Application of MsABI5 derived from malus sieboldii in improvement of drought resistance and salt resistance of strigolactones mediated plants

Abstract

The invention discloses an application of MsABI5 derived from malus sieversiana in improvement of drought resistance and salt resistance of strigolactones mediated plants. The invention provides application of an MsABI5 protein or a coding gene thereof in regulation and control of drought resistance and / or salt resistance of plants. The MsABI5 protein is a protein of which the amino acid sequence is SEQ ID No. 2. The application proves that after the function of the MsABI5 is inhibited, the drought resistance / salt resistance improvement effect mediated by strigolactones is also inhibited. The molecular mechanism that strigolactones cooperate with abscisic acid signals to improve the drought resistance of the apples is deeply clarified, effective core transcription factors are provided for the mechanism, and gene resources are provided for cultivating comprehensive apple stocks for balancing plant growth and development and resisting drought.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to application of MsABI5 derived from Xinjiang wild apple in improving the drought resistance and salt tolerance of plants mediated by strigolactones. Background Art

[0002] Apple is one of the most widely cultivated horticultural crops in the world and an important economic fruit tree in my country. Its yield is of great significance to the global economy. Apple planting requires an annual precipitation of more than 500 mm, which is conducive to the growth and development of apple trees and the increase of yield. Among the important apple producing areas in my country, the apple producing areas of the Loess Plateau in the northwest belong to arid and semi-arid areas. The large temperature difference between day and night in this area is conducive to the differentiation of apple flower buds and the accumulation of sugar in fruits. However, the loose soil, poor soil water retention and annual precipitation cannot meet the water demand of apple trees, resulting in frequent droughts. Drought will affect the growth and development of apple trees, causing the tree to weaken, and then lead to growth stagnation, leaf and fruit drop and even tree death, which ultimately restricts the increase of apple yield. At present, using apple drought-resistant rootstock grafted varieties to improve drought problems in production is one of the commonly used technologies. However, at the theoretical research level, in order to adapt to drought, apples will take a series of phenotypic and physiological changes, such as accelerated elongation of taproots and adventitious roots, restriction of aboveground growth and closure of stomatal leaves, etc. Plant hormones play an important regulatory role in these phenotypic and physiological changes.

[0003] Abscisic acid (ABA), as a common plant hormone, is mainly involved in phenotypic and physiological changes such as stomatal movement, root growth and drought stress response, and has been widely studied in regulating apple drought resistance. Strigolactones (SLs), as a new type of plant hormone, can promote the elongation of taproots and adventitious roots as well as the growth and development of aboveground parts. Summary of the invention

[0004] The purpose of the present invention is to provide the use of MsABI5 derived from Xinjiang wild apple in improving the drought resistance and salt tolerance of plants mediated by strigolactones. MsABI5 is an important transcription factor in the ABA signal pathway.

[0005] In the first aspect, the present invention claims the use of MsABI5 protein or its encoding gene in regulating plant drought resistance and / or salt tolerance;

[0006] The MsABI5 protein is derived from Malus Sieversii (ledeb.) Roem., and can be any of the following:

[0007] (A1) a protein having an amino acid sequence of SEQ ID No. 2;

[0008] (A2) a protein derived from apple having the same function as the amino acid sequence shown in SEQ ID No. 2, through substitution and / or deletion and / or addition of one or more amino acid residues;

[0009] (A3) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more identity with the amino acid sequence defined in any one of (A1) to (A2) and having the same function as that of an apple;

[0010] (A4) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein defined in any one of (A1) to (A3).

[0011] In the above-mentioned proteins, identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using an identity search site on the Internet, such as the BLAST page on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as a matrix, setting the Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively, and searching for the identity of a pair of amino acid sequences, the identity value (%) can be obtained.

[0012] The 80% or more identity may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity. The 85% or more identity may be at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity. The 90% or more identity may be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity. The greater than 95% identity may be at least 95%, 96%, 97%, 98% or 99% identity.

[0013] In the application, the expression level and / or activity of the MsABI5 protein in the plant body is reduced, and the drought resistance and / or salt tolerance of the plant is reduced; the expression level and / or activity of the MsABI5 protein in the plant body is increased, and the drought resistance and / or salt tolerance of the plant is improved.

[0014] Furthermore, the plant drought resistance and / or salt tolerance is plant drought resistance and / or salt tolerance mediated by strigolactone.

[0015] In a second aspect, the present invention claims protection for any of the following applications:

[0016] (B1) Use of a substance capable of inhibiting the expression and / or activity of MsABI5 protein in creating drought-sensitive and / or salt-sensitive plant models;

[0017] The drought-sensitive and / or salt-sensitive plant model is a plant model in which the damage caused by drought stress and / or salt stress cannot be alleviated by strigolactone or its analogs.

[0018] (B2) Use of a substance capable of promoting the expression and / or activity of MsABI5 protein in breeding drought-resistant and / or salt-tolerant plant varieties.

[0019] Wherein, the MsABI5 protein is any one of the proteins shown in (A1)-(A4) above.

[0020] Furthermore, the substance capable of inhibiting the expression and / or activity of the MsABI5 protein may be any substance that can directly target the MsABI5 protein or its encoding gene and inhibit the expression and / or activity of the MsABI5 protein.

[0021] In one embodiment of the present invention, in (B1), the substance capable of inhibiting the expression and / or activity of the MsABI5 protein is a DNA molecule fused with the coding gene of the MsABI5 protein and the coding sequence of SRDX, or an expression cassette or recombinant vector containing the DNA molecule. Specifically, the nucleotide sequence of the DNA molecule is positions 29-1453 of SEQ ID No.3.

[0022] In one embodiment of the present invention, the recombinant vector carrying the DNA molecule (positions 29-1453 of SEQ ID No. 3) is specifically a recombinant vector formed by inserting the MsABI5 amino acid coding sequence and the SRDX amino acid sequence into the multiple cloning site of a plant expression vector, wherein MsABI5 and SRDX are expressed in fusion, SRDX is an amino acid sequence consisting of multiple repeated leucines, and in the present invention, the SRDX sequence is LDLDLELRLGFA, which functions to inhibit the regulation of the target gene by the transcription factor MsABI5 without the problem of functional redundancy (Hiratsu et al. (2003) Plant J. 34: 733-739).

[0023] Furthermore, the substance capable of promoting the expression and / or activity of the MsABI5 protein may be any substance that can directly target the MsABI5 protein or its encoding gene and promote the expression and / or activity of the MsABI5 protein, such as the MsABI5 protein or its encoding gene or an expression cassette or expression vector containing the encoding gene.

[0024] In a third aspect, the present invention claims protection for any of the following methods:

[0025] Method I: A method for reducing drought resistance and / or salt tolerance of plants, comprising the following steps: reducing the expression level and / or activity of MsABI5 protein in the plant.

[0026] Method II: A method for improving plant drought resistance and / or salt tolerance, comprising the following steps: increasing the expression level and / or activity of MsABI5 protein in the plant.

[0027] Method III: A method for creating a drought-sensitive and / or salt-sensitive plant model, comprising the following steps: reducing the expression level and / or activity of MsABI5 protein in the plant.

[0028] Method IV: A method for breeding drought-resistant and / or salt-tolerant plant varieties, comprising the following steps: increasing the expression level and / or activity of MsABI5 protein in the plant.

[0029] Wherein, the MsABI5 protein is any one of the proteins shown in (A1)-(A4) above.

[0030] Furthermore, the plant drought resistance and / or salt tolerance is plant drought resistance and / or salt tolerance mediated by strigolactone.

[0031] In one embodiment of the present invention, reducing the expression level and / or activity of the MsABI5 protein in the plant is achieved by chimeric suppressor silencing technology, specifically by introducing into the plant a DNA molecule fused with the coding gene of the MsABI5 protein and the coding sequence of SRDX, or an expression cassette or recombinant vector containing the DNA molecule. More specifically, the nucleotide sequence of the DNA molecule is positions 29-1453 of SEQ ID No.3.

[0032] In one embodiment of the present invention, the DNA molecule is introduced into the plant in the form of a recombinant vector. The recombinant vector is specifically a recombinant vector formed by inserting the MsABI5 amino acid coding sequence and the SRDX amino acid sequence into the multiple cloning site of the plant expression vector, wherein MsABI5 and SRDX are fused and expressed, and SRDX is an amino acid sequence involving multiple repeated leucines. In the present invention, the SRDX sequence is LDLDLELRLGFA, which functions to inhibit the regulation of the target gene by the transcription factor MsABI5 without the problem of functional redundancy (Hiratsu et al. (2003) Plant J. 34: 733-739).

[0033] Furthermore, increasing the expression level and / or activity of the MsABI5 protein in the plant can be achieved by introducing the MsABI5 protein or its encoding gene or an expression cassette or expression vector containing the encoding gene into the plant.

[0034] Plant expression vectors include plant binary expression vectors for Agrobacterium infection and vectors for plant gene bombardment transformation, such as pCAMBIA1300, pCAMBIA1301, pCAMBIA1302 (CAMBIA), pRI101 and pBI121. Plant expression vectors usually carry marker genes such as the GUS gene that can produce a blue substrate or the GFP gene that produces green fluorescence, which are used to screen and identify transgenic plant cell lines or plants. In addition, antibiotic marker genes (such as the nptII gene that confers resistance to kanamycin, the hph gene that confers resistance to hygromycin, the bar gene that confers resistance to the herbicide phosphinothricin, the EPSPS gene that confers resistance to glyphosate, etc. From the perspective of safety, the plant expression vector can be modified to remove the selectable marker gene, and the transgenic plants can be directly screened by adversity. The above-mentioned expression cassette refers to a DNA that can express MsABI5 in a host cell, and the DNA includes a promoter that initiates transcription of the MsABI5 gene, a terminator that terminates transcription of the MsABI5 gene, and an enhancer sequence. The promoter used in the present invention includes but is not limited to the constitutive promoter CAMV 35S promoter of the cauliflower mosaic virus. Other promoters that can be used in the present invention include but are not limited to: tissue-specific promoters, such as the seed-specific promoter pF128 (CN101063139B (Chinese Patent 200710099169.7)) and inducible promoters, such as the methyl jasmonate-inducible promoter OsMeJA (CN 113881669B (Chinese Patent 202111073635.0)), etc. All references cited herein are cited in full. The above-mentioned recombinant bacteria may specifically be bacteria or yeast, wherein the bacteria may be Escherichia coli or Agrobacterium, such as Escherichia coli TOP10 or DH5α strains for constructing expression vectors, Agrobacterium EHA105 or GV3101 strains for infecting plant cells, AH109 or EGY48 strains for yeast hybridization experiments, Escherichia coli BL21 or Rosetta strains for prokaryotic protein expression, etc.

[0035] In a fourth aspect, the present invention claims a method for promoting the expression of MsABI5 protein and / or its encoding gene in plants.

[0036] The method for promoting the expression of MsABI5 protein and / or its encoding gene in plants claimed in the present invention may include the following steps: treating the plants with strigolactone or its analogs, and subjecting the plants to drought stress (such as natural drought, i.e., no watering).

[0037] Wherein, the MsABI5 protein is any one of the proteins shown in (A1)-(A4) above.

[0038] In a fifth aspect, the present invention claims a method for inhibiting or blocking strigolactone or its analogs from improving the drought resistance and / or salt tolerance of plants.

[0039] The method claimed in the present invention for inhibiting or blocking strigolactone or its analogs from improving plant drought resistance and / or salt tolerance may include the following steps: reducing the expression level and / or activity of MsABI5 protein in the plant.

[0040] Wherein, the MsABI5 protein is any one of the proteins shown in (A1)-(A4) above.

[0041] In a sixth aspect, the present invention claims the use of strigolactone or its analogues in improving the drought resistance and / or salt tolerance of plants. Wherein, the plant is a plant in which the expression amount and / or activity of MsABI5 protein in the body is not inhibited. Wherein, the MsABI5 protein is any one of the proteins shown in (A1)-(A4) above.

[0042] In a seventh aspect, the present invention claims composition 1.

[0043] The composition 1 claimed in the present invention consists of the following (a1) and (a2):

[0044] (a1) a substance capable of promoting the expression and / or activity of MsABI5 protein;

[0045] (a2) Strigolactone or its analogues.

[0046] Wherein, the MsABI5 protein is any one of the proteins shown in (A1)-(A4) above.

[0047] In an eighth aspect, the present invention claims the use of the composition 1 described in the seventh aspect above for improving the drought resistance and / or salt tolerance of plants with reduced expression level and / or activity of MsABI5 protein in vivo.

[0048] Wherein, the MsABI5 protein is any one of the proteins shown in (A1)-(A4) above.

[0049] In the application, (a1) is first used to increase the expression level and / or activity of the MsABI5 protein in the plant, and then (a2) is used to improve the drought resistance and / or salt tolerance of the plant.

[0050] In a ninth aspect, the present invention claims composition 2.

[0051] The composition 2 claimed in the present invention is composed of the following (b1) and (b2):

[0052] (b1) a substance capable of inhibiting the expression and / or activity of MsABI5 protein;

[0053] (b2) Strigolactone or its analogues.

[0054] Wherein, the MsABI5 protein is any one of the proteins shown in (A1)-(A4) above.

[0055] In a tenth aspect, the present invention claims protection for the use of the composition 2 described in the ninth aspect above in creating and verifying a plant model in which damage caused by drought stress and / or salt stress cannot be alleviated by strigolactone or its analogs.

[0056] In the application, (b1) is first used to reduce the expression level and / or activity of the MsABI5 protein in the plant to obtain a plant model, and then the plant model is subjected to drought stress and / or salt stress to verify whether the damage caused by drought stress and / or salt stress cannot be alleviated by strigolactone or its analogues.

[0057] In the above-mentioned related aspects, the gene encoding the MsABI5 protein may be any of the following:

[0058] (C1) DNA molecule shown in SEQ ID No.1;

[0059] (C2) a DNA molecule that hybridizes with the DNA molecule defined in (C1) under stringent conditions and encodes the MsABI5 protein;

[0060] (C3) A DNA molecule that has more than 99%, more than 95%, more than 90%, more than 85% or more identity with any of the DNA sequences defined in (C1)-(C2) and encodes the MsABI5 protein.

[0061] In the above-mentioned gene, the stringent conditions may be as follows: 50°C, hybridization in a mixed solution of 7% sodium dodecyl sulfate (SDS), 0.5M Na3PO4 and 1mM EDTA, and rinsing at 50°C, 2×SSC, 0.1% SDS; it may also be: 50°C, hybridization in a mixed solution of 7% SDS, 0.5M Na3PO4 and 1mM EDTA, and rinsing at 50°C, 1×SSC, 0.1% SDS; it may also be: 50°C, hybridization in a mixed solution of 7% SDS, 0.5M Na3PO4 and 1mM EDTA, and rinsing at 50°C, 0.5×SSC, 0.1% SDS; it may also be: 50°C, hybridization in a mixed solution of 7% SDS, 0.5M Na3PO4 and 1mM EDTA, and rinsing at 50°C, 0.1×SSC, 0.1% Rinse in SDS; alternatively: hybridize in a mixed solution of 7% SDS, 0.5M Na3PO4 and 1mM EDTA at 50°C, rinse in 0.1×SSC, 0.1% SDS at 65°C; alternatively: hybridize in a solution of 6×SSC, 0.5% SDS at 65°C, then wash the membrane once with 2×SSC, 0.1% SDS and once with 1×SSC, 0.1% SDS.

[0062] In the above genes, the identity of the nucleotide sequence can be determined using an identity search site on the Internet, such as the BLAST webpage on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as a Matrix, setting Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively and searching for the identity of a pair of nucleotide sequences, the identity value (%) can be obtained.

[0063] In the above genes, the above 95% identity may be at least 96%, 97%, 98% identity. The above 90% identity may be at least 91%, 92%, 93%, 94% identity. The above 85% identity may be at least 86%, 87%, 88%, 89% identity. The above 80% identity may be at least 81%, 82%, 83%, 84% identity.

[0064] In each of the above related aspects, the plant may be a dicotyledonous plant.

[0065] Furthermore, the dicotyledonous plant may be a plant of the Rosaceae family.

[0066] Furthermore, the Rosaceae plant may be a Malus plant.

[0067] More specifically, the plant of the genus Malus may be apple, such as Malus odoratus or 'GL-3' apple.

[0068] In the above-mentioned related aspects, in one embodiment of the present invention, the monolactone analog is specifically rac-GR24.

[0069] Beneficial effects of the present invention:

[0070] The present invention discloses the application of the transcription factor MsABI5 from Xinjiang wild apple, which is related to SLs cooperating with ABA signals to improve plant drought resistance and / or drug resistance. The present invention uses RT-qPCR technology to find that the expression of MsABI5 can be induced by rac-GR24 under drought conditions; the MsABI5 function inhibition strain is obtained by using an apple stable genetic transformation system and a chimeric suppressor silencing technology; mannitol and NaCl are used to simulate drought / salt stress and rac-GR24 treatment, and the results show that after the MsABI5 function is inhibited, the drought resistance / salt tolerance improvement effect of rac-GR24 is also inhibited. The present invention helps to further clarify the molecular mechanism of SLs cooperating with ABA signals to improve apple drought resistance, provide an effective core transcription factor for the mechanism, and provide gene resources for cultivating comprehensive apple rootstocks that balance plant growth and development and drought resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0071] Figure 1 SLs can improve the drought resistance of apples. Among them, A is the Xinjiang wild apple plants that maintained similar growth potential before treatment (14-16 leaves, 18-21cm high); B is the effect of rac-GR24 treatment on the phenotype of Xinjiang wild apple under drought conditions; C and D are the effects of rac-GR24 treatment on the aboveground height (C) and leaf number (D) of Xinjiang wild apple under drought conditions; EG are the effects of rac-GR24 treatment on proline (E), MDA (F) and total chlorophyll (G) of Xinjiang wild apple under drought conditions. Note: FW is fresh weight; scale bar is 10cm; data of three repeated experiments are expressed as mean ± standard deviation; different lowercase letters (ag) indicate significant differences (P<0.05) through LSD test.

[0072] Figure 2 The expression differences of ABA signaling pathway-related transcription factors in SLs regulating drought resistance of Xinjiang wild apple. Note: The experimental data repeated three times are expressed as mean ± standard deviation, and different lowercase letters (ad) indicate significant differences (P<0.05) through LSD test.

[0073] Figure 3Identification of MsABI5 transgenic lines. A is the identification of MsABI5-OE transgenic apple lines; B is the identification of MsABI5-SRDX transgenic apple lines. Note: The experimental data repeated three times are expressed as mean ± standard deviation; different lowercase letters (ac) indicate significant differences (P<0.05) through LSD test.

[0074] Figure 4 Xinjiang wild apple MsABI5 positively regulates apple drought resistance and salt tolerance. A is the phenotypic comparison of MsABI5 transgenic apple plants and 'GL-3' plants under normal and stress conditions; BD are the malondialdehyde content (B), proline content (C) and total chlorophyll content (D) of 'GL-3' plants and MsABI5 transgenic apple plants under normal and stress conditions, respectively. Note: FW is fresh weight; scale bar is 1 cm; data from three replicates are expressed as mean ± standard deviation; different lowercase letters (af) indicate significant differences (P<0.05) through LSD test. The horizontal axis of B is the same as D.

[0075] Figure 5 The effect of SLs on the drought and salt tolerance of apple depends on MsABI5. A shows the effect of rac-GR24 on the phenotype of MsABI5-SRDX transgenic apple plants under mannitol and NaCl conditions; B shows the effect of rac-GR24 on the proline (B), malondialdehyde (C) and total chlorophyll (D) contents of MsABI5-SRDX transgenic apple plants under mannitol and NaCl conditions. Note: Scale bar is 1 cm; FW is fresh weight; data from three replicates are expressed as mean ± standard deviation; different lowercase letters (ad) indicate significant differences (P<0.05) through LSD test. The horizontal coordinates of B and C are the same as D. DETAILED DESCRIPTION

[0076] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0077] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0078] Plant total RNA extraction kit and plasmid extraction kit were purchased from Tiangen Company, RNA reverse transcription reagent and homologous recombination kit were purchased from Novazon, PrimeSTAR Max high-fidelity enzyme and restriction endonuclease were purchased from Takara, DNA marker was purchased from Zhongke Ruitai Company, agarose gel recovery kit was purchased from AxyGen, 2×SYBR qPCRMix was purchased from Zhuangmeng Bio, kanamycin, rifampicin, timentin and 1-naphthaleneacetic acid were purchased from Sigma, hygromycin was purchased from Roche, and phenylthiadiazolyl urea (TDZ) was purchased from Coollebo. Escherichia coli DH5α competent cells and Agrobacterium tumefaciens EHA105 competent cells were purchased from Zhuangmeng. The plant binary expression vector pCAMBIA1302 can be obtained by the public from the applicant to repeat the experiments related to the present invention, and cannot be used for other purposes.

[0079] The strigolactone analog (rac-GR24) was purchased from Beijing Coolaibo Company (catalog number 76974-79-3).

[0080] Malus sieversii and 'GL-3' involved in the following embodiments are both recorded in the article "Chen Feng et al. MicroRNA156ab regulates apple plant growth and droughttolerance by targeting transcription factor MsSPL13. Plant Physiol. 2023Jul3; 192(3): 1836-1857. doi: 10.1093 / plphys / kiad099.", which can be obtained by the public from the applicant and can only be used to repeat the experiments of the present invention and cannot be used for other purposes.

[0081] The amino acid sequence of the MsABI5 protein involved in the following examples is shown in SEQ ID No.2, and the corresponding coding gene sequence is shown in SEQ ID No.1.

[0082] Example 1: Application of rac-GR24 in improving drought resistance and growth of Xinjiang wild apple

[0083] Xinjiang wild apple plants with similar growth potential (14-16 leaves, 18-21 cm high) were divided into 6 groups (3 apple plants in each group) as follows:

[0084] Normal watering group (control group); natural drought treatment group (drought group); normal watering group after treatment with 5μM rac-GR24 (5μM rac-GR24 / control group); natural drought treatment group after treatment with 5μM rac-GR24 (5μMrac-GR24 / drought group); natural drought treatment group after treatment with 10μM rac-GR24 (10μM rac-GR24 / drought group); natural drought treatment group after treatment with 20μM rac-GR24 (20μM rac-GR24 / drought group). The specific operation of rac-GR24 treatment is: before drought treatment, irrigate Xinjiang wild apple plants with different concentrations of rac-GR24 aqueous solution until the soil water content is saturated; natural drought treatment is to stop watering until the soil water content reaches 0% on the basis of keeping the plant growth environment unchanged.

[0085] Each apple plant in each treatment group was used as a biological replicate, and three experimental replicates were set for each treatment group.

[0086] The proline and malondialdehyde contents were determined using a plant proline detection kit (Cat. No. BC0295) and a plant malondialdehyde detection kit (Cat. No. BC0025), both purchased from Solebao. For specific operations, refer to the instructions.

[0087] The chlorophyll determination method was based on the method of Sun et al. (Sun et al. (2022) Tree Physiol. 42: 1827-1840). The specific steps are as follows:

[0088] Take 0.4g of leaves and grind them thoroughly in a mortar, then add 4-6mL of 95% ethanol until the tissue turns white and extract for 24h. Filter the extract (filter paper), dilute to 50mL with 95% ethanol, use 95% ethanol as a blank control, and measure the absorbance at 663nm and 645nm. Calculate the chlorophyll content using the following formula:

[0089] Chlorophyll a content (mg / g FW) = (12.7D 663 nm -2.69D 645 nm )×V / 1000×m;

[0090] Chlorophyll b content (mg / g FW) = (22.9D 645 nm -4.68D 663 nm )×V / 1000×m;

[0091] Total chlorophyll (mg / g FW) = (20.21D 645 nm +8.02D663 nm )×V / 1000×m;

[0092] Where: D 663 nm and D 645 nm represent the absorbance value at that wavelength respectively; V is the volume of the extract (mL); m is the fresh weight of the leaves (g); 1000 is the conversion factor between mL and L of the extract volume.

[0093] Real-time fluorescence quantitative PCR was used to detect the expression levels of MsABF1, MsABF2 and MsABI5 in rac-GR24 to improve the drought resistance of Xinjiang wild apple, with MdHistone H3 as the internal reference. The specific fluorescence quantitative primers are as follows (5'-3'):

[0094] MsABI5-F: AATGGGGCTTACCCGACAGT; MsABI5-R: CCCATCCCAATTGTCTGCCC.

[0095] MsABF1-F: GGGGTCGGAAGGGAAGTAAA; MsABF1-R: CGAACCGGCAGCAACATTAT.

[0096] MdABF2-F: AGCTGGGGTTGTGAGAGAAG; MdABF2-R: GGCAAATTTGAACCCTGATTCG.

[0097] MdHistone H3-F: TGAAGAAGCCCCACAGATA; MdHistone H3-R: GTCAGTCTTGAAGTCCTGCG.

[0098] The results are as follows Figure 1 As shown, rac-GR24 treatment significantly alleviated the reduction in seedling leaf number and leaf wilting and shrinkage caused by drought stress, and this alleviating effect increased with the increase of rac-GR24 concentration. In addition, rac-GR24 treatment promoted the accumulation of proline under drought conditions, alleviated the sharp increase in MDA levels and chlorophyll degradation caused by drought.

[0099] In addition, the results of the responses of transcription factors related to the ABA signaling pathway to SLs under drought conditions are as follows Figure 2As shown in the figure, both MsABF1 and MsABF2 can be significantly induced by drought, but do not respond to rac-GR24 treatment under drought conditions. MsABI5 can not only be induced by drought stress, but also be induced by rac-GR24 under drought conditions, and the expression level is positively correlated with the treatment concentration of rac-GR24. In addition, rac-GR24 treatment promotes the growth and development of Xinjiang wild apple under drought conditions.

[0100] Example 2: Application of MsABI5 in regulating rac-GR24-mediated drought and salt tolerance in apple

[0101] In this example, the stable genetic transformation system of apple and the chimeric suppressor silencing technology were used to obtain the MsABI5 functional inhibition strain, and then the role of MsABI5 in regulating the drought and salt tolerance of apple mediated by rac-GR24 was detected. At the same time, this example also constructed the MsABI5 overexpression strain.

[0102] 1. Construction of MsABI5-SRDX and MsABI5-OE recombinant vectors

[0103] Using the upstream primer (F: CGGGGGACTCTTGACCATGGTAGATCTG ATGTGCTTCAATTTGATC) and downstream primer (R1: CGCAAAGCCCAGGCGCAGTTCCAGATCCAGATCCAGTGCCATCAAACCACAACTATGAC), PCR amplification was performed using Xinjiang wild apple cDNA as a template to obtain PCR product 1. Using the obtained PCR product 1 as a template, the upstream primer (F: CGGGGGACTCTTGACCATGGTAGATCTG ATGTGCTTCAATTTGATC) and downstream primer (R2: TCCAGTGAAAAGTTC TTCTCCTTTACTAGT CGCAAAGCCCAGGCGCAG) to obtain PCR product 2. Using the upstream primer (F: CG GGGGACTCTTGACCATGGTAGATCTG ATGTGCTTCAATTTGATC) and downstream primer (R: TCCAGTGAAAAGTTCTTCTCCTTTACTAGT CAAACCACAACTATGA) was used as a template for PCR amplification to obtain PCR product 3 (Note: the underlined part in the above primers is the pCAMBIA1302 vector sequence, which is used for homologous recombination). The nucleotide sequence of the PCR product 2 is shown in SEQ ID No.3, and the nucleotide sequence of the PCR product 3 is shown in SEQ ID No.4.

[0104] The PCR products 2 and 3 obtained above (the underlined parts in the above primers at both ends of the amplified products are the homologous arms used for homologous recombination) were respectively inserted into the restriction sites BglII and SpeI of the pCAMBIA1302 expression vector (which carries the GFP gene) by restriction digestion and ligation based on the principle of homologous recombination. After sequencing confirmation, the pCAMBIA1302-MsABI5-SRDX recombinant vector and the pCAMBIA1302-MsABI5 recombinant vector were obtained.

[0105] The structure description of the pCAMBIA1302-MsABI5-SRDX recombinant vector and the pCAMBIA1302-MsABI5 recombinant vector: the pCAMBIA1302-MsABI5-SRDX recombinant plasmid was obtained by inserting the DNA fragment shown in positions 29-1453 of SEQ ID No.3 between the restriction sites BglII and SpeI of the pCAMBIA1302 vector by homologous recombination, and the pCAMBIA1302-MsABI5 recombinant plasmid was obtained by inserting the DNA fragment shown in positions 29-1411 of SEQ ID No.4. The key expression elements on these two recombinant vectors are as follows Figure 3 shown.

[0106] 2. Obtaining recombinant Agrobacterium MsABI5-SRDX and MsABI5-OE

[0107] The pCAMBIA1302-MsABI5-SRDX recombinant plasmid and pCAMBIA1302-MsABI5 recombinant plasmid obtained above were transformed into Agrobacterium tumefaciens EHA105 competent cells, and the positive recombinant bacteria were identified by bacterial liquid PCR. The positive recombinant Agrobacterium were named MsABI5-SRDX and MsABI5-OE, respectively, and used for apple genetic transformation.

[0108] 3. Genetic transformation of apple

[0109] The leaf disc method was used to infect apple 'GL-3' leaves with MsABI5-SRDX and MsABI5-OE recombinant Agrobacterium. The specific steps are as follows:

[0110] (1) Preparation of Agrobacterium heavy suspension

[0111] The MsABI5-SRDX and MsABI5-OE recombinant Agrobacterium were inoculated into YEP liquid medium containing 50 mg / mL kanamycin (Kana) and 50 mg / mL rifampicin (Rif) for expansion culture. The culture was cultured at 28°C and 200 rpm until the bacterial solution turned bright orange. The culture was centrifuged at room temperature and 5000 rpm for 10 min. The bacterial precipitate was reselected using MS liquid medium until the OD600 = about 0.6, and place it in the dark for short-term use.

[0112] (2) Infection of leaves of apple 'GL-3'

[0113] Use scissors to cut young apple leaves along the petiole, and cut 2-4 times perpendicular to the main vein of the leaf with a scalpel. Transfer the treated leaves to the bacterial resuspension and soak for about 10 minutes. After absorbing the bacterial liquid on the surface of the leaves with sterilized filter paper, spread the leaves with the back facing down on MS medium containing 4 mg / L 6BA + 0.5 mg / L IBA and culture in the dark for 3 days.

[0114] (3) Screening of MsABI5-SRDX and MsABI5-OE transgenic lines

[0115] Since the pCAMBIA1302 expression vector carries a marker gene for hygromycin resistance, the apple leaves after dark culture are placed on a MS medium containing 4mg / L 6BA+0.5mg / L IBA+400mg / L cefotaxime sodium+4mg / L hygromycin and cultured for about 40 days (if the leaves turn brown and necrotic during this period, the screening medium is replaced in time), and the leaves with more callus tissue are placed under light and continue to be cultured for about 30 days (if the leaves turn brown and necrotic during this period, the screening medium is replaced in time). The green shoots are cut off from the leaves with a surgical blade and then transferred to a MS medium containing 0.5mg / L 6BA+0.5mg / L IBA and continue to be cultured until the transgenic plants to be identified grow leaves. The culture temperature conditions are 22-24°C, the light conditions are 100-200μmol / m / s, the relative humidity is 30%-40%, and the day and night are alternated for 16h / 8h.

[0116] 4. Identification of MsABI5-SRDX and MsABI5-OE transgenic lines

[0117] The cDNA of the positive strain to be identified was used as a template, and the upstream primer (F: AATGGGGCTTACCCGACAGT) and the downstream primer (R: CCCATCCCAATTGTCTGCCC) were used to detect the expression level of MdABI5 by real-time fluorescence quantitative analysis. 'GL-3' was also used as a control in the experiment.

[0118] The results are as follows Figure 3As shown, the expression level of MdABI5 was significantly upregulated in the #6, #7 and #14 strains of MsABI5-OE and the #6, #7 and #8 strains of MsABI5-SRDX compared with 'GL-3'. The #6, #7 and #14 strains of MsABI5-OE and the #6, #7 and #8 strains of MsABI5-SRDX were placed in 1 / 2MS medium containing 0.5 mg / L IBA for rooting and culture for about 30 days, and the rooted whole plants were illuminated for GFP fluorescence. The results are shown in Figure 3 As shown, GFP fluorescence was observed in the roots and calli of lines #6, #7 and #14 of MsABI5-OE and lines #6, #7 and #8 of MsABI5-SRDX compared to 'GL-3'.

[0119] 5. Analysis of drought resistance and salt tolerance of MsABI5-OE and MsABI5-SRDX transgenic apple plants

[0120] MsABI5-OE and MsABI5-SRDX transgenic apple plants with the same growth conditions were placed in MS medium containing 300mM mannitol (simulating drought stress) or 200mM NaCl (simulating salt stress) for 14 days, and then the proline, malondialdehyde and chlorophyll contents in the leaves were detected. 'GL-3' was also set as a control in the experiment.

[0121] The results are as follows Figure 4 As shown in the figure, under normal conditions, the phenotypes of MsABI5-OE and MsABI5-SRDX transgenic apple plants were not significantly different from 'GL-3', the proline level of MsABI5-OE plants was significantly higher than that of 'GL-3', and the total chlorophyll content of MsABI5-SRDX plants was significantly lower than that of 'GL-3'. Under mannitol or NaCl conditions, compared with 'GL-3', the leaves of MsABI5-SRDX transgenic lines turned yellow and necrotic, and their malondialdehyde content was significantly higher than that of 'GL-3', and the proline and chlorophyll contents were significantly lower than those of 'GL-3', while the opposite was true for MsABI5-OE plants.

[0122] 6. Verification of MsABI5 regulation of rac-GR24-mediated drought and drug resistance in apple

[0123] MsABI5-SRDX transgenic lines with the same growth conditions were placed in MS medium containing "20μM rac-GR24+300mM mannitol" or "20μM rac-GR24+200mM NaCl" for 14 days. 'GL-3' was also used as a control in the experiment.

[0124] The results are as follows Figure 5As shown, rac-GR24 could alleviate the damage caused by mannitol and NaCl to 'GL-3', but could not alleviate the damage caused by mannitol and NaCl to MsABI5-SRDX transgenic line.

[0125] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. Application of MsABI5 protein or its encoding gene in regulating plant drought resistance and / or salt tolerance; The MsABI5 protein is any of the following: (A1) a protein having an amino acid sequence of SEQ ID No. 2; (A2) a protein derived from apple having the same function as the amino acid sequence shown in SEQ ID No. 2, through substitution and / or deletion and / or addition of one or more amino acid residues; (A3) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more identity with the amino acid sequence defined in any one of (A1) to (A2) and having the same function as that of an apple; (A4) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein defined in any one of (A1) to (A3).

2. The use according to claim 1, characterized in that: In the application, the expression level and / or activity of the MsABI5 protein in the plant is reduced, and the drought resistance and / or salt tolerance of the plant is reduced; and / or the expression level and / or activity of the MsABI5 protein in the plant is increased, and the drought resistance and / or salt tolerance of the plant is improved.

3. The use according to claim 1 or 2, characterized in that: The plant drought resistance and / or salt tolerance is the plant drought resistance and / or salt tolerance mediated by strigolactone.

4. Any of the following applications: (B1) Use of a substance capable of inhibiting the expression and / or activity of MsABI5 protein in creating drought-sensitive and / or salt-sensitive plant models; (B2) Use of a substance capable of promoting the expression and / or activity of MsABI5 protein in breeding drought-resistant and / or salt-tolerant plant varieties; The MsABI5 protein is any of the following: (A1) a protein having an amino acid sequence of SEQ ID No. 2; (A2) a protein derived from apple having the same function as the amino acid sequence shown in SEQ ID No. 2, through substitution and / or deletion and / or addition of one or more amino acid residues; (A3) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more identity with the amino acid sequence defined in any one of (A1) to (A2) and having the same function as that of an apple; (A4) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein defined in any one of (A1) to (A3).

5. The use according to claim 4, characterized in that: In (B1), the substance capable of inhibiting the expression and / or activity of the MsABI5 protein is a DNA molecule formed by fusion of the coding gene of the MsABI5 protein and the coding sequence of SRDX, or an expression cassette or recombinant vector containing the DNA molecule; Further, the nucleotide sequence of the DNA molecule is positions 29-1453 of SEQ ID No.3; In (B2), the substance capable of promoting the expression and / or activity of the MsABI5 protein is the gene encoding the MsABI5 protein or an expression cassette or recombinant vector containing the gene.

6. Either of the following methods: Method I: A method for reducing drought resistance and / or salt tolerance of plants, comprising the following steps: reducing the expression level and / or activity of MsABI5 protein in the plant; Method II: A method for improving drought resistance and / or salt tolerance of plants, comprising the following steps: increasing the expression level and / or activity of MsABI5 protein in the plant; Method III: A method for creating a drought-sensitive and / or salt-sensitive plant model, comprising the following steps: reducing the expression level and / or activity of MsABI5 protein in the plant; Method IV: A method for breeding drought-resistant and / or salt-tolerant plant varieties, comprising the following steps: increasing the expression level and / or activity of MsABI5 protein in the plant; The MsABI5 protein is any of the following: (A1) a protein having an amino acid sequence of SEQ ID No. 2; (A2) a protein derived from apple having the same function as the amino acid sequence shown in SEQ ID No. 2, through substitution and / or deletion and / or addition of one or more amino acid residues; (A3) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more identity with the amino acid sequence defined in any one of (A1) to (A2) and having the same function as that of an apple; (A4) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein defined in any one of (A1) to (A3).

7. The use according to claim 4 or 5 or the method according to claim 6, characterized in that: The drought-sensitive and / or salt-sensitive plant model is a plant model in which damage caused by drought stress and / or salt stress cannot be alleviated by strigolactone or its analogs; and / or The plant drought resistance and / or salt tolerance is plant drought resistance and / or salt tolerance mediated by strigolactone; and / or In the method, reducing the expression level and / or activity of the MsABI5 protein in the plant is achieved by introducing into the plant a DNA molecule fused with the coding gene of the MsABI5 protein and the coding sequence of SRDX, or an expression cassette or recombinant vector containing the DNA molecule; Furthermore, the nucleotide sequence of the DNA molecule is positions 29-1453 of SEQ ID No.

3.

8. A method for promoting the expression of MsABI5 protein and / or its encoding gene in a plant, comprising the following steps: treating the plant with strigolactone or its analogs, and subjecting the plant to drought stress; or A method for inhibiting or blocking strigolactone or its analogs from improving drought resistance and / or salt tolerance of plants, comprising the following steps: reducing the expression level and / or activity of MsABI5 protein in the plant; or Use of strigolactone or its analogues in improving drought resistance and / or salt tolerance of plants; the plants are plants in which the expression amount and / or activity of MsABI5 protein in the body is not inhibited; or Composition 1, consisting of the following (a1) and (a2): (a1) a substance capable of promoting the expression and / or activity of MsABI5 protein; (a2)Strigolactone or its analogs; or Use of the composition 1 in improving the drought resistance and / or salt tolerance of plants with reduced expression and / or activity of MsABI5 protein in vivo; or Composition 2, consisting of the following (b1) and (b2): (b1) a substance capable of inhibiting the expression and / or activity of MsABI5 protein; (b2)Strigolactone or its analogs; The composition 2 is used in creating and verifying a plant model in which damage caused by drought stress and / or salt stress cannot be alleviated by strigolactone or its analogs.

9. The use, method or composition according to any one of claims 1 to 8, characterized in that: The coding gene of the MsABI5 protein is any one of the following: (C1) DNA molecule shown in SEQ ID No.1; (C2) a DNA molecule that hybridizes with the DNA molecule defined in (C1) under stringent conditions and encodes the MsABI5 protein; (C3) A DNA molecule that has more than 99%, more than 95%, more than 90%, more than 85% or more identity with any of the DNA sequences defined in (C1)-(C2) and encodes the MsABI5 protein.

10. The use, method or composition according to any one of claims 1 to 9, characterized in that: The plant is a dicotyledonous plant; Furthermore, the dicotyledonous plant is a plant of the Rosaceae family; Furthermore, the Rosaceae plant is a plant of the genus Malus; More specifically, the plant of the genus Malus is apple.

Images