W-specific gene for identifying female and male of each instar of ostrinia furnacalis, specific primer pair, kit and detection method

Abstract

The application discloses a W-specific gene for identifying female and male of each instar of Ostrinia furnacalis, a specific primer pair, a kit and a detection method. The nucleotide sequence of the W-specific gene is shown as SEQ ID NO:1. The application also provides a specific primer pair for detecting the W-specific gene. The application further provides a PCR detection method for rapidly identifying female and male of each instar of Ostrinia furnacalis. After gDNA of Ostrinia furnacalis is extracted, PCR amplification is carried out, and agarose gel electrophoresis is carried out on the PCR amplification product. The cloned fragment of the W-specific gene of the female has a corresponding band in the agarose gel electrophoresis diagram, and the male has no corresponding band. The method is suitable for identifying female and male of each growth and development stage of Ostrinia furnacalis, has short detection time, simple operation and low cost, and is suitable for large-scale detection. The method has high accuracy, and non-insect taxonomists can also identify female and male of each growth and development stage of Ostrinia furnacalis through the method.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular markers, and particularly relates to a W-specific gene for identifying female and male of each instar of Ostrinia furnacalis, a specific primer pair, a kit and a detection method. BACKGROUND

[0002] Ostrinia furnacalis is an important pest of corn, which damages the heart leaf, stem, ear axis, filament and bract of corn plant, causes the damaged part to lose function, affects pollination, destroys the transportation of water and nutrients in the plant, and reduces the grain yield. Meanwhile, it also indirectly causes various diseases, which seriously affects the safe cultivation and production of corn in China.

[0003] The physiological and biochemical basic research of insects usually needs gender identification, and modern pest control methods also need gender identification of research objects.

[0004] At present, the female and male identification of Ostrinia furnacalis has morphological and molecular identification methods. The morphological identification is that the rhombic black spot in the middle of two hairs of the 9th abdominal segment of the male larva of the 4th instar is not easy to be seen under a low-power microscope, and the 4th instar larva has no such characteristics. The molecular identification method uses the dosage difference of Z gene in female and male individuals, and quantitatively PCR is carried out on the Z gene by extracting the genomic DNA of the larvae below the 5th instar and eggs to identify the female and male. However, the existing quantitative PCR operation is complicated, not suitable for batch identification of female and male of Ostrinia furnacalis, and the cost is high.

[0005] Ostrinia furnacalis is determined by ZZ / ZW sex determination system, and the W chromosome is specific to female individuals. The W-specific gene can be used to realize the development of molecular markers for female and male of all instars of Ostrinia furnacalis. However, at present, no reliable W-specific gene of Ostrinia furnacalis has been reported. SUMMARY

[0006] The application aims to overcome the deficiencies in the prior art, and provides a W-specific gene for identifying female and male of each instar of Ostrinia furnacalis, a specific primer pair, a kit and a detection method.

[0007] The application is achieved by the following technical scheme.

[0008] A W-specific gene for identifying female and male of each instar of Ostrinia furnacalis, the nucleotide sequence of which is shown in SEQ ID NO: 1.

[0009] The application further provides a specific primer pair for detecting the W-specific gene for identifying female and male of each instar of Ostrinia furnacalis, and the nucleotide sequences are as follows:

[0010] Ofur03G001590-F: AGAGTGCTACCACCTCCGAT, SEQ ID NO: 2;

[0011] Ofur03G001590-R: CAGTGCGACCTCCTTCCAAT, SEQ ID NO: 3.

[0012] The present application also provides a kit for identifying the female and male of each instar of Ostrinia furnacalis, which comprises genetic gender-specific primers.

[0013] The present application also provides a PCR detection method for rapidly identifying the female and male of each instar of Ostrinia furnacalis by using the W-specific gene for identifying the female and male of each instar of Ostrinia furnacalis, which comprises the following steps:

[0014] 1) gDNA extraction of Ostrinia furnacalis;

[0015] 2) PCR amplification;

[0016] 3) agarose gel electrophoresis of the PCR amplification product;

[0017] 4) female and male identification of Ostrinia furnacalis by agarose gel electrophoresis, the cloned fragment of the W-specific gene of the female has a corresponding band in the agarose gel electrophoresis map, and the male has no corresponding band.

[0018] Further, in step 2), the PCR amplification reaction system comprises Premix Taq TM , gDNA of Ostrinia furnacalis, ddH2O and a pair of specific primers.

[0019] The specific primers are as follows:

[0020] Ofur03G001590-F: AGAGTGCTACCACCTCCGAT, SEQ ID NO: 2;

[0021] Ofur03G001590-R: CAGTGCGACCTCCTTCCAAT, SEQ ID NO: 3.

[0022] Further, the PCR amplification reaction condition in step 2) is as follows: pre-denaturation at 94℃ for 3 min; denaturation at 94℃ for 10 sec, annealing at 60℃ for 10 sec, extension at 72℃ for 10 min, 28 cycles; final extension at 72℃ for 5 min; and preservation at 4℃.

[0023] Further, in step 3), the agarose gel electrophoresis is 1% agarose gel electrophoresis at a voltage of 120V for 20 min.

[0024] The beneficial effects of the present application are: 1. The method of the present application breaks through the limitations of the existing morphological identification method and is suitable for the identification of male and female of each growth and development stage of O. furnacalis. 2. Compared with the existing quantitative PCR detection technology, the method of the present application has the advantages of short detection time, simple operation and low cost, and is suitable for large-scale detection. 3. The method of the present application has high accuracy, and non-insect taxonomists can also identify the male and female of each growth and development stage of O. furnacalis through the method of the present application. BRIEF DESCRIPTION OF DRAWINGS

[0025] Figure 1 is an agarose gel electrophoresis diagram of the PCR amplification product of O. furnacalis gDNA. DETAILED DESCRIPTION

[0026] The present application will be described in detail below in combination with the drawings.

[0027] By assembling the W chromosome of O. furnacalis, a W-specific gene named Ofur03G001590 is identified through bioinformatics analysis, and specific primers are designed using NCBI (https: / / www.ncbi.nlm.nih.gov /

[0028] tools / primer-blast / index.cgi?LINK_LOC=BlastHome) and ordinary PCR method, which can realize the identification of male and female of all instars of O. furnacalis. EMBODIMENT

[0029] I. Experimental process

[0030] 1. O. furnacalis gDNA extraction

[0031] 1) Select seven female O. furnacalis (3 adult insects, 3 larvae and 1 pupa) and seven male O. furnacalis (3 adult insects, 3 larvae and 1 pupa), add 200ul CTAB mixed solution to each O. furnacalis, grind thoroughly, and then add 800ul CTAB mixed solution.

[0032] 2) Water bath at 65℃ for 30min, invert every 10min. Normal temperature 25℃, 12000rpm, centrifuge for 10min.

[0033] 3) Take the supernatant to a new centrifuge tube, add the same volume (1ml) of chloroform-isoamyl alcohol mixed solution (volume ratio 24:1) as CTAB, oscillate 100 times (horizontal oscillation instrument 5min), normal temperature 25℃, 12000rpm, centrifuge for 10min.

[0034] 4) Take the supernatant, add 1 ml chloroform-isopropyl alcohol mixture (volume ratio 24:1), 25°C, 12000 rpm, centrifuge for 10 min, take the supernatant (can take 600ul to avoid off-balance centrifuge).

[0035] 5) Add 1 ml isopropyl alcohol to the supernatant of step 4), mix gently, stand, -80°C, 10 min or -20°C, 1 h.

[0036] 6) 25°C, 12000 rpm, centrifuge for 10 min, pour the supernatant.

[0037] 7) Add 1 ml 70% ethanol (-20°C pre-cooled) to the precipitate to precipitate DNA, 25°C, 12000 rpm, centrifuge for 10 min, repeat 1 time.

[0038] 8) Dry on filter paper, add 20ul ddH2O to dissolve, store at -20°C.

[0039] 2. PCR amplification

[0040] According to the DNA sequence of Ofur03G001590, specific primers were designed and synthesized by Shenguo Bioengineering (Shanghai) Co., Ltd. The nucleotide sequence of the specific primer (5'->3') is:

[0041] Ofur03G001590-F: AGAGTGCTACCACCTCCGAT, SEQ ID NO: 2;

[0042] Ofur03G001590-R: CAGTGCGACCTCCTTCCAAT, SEQ ID NO: 3.

[0043] The above gDNA was used as a template to construct a PCR reaction system, as shown in Table 1.

[0044]

[0045] The PCR reaction program is shown in Table 2.

[0046]

[0047] Use 1% agarose gel, electrophoresis at 120V for 22min, observe the electrophoresis band in the gel imaging system, and send the PCR product to Shenguo Bioengineering (Shanghai) Co., Ltd. for sequencing. The length of the amplified band can be preliminarily judged by agarose gel electrophoresis map, if correct, further sequencing, and comparison of the sequence of the amplified band.

[0048] II. Test results

[0049] After PCR amplification, such as Figure 1 As shown, M is the DL2000 DNA Maker, with bands ranging from 2000bp, 1000bp, 750bp, 500bp, 250bp, and 100bp in length from top to bottom; 1-7 are PCR products of the female Asian corn borer Ofur03G001590; 8-14 are PCR products of the male Ofur03G001590. The cloned fragment of the W-specific gene from the female insect shows a corresponding band in the agarose gel electrophoresis image, but no corresponding band in the male. This indicates that the target fragment of the Ofur03G001590 gene was detected only in the female insect, and no corresponding fragment was cloned in the male.

[0050] The above results demonstrate that by using the specific primers provided by this invention to perform PCR amplification on a single Asian corn borer and then performing agarose gel electrophoresis on the PCR amplification products, the sex of the Asian corn borer can be identified. Specifically, the female DNA sample can amplify the corresponding fragment of the Ofur03G001590 gene, while no corresponding fragment is amplified in the male.

[0051] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, and is not intended to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions made by those skilled in the art to the technical solution of the present invention do not depart from the essence and scope of the technical solution of the present invention.

Claims

1. A rapid PCR detection method for identifying the sex of different developmental stages of the Asian corn borer, characterized in that, Includes the following steps: 1) Extraction of gDNA from Asian corn borer; 2) PCR amplification was performed using specific primer pairs for identifying the sex of the W gene in each developmental stage of the Asian corn borer; 3) Perform agarose gel electrophoresis on the PCR amplification products; 4) Sexing of Asian corn borers was determined by agarose gel electrophoresis. Cloned fragments of the W-specific gene in females showed corresponding bands in the agarose gel electrophoresis image, while males did not show corresponding bands. The nucleotide sequence of the W-specific gene used to identify the sex of different developmental stages of the Asian corn borer is shown in SEQ ID NO: 1; The nucleotide sequences of the specific primer pair are as follows: Ofur03G001590-F: AGAGTGCTACCACCTCCGAT, SEQ ID NO: 2; Ofur03G001590-R:CAGTGCGACCTCCTTCCAAT, SEQ ID NO:

3.

2. The PCR detection method according to claim 1, characterized in that: In step 2), the PCR amplification reaction system includes Premix Taq. TM Asian corn borer gDNA, ddH2O, and the specific primer pair.

3. The PCR detection method according to claim 1, characterized in that: The PCR amplification reaction conditions in step 2) are as follows: pre-denaturation at 94℃ for 3 min; denaturation at 94℃ for 10 sec, annealing at 60℃ for 10 sec, extension at 72℃ for 10 min, for 28 cycles; final extension at 72℃ for 5 min; and storage at 4℃.

4. The PCR detection method according to claim 1, characterized in that: In step 3), the agarose gel electrophoresis is performed using 1% agarose gel at 120V for 20 minutes.

Images