15 minutes). After centrifugation, carefully transfer the upper aqueous phase (about 1 / 2 the volume of Trizol) to a new EP tube, add an equal volume of isopropanol, shake and let stand at room temperature for 5 - 10 minutes, then centrifuge at 12,000 g at 4°C. Add 1 ml of 75% ethanol (prepared with DEPC-treated water) to wash the precipitate. Add at least 1 ml of ethanol for every 1 ml of Trizol used, centrifuge at 10,000 rpm at 4°C for 10 minutes, discard the supernatant, let stand at room temperature to dry, and add an appropriate amount of DEPC water (30 - 100 μl of water according to experimental needs), pipette several times with a pipette tip to fully dissolve the RNA. Subsequently, reverse transcription was performed using the cDNA RT PCR kit from Takara. Quantitative RT-PCR was performed using SYBR Premix Ex Taq from Takara. The relative expression level of the target gene was normalized to the β-Actin gene.

[0048] As Figure 1 shown in e, f, with the increase in the concentration and time of CSE stimulation, the RNA level of ARSK gradually decreased.

[0049] In summary, the expression of ARSK in the lung tissues of COPD patients was significantly lower than that in healthy individuals, and the expression of ARSK in the lung tissues of COPD model mice was significantly lower than that in control mice. Similarly, the expression of ARSK in CSE-stimulated HBE cells was significantly decreased.

[0050] Example 2: Observe the effect of overexpressing ARSK on the senescence of airway epithelial cells

[0051] Transfect HBE cells with control or ARSK overexpression plasmids, verify the overexpression efficiency, and evaluate the cell senescence status by Western blotting, β-galactosidase staining, PCR, and ELISA after adding CSE stimulation for 24 hours. The specific steps are as follows:

[0052] 1. Construction of ARSK overexpression plasmid and cell transfection

[0053] The ARSK gene sequence was obtained from the NCBI gene bank. The pcDNA expression vector was selected, and the target sequence and the vector were cut by restriction endonucleases. Subsequently, they were ligated using DNA ligase. Finally, the ligated recombinant plasmid was transferred into competent cells DH5α for transformation to extract plasmid DNA. HBE cells were evenly seeded in a 12-well plate. When they grew to 80% density, a complex was formed using liposome transfection reagent Lipo3000 and plasmid DNA, and then added to the cell culture medium. Through the interaction between the liposome and the cell membrane, the plasmid DNA entered the cells. After 24 h, CSE was added and the cells were stimulated for another 24 h, and then cell proteins were extracted for overexpression verification. Thus, the cells were divided into four groups: control group, control + CSE group, overexpression group, and overexpression + CSE group.

[0054] As Figure 2 shown in a, cells in the overexpression group and the overexpression + CSE group carried the Flag tag of the ARSK plasmid, while no Flag tag expression was observed in the control group, indicating successful transfection of the ARSK overexpression plasmid.

[0055] 2. Western blotting

[0056] Total proteins in HBE cells were extracted using RIPA lysis buffer containing phosphatase inhibitors. The proteins were separated by 10% or 12% SDS-PAGE gels, then transferred to PVDF membranes and blocked in 5% milk for 1 - 2 hours. Subsequently, they were incubated with primary antibodies overnight at 4°C, rinsed three times with TBST, incubated with secondary antibodies for 1 h, and finally exposed using chemiluminescent solution.

[0057] As Figure 2 shown in b, c, and d, the expression of senescence proteins p21 and p53 in the control + CSE group was significantly increased compared with the control group, but the expression of p21 and p53 in the overexpression + CSE group was significantly decreased compared with the control + CSE group, indicating that overexpression of ARSK can significantly improve the expression of CSE-induced cell senescence proteins.

[0058] 3. PCR

[0059] The PCR experiment was performed as described above.

[0060] As Figure 2As shown in e, the RNA level expressions of IL-6, IL-8 and IL-1β in the control + CSE group were significantly increased compared with the control group, but the RNA level expressions of IL-6, IL-8 and IL-1β in the overexpression + CSE group were significantly decreased compared with the control + CSE group, indicating that overexpression of ARSK could significantly improve the CSE-induced senescence-associated secretory phenotype.

[0061] 4. ELISA

[0062] Specific IL-6, IL-8 and IL-1β antibodies were immobilized in the wells of an ELISA plate. This was done by diluting the antigen in the coating buffer and incubating overnight at 4°C. After coating, unbound sites were blocked using a blocking solution to reduce non-specific binding. Usually, it was incubated at room temperature for 1 - 2 hours. The plate was washed with the washing solution to remove the unbound blocking solution. The test samples and a series of standards with known concentrations were added to the ELISA plate. Usually, it was incubated at 37°C for 1 - 2 hours to allow the antigen in the sample to bind to the coated antibody. The plate was washed again with the washing solution, and specific primary antibody was added and incubated at 37°C for 1 - 2 hours. The plate was washed again with the washing solution, and secondary antibody conjugated with HRP was added and incubated at 37°C for 1 hour. Finally, it was washed again, and a substrate that could be catalyzed by HRP to produce a color change was added. After a certain time, a stop solution was added to stop the reaction and stabilize the color change. Finally, the results were read on an ELISA reader.

[0063] As Figure 2 As shown in f, the protein level expressions of IL-6, IL-8 and IL-1β in the control + CSE group were significantly increased compared with the control group, but the protein level expressions of IL-6, IL-8 and IL-1β in the overexpression + CSE group were significantly decreased compared with the control + CSE group, indicating that overexpression of ARSK could significantly improve the CSE-induced senescence-associated secretory phenotype.

[0064] 5. β-Galactosidase staining

[0065] After washing with PBS and fixing in β-galactosidase fixative for 15 minutes, we stained HBE cells overnight at 37°C using a SA-β-galactosidase staining kit (Solarbio, Beijing, China). Finally, the staining results were observed and photographed under an optical microscope.

[0066] As Figure 2 As shown in g, the number of senescent cells in the control + CSE group was significantly increased compared with the control group, and the number of senescent cells in the overexpression + CSE group was significantly decreased compared with the control + CSE group, indicating that overexpression of ARSK could significantly improve the increase in the number of CSE-induced senescent cells.

[0067] In summary, after overexpression of ARSK, the expressions of cell senescence-related proteins p21 and p53 caused by CSE stimulation can be reduced, the number of senescent cells can be reduced, and the senescence-associated secretory phenotype can be alleviated.

[0068] Example 3: Observe the effect of overexpressing ARSK on mitophagy in airway epithelial cells

[0069] Transfect control or ARSK overexpression plasmid into HBE cells, and detect mitophagy by Western blotting after adding CSE stimulation for 24 h.

[0070] 1. Construction of ARSK overexpression plasmid and cell transfection

[0071] The experimental procedure is shown in step 1 of Test Example 2. Thus, we divided the cells into four groups: control group, control + CSE group, overexpression group, and overexpression + CSE group.

[0072] 2. Western blotting

[0073] Conduct the experiment as described above

[0074] As Figure 3 As shown in a, b, the expressions of mitophagy proteins PINK1, Parkin, LC3, and p-DRP1 in the control + CSE group were significantly increased compared with the control group, but the expressions of mitophagy proteins PINK1, Parkin, LC3, and p-DRP1 in the overexpression + CSE group were significantly decreased compared with the control + CSE group.

[0075] In summary, after overexpression of ARSK, the expressions of mitophagy proteins PINK1, Parkin, LC3, and p-DRP1 caused by CSE stimulation can be reduced.

[0076] Example 4: Observe the recovery effect of adding a mitophagy inhibitor to HBE cells after knocking down ARSK on mitophagy and cell senescence

[0077] Transfect control or ARSK small interference into HBE cells, add a mitophagy inhibitor, and then perform CSE stimulation for 24 h, and detect mitophagy and cell senescence status by Western blotting.

[0078] 1. Transfect control or ARSK small interference into HBE cells

[0079] The ARSK small interfering RNA and the control small interfering RNA were purchased from Ribobio. The sequence of the ARSK small interfering RNA was GGACTATACTTCAGGACAT. HBE cells were seeded in 12-well plates, and 500 μl of medium, 60 nM small interfering RNA, and 1 μl of Lipo3000 were added to each well. The medium was changed 8 - 12 h later, and CSE and the mitochondrial autophagy inhibitor liensinine were added 12 h later and the cells were stimulated for 24 h. Thus, the cells were divided into 6 groups: control group, control + CSE group, ARSK knockdown group, ARSK knockdown + CSE group, ARSK knockdown + liensinine group, ARSK knockdown + liensinine + CSE group.

[0080] As Figure 4 shown in a, the RNA level expression of ARSK in HBE cells of the ARSK knockdown group was significantly decreased compared with that of the control group cells, thereby determining the knockdown efficiency of ARSK.

[0081] 2. CCK8 assay

[0082] An appropriate amount of cells was seeded into 96-well cell culture plates, and the cell density was usually 1×10^4 to 1×10^5 cells per well. After cell seeding, the cells were cultured in an environment of 37 °C and 5% CO2 for 24 hours to allow the cells to adhere to the wall and grow stably. Different concentrations of liensinine were added to the cell culture plates and the treatment time was 24 hours. Subsequently, 10 μL of CCK8 reagent was added to each well and gently shaken and mixed evenly. The cell culture plates were placed in an incubator at 37 °C for 1 - 4 hours. After sufficient reaction, the absorbance of each well was measured at a wavelength of 450 nm using a microplate reader.

[0083] As Figure 4 shown in b, when the concentration of liensinine was 40 μM, the cell state was good. Therefore, we selected 40 μM for subsequent treatment.

[0084] 3. Western blotting

[0085] The method was as described previously

[0086] As Figure 4As shown in c, the expression of mitochondrial autophagy proteins PINK1, Parkin, LC3, and p-DRP1 in the ARSK knockdown + CSE group was significantly increased compared with that in the control + CSE group. Meanwhile, the expression of senescence proteins p21 and p53 was increased, indicating that knocking down ARSK could exacerbate the increase in mitochondrial autophagy and senescence induced by CSE stimulation. The expression of mitochondrial autophagy proteins PINK1, Parkin, LC3, and p-DRP1 in the ARSK knockdown + liensinine + CSE group was significantly decreased compared with that in the ARSK knockdown + CSE group, indicating that mitochondrial autophagy was indeed inhibited. At this time, we found that the expression of senescence proteins p21 and p53 was also significantly decreased, suggesting that mitochondrial autophagy mediated the regulatory effect of ARSK on cell senescence.

[0087] 3. β-galactosidase staining

[0088] The method was the same as described above.

[0089] As Figure 4 shown in d, the positive rate of β-galactosidase staining in the ARSK knockdown + CSE group was significantly higher than that in the control + CSE group, indicating that knocking down ARSK exacerbated cell senescence. The number of senescent cells in the ARSK knockdown + liensinine + CSE group was significantly decreased compared with that in the ARSK knockdown + CSE group, indicating that inhibiting mitochondrial autophagy could alleviate the exacerbation of cell senescence by ARSK knockdown under CSE stimulation.

[0090] 4. ELISA

[0091] The method was the same as described above.

[0092] As Figure 4 shown in e, the contents of IL-6, IL-8, and IL-1β in the cell supernatant of the ARSK knockdown + CSE group were significantly higher than those in the control + CSE group, indicating that knocking down ARSK exacerbated the senescence-associated secretory phenotype. The contents of the above factors in the ARSK knockdown + liensinine + CSE group were significantly decreased compared with those in the ARSK knockdown + CSE group. It indicates that inhibiting mitochondrial autophagy can alleviate the exacerbation of the senescence-associated secretory phenotype by ARSK knockdown under CSE stimulation.

[0093] In summary, as Figure 4 shown, adding a mitochondrial autophagy inhibitor to HBE cells with knocked-down ARSK can partially reverse the increase in mitochondrial autophagy and the cell senescence state caused by CSE stimulation, indicating that mitochondrial autophagy mediates the regulatory effect of ARSK on HBE cell senescence.

[0094] Example 5: Observation on the prevention and treatment effect of COPD lung senescence by establishing a smoking model in mice with overexpressed ARSK in the lungs

[0095] Wild-type C57 mice were injected with ARSK-AAV into the airways to construct mice with overexpression of ARSK in the lungs. Control group mice were injected with blank control AAV into the airways. After 21 days, a mouse model of COPD was constructed by passive smoking for 3 months. After modeling, lung function was detected by a pulmonary function instrument, lung inflammation was detected by HE staining of lung sections, and the senescence status of the lungs was detected by methods such as Western blotting, PCR, and β-galactosidase staining. Thus, the mice were divided into four groups: control group, control smoking group, ARSK-AAV group, and ARSK-AAV smoking group.

[0096] 1. Construction of a mouse model of COPD and detection of lung function

[0097] The method for constructing a mouse model of COPD was as described above. After modeling, lung function was detected by a pulmonary function instrument. The lung function of all mice was measured using a FlexiVent system (SCIREQ, Canada) under general anesthesia. Anesthesia was induced by intraperitoneal injection of 1% sodium pentobarbital at a dose of 10 mL per kilogram of body weight.

[0098] As Figure 5 shown in 0.1s a, the lung function FEV 0.1s , FEV

[0099] / FVC values of the control smoking group mice were significantly lower than those of the control group mice, indicating the successful establishment of the COPD model mice. The lung function of the ARSK-AAV smoking group mice was significantly higher than that of the control smoking group mice, indicating the preventive and therapeutic effects of ARSK overexpression in the lungs on COPD.

[0100] After removing fresh mouse lung tissue, it was fixed with 4% paraformaldehyde for 48 hours, 70% ethanol for 1.5 hours once, 80% ethanol for 30 minutes once, 95% ethanol for 15 minutes twice, absolute ethanol for 10 minutes three times, cleared with xylene twice, 15 minutes each time, infiltrated with paraffin I for 30 minutes, paraffin II for 90 minutes, paraffin III for 6 hours, embedded and sectioned, and then baked at a temperature controlled at 55 - 60 °C for 1 hour. Subsequently, it was dewaxed to water, stained with hematoxylin and eosin, differentiated with hydrochloric acid alcohol, and dehydrated and sealed.

[0101] As Figure 5 shown in

[0102] 3. PCR

[0103] The method is the same as described above.

[0104] As Figure 5 As shown in c, the expressions of IL-6, KC and IL-1β in the lung tissues of the control smoking group mice were significantly increased compared with those of the control group mice, while the expressions of IL-6, KC and IL-1β in the lung tissues of the ARSK-AAV smoking group mice were significantly decreased compared with those of the control smoking group mice. This indicates the alleviating effect of overexpression of ARSK in the lung on COPD pulmonary inflammation, and also indicates the alleviation of COPD lung senescence by overexpression of ARSK in the lung.

[0105] 4. ELISA

[0106] After the mice were anesthetized, their four limbs were fixed, the chest cavity was opened, the trachea was exposed, a small incision was made at the upper part of the trachea near the mouse head, a lavage needle was inserted into the trachea, and it was tightly tied to the trachea with a fine silk thread. After removing the needle of a 1 mL syringe, it was inserted into the lavage needle to lavage the lungs of the mice. Each time, 0.3 mL of pre-cooled normal saline containing 1% FBS (fetal bovine serum) was aspirated with the syringe, slowly infused, the syringe was pumped three times and then slowly withdrawn to recover the liquid, which was placed in a 1.5 mL EP tube and placed on ice. After centrifugation, the supernatant was taken to obtain the supernatant of bronchoalveolar lavage fluid (BALF). ELISA was performed as described above to detect the contents of IL-6, KC and IL-1β in BALF.

[0107] As Figure 5 As shown in d, the contents of IL-6, KC and IL-1β in BALF of the control smoking group mice were significantly increased compared with those of the control group mice, while the contents of IL-6, KC and IL-1β in BALF of the ARSK-AAV smoking group mice were significantly decreased compared with those of the control smoking group mice. This indicates the alleviating effect of overexpression of ARSK in the lung on COPD pulmonary inflammation, and also indicates the alleviation of COPD lung senescence by overexpression of ARSK in the lung.

[0108] 5. β-Galactosidase staining

[0109] The lung sections of the mice were stained as described above.

[0110] As Figure 5 As shown in e, the positive rate of β-galactosidase staining in the airway epithelium of the control smoking group mice was significantly higher than that of the control group mice, while the positive rate of β-galactosidase staining in the airway epithelium of the ARSK-AAV smoking group mice was significantly decreased compared with that of the control smoking group mice. This indicates the alleviation of airway epithelial senescence in COPD by overexpression of ARSK in the lung.

[0111] 6. Western blotting

[0112] Extract mouse lung tissue proteins for Western blotting as described above.

[0113] As Figure 5 shown in Figure f, the expression of senescence proteins p21 and p53 in the lung tissue of mice in the control smoking group was significantly increased compared with that of the control group, while the expression of senescence proteins p21 and p53 in the ARSK-AAV smoking group was significantly decreased compared with that of the control smoking group. This indicates the alleviation of COPD lung senescence by overexpression of ARSK in the lung.

[0114] In summary, after smoking, the lung function of ARSK-overexpressing mice was significantly increased compared with that of control mice. HE staining showed that the inflammation around the airways of ARSK-overexpressing smoking mice was significantly decreased, and the RNA levels of inflammatory factors in the lung tissue and the inflammatory cell count in bronchoalveolar lavage fluid (BALF) were significantly decreased. Western blotting and β-galactosidase staining showed that lung senescence in ARSK-overexpressing smoking mice was significantly alleviated.

[0115] Obviously, the above embodiments are merely examples for clear illustration and not limitations on the implementation manners. For those of ordinary skill in the art, other different forms of changes or alterations can be made based on the above description. It is not necessary and impossible to enumerate all the implementation manners here. And the obvious changes or alterations derived therefrom are still within the protection scope of the present invention.

Claims

1. Use of a reagent for detecting arylsulfatase K in the preparation of a product for diagnosing chronic obstructive pulmonary disease, wherein the product is a medicine.

2. The application according to claim 1, characterized in that: The chronic obstructive pulmonary disease is chronic obstructive pulmonary disease induced by cigarette smoke or cigarette smoke extract.

3. Use of arylsulfatase K in the preparation of drugs for preventing, delaying or treating chronic obstructive pulmonary disease.

4. The application according to claim 3, characterized in that: Vectors that overexpress arylsulfatase K can inhibit airway epithelial cell senescence, thereby preventing, delaying or treating chronic obstructive pulmonary disease.

5. Use of arylsulfatase K in the preparation of a product for delaying airway epithelial cell aging, wherein the product is a medicine.

6. The application according to claim 5, characterized in that: The vector overexpressing arylsulfatase K delays the senescence of airway epithelial cells by increasing the expression of arylsulfatase K, reducing the expression of cell senescence-related proteins p21 and p53, and inhibiting mitochondrial autophagy.

7. Use of a kit in the preparation of a product for diagnosing chronic obstructive pulmonary disease, characterized in that: The kit includes a reagent for detecting arylsulfatase K, and the product is a medicine.

Images