Ovarian targeting exosome loaded with antioxidant and preparation method of ovarian targeting exosome

Abstract

The invention relates to an ovarian targeting exosome loaded with an antioxidant and a preparation method of the ovarian targeting exosome. The ovarian targeting exosome loaded with the antioxidant is obtained by constructing the ovarian targeting exosome and then loading the small-molecule antioxidant into the ovarian targeting exosome. The small-molecule antioxidant can be delivered into the ovarian tissue of a tumor patient in a targeted manner before chemotherapy or during chemotherapy, the chemotherapy effect of tumor cells is not affected while the ovarian function is protected, and ovarian function protection in the chemotherapy process is achieved.

Description

Technical Field

[0001] The present invention belongs to the field of tumor treatment, and particularly relates to an ovarian-targeted exosome loaded with an antioxidant and a preparation method thereof. Background Art

[0002] Advances in tumor treatment methods have completely changed the outcomes of cancer patients and improved their long-term survival rates. This has also led to a gradual increase in the fertility needs of young female cancer patients. However, the chemotherapy and radiotherapy currently used in cancer treatment can damage women's ovarian function, leading to an increased risk of infertility in female patients. The ovaries are not only the place where eggs develop and mature, but can also secrete estrogen and progesterone. They are important organs for maintaining women's fertility and physical and mental health. Existing fertility preservation methods, such as egg cryopreservation and ovarian tissue cryopreservation, have solved the problem of fertility loss caused by chemotherapy-induced ovarian damage to a certain extent, but it is difficult to completely restore or maintain the endocrine function of the ovaries for a long time.

[0003] The intervention methods for chemotherapy-induced ovarian damage currently under study mainly include: gonadotropin-releasing hormone agonist (GnRH-a), apoptosis inhibitors, antioxidants, and mesenchymal stem cells and their derivatives, etc. Most of the research is still in the preclinical research stage. The main problems are: ① The effectiveness is controversial; ② The mechanism of action is unclear; ③ The targeting is poor, which may affect the anti-tumor effect, etc.

[0004] Chemotherapy and radiotherapy can cause cancer cells and normal tissue cells to produce a large amount of reactive oxygen species, leading to cell apoptosis. Antioxidants are a very promising class of chemotherapy protective agents, but due to their lack of targeting and their action pathways antagonizing the mechanism by which chemotherapy drugs kill cancer cells, their use before or during chemotherapy may affect the effectiveness of chemotherapy drugs in clearing cancer cells.

[0005] Mammalian cells can continuously release extracellular vesicles, or exosomes, into the external environment. By genetically engineering the cells that produce exosomes or directly chemically modifying the exosomes, exosomes can be targeted, thus becoming carriers for the targeted delivery of small molecule drugs. Summary of the invention

[0006] The technical problem to be solved by the present invention is to provide an ovarian targeted exosome loaded with antioxidants and a preparation method thereof, so as to overcome the problem that the ovarian chemotherapy protective agent in the prior art lacks targeting.

[0007] The present invention provides an ovary-targeted exosome loaded with an antioxidant, which is obtained by constructing the ovary-targeted exosome and then loading a small molecule antioxidant into the ovary-targeted exosome.

[0008] Preferably, the ovary-targeted exosomes are obtained by genetically modifying exosome-producing cells so that the exosomes produced have ovary-targeted proteins on their surfaces.

[0009] Preferably, the exosome-producing cells are one of human embryonic kidney cells HEK-293T cells, human umbilical cord mesenchymal stem cells, human adipose mesenchymal stem cells, human amniotic membrane mesenchymal stem cells, etc.

[0010] Preferably, the ovary-targeted protein is Lamp2b protein fused to the polypeptides at positions 33 to 53 of FSH protein at the N-terminus.

[0011] Preferably, the small molecule antioxidant is at least one of vitamin E, resveratrol, ferulic acid and melatonin.

[0012] The present invention also provides a method for preparing ovarian-targeted exosomes loaded with antioxidants, comprising the following steps:

[0013] The exosome-producing cells are genetically modified so that the exosomes they produce have ovarian-targeted proteins on their surface; small molecule antioxidants are loaded into the exosomes to obtain ovarian-targeted exosomes loaded with antioxidants.

[0014] The loading is loading into exosomes by ultrasound or other methods.

[0015] The exosome-producing cells include one or more of human embryonic kidney cells HEK-293T cells, human umbilical cord mesenchymal stem cells, human adipose mesenchymal stem cells, human amniotic membrane mesenchymal stem cells, and the like.

[0016] The ovarian targeting protein is a Lamp2b protein with the 33rd to 53rd polypeptides of the FSH protein fused to the N-terminus, the polypeptide sequence is: YTRDLVYKDPARPKIQKTCTF (as shown in SEQ ID NO: 2), and the corresponding gene sequence is: tacaccagggatctggtgtataaggacccagccaggcccaaaatccagaaaacatgtaccttc (as shown in SEQ ID NO: 1).

[0017] The small molecule antioxidant is at least one of vitamin E, vitamin E, resveratrol, ferulic acid, and melatonin.

[0018] The present invention also provides an application of ovarian-targeted exosomes loaded with antioxidants in the preparation of ovarian protection drugs during chemotherapy.

[0019] Beneficial Effects

[0020] The present invention can deliver small molecule antioxidants to the ovarian tissue of tumor patients before or during chemotherapy, thereby protecting ovarian function without affecting the chemotherapy effect of tumor cells, thereby protecting ovarian function during chemotherapy. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 is a schematic diagram of the structure of ovarian-targeted exosomes loaded with antioxidants;

[0022] Figure 2 The nanoparticle size tracking test results of the ovarian-targeted exosomes prepared in Example 3 and the ovarian-targeted exosomes loaded with vitamin E;

[0023] Figure 3 This is the result of the experiment of detecting cell proliferation activity by CCK-8 method;

[0024] Figure 4 This is a diagram showing the experimental results of detecting cell apoptosis by flow cytometry;

[0025] Figure 5 This is the experimental result of ovarian tissue staining and follicle counting. DETAILED DESCRIPTION

[0026] The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and are not intended to limit the scope of the present invention. In addition, it should be understood that after reading the content taught by the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms fall within the scope limited by the appended claims of the application equally.

[0027] Example 1

[0028] Construction of ovarian targeted protein expression plasmid and cell transfection.

[0029] The ovarian targeting protein is a recombinant protein (SEQ ID NO: 4) formed by adding a connector sequence between the 33rd to 53rd amino acids of the FSH protein (SEQ ID NO: 2) and the Lamp2b protein. The DNA sequence (SEQ ID NO: 3) expressing the recombinant protein is introduced into the pcDNA eukaryotic expression vector through the NheI and BamHI restriction endonuclease cutting sites after gene synthesis.

[0030] The successfully constructed ovarian-targeted protein expression plasmid was introduced into DH5α E. coli competent cells, spread on agar culture plates containing ampicillin resistance, and after the clones grew out, a single clone was picked and inoculated into LB liquid culture medium containing ampicillin for amplification and culture. Then, the endotoxin-free plasmid extraction kit was used for plasmid extraction.

[0031] HEK-293T cells were inoculated into a 10 cm diameter cell culture dish. When the cell density grew to about 80% confluence, plasmid transfection was performed. Lipofectine was selected as the transfection reagent. TM 2000 liposome transfection reagent (purchased from Invitrogen). The amount of plasmid transfected into each 10 cm dish of cells was 10 μg, and the corresponding transfection reagent volume used was 30 μL.

[0032] Example 2

[0033] Collection and purification of ovarian-targeted exosomes:

[0034] 24 hours after plasmid transfection, DMEM cell culture medium containing 10% exosome-free fetal bovine serum was replaced. After 48 hours of motif culture, the cell culture supernatant was harvested and the exosomes in the supernatant were collected by differential centrifugation. The specific operation steps are: ①4℃, 350×g, centrifugation for 15 minutes to remove cells; ②4℃, 2,000×g, centrifugation for 20 minutes to remove dead cells and cell debris; ③4℃, 12,000×g, centrifugation for 40 minutes to remove large-sized extracellular vesicles; ④4℃, 120,000×g, centrifugation for 90 minutes to precipitate exosomes; ⑤ resuspend the exosome precipitate with PBS buffer, 4℃, 120,000×g, centrifugation for 70 minutes, wash and collect the exosomes; ⑥ resuspend the exosome precipitate with an appropriate volume of PBS, and freeze it in an ultra-low temperature refrigerator at -80℃ after aliquoting.

[0035] Example 3

[0036] Ovarian-targeted exosomes loaded with antioxidants.

[0037] An appropriate concentration of small molecule antioxidants was mixed with purified ovarian-targeted exosomes. The preferred small molecule antioxidant was vitamin E, the preferred vitamin E concentration was 10 μM, and the preferred ovarian-targeted exosome concentration was 1×10E8 / mL. Ultrasonic treatment was performed using an ultrasonic disruptor with a total power of 500 W, φ2 amplitude, 40% power, 2 seconds of ultrasound and 2 seconds of pause, and a total of 5 minutes of ultrasound. After ultrasound, incubate at room temperature for 30 minutes, and then centrifuge at 4°C, 120,000×g for 70 minutes to remove free small molecule antioxidants.

[0038] The schematic diagram of the structure of the ovarian-targeted exosomes loaded with antioxidants is shown in the figure. Figure 1 shown.

[0039] The ovarian targeted exosomes before and after loading with vitamin E were subjected to a final test of nanoparticle size. The experimental results are as follows Figure 2As shown in Figure 2, the average diameter of ovarian-targeted exosomes before and after loading with vitamin E was about 100 nanometers, which is consistent with the typical characteristics of exosomes. Loading vitamin E by ultrasound had no significant effect on the particle size of exosomes.

[0040] Example 4

[0041] Ovarian-targeted exosomes loaded with vitamin E had an effect on the proliferation of human ovarian granulosa cells KGN cells after adding the chemotherapy drug cisplatin and solvent control in the culture system. After drug treatment, the proliferation activity of cells was detected by CCK-8 method, and the apoptosis of cells was detected by flow cytometry.

[0042] The results of the CCK-8 assay to detect cell proliferation activity were as follows Figure 3 As shown, the addition of ovarian-targeted exosomes loaded with vitamin E could significantly improve the decreased granulosa cell viability induced by cisplatin treatment.

[0043] The results of the experiment using flow cytometry to detect cell apoptosis are as follows Figure 4 As shown, the addition of ovarian-targeted exosomes loaded with vitamin E could significantly ameliorate granulosa cell apoptosis induced by cisplatin treatment.

[0044] Example 5

[0045] Detection of the ovarian protective effect of ovarian-targeted exosomes loaded with vitamin E in a mouse cisplatin chemotherapy model.

[0046] Cisplatin was intraperitoneally injected into 8-week-old female C57BL / 6 mice after adaptive feeding at a dose of 5 mg / kg. Exosomes were injected into the tail vein on the first day after administration. The exosome injection volume was 100 μg per mouse, and the injection was given once every other day for a total of 3 injections. Samples were collected on the 7th day after cisplatin treatment, and the ovaries were removed and embedded in paraffin for sectioning. After HE staining, the morphology and structure of the ovarian sections were observed under an optical microscope, and the number of various follicles was counted.

[0047] The experimental results of ovarian tissue staining and follicle counting are as follows Figure 5 As shown, the total number of healthy follicles in the ovaries of mice treated with ovarian-targeted exosomes loaded with vitamin E was significantly increased compared with the control group.

Claims

1. An ovarian-targeted exosome loaded with antioxidants, characterized in that: The method is obtained by constructing ovary-targeted exosomes and then loading small molecule antioxidants into the ovary-targeted exosomes.

2. The ovarian-targeted exosomes according to claim 1, characterized in that: The ovary-targeted exosomes are obtained by genetically modifying exosome-producing cells so that the exosomes produced by them have ovary-targeted proteins on their surfaces.

3. The ovarian-targeted exosomes according to claim 2, characterized in that: The exosome-producing cell is one of human embryonic kidney cells HEK-293T cells, human umbilical cord mesenchymal stem cells, human adipose mesenchymal stem cells, and human amniotic membrane mesenchymal stem cells.

4. The ovarian-targeted exosomes according to claim 2, characterized in that: The ovary targeting protein is a Lamp2b protein with the polypeptides at positions 33 to 53 of the FSH protein fused to the N-terminus.

5. The ovarian-targeted exosomes according to claim 1, characterized in that: The small molecule antioxidant is at least one of vitamin E, resveratrol, ferulic acid and melatonin.

6. A method for preparing ovarian-targeted exosomes loaded with antioxidants according to any one of claims 1 to 5, comprising the following steps: The exosome-producing cells are genetically modified so that the exosomes they produce have ovarian-targeted proteins on their surface; small molecule antioxidants are loaded into the exosomes to obtain ovarian-targeted exosomes loaded with antioxidants.

7. Use of the ovarian-targeted exosomes loaded with antioxidants as described in any one of claims 1 to 5 in the preparation of drugs for protecting ovaries during chemotherapy.

Images