Antimicrobial endolysin polypeptides, compositions and formulations

Abstract

The present invention relates to a novel endolysin polypeptide or a fragment thereof having antimicrobial activity, preferably having antimicrobial activity against Clostridium perfringens. The present invention also relates to a nucleic acid molecule encoding the endolysin polypeptide or fragment, a recombinant polynucleotide expression vector comprising such a nucleic acid molecule, and a host cell comprising such a nucleic acid molecule or comprising such a recombinant polynucleotide expression vector. The present invention also relates to a composition and a food comprising the endolysin polypeptide or fragment and its use in treating diseases or disorders of animals.

Description

[0001] This application is a divisional application of a patent application with application number 202080027102.6 filed on January 31, 2020 and invention name “Antimicrobial Endolysin Polypeptides, Compositions and Preparations”. Technical Field

[0002] The present invention relates to a novel endolysin polypeptide or a fragment thereof having antimicrobial activity, preferably having antibacterial activity against Clostridium perfringens. The present invention also relates to a nucleic acid molecule encoding the endolysin polypeptide or fragment, a recombinant polynucleotide expression vector comprising such a nucleic acid molecule, and a host cell comprising such a nucleic acid molecule or comprising such a recombinant polynucleotide expression vector. The present invention also relates to a composition and a food comprising the endolysin polypeptide or fragment and its use in treating a disease or disorder in an animal. Background Art

[0003] Concerns about antibiotic resistance have led to public and regulatory pressure to ensure their judicious use in both human and veterinary medicine. Prevention of animal disease, particularly caused by Clostridium perfringens, has become a greater concern in food animal production. To achieve the same high levels of food animal production, the development of alternative antimicrobial agents is necessary. Agents developed specifically for the relevant microbial species of concern would serve as effective tools for the control of economically important diseases and are therefore ideal candidates for therapeutic treatment.

[0004] Several novel phage-derived endolysins with lytic activity against Clostridium perfringens type A have been identified and characterized. Synergistic effects between certain endolysins that increase antimicrobial activity against single strains and a broad spectrum of Clostridium perfringens type A strains have also been demonstrated.

[0005] Clostridium perfringens is a gram-positive, rod-shaped, anaerobic, spore-forming bacterium of the genus Clostridium. It is commonly found in decaying vegetation, marine sediments, the intestinal tract of humans and other vertebrates, insects, and soil. Although Clostridium perfringens is ubiquitous and usually benign, it is also the cause of many serious infections in animals and humans. In fact, Clostridium perfringens is known to be the cause of food poisoning, gas gangrene (clostridial myonecrosis), necrotic enteritis, and non-foodborne gastrointestinal infections. Based on the type of toxin expression, Clostridium perfringens strains are divided into five toxin types: A, B, C, D, and E.

[0006] Type A Clostridium perfringens is a particular concern for the poultry industry. The presence of type A Clostridium perfringens in the intestines of poultry, especially broilers, has been associated with a variety of diseases, such as intestinal lesions and necrotic enteritis, and can lead to a significant reduction in the growth of poultry. In addition to ionophores such as monensin and salinomycin, antibiotics such as bacitracin, virginiamycin and penicillin have been used to alleviate clinical and subclinical necrotic enteritis in poultry. However, the increase in drug resistance in recent years has significantly reduced the reliability of these antibiotics. Of particular concern is the increase in the prevalence and range of multidrug-resistant strains. In addition to the increasing resistance to conventional antibiotics, most antibiotics have broad-spectrum activity against a range of bacterial populations. Therefore, antibiotic treatment not only affects pathogenic bacteria, but also has an adverse effect on the beneficial and protective flora in the intestines of chickens. Therefore, it is very necessary to develop narrow-spectrum antimicrobial agents that specifically kill Clostridium perfringens, especially type A Clostridium perfringens, which have little or no collateral effects on the beneficial flora.

[0007] Endolysins encoded by bacteriophages can be used as antimicrobial agents specific to their host bacterial species. Bacteriophages are viruses that infect bacteria. The expansion of the understanding of bacteriophage biology, including the increase of antibiotic-resistant strains of bacteria, has led to an increase in interest in these specific lysozymes. Endolysins are used by bacteriophages to degrade bacterial cell wall peptidoglycans from the inside of bacteria, thereby promoting the release of phage offspring. Studies have shown that endolysins can also have antimicrobial effects when applied externally to gram-positive bacteria. Gram-positive bacteria-specific endolysins generally have modular organizations. Many of these endolysins have a dual domain structure, in which the N-terminal catalytic domain and the C-terminal cell wall binding domain are connected by a joint. Endolysins with different domain structures have also been found.

[0008] The N-terminal catalytic domain of endolysin is responsible for the enzymatic cleavage of the peptidoglycan layer of the cell wall. The peptidoglycan layer consists of a linear carbohydrate backbone with N-acetylglucosamine and N-acetylmuramic acid monomers connected alternately (β1-4). The carbohydrate backbone is cross-linked by species-specific peptide side chains. Depending on the type of bond they cut, endolysin can be N-acetyl-β-D-glucosaminidase or N-acetyl-β-D-muramidic acid enzyme. Alternatively, some endolysins have endopeptidase activity, cutting specific bonds of peptide side chains. Finally, the fourth type of endolysin is N-acetylmuramoyl-L-alanine amidase, which hydrolyzes the amide bond between sugar chains and peptide chains.

[0009] The C-terminal cell wall binding domain is mainly responsible for the specificity of endolysin to its target species or genus. This domain is non-covalently bound to the cell envelope, which can be a part of peptidoglycan or other cell wall-related molecules. The combination with the cell wall is tight and irreversible, which also minimizes the attack of endolysin on the surrounding cells of the cracked bacteria. In addition, the catalytic domain also has an impact on the specificity of endolysin. The peptidoglycan structure is different between Gram types and between different bacterial species. Therefore, the presence or absence of a specific target bond will contribute to the specificity of endolysin.

[0010] Due to their specificity and the low likelihood of the emergence of resistant strains, endolysins can be favorable antimicrobial agents against Clostridium perfringens, especially type A Clostridium perfringens, and they can be an effective method for controlling the occurrence of animal diseases such as necrotic enteritis in poultry. To this end, the inventors have identified and characterized several novel phage-derived endolysins with high specificity and lytic activity against a broad spectrum of Clostridium perfringens strains such as type A strains. Synergistic effects between the identified endolysins were also found, indicating that the use of mixtures of endolysins can enhance their antimicrobial efficacy. Summary of the invention

[0011] The inventors have identified endolysin polypeptides having surprisingly advantageous functional antimicrobial activities, including as described and defined herein according to SEQ ID numbers. Thus, the present invention encompasses any such specific endolysin polypeptides, as well as any polypeptides comprising fragments or variants of such endolysin polypeptides, or any polypeptides comprising any one or more fragments of any such endolysin polypeptides, as well as any polypeptides comprising any one or more sequence variants thereof, provided that any such endolysin polypeptides retain any antimicrobial activity described and defined herein.

[0012] In addition to the specific endolysin polypeptides disclosed herein and defined herein according to SEQ ID numbers, the present invention also provides any endolysin polypeptides and any polypeptides comprising fragments or variants of such endolysin polypeptides, or any polypeptides comprising any one or more fragments of any such endolysin polypeptides and any one or more sequence variants thereof, provided that any such polypeptide has any one or more of the surprising antimicrobial activities described and defined herein. Therefore, any such endolysin polypeptide can be considered to be functionally equivalent to any specific polypeptide disclosed herein and defined herein according to SEQ ID numbers.

[0013] The inventors surprisingly determined that multiple endolysin polypeptides of the invention used together, such as two or more endolysin polypeptides of the invention used together, can have a synergistic effect.

[0014] The inventors surprisingly determined that cell extracts including algal cell extracts can enhance the functional properties of the endolysin polypeptides of the present invention. Therefore, the endolysin polypeptides of the present invention expressed in cells (such as algal cells) can have enhanced functional properties, and the endolysin polypeptides of the present invention mixed with cell extracts (such as algal cell extracts) can have enhanced functional properties.

[0015] The endolysin polypeptide of the present invention is an isolated endolysin polypeptide having antimicrobial activity, and wherein the isolated polypeptide comprises or consists of the following amino acid sequence:

[0016] It is an N-terminal Clostridium perfringens cell wall peptidoglycan catalytic domain polypeptide.

[0017] Or it is a fragment of the N-terminal catalytic domain polypeptide; or

[0018] It is at least 80% identical to the amino acid sequence of the N-terminal cell wall peptidoglycan catalytic domain of the Clostridium perfringens phage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8 or 11,

[0019] Or it is a fragment of the N-terminal catalytic domain polypeptide, and its amino acid sequence corresponding to the amino acid sequence of the fragment shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8 or 11 is at least 80% identical.

[0020] The isolated endolysin polypeptide may comprise or consist of the following amino acid sequence: the amino acid sequence is the N-terminal Clostridium perfringens cell wall peptidoglycan catalytic domain and is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of the Clostridium perfringens bacteriophage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8 or 11.

[0021] In the case of a fragment of the amino acid sequence, the endolysin polypeptide may comprise or consist of an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of the sequence shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8 or 11 corresponding to the amino acid sequence of the fragment.

[0022] The N-terminal Clostridium perfringens cell wall peptidoglycan catalytic domain of the endolysin polypeptide defined according to the amino acid sequence shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8 or 11 is represented by the amino acid sequence shown in SEQ ID NO: 12, 13, 14, 15, 16, 17, 19 and 20XX, respectively. In addition, the N-terminal Clostridium perfringens cell wall peptidoglycan catalytic domain of the endolysin polypeptide defined according to the amino acid sequence shown in SEQ ID NO: 6 can be represented by the amino acid sequence shown in SEQ ID NO: 18.

[0023] Any endolysin polypeptide defined above may have any antimicrobial activity as defined herein.

[0024] The endolysin polypeptide of the present invention may be an isolated endolysin polypeptide having antimicrobial activity as defined above, further wherein the isolated polypeptide comprises: an N-terminal Clostridium perfringens cell wall peptidoglycan catalytic domain polypeptide or a fragment thereof, a C-terminal Clostridium perfringens cell wall binding domain polypeptide or a fragment thereof, and optionally a linker polypeptide or a fragment thereof connecting the N-terminal domain and the C-terminal domain; wherein the isolated polypeptide comprises:

[0025] a) an amino acid sequence that is at least 80% identical to the amino acid sequence of the N-terminal cell wall peptidoglycan catalytic domain of the Clostridium perfringens phage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8 or 11, or an amino acid sequence that is a fragment of the N-terminal catalytic domain polypeptide and is at least 80% identical to the amino acid sequence of the amino acid sequence corresponding to the fragment of the sequence shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8 or 11; and

[0026] b) an amino acid sequence that is at least 80% identical to an endolysin C-terminal Clostridium perfringens cell wall binding domain polypeptide or a fragment of said polypeptide; or an amino acid sequence that is at least 80% identical to the amino acid sequence of the C-terminal cell wall binding domain of the Clostridium perfringens bacteriophage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8, or an amino acid sequence that is a fragment of said C-terminal binding domain polypeptide and is at least 80% identical to the amino acid sequence of the amino acid sequence corresponding to said fragment of the sequence shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8; and

[0027] c) an optional linker amino acid sequence that is at least 80% identical to a linker of an endolysin polypeptide or a fragment of said polypeptide; or an optional amino acid sequence that is at least 80% identical to the amino acid sequence of a linker of a Clostridium perfringens phage endolysin polypeptide as shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8, or an amino acid sequence that is a fragment of said linker and is at least 80% identical to the amino acid sequence of the amino acid sequence corresponding to said fragment of the sequence shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8; wherein said linker amino acid sequence connects said amino acid sequence of the N-terminal cell wall peptidoglycan catalytic domain or a fragment thereof of the Clostridium perfringens phage endolysin polypeptide and the C-terminal cell wall binding domain or a fragment thereof of the Clostridium perfringens phage endolysin polypeptide.

[0028] The endolysin polypeptide of the present invention may be an isolated endolysin polypeptide having antimicrobial activity as defined above, wherein the isolated polypeptide comprises: an amino acid sequence comprising an N-terminal Clostridium perfringens cell wall peptidoglycan catalytic domain polypeptide or a fragment thereof or consisting of an N-terminal Clostridium perfringens cell wall peptidoglycan catalytic domain polypeptide or a fragment thereof, an amino acid sequence comprising a C-terminal Clostridium perfringens cell wall binding domain polypeptide or a fragment thereof or consisting of a C-terminal Clostridium perfringens cell wall binding domain polypeptide or a fragment thereof, and an amino acid sequence comprising a linker polypeptide connecting the N-terminal and C-terminal domains or a fragment thereof or consisting of a linker polypeptide connecting the N-terminal and C-terminal domains; wherein the isolated polypeptide comprises:

[0029] a) an amino acid sequence that is at least 80% identical to the amino acid sequence of the N-terminal cell wall peptidoglycan catalytic domain of the Clostridium perfringens phage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8 or 11, or an amino acid sequence that is a fragment of the N-terminal catalytic domain polypeptide and is at least 80% identical to the amino acid sequence of the amino acid sequence corresponding to the fragment of the sequence shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8 or 11; and

[0030] b) an amino acid sequence that is at least 80% identical to the amino acid sequence of the C-terminal Clostridium perfringens cell wall binding domain of the Clostridium perfringens phage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8, or an amino acid sequence that is a fragment of the C-terminal binding domain polypeptide and is at least 80% identical to the amino acid sequence of the sequence shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8 corresponding to the amino acid sequence of the fragment; and

[0031] c) an amino acid sequence that is at least 80% identical to the amino acid sequence of the linker of the Clostridium perfringens phage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8, or an amino acid sequence that is a fragment of the linker and is at least 80% identical to the amino acid sequence of the amino acid sequence corresponding to the fragment shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8.

[0032] The endolysin polypeptide of the present invention may be an isolated endolysin polypeptide having antimicrobial activity as defined above, wherein the isolated polypeptide consists of or comprises the following:

[0033] a) an amino acid sequence consisting of or comprising a fragment of the N-terminal catalytic domain and being at least 80% identical to the amino acid sequence of the sequence shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8 or 11 corresponding to the amino acid sequence of the fragment; and / or

[0034] b) an amino acid sequence consisting of or comprising a fragment of the C-terminal binding domain and being at least 80% identical to the amino acid sequence of the sequence shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8 corresponding to the amino acid sequence of the fragment; and / or

[0035] c) an amino acid sequence consisting of or comprising a fragment of said linker and being at least 80% identical to the amino acid sequence of the sequence shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8 corresponding to the amino acid sequence of said fragment.

[0036] In any of the above-mentioned endolysin polypeptides of the present invention having an amino acid sequence of an N-terminal Clostridium perfringens cell wall peptidoglycan catalytic domain or a fragment thereof, and an amino acid sequence of a C-terminal Clostridium perfringens cell wall binding domain or a fragment thereof, and optionally a linker amino acid sequence or an amino acid sequence of a fragment thereof, the percent identity with the reference sequence may be 80% or higher. Thus, in any such isolated endolysin polypeptide, the endolysin polypeptide may comprise or consist of an amino acid sequence that is an N-terminal Clostridium perfringens cell wall peptidoglycan catalytic domain and that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of a known endolysin N-terminal Clostridium perfringens cell wall peptidoglycan catalytic domain polypeptide. In the case of a fragment of the amino acid sequence, the endolysin polypeptide may comprise or consist of an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of a known endolysin N-terminal Clostridium perfringens cell wall peptidoglycan catalytic domain polypeptide corresponding to the amino acid sequence of the fragment. In any such isolated endolysin polypeptide, the endolysin polypeptide may comprise or consist of an amino acid sequence that is an N-terminal Clostridium perfringens cell wall peptidoglycan catalytic domain and is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of the Clostridium perfringens bacteriophage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8 or 11. In the case where the amino acid sequence is a fragment of the amino acid sequence, the endolysin polypeptide may comprise or consist of an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of the amino acid sequence corresponding to the fragment of the sequence shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8 or 11. In any such isolated endolysin polypeptide, the endolysin polypeptide may comprise or consist of an amino acid sequence that is a C-terminal Clostridium perfringens cell wall binding domain and is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of a known endolysin C-terminal Clostridium perfringens cell wall binding domain polypeptide.In the case of a fragment of the amino acid sequence, the endolysin polypeptide may comprise or consist of an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of a known endolysin C-terminal Clostridium perfringens cell wall binding domain polypeptide corresponding to the amino acid sequence of the fragment. Alternatively, in any such isolated endolysin polypeptide, the endolysin polypeptide may comprise or consist of an amino acid sequence that is a C-terminal Clostridium perfringens cell wall binding domain and which is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of the Clostridium perfringens bacteriophage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8. In the case of a fragment of the amino acid sequence, the endolysin polypeptide may comprise or consist of an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of the sequence shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8 corresponding to the amino acid sequence of the fragment. In any such isolated endolysin polypeptide, the endolysin polypeptide may optionally comprise or consist of an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of a linker of a known endolysin polypeptide. In the case of a fragment of the amino acid sequence, the endolysin polypeptide may comprise or consist of an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of the linker of a known endolysin polypeptide corresponding to the amino acid sequence of the fragment. Alternatively, in any such isolated endolysin polypeptide, the endolysin polypeptide may comprise or consist of an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of the linker of the Clostridium perfringens bacteriophage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8.In the case of a fragment of the amino acid sequence, the endolysin polypeptide may comprise or consist of an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of the sequence shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8 corresponding to the amino acid sequence of the fragment.

[0037] The endolysin polypeptide of the present invention may be an isolated endolysin polypeptide having antimicrobial activity as defined above, wherein the isolated polypeptide comprises: an amino acid sequence, wherein the N-terminal catalytic domain, the C-terminal cell wall binding domain and the linker are at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the corresponding amino acid sequences of the N-terminal domain, C-terminal domain and linker of the Clostridium perfringens phage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8 or 11, respectively.

[0038] Any endolysin polypeptide defined above may have any antimicrobial activity as defined herein.

[0039] The endolysin polypeptide of the present invention may be an isolated endolysin polypeptide having antimicrobial activity as defined above, wherein the polypeptide comprises or consists of:

[0040] a) an amino acid sequence comprising all of the N-terminal domain, the C-terminal domain and the linker of the Clostridium perfringens phage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 6 or 8, or an amino acid sequence consisting of all of the N-terminal domain, the C-terminal domain and the linker of the Clostridium perfringens phage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 6 or 8, and wherein the amino acid sequence is 100% identical to the sequence of the N-terminal domain, the C-terminal domain and the linker of the Clostridium perfringens phage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 6 or 8; or

[0041] b) an amino acid sequence comprising all of the N-terminal domains, the C-terminal domains and the linker fragments of the Clostridium perfringens phage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 6 or 8, or an amino acid sequence consisting of all of the N-terminal domains, the C-terminal domains and the linker fragments of the Clostridium perfringens phage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 6 or 8, and wherein the amino acid sequence of each fragment is 100% identical to the sequence of the amino acid sequence of the Clostridium perfringens phage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8 corresponding to the amino acid sequence of the fragment.

[0042] The endolysin polypeptide of the present invention may be an isolated endolysin polypeptide having antimicrobial activity as defined above, wherein the polypeptide comprises or consists of the following amino acid sequence: the amino acid sequence is 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of the Clostridium perfringens phage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8 or 11.

[0043] The endolysin polypeptide of the present invention may be an isolated endolysin polypeptide having antimicrobial activity as defined above, wherein the polypeptide comprises or consists of the following amino acid sequence: the amino acid sequence is 100% identical to the amino acid sequence of the Clostridium perfringens phage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8 or 11.

[0044] The endolysin polypeptide of the present invention may be an isolated endolysin polypeptide or fragment having antimicrobial activity as defined above, wherein the antimicrobial activity is bacteriolytic activity and / or bacterial growth inhibitory activity.

[0045] The endolysin polypeptide of the present invention may be an isolated endolysin polypeptide or fragment having antimicrobial activity as defined above, wherein the isolated polypeptide or fragment has bacteriolytic activity and / or bacterial growth inhibitory activity against Clostridium perfringens.

[0046] The endolysin polypeptide of the present invention may be an isolated endolysin polypeptide or fragment having antimicrobial activity as defined above, wherein the isolated polypeptide or fragment has lytic activity and / or bacterial growth inhibition activity against Clostridium perfringens, preferably type A strain of Clostridium perfringens. Alternatively, or in addition, when any such polypeptide or fragment is tested against Clostridium perfringens strain NCTC8237 at a concentration of 5 μg / ml in a cell viability assay as described herein, it may exhibit a ΔLog10 value of about 0.40 or greater, 2.00 or greater, or 3.70 or greater. Alternatively, or in addition, when any such polypeptide or fragment is tested against Clostridium perfringens strain NCTC8237 at a concentration of 5 μg / ml in a cell viability assay as described herein, it may exhibit a cell viability reduction of about 60% or greater, 70% or greater, 80% or greater, 90% or greater, or 100%. Alternatively, or in addition, when any such polypeptide or fragment is tested against Clostridium perfringens strain NCTC8237 at a concentration of 5 μg / ml in a cell turbidity reduction assay as described herein, it may exhibit a t50% lysis value of 7 minutes or less; or it exhibits a t50% lysis value of 3 minutes or less. ...3 minutes or less. 4 When the 1:1% cell / mL is tested against Clostridium perfringens strain Cp6, it exhibits a MIC and / or MBC value of 17 μg / mL or less, preferably 1.7 μg / mL or less; or it exhibits a MIC and / or MBC value of 0.65 μM or less, preferably 0.05 μM or less.

[0047] Alternatively, or in addition, any such polypeptide or fragment may be tested for endolysin activity (i.e., hydrolytic activity), and thus antimicrobial activity, by assessing the degradation rate of purified peptidoglycan (PGN) in vitro, wherein the endolysin polypeptide or fragment may be determined to have endolysin hydrolytic activity if the endolysin polypeptide or fragment promotes a statistically significant increase in the degradation rate of purified PGN in vitro. The degradation rate of purified PGN in vitro may be assessed with reference to the background rate of PGN degradation, i.e., with reference to a control preparation that does not contain the endolysin polypeptide. The degradation rate of purified PGN in vitro may be assessed by reference to the PGN degradation rate of a reference polypeptide or control polypeptide, wherein the reference polypeptide or control polypeptide is a polypeptide that does not promote a statistically significant increase in the degradation rate of purified PGN in vitro, such as a polypeptide that is an endolysin without PGN catalytic activity, or any polypeptide that is not an endolysin, such as bovine serum albumin or lysozyme.

[0048] Alternatively, or in addition, any such polypeptide or fragment can be tested for endolysin activity (i.e., hydrolytic activity), and therefore antimicrobial activity, by assessing whether any such polypeptide or fragment promotes a statistically significant reduction in the absolute amount of in vitro purified PGN at the endpoint of a PGN degradation assay. The amount of degradation (reduction) of in vitro purified PGN at the endpoint of a PGN degradation assay can be assessed with reference to the background amount of PGN degradation, i.e., with reference to a control formulation that does not contain an endolysin polypeptide. The amount of degradation (reduction) of in vitro purified PGN at the endpoint of a PGN degradation assay can be assessed by reference to the amount of PGN degradation of a reference polypeptide or control polypeptide, wherein the reference polypeptide or control polypeptide is a polypeptide that does not promote a statistically significant reduction in the amount of in vitro purified PGN, such as a polypeptide that is an endolysin without PGN catalytic activity, or any polypeptide that is not an endolysin, such as bovine serum albumin or lysozyme.

[0049] The present invention provides a separated recombinant nucleic acid molecule comprising a first nucleic acid sequence encoding any endolysin polypeptide or fragment of the present invention, optionally wherein the separated recombinant nucleic acid molecule further comprises a second nucleic acid sequence encoding a promoter, and wherein the first nucleic acid sequence is operably linked to the second nucleic acid sequence; optionally wherein the first nucleic acid sequence of the separated recombinant nucleic acid molecule encodes a cDNA. The present invention provides a separated recombinant polynucleotide expression vector comprising the nucleic acid molecule and comprising the first nucleic acid sequence and the second nucleic acid sequence. In any such separated recombinant nucleic acid molecule comprising the first nucleic acid sequence and the second nucleic acid sequence, or in any such separated recombinant polynucleotide expression vector comprising the first nucleic acid sequence and the second nucleic acid sequence, the promoter may be capable of promoting the expression of the endolysin polypeptide or fragment having antimicrobial activity in a cell of a unicellular microorganism, the cell being optionally a yeast cell, a bacterial cell (such as a lactobacillus), a fungal cell or an algae cell, preferably an algae cell. The nucleic acid sequence encoding the endolysin polypeptide or fragment may be codon-optimized for expression in a host cell, optionally wherein the host cell is a cell of a unicellular microorganism, optionally a yeast cell, a bacterial cell (such as a lactobacillus), a fungal cell or an algal cell, preferably an algal cell.

[0050] The present invention also provides a host cell comprising: a population of nucleic acid molecules as defined above, and encoding an endolysin polypeptide or fragment as defined above, and / or a population of recombinant polynucleotide expression vectors as defined above encoding an endolysin polypeptide or fragment as defined above, optionally wherein the host cell further comprises an endolysin polypeptide or fragment as defined above and the endolysin polypeptide or fragment has been expressed from the molecule or vector, optionally wherein the host cell is a cell of a unicellular microorganism, optionally a yeast cell, a bacterial cell (such as a lactobacillus), a fungal cell or an algal cell, preferably an algal cell, or wherein the host cell is a cell of a plant. In any such host cell, each molecule or vector of the population may encode the same endolysin polypeptide or fragment as defined above, or the molecules or vectors of the population may encode two or more different endolysin polypeptides or fragments as defined above, optionally wherein the host cell further comprises the endolysin polypeptide or fragment and which has been expressed from the molecule or vector, optionally wherein the host cell is a cell of a unicellular microorganism, optionally a yeast cell, a bacterial cell (such as a lactobacillus), a fungal cell or an algal cell, preferably an algal cell, or wherein the host cell is a cell of a plant.

[0051] The present invention also provides a cell lysate, comprising: a population of endolysin polypeptides or fragments as defined above and the endolysin polypeptides or fragments have been expressed from a nucleic acid molecule as defined above and / or a recombinant polynucleotide expression vector as defined above, optionally wherein the population consists of the same endolysin polypeptide or fragment as defined above, or wherein the population consists of two or more different endolysin polypeptides or fragments as defined above, optionally wherein the lysate is produced after expressing the endolysin polypeptide or fragment in a host cell, the host cell being a cell of a unicellular microorganism, optionally a yeast cell, a bacterial cell (such as a lactobacillus), a fungal cell or an algal cell, preferably an algal cell, or wherein the host cell is a plant cell.

[0052] The present invention also provides a composition comprising a population of endolysin polypeptides or fragments having antimicrobial activity as defined above, optionally wherein the population consists of the same endolysin polypeptides or fragments as defined above, or wherein the population consists of two or more different endolysin polypeptides or fragments thereof as defined above. In any such composition, the population of endolysin polypeptides or fragments having antimicrobial activity can be added to the composition (a) as purified polypeptides or fragments; or (b) as a component of one or more cell extracts; or (c) as purified polypeptides or fragments and as a component of one or more cell extracts; optionally wherein the cell extract described in (b) or (c) is an extract of a unicellular microorganism, which is optionally a yeast cell, a bacterial cell (such as a lactobacillus), a fungal cell or an algae cell, preferably an algae cell, or wherein the cell is a plant cell. In any such composition comprising a population of host cells, the host cells of the population may comprise an endolysin polypeptide or fragment having antimicrobial activity as defined above expressed in the host cells, wherein the endolysin polypeptide or fragment consists of the same endolysin polypeptide or fragment as defined above, or wherein the endolysin polypeptide or fragment consists of two or more different endolysin polypeptides or fragments thereof as defined above.

[0053] The present invention also provides a whole cell composition, which comprises a population of all host cells, wherein the cells of the population comprise an endolysin polypeptide or fragment with antimicrobial activity as defined above expressed in the host cell, wherein the endolysin polypeptide or fragment consists of the same endolysin polypeptide or fragment as defined above, or wherein the endolysin polypeptide or fragment consists of two or more different endolysin polypeptides or fragments thereof as defined above. The host cells of the population may be cells of a unicellular microorganism, optionally yeast cells, bacterial cells (such as lactobacilli), fungal cells or algae cells. The host cells of the population are preferably unicellular algae cells, more preferably Chlamydomonas Sp. cells, and even more preferably Chlamydomonas reinhardtii cells.

[0054] Any of the above compositions or whole cell compositions may comprise a dried biomass comprising an endolysin polypeptide or fragment having antimicrobial activity expressed in algal cells, preferably wherein the composition or whole cell composition is spray dried.

[0055] The present invention also provides a dried biomass composition, comprising a cell lysate as defined above, and / or a composition and / or a whole cell composition as defined above, wherein the dried biomass composition comprises: a cell lysate comprising an endolysin polypeptide or fragment with antimicrobial activity as defined above and / or a host cell comprising an endolysin polypeptide or fragment with antimicrobial activity as defined above expressed in a host cell. The host cells of the population are algae cells, preferably unicellular algae cells, more preferably Chlamydomonas cells, and even more preferably Chlamydomonas reinhardtii cells; preferably, wherein the dried biomass composition is spray-dried.

[0056] The present invention also provides an antimicrobial preparation comprising an endolysin polypeptide or fragment having antimicrobial activity as defined above and a pharmaceutically acceptable carrier / excipient.

[0057] Any such antimicrobial preparation may comprise a population of host cells, wherein the host cells of the population are as defined above, or wherein the preparation comprises a cell lysate as defined above, or wherein the preparation comprises a composition as defined above, or wherein the preparation comprises a dried biomass composition as defined above.

[0058] The present invention also provides an animal food comprising: (a) one or more foods; and (b) an isolated endolysin polypeptide or fragment having antimicrobial activity as defined above.

[0059] The present invention also provides an animal food, comprising:

[0060] (a) one or more foods; and

[0061] (b) also includes:

[0062] (i) any host cell as defined above;

[0063] (ii) any cell lysate as defined above;

[0064] (iii) any composition as defined above;

[0065] (iv) any whole cell composition as defined above;

[0066] (v) any dried biomass composition as defined above; and / or

[0067] (vi) Any antimicrobial agent as defined above.

[0068] The food may be suitable for consumption by poultry, optionally broiler chickens, preferably chickens (Gallus gallus domesticus); or wherein the food is suitable for consumption by pigs, preferably pigs (Sus scrofa domesticus); or wherein the food is suitable for consumption by rodents, optionally mice or rats.

[0069] Any of the above host cells, cell lysates, compositions, whole cell compositions, dried biomass compositions, antimicrobial preparations or animal foods may contain two or more endolysin polypeptides or fragments having antimicrobial activity different from those defined above. The exhibited antimicrobial activity provided by two or more different endolysin polypeptides or fragments may be a synergistic activity.

[0070] Any combination of two or more endolysin polypeptides or fragments may be provided. The combination may comprise: a combination of an endolysin polypeptide having an amino acid sequence as set forth in SEQ ID NO: 1 and an endolysin polypeptide having an amino acid sequence as set forth in any one of SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8 or 11; a combination of an endolysin polypeptide having an amino acid sequence as set forth in SEQ ID NO: 2 and an endolysin polypeptide having an amino acid sequence as set forth in any one of SEQ ID NOs: 3, 4, 5, 6, 7, 8 or 11; a combination of an endolysin polypeptide having an amino acid sequence as set forth in SEQ ID NO: 3 and an endolysin polypeptide having an amino acid sequence as set forth in any one of SEQ ID NOs: 4, 5, 6, 7, 8 or 11; a combination of an endolysin polypeptide having an amino acid sequence as set forth in SEQ ID NO: 4 and an endolysin polypeptide having an amino acid sequence as set forth in any one of SEQ ID NOs: 5, 6, 7, 8 or 11; a combination of an endolysin polypeptide having an amino acid sequence as set forth in SEQ ID NO: 5 and an endolysin polypeptide having an amino acid sequence as set forth in any one of SEQ ID NOs: 6, 7, 8 or 11; NO:6 and an endolysin polypeptide having an amino acid sequence as shown in any one of SEQ ID NOs:7, 8 or 11; an endolysin polypeptide having an amino acid sequence as shown in SEQ ID NO:7 and an endolysin polypeptide having an amino acid sequence as shown in any one of SEQ ID NOs:8 or 11; and an endolysin polypeptide having an amino acid sequence as shown in SEQ ID NO:8 and an endolysin polypeptide having an amino acid sequence as shown in SEQ ID NO:11. It should be understood that the above combination may include one or more other endolysin polypeptides. It should also be understood that the above combination involves a combination of fragments of the endolysin polypeptide and a combination of full-length endolysin polypeptide fragments of the endolysin polypeptide.

[0071] Any of the above host cells, cell lysates, compositions, whole cell compositions, dried biomass compositions, antimicrobial preparations or animal foods may be spray-dried, freeze-dried or in powdered form.

[0072] In any of the above-described nucleic acids, expression vectors, host cells, cell lysates, compositions, whole cell compositions, dried biomass compositions, antimicrobial preparations or animal foods of the invention, reference to an endolysin polypeptide, fragment or variant encompasses a combination of one or more endolysin polypeptides and / or one or more fragments and / or one or more variants.

[0073] The present invention also provides any of the above nucleic acids, expression vectors, host cells, cell lysates, compositions, whole cell compositions, dried biomass compositions, antimicrobial preparations or animal foods of the present invention for use as medicaments and for treating bacterial infections in animals. The bacterial infection may be an infection with Clostridium perfringens, optionally an infection caused by a type A strain of Clostridium perfringens.

[0074] The present invention also provides any of the above nucleic acids, expression vectors, host cells, cell lysates, compositions, whole cell compositions, dried biomass compositions, antimicrobial preparations or animal foods of the present invention for use in treating a disease or condition caused by infection with Clostridium perfringens, optionally an infection caused by a type A strain of Clostridium perfringens. The disease or condition caused by infection with Clostridium perfringens may be food poisoning, gas gangrene, necrotic enteritis, intestinal lesions and / or gastrointestinal infections.

[0075] The present invention also provides a method for preventing or treating a disease or illness in an animal, the method comprising: administering to the animal a preventive or therapeutically effective amount of any isolated endolysin polypeptide or fragment with antimicrobial activity disclosed herein, any host cell disclosed herein, any cell lysate disclosed herein, any composition disclosed herein, any whole cell composition disclosed herein, any dried biomass composition disclosed herein, any antimicrobial preparation disclosed herein, or animal food disclosed herein, and for any specific prevention or treatment of a disease or illness in an animal disclosed herein. The animal may be a poultry animal, optionally a broiler, preferably a chicken; or the animal may be a pig, preferably a pig.

[0076] The present invention also provides a method for obtaining any isolated polypeptide or fragment having antimicrobial activity as defined herein, comprising:

[0077] (a) culturing a host cell comprising any nucleic acid molecule or any recombinant polynucleotide expression vector disclosed herein in a culture system;

[0078] (b) harvesting the cultured host cells; and

[0079] (c) isolating the polypeptide or fragment from the host cell and / or culture medium.

[0080] The present invention also provides a method for obtaining a dried biomass composition comprising any isolated endolysin polypeptide or fragment having antimicrobial activity as defined above, the method comprising:

[0081] (a) culturing any host cell as defined above in a culture system under conditions where an endolysin polypeptide or fragment having antimicrobial activity is expressed;

[0082] (b) harvesting and isolating the host cell from the culture system;

[0083] (c) drying the host cells to form a dried biomass; and

[0084] (d) formulating the dried biomass into a composition.

[0085] The present invention also provides a method for obtaining a dried biomass composition comprising any isolated endolysin polypeptide or fragment having antimicrobial activity as defined above, the method comprising:

[0086] (a) culturing any host cell as defined above in a culture system under conditions where an endolysin polypeptide or fragment having antimicrobial activity is expressed;

[0087] (b) producing a lysate from the cultured host cells;

[0088] (c) drying the lysate to form a dried biomass; and

[0089] (d) formulating the dried biomass into a composition;

[0090] wherein the lysate is produced by lysing the host cells in situ in the culture system, or wherein the lysate is produced by lysing the host cells after the host cells have been harvested and separated from the culture system.

[0091] In any such method of obtaining a dried biomass composition, the host cell may be an algal cell, preferably a unicellular algal cell, more preferably a Chlamydomonas cell, still more preferably a Chlamydomonas reinhardtii cell. In any such method of obtaining a dried biomass composition, the step of drying to form a dried biomass may comprise spray drying. BRIEF DESCRIPTION OF THE DRAWINGS

[0092] Figure 1 : shows the expression of tRNA-Wtca molecules that allow translation of the RFP coding sequence using the WTGG-TGA codons.

[0093] Cultures of strains transformed with plasmids ecAL002, ecAL003, and ecAL004 6 hours after adding IPTG to the culture medium. (A) Cultures illuminated with white light; (B) Cultures irradiated with UV light; (C) SDS-PAGE gels of protein extracts from cultures transformed with plasmids ecAL002, ecAL003, and ecAL004 stained with InstantBlue protein stain. Cells were harvested 5 hours after adding IPTG to the culture medium and disrupted by sonication. Total protein extracts (T) and supernatants (S) after centrifugation at 15,000 rpm for 5 minutes were resolved in 4-15% polyacrylamide gels. Arrows indicate protein bands that may correspond to RFP.

[0094] Figure 2 : Shown is SDS-PAGE analysis of clarified lysates of bAL002 and bAL007 to bAL017.

[0095] Protein gels confirm that all endolysins except AMI3phi24R (bAL014) are expressed. Bands corresponding to endolysins are framed in red.

[0096] Figure 3 : Exemplary spot assay results from screening set 1 are shown.

[0097] Freshly-plated cells and cell lawns of Clostridium perfringens strain (NCTC 8238) were screened for endolysins expressed by E. coli, including various negative / positive controls. The markers on the agar plates correspond to the legends presented. 20 μg / ml ampicillin was shown to inhibit the growth of Cp on freshly plated cells, but did not show lytic activity on cell lawns. At the tested concentrations, lysozyme, disodium EDTA and combinations thereof had no effect on freshly plated cells and cell lawns. On the contrary, depending on the specific E. coli expressed endolysin, lytic activity was observed on freshly plated cells and cell lawns. For example, clarified bAL016 (GH25CPFORC3) lysates were able to produce clearance zones on cell lawns and freshly plated cells. The size of the clearance zone does not indicate the specific activity of the endolysin because the clarified lysate spots were not standardized for endolysin expression levels.

[0098] Figure 4 : Shows exemplary spot assay results for Clostridium perfringens strain from Screening Set 2 (NCTC 8237).

[0099] Newly plated cells and cell lawns were screened for E. coli expressed endolysins, including various negative / positive controls. Spot check results were similar to those of screening set 1. Other antibiotics tested (chloramphenicol, kanamycin, and spectinomycin) had no effect on both exponential and stationary phase cells. Compared to screening set 1, a higher concentration of disodium EDTA (10 mM) showed an inhibitory effect on newly plated cells, but not on cell lawns. Similar to screening set 1, clarified bAL016 (GH25CPFORC3) lysate produced a clearance zone on cell lawns and newly plated cells. The size of the clearance zone does not indicate the specific activity of the endolysin because the clarified lysate spots were not standardized for endolysin expression levels.

[0100] Figure 5 : Shown are the spot assay results for four non-C. perfringens species commonly found in the poultry gut (DSMZ 753, 1351, 6011 and 20083).

[0101] Freshly plated cells and lawns were screened for endolysins expressed in E. coli and various negative / positive controls were included. Sample and spot layout was similar to Figure 4 . Depending on the species, 20 μg / ml ampicillin and 10 mM disodium EDTA showed an inhibitory effect on freshly plated cells but had no effect on the cell lawn. Chloramphenicol also showed some inhibitory effect on freshly plated cells. In contrast, all E. coli expressed endolysins showed no lytic activity against freshly plated cells and cell lawns.

[0102] Figure 6 : Shows SDS-PAGE analysis and densitometry of purified GH25CPFORC3, AMI2phiCPV4 and AMI2phiZP2 endolysins.

[0103] Protein gel results showed that the endolysins were properly purified from the corresponding E. coli strains with minimal contaminating protein residues. Densitometry analysis using a BSA standard curve determined that the purified endolysin stock concentrations were approximately 2400 μg / mL, 750 μg / mL, and 1000 μg / mL for GH25CPFORC3, AMI2phiCPV4, and AMI2phiZP2, respectively.

[0104] Figure 7 : Shows exemplary spot assay results for evaluating the inhibitory effect and bacteriolytic activity of purified endolysins against Clostridium perfringens.

[0105] (A) Freshly plated cells - exemplary spot assay for testing the inhibitory effect of endolysin on Clostridium perfringens (APHA B00976). (B) Cell lawn 2 - exemplary spot assay for testing the lytic activity of endolysin on Clostridium perfringens (APHA B00976). No visible growth detection is indicated by -, while + / -, +, ++ and +++ correspond to increasingly clear and larger clearance zones.

[0106] Figure 8 : shows the turbidity reduction assay plate format. Sample arrangement and effective loading concentration of antibiotic enzymes on a 96-well microplate with a final volume of 100 μL per well.

[0107] Control samples included PBS control (100 μL / well PBS, pH 7.0 only; 8 replicates) and blank control (10 μL / well PBS, pH 7.0 + 90 μL / well resuspended cells; 8 replicates). In addition to lysozyme, GH25CPFORC3, AMI2phiCPV4 and AMI2phiZP2 endolysins were assayed in triplicate for each loading concentration.

[0108] Fig. 9 : Shown is the dose response of lysozyme (A) and endolysins (GH25CPFORC3 (B), AMI2phiCPV4 (C), and AMI2phiZP2 (D)) on the reduction of NCTC 2837 turbidity.

[0109] Fig.10 : Shows the ranking of the endolysin lytic activity of NCTC2837 at different loading concentrations (5, 2.5, 1.25 and 0.63 μg / mL, respectively - A to D).

[0110] Fig.11 : Dose response of lysozyme (A) and endolysins (GH25CPFORC3 (B), AMI2phiCPV4 (C), and AMI2phiZP2 (D)) on NCTC 8237 turbidity reduction is shown.

[0111] Fig.12 : Shows the ranking of the endolysin lytic activity of NCTC8237 at different loading concentrations (5, 2.5, 1.25 and 0.63 μg / mL, respectively - A to D).

[0112] Fig.13 : Dose response of lysozyme (A) and endolysins (GH25CPFORC3 (B), AMI2phiCPV4 (C), and AMI2phiZP2 (D)) on NCTC 8238 turbidity reduction is shown.

[0113] Fig.14: Shows the ranking of the endolysin lytic activity of NCTC8238 at different loading concentrations (5, 2.5, 1.25 and 0.63 μg / mL, respectively - A to D).

[0114] Fig.15 : Dose response of lysozyme (A) and endolysins (GH25CPFORC3 (B), AMI2phiCPV4 (C), and AMI2phiZP2 (D)) on NCTC 8239 turbidity reduction is shown.

[0115] Fig.16 : Shows the ranking of the endolysin lytic activity of NCTC8239 at different loading concentrations (5, 2.5, 1.25 and 0.63 μg / mL, respectively - A to D).

[0116] Fig.17 : Shown is a summary of the lytic activity of endolysins at different loading concentrations (5, 2.5, 1.25 and 0.63 μg / mL) and against different C. perfringens reference strains (NCTC 2837 (A), 8237 (B), 8238 (C), 8239 (D)).

[0117] The extracted "t_50% lysis" values ​​plotted on a scatter plot allow for a more concise description of the ranking and dose response of the endolysins, including for different strains. The scatter plot indicates that NCTC 8237 is the most sensitive to the endolysins tested, while NCTC 8238 is the most resistant.

[0118] Fig.18 : Shows the summary of the lytic activity of lysozyme and endolysin against NCTC 8238.

[0119] The lysozyme "t_50% lysis" value could only be determined from the turbidity reduction assay results for NCTC 8238. Although lysozyme showed higher lytic activity against NCTC 8238 than against the other 3 strains (NCTC 2837, 8237, 8239), the summary graph showed that its lytic activity was still much less compared to endolysin.

[0120] Fig.19 : Shown is the log10 reduction of C. perfringens strains treated with endolysin at loading concentrations of 1 μg / mL and 5 μg / mL.

[0121] The Δlog10 values ​​of 4 different Clostridium perfringens (NCTC 2837, 8237, 8238, 8239) cells treated with (A) GH25CPFORC3, (B) AMI2phiCPV4 and (C) AMI2phiZP2 endolysins with an initial bacterial load of 15.3 million cells / mL are shown. The Δlog10 values ​​are calculated as the log10 of the ratio between the untreated cell control response and the endolysin-treated cell response of each strain. The average Δlog10 values ​​and standard deviations of three biological replicates are shown. The assay results support the endolysin performance ranking established according to Example 12, from highest performance to lowest performance: 1) GH25CPFORC3, 2) AMI2phiCPV4, 3) AMI2phiZP2.

[0122] Fig. 20 : shows the dose response of Clostridium perfringens to the activity of endolysin. Fig.19 The percentage of cell viability reduction was calculated from the Δlog10 values ​​and plotted against the endolysin concentration used in the assay. The results showed that the percentage of cell viability reduction increased with the increase of added endolysin.

[0123] Fig. 20 The graphics in Fig.19 Alternative graphs of the data shown in . These alternative graphs show the percent reduction in strain viability as a function of endolysin loading concentration. The graphs show that increasing endolysin concentration is able to reduce cell viability. However, for all strains, there was no linear change in the endolysin and cell viability dose response with the addition of 5-fold more endolysin, from 1 μg / mL to 5 μg / mL, and no 5-fold reduction in cell viability was achieved. Given the current assay conditions, the antimicrobial activity of endolysins may be underestimated.

[0124] Fig.21: Illustrative point assay results are shown to study the synergistic interaction between GH25CPFORC3 ('FORC3) and AMI2phiCPV4 ('V4) endolysins and their bacteriolytic activity to Clostridium perfringens. The endolysins of single or combined spotting are arranged on NCTC8238 cell moss according to the sample. There is no visible growth detection represented by -, and + / -, +, ++ and +++ correspond to increasingly clear and increasingly larger clearance zones. Synergistic effect is observed, because compared with 200ug / mL GH25CPFORC3 or AMI2phiCPV4 spots, when GH25CPFORC3 and AMI2phiCPV4 are each spotted at 100ug / mL, a larger clearance zone is produced. Similarly, compared with 100ug / mL GH25CPFORC3 or AMI2phiCPV4 spots, when GH25CPFORC3 and AMI2phiCPV4 are each spotted at 50ug / mL, a larger clearance zone is produced.

[0125] Fig. 22 : Affinity purification of 6xHis-tagged AMI2phiZP2, AMI2phiCPV4, and GH25CPF4969 endolysins. SDS-PAGE gels and densitometry showed that the endolysins were properly purified from the corresponding E. coli strains. Densitometry analysis using a BSA standard curve determined that the purified endolysin stock concentrations were approximately 1700 μg / mL, 1000 μg / mL, and 3600 μg / mL for AMI2phiZP2, AMI2phiCPV4, and GH25CPF4969, respectively.

[0126] Fig.23: Exemplary checkerboard PGN assay plate layout and endolysin loading concentrations. Two checkerboard PGN assays were performed in a 96-well microplate, with an exemplary sample layout for a 1× endolysin starting concentration of 10 μg / mL. The 10× column endolysin stock solution (i.e., endolysin 1 or 3) was diluted 6 times by 2-fold serial dilution to 1.6 μg / mL, while the 10× row endolysin (i.e., endolysin 2 or 4) stock solution was diluted 4 times by 2-fold serial dilution to 6 μg / mL. 10 μL / well of the 10× stock solution of the corresponding endolysin 1 or 3 was distributed to the appropriate columns, and similarly, 10 μL / well of the 10× stock solution of the corresponding endolysin 2 or 4 was distributed to the appropriate rows. 10 μL / well PBS (pH 7.0) was added to the control columns 6 and 12 of endolysin 1 or 3 only, respectively. Similarly, 10 μL / well PBS (pH 7.0) was added to the control row H of endolysin 2 or 4 only. An additional 10 μL / well PBS (pH 7.0) was added to wells H6 and H12 for 0 μg / mL loading wells (i.e., PGN only controls). The PGN assay was initiated by dispensing 80 μL / well of PGN assay stock solution (prepared as described in Example 20), effectively diluting each endolysin 10-fold. Wells H6 and H12 were "PGN only" control wells with 0 μg / mL endolysin. The endolysin loading in each well corresponded to the indicated row and column loading concentrations.

[0127] Fig.24: Synergistic effect of purified GH25CPFORC3 and AMI2phiZP2 endolysin on PGN degradation of C. perfringens strain Cp6. (A) PGN degradation curves of 2.5 μg / mL GH25CPFORC3, 2.5 μg / mL AMI2phiZP2, and 2.5 μg / mL GH25CPFORC3 + 2.5 μg / mL AMI2phiZP2. (B) PGN degradation curves of 2.5 μg / mL GH25CPFORC3, 0.63 μg / mL AMI2phiZP2, and 2.5 μg / mL GH25CPFORC3 + 0.63 μg / mL AMI2phiZP2. (C) PGN degradation curves of 1.25μg / mL GH25CPFORC3, 2.5μg / mL AMI2phiZP2, and 1.25μg / mL GH25CPFORC3+2.5μg / mL AMI2phiZP2. (D) Summary of initial PGN degradation rate. Degradation curve marks correspond to purified endolysin and its loading. In addition, the accompanying marks in brackets describe the initial degradation rate (OD / hr) of the PGN degradation curve. When the endolysin combination shows 1) a higher PGN degradation rate compared to the sum of the individual rates of each endolysin and / or 2) a higher PGN degradation to a lower OD compared to when using endolysin alone, the synergistic effect is evaluated to exist. Therefore, the results show that the endolysin combination is synergistic.

[0128] Fig.25: Synergistic effect of purified GH25CPFORC3 and AMI2phiCPV4 endolysins on PGN degradation of C. perfringens strain Cp6. (A) PGN degradation curves of 2.5 μg / mL GH25CPFORC3, 2.5 μg / mL AMI2phiCPV4, and 2.5 μg / mL GH25CPFORC3 + 2.5 μg / mL AMI2phiCPV4. (B) PGN degradation curves of 1.25 μg / mL GH25CPFORC3, 2.5 μg / mL AMI2phiCPV4, and 1.25 μg / mL GH25CPFORC3 + 2.5 μg / mL AMI2phiCPV4. (C) PGN degradation curves of 0.16μg / mL GH25CPFORC3, 5μg / mL AMI2phiCPV4, and 0.16μg / mL GH25CPFORC3+5μg / mL AMI2phiCPV4. (D) Summary of initial PGN degradation rate. Degradation curve marks correspond to purified endolysin and its loading. In addition, the accompanying marks in brackets describe the initial degradation rate (OD / hr) of the PGN degradation curve. When the endolysin combination shows 1) a higher PGN degradation rate compared to the sum of the individual rates of each endolysin and / or 2) a higher PGN degradation to a lower OD compared to when using endolysin alone, the synergistic effect is evaluated to exist. Therefore, the results show that the endolysin combination is synergistic.

[0129] Fig.26: Synergistic effect of purified GH25CPF4969 and AMI3CPF4969 endolysins on PGN degradation of C. perfringens strain Cp6. (A) PGN degradation curves of 10 μg / mL GH25CPF4969, 5 μg / mL AMI3CPF4969, and 10 μg / mL GH25CPF4969 + 5 μg / mL AMI3CPF4969. (B) PGN degradation curves of 10 μg / mL GH25CPF4969, 2.5 μg / mL AMI3CPF4969, and 10 μg / mL GH25CPF4969 + 2.5 μg / mL AMI3CPF4969. (C) PGN degradation curves of 5μg / mL GH25CPF4969, 10μg / mL AMI3CPF4969, and 5μg / mL GH25CPF4969+10μg / mL AMI3CPF4969. (D) PGN degradation curves of 0.16μg / mL GH25CPF4969, 10μg / mL AMI3CPF4969, and 0.16μg / mL GH25CPF4969+10μg / mL AMI3CPF4969. (E) Summary of initial PGN degradation rates. Degradation curve labels correspond to purified endolysin and its loading. In addition, the accompanying labels in brackets describe the initial degradation rate (OD / hr) of the PGN degradation curve. A synergistic effect was assessed to be present when the endolysin combination exhibited 1) a higher PGN degradation rate than the sum of the individual rates of each endolysin and / or 2) a higher PGN degradation to a lower OD than when the endolysin was used alone. Thus, the results indicate that the endolysin combination is synergistic.

[0130] Fig. 27: Synergistic effect of purified GH25phiS63 and GH25CPF4969 endolysins on PGN degradation of Clostridium perfringens strain Cp6. (A) PGN degradation curves of 10μg / mL GH25phiS63, 10μg / mL GH25CPF4969, and 10μg / mL GH25phiS63+10μg / mL GH25CPF4969. (B) PGN degradation curves of 5μg / mL GH25phiS63, 10μg / mL GH25CPF4969, and 5μg / mL GH25phiS63+10μg / mL GH25CPF4969. (C) Summary of initial PGN degradation rates. Degradation curve labels correspond to the purified endolysins and their loading amounts. In addition, the accompanying labels in brackets describe the initial degradation rates (OD / hr) of the PGN degradation curves. A synergistic effect was assessed to be present when the endolysin combination exhibited 1) a higher PGN degradation rate than the sum of the individual rates of each endolysin and / or 2) a higher PGN degradation to a lower OD than when the endolysin was used alone. Thus, the results indicate that the endolysin combination is synergistic.

[0131] Fig.28 : Synergistic effect of purified GH25CPFORC3 and AMI3CPF4969 endolysin on the degradation of PGN of Clostridium perfringens strain Cp6. (A) PGN degradation curves of 1.25μg / mL GH25CPFORC3, 2.5μg / mL AMI3CPF4969, and 1.25μg / mL GH25CPFORC3+2.5μg / mL AMI3CPF4969. (B) PGN degradation curves of 0.63μg / mL GH25CPFORC3, 2.5μg / mL AMI3CPF4969, and 0.63μg / mL GH25CPFORC3+2.5μg / mL AMI3CPF4969. (C) Summary of initial PGN degradation rates. Degradation curve labels correspond to purified endolysin and its load. In addition, the accompanying labels in brackets describe the initial degradation rate (OD / hr) of the PGN degradation curve. A synergistic effect was assessed to be present when the endolysin combination exhibited 1) a higher PGN degradation rate than the sum of the individual rates of each endolysin and / or 2) a higher PGN degradation to a lower OD than when the endolysin was used alone. Thus, the results indicate that the endolysin combination is synergistic.

[0132] Fig.29: Synergistic effect of purified GH25CPF4969 and AMI2phiZP2 endolysin on PGN degradation of Clostridium perfringens strain Cp6. (A) PGN degradation curves of 2.5μg / mL GH25CPF4969, 2.5μg / mL AMI2phiZP2, and 2.5μg / mL GH25CPF4969+2.5μg / mL AMI2phiZP2. (B) PGN degradation curves of 0.31μg / mL GH25CPF4969, 10μg / mL AMI2phiZP2, and 0.31μg / mL GH25CPF4969+10μg / mL AMI2phiZP2. (C) Summary of initial PGN degradation rates. Degradation curve labels correspond to purified endolysin and its loading. In addition, the accompanying labels in brackets describe the initial degradation rate (OD / hr) of the PGN degradation curve. A synergistic effect was assessed to be present when the endolysin combination exhibited 1) a higher PGN degradation rate than the sum of the individual rates of each endolysin and / or 2) a higher PGN degradation to a lower OD than when the endolysin was used alone. Thus, the results indicate that the endolysin combination is synergistic.

[0133] Fig.30 : Plate layout for PGN degradation assay (A) and MIC assay (B) for evaluating the lytic and antimicrobial activities of algal extracts.

[0134] Fig.31 : Lytic activity of algae extracts expressing endolysins on C. perfringens Cp6 cells (whole cell Cp6 spot assay). Samples from shake flask cultures of Chlamydomonas strains crAL035, crAL038, crAL039, crAL045, crAL057 and crAL061 were collected to determine their lytic activity on C. perfringens Cp6 cells. Soluble extracts prepared from each strain were standardized to 10 mg TSP / mL, and 10 μL were spotted on solid agar medium embedded with C. perfringens Cp6 cells. Soluble extracts were spotted 2 times. The number at the center of each spot represents the Chlamydomonas strain from which the extract was prepared. The lytic activity was qualitatively assessed based on the size and clarity of the clearance zone around each spot. crAL035 (a strain produced by transformation with a vector that does not contain an endolysin gene) was used as a control.

[0135] Fig.32: Lytic activity of algal extracts expressing endolysins against C. perfringens Cp6 cells (PGN degradation assay). (A) PGN degradation curves of extracts from algal strains expressing only GH25CPFORC3 (crAL045 and crAL061). (B) PGN degradation curves of extracts from algal strains expressing only AMI2phiZP2 (crAL038 and crAL039). (C) PGN degradation curves of strains crAL057 (which co-express GH25CPFORC3 and AMI2phiZP2), crAL038 (AMI2phiZP2 only), and crAL061 (GH25CPFORC3 only). (D) Summary of initial PGN degradation rates extracted from Figures A to C.

[0136] Fig.33 : Minimum inhibitory concentration (MIC) of extracts from algae strains expressing endolysins against Clostridium perfringens Cp6 cells. MIC values ​​of soluble extracts prepared from Chlamydomonas strains expressing endolysins. MIC is expressed as the total soluble protein of the soluble extract that completely inhibits bacterial growth, in micrograms per milliliter (μg TSP / mL). Error bars correspond to 1 standard error.

[0137] Fig.34 : Plate layout for PGN degradation assay to evaluate the lytic activity of algal extracts. Algal extracts were prepared at 10 mg TSP / mL (10× stock solution) and then diluted up to 7 times to 78 μg TSP / mL by 2-fold serial dilutions. Extracts from strain crAL035 were diluted only 3 times to 1250 μg TSP / mL by 2-fold serial dilutions. 10 μL / well of the extract dilutions were dispensed into a 96-microwell plate according to the plate layout shown. For the "PGN only" control wells that were not loaded with extract, 10 μL / well PBS (pH 7.0) was dispensed. The PGN assay was started by dispensing 90 μL / well PGN assay stock solution.

[0138] Fig.35 : Lytic activity assay of endolysin-expressing strains crAL075, crAL076, crAL077, crAL078, crAL079 and crAL080 against C. perfringens Cp6 cells (whole cell Cp6 spot assay). (A) Spot assay plate layout. (B) Spot assay results of different algae extracts. The number in the center of each spot refers to the corresponding strain ID (e.g., "58" refers to strain crAL058). It is followed by a number indicating the dilution factor (1, 2, and 4). All algae extracts were standardized to a 1× stock solution of 10 mg TSP / mL.

[0139] Fig.36: PGN degradation curves of algal extracts produced by Chlamydomonas strains crAL035, crAL038, crAL039, crAL041, crAL058, crAL075, crAL076, crAL077, crAL078, crAL079 and crAL080. (A) PGN degradation curves of 125, 250, 500 and 1000 μg TSP / mL extracts from crAL035, which does not carry any endolysin genes. (B) Background PGN degradation when mixed with buffer (PBS, pH 7.0) instead of algal extract (4 replicates). (C) PGN degradation curves of extracts from strains expressing putative GH25 endolysins: crAL041 (GH25CPFORC3), crAL075 (GH25phiS63) and crAL079 (AMI3CPF4969). (D) PGN degradation curves of extracts from strains crAL038 (AMI2phiZP2) and crAL080 (GH25CPF4969) expressing putative AMI2 endolysins. (E) PGN degradation curves of extracts from strains crAL076 (AMI3CPFORC25), crAL077 (AMI3CPJP55) and crAL078 (AMI3phi24R) expressing putative AMI3 endolysins. (F) PGN degradation curves of extracts from the negative control crAL035 strain that does not express the endolysin gene and from the inactive strains crAL075 and crAL077.

[0140] Fig.37 : Lytic activity of algal extracts produced from Chlamydomonas strains crAL035, crAL038, crAL039, crAL041, crAL045, crAL058, crAL075, crAL076, crAL077, crAL078, crAL079, and crAL080. (A) Dose response of the initial rate of PGN degradation caused by increasing amounts of extracts containing the putative GH25 endolysin. (B) Dose response of the initial rate of PGN degradation caused by increasing amounts of extracts containing the putative AMI2 endolysin. (C) Dose response of the initial rate of PGN degradation caused by increasing amounts of extracts containing the putative AMI3 endolysin. (D) Summary of the activity of extracts from Chlamydomonas reinhardtii strains expressing endolysins, expressed as change in OD at 600 nm / (h×(μg TSP / ml).

[0141] Fig.38: Growth curves of Chlamydomonas reinhardtii strains crAL045 and crAL039 grown in a 5L bioreactor. The optical density (OD750nm) at 750nm was used to track the increase in cell density over time. The cultures were grown at 25°C under dark conditions with bubbling and pH control. (A) shows the growth curve of strain crAL045 and (B) shows the growth curve of strain crAL039. Strain crAL045 was harvested at about 41OD after 6 days of growth. The cells were spray dried to obtain a total yield of 25.8g of dry biomass. Similarly, strain crAL039 was harvested at about 116OD after 5 days of growth, and 42g of dry biomass was generated after spray drying.

[0142] Fig.39 : MIC / MBC assay plate layout and effective extract loading concentrations. The MIC / MBC assay was initiated according to the indicated plate format accordingly. The TSP content of the soluble extracts of crAL045 and crAL039 used was 30 mg TSP / mL (10× stock solution). The crAL045 and crAL039 soluble extracts were serially diluted 2× 11 times using PBS (pH 7.0) buffer, or to an effective dilution of 2048×. To initiate the MIC assay, 10 μL / well of the 2-fold serially diluted soluble extracts was dispensed according to the plate layout, and then 90 μL / well of ~10 5 1 cells / mL Cp6 to obtain the effective loading concentration. Serial dilutions of crAL045 extracts were assayed in triplicate, while crAL039 extracts were assayed in duplicate.

[0143] Fig.40 : Antimicrobial activity of crAL045 and crAL039 spray-dried biomass. Spray-dried biomass from crAL045 and crAL039 strains was used to produce soluble extracts for antimicrobial activity assays. The low MIC values ​​using 2.5E5 cells / mL of Clostridium perfringens strain CP6 indicated that both crAL045 and crAL039 dried biomass had high antimicrobial activity. The MBC values ​​were slightly increased over the MIC values. The antimicrobial activity rankings matched those observed using soluble extracts from wet shake flask pellets (Example 24), with crAL045 being more active than crAL039. Interestingly, extracts from spray-dried biomass were able to produce much lower MIC values ​​compared to shake flask extracts.

[0144] Fig.41: Plate layouts showing PGN degradation assays enhanced by algae extracts of representative endolysins. (A) Layouts for 35D, 35L, 53D, and 54D algae extract enhanced PGN assays showing GH25CPFORC3 and AMI2phiZP2 endolysins. 2× serial dilutions of endolysins diluted in PBS (pH 7.0) buffer or 4 algae extracts were assayed without replication. (B) Layouts for 54D algae extract enhanced PGN assays showing GH25CPFORC3, GH25CPF4969, AMI2phiZP2, and AMI3CPF4969 endolysins. 2× serial dilutions of endolysins diluted in PBS (pH 7.0) buffer or 54D algae extract were assayed in 3 replicates. For each plate layout, 4 replicates of "PGN only" control wells loaded with 0 μg / mL endolysins were also included for dilution to determine their background degradation rates (if any). The effective extract concentrations recorded correspond only to the wells where the extract dilutions were used.

[0145] Fig.42 = 5.3 fold enhancement of endolysin in algae extract compared to PBS (pH 7.0) buffer. This equation is used to calculate the enhancement fold of PGN degradation activity of endolysin in algae extract compared to PBS (pH 7.0) buffer. For example, v 2.5,ex corresponds to the initial PGN degradation rate of endolysin diluted in algal extract at a loading concentration of 2.5 μg / mL. Alternatively, v 0,ex Corresponds to the initial PGN degradation rate of the algal extract with only 0 μg / mL endolysin loading (ie, background degradation rate).

[0146] Fig.43 : Chlamydomonas reinhardtii extracts at a concentration of 2.5 μg / mL enhance the PGN degradation activity of GH25CPFORC3 endolysin. PGN degradation curves of 2.5 μg / mL purified GH25CPFORC3 endolysin mixed with 35D (A), 35L (B), 53D (C) and 54D (D) Chlamydomonas reinhardtii extracts are shown and compared with the PGN degradation curve of purified endolysin mixed with PBS (pH 7.0) buffer alone. The initial rates extracted from the PGN degradation curves are summarized in the bar graph (E); the error bars correspond to 1 standard error. The results show that all 4 Chlamydomonas reinhardtii extracts enhance the PGN degradation activity of GH25CPFORC3. In addition, the bar graph shows that Chlamydomonas reinhardtii extracts themselves (0 μg / mL endolysin) cannot degrade PGN.

[0147] Fig.44: Chlamydomonas reinhardtii extracts at a concentration of 1.25 μg / mL enhance the PGN degradation activity of GH25CPFORC3 endolysin. PGN degradation curves of 1.25 μg / mL purified GH25CPFORC3 endolysin mixed with 35D (A), 35L (B), 53D (C) and 54D (D) Chlamydomonas reinhardtii extracts are shown and compared with the PGN degradation curve of the purified endolysin mixed with PBS (pH 7.0) buffer alone. The initial rates extracted from the PGN degradation curves are summarized in the bar graph (E); the error bars correspond to 1 standard error. The results show that all 4 Chlamydomonas reinhardtii extracts enhance the PGN degradation activity of GH25CPFORC3. In addition, the bar graph shows that Chlamydomonas reinhardtii extracts themselves (0 μg / mL endolysin) cannot degrade PGN.

[0148] Fig.45 : Chlamydomonas reinhardtii extracts at a concentration of 0.63 μg / mL enhance the PGN degradation activity of GH25CPFORC3 endolysin. PGN degradation curves of 0.63 μg / mL purified GH25CPFORC3 endolysin mixed with 35D (A), 35L (B), 53D (C) and 54D (D) Chlamydomonas reinhardtii extracts are shown and compared with the PGN degradation curve of purified endolysin mixed with PBS (pH 7.0) buffer alone. The initial rates extracted from the PGN degradation curves are summarized in the bar graph (E); the error bars correspond to 1 standard error. The results show that all 4 Chlamydomonas reinhardtii extracts enhance the PGN degradation activity of GH25CPFORC3. In addition, the bar graph shows that Chlamydomonas reinhardtii extracts themselves (0 μg / mL endolysin) cannot degrade PGN.

[0149] Fig.46 : 35D, 35L, 53D and 54D algae extracts on the PGN degradation activity of GH25CPFORC3 endolysin. The results of a single replicate showed that at the specified loading concentration, and depending on the algae extract, GH25CPFORC3 endolysin was enhanced up to about 2.5 times compared to when mixed in PBS (pH 7.0) buffer.

[0150] Fig.47: Chlamydomonas reinhardtii extracts at concentrations of 0.31, 0.16 and 0.08 μg / mL enhance the PGN degradation activity of GH25CPFORC3 endolysin. PGN degradation curves of 0.31 (A), 0.16 (B) and 0.08 (C) μg / mL purified GH25CPFORC3 endolysin mixed with 35D, 35L, 53D and 54D Chlamydomonas reinhardtii extracts are shown and compared with the PGN degradation curve of the purified endolysin mixed with PBS (pH 7.0) buffer alone. Comparison of the degradation curves shows that the PGN degradation activity of the endolysin is enhanced in the presence of algae extracts compared to only in buffer.

[0151] Fig.48 : Chlamydomonas reinhardtii extracts enhance the PGN degradation activity of AMI2phiZP2 endolysin. PGN degradation curves of 2.5 (A), 1.25 (B) and 0.63 (C) μg / mL purified AMI2phiZP2 endolysin mixed with 54D Chlamydomonas reinhardtii extract are shown and compared with the PGN degradation curve of purified endolysin mixed with PBS (pH 7.0) buffer alone. The initial rates extracted from the PGN degradation curves are summarized in the bar graphs (D-2.5μg / mL), (E-1.25μg / mL) and (F-0.63μg / mL); the error bars correspond to 1 standard error. The results show that all 4 Chlamydomonas reinhardtii extracts enhance the PGN degradation activity of AMI2phiZP2. In addition, the bar graphs show that Chlamydomonas reinhardtii extracts themselves (0μg / mL endolysin) cannot degrade PGN.

[0152] Fig.49 : fold enhancement of PGN degradation activity of AMI2phiZP2 endolysin by 35D, 35L, 53D and 54D algae extracts. The results of single replicates showed that at the specified loading concentrations and depending on the algae extract, AMI2phiZP2 endolysin was enhanced up to about 2.2-fold compared to when mixed in PBS (pH 7.0) buffer.

[0153] Fig.50: The enhancement of the PGN degradation activity of GH25CPFORC3 endolysin by 54D Chlamydomonas reinhardtii extract is reproducible. Representative PGN degradation curves of 2.5 (A), 1.25 (B), 0.63 (C), 0.31 (D), 0.16 (E) and 0 (F) μg / mL purified GH25CPFORC3 endolysin mixed with 54D Chlamydomonas reinhardtii extract are shown and compared with the representative PGN degradation curve of the purified endolysin mixed with PBS (pH 7.0) buffer alone. The initial rates extracted from the PGN degradation curves are summarized in the bar graph (G); the error bars correspond to 1 standard error. The results show that the enhancement of the PGN degradation activity of GH25CPFORC3 endolysin by algae extract is reproducible and consistent with 3 replicates. While endolysin diluted in buffer exhibited degradation activity almost as low as background (0 μg / mL endolysin), especially at reduced loading concentrations, the enhancement was significant and could be seen at, for example, an endolysin concentration of 0.16 μg / mL.

[0154] Fig.51 : The enhancement of the PGN degradation activity of AMI2phiZP2 endolysin by 54D Chlamydomonas reinhardtii extract is reproducible. Representative PGN degradation curves of 1.25 (A), 0.63 (B), 0.31 (C), 0.16 (D) and 0 (E) μg / mL purified AMI2phiZP2 endolysin mixed with 54D Chlamydomonas reinhardtii extract are shown and compared with the representative PGN degradation curve of the purified endolysin mixed with PBS (pH 7.0) buffer alone. The initial rates extracted from the PGN degradation curves are summarized in the bar graph (F); the error bars correspond to 1 standard error. The results show that the enhancement of the PGN degradation activity of AMI2phiZP2 endolysin by algae extract is reproducible and consistent with 3 replicates.

[0155] Fig.52: 54D Chlamydomonas reinhardtii extract enhances the PGN degradation activity of AMI3CPF4969 endolysin. Representative PGN degradation curves of 2.5 (A), 1.25 (B), 0.63 (C), 0.31 (D), 0.16 (E) and 0 (F) μg / mL purified AMI3CPF4969 endolysin mixed with 54D Chlamydomonas reinhardtii extract are shown, and compared with the representative PGN degradation curve of the purified endolysin mixed with PBS (pH 7.0) buffer alone. The initial rates extracted from the PGN degradation curves are summarized in the bar graph (G); the error bars correspond to 1 standard error. The results are consistent with 3 replicates and indicate that the enhancement of the algae extract also extends to AMI3CPF4969. When endolysin diluted in buffer exhibited degradation activity close to background levels (0 μg / mL endolysin), the enhancement was dramatic, especially at reduced loading concentrations, and could be seen at endolysin concentrations of, for example, 1.25, 0.63, 0.31 and 0.16 μg / mL.

[0156] Fig.53 : 54D Chlamydomonas reinhardtii extract enhances the PGN degradation activity of GH25CPF4969 endolysin. Representative PGN degradation curves of 1.25 (A), 0.63 (B), 0.31 (C), 0.16 (D) and 0 (E) μg / mL purified GH25CPF4969 endolysin mixed with 54D Chlamydomonas reinhardtii extract are shown, and compared with the representative PGN degradation curve of the purified endolysin mixed with PBS (pH 7.0) buffer alone. The initial rates extracted from the PGN degradation curves are summarized in the bar graph (F); the error bars correspond to 1 standard error. The results are consistent with 3 replicates and show that the enhancement of the algae extract also extends to GH25CPF4969.

[0157] Fig.54 :54D algae extract to the PGN degradation activity of endolysin enhancement multiple.Algae extract enhances the PGN degradation activity of endolysin GH25CPFORC3 and AMI3CPF4969 and endolysin AMI2phiZP2 and GH25CPF4969.For GH25CPFORC3 and AMI3CPF4969 endolysin extract enhancement is significant, for GH25CPFORC3 and AMI3CPF4969 endolysin, enhancement is up to about 69 times and 44 times, respectively.For AMI33CPF4969 extract enhancement can also be said to be "infinitely" enhanced, because the endolysin diluted in buffer shows a degradation rate similar to the background at a concentration lower than 0.63μg / mL.AMI2phiZP2 and GH25CPF4969 endolysin are enhanced by algae extract up to about 2 times.

[0158] Fig.55 : Algae extract enhances the antimicrobial activity of GH25CPFORC3 and AMI2phiZP2 endolysin. (A) Plate arrangement for MIC determination of GH25CPFORC3 and AMI2phiZP2 diluted in PBS (pH 7.0) or algae extract (54D) prepared from strain crAL054 grown in the dark. (B) MIC values ​​of GH25CPFORC3 and AMI2phiZP2 in PBS (pH 7.0) buffer or 500 μg TSP / mL54D extract. The results show that the extract enhances the activity of purified GH25CPFORC3 and AMI2phiZP2 endolysin by approximately 2.5 times and 4 times, respectively, compared with when in buffer. Error bars correspond to 1 standard error.

[0159] Fig.56 : Combinations of Chlamydomonas extracts tested were performed to study synergistic effects. Combinations of 9 different Chlamydomonas strains were tested to study their synergistic effects when used in combination. Combinations 8-9 used crAL058 extracts (co-expressed GH25CPFORC3 and AMI2phiZP2 endolysins), and extracts from a second strain expressing an endolysin not expressed in crAL058. The corresponding endolysin expressed in each Chlamydomonas strain is also indicated.

[0160] Fig.57 : Exemplary checkerboard PGN assay plate layout and extract loading concentrations. Two checkerboard PGN assays were initiated in a 96-well microplate, with an exemplary sample layout for a 1× endolysin starting concentration of 500 μg / mL. The 10× column extract stock (i.e., extract 1 or 3) was diluted 6 times by 2-fold serial dilution to 78.1 μg / mL, while the 10× row extract stock (i.e., extract 2 or 4) was diluted 4 times by 2-fold serial dilution to 313 μg / mL. 10 μL / well of the corresponding dilution of extract 1 or 3 was distributed to the appropriate column, and similarly, 10 μL / well of the corresponding dilution of extract 2 or 4 was distributed to the appropriate row. 10 μL / well PBS (pH 7.0) was added to columns 6 and 12 (dilutions of extract 1 or 3 only), respectively. Similarly, 10 μL / well PBS (pH 7.0) was added to row H wells (dilutions of extract 2 or 4 only). Ensure that H6 and H12 ("PGN only" control, with 0 μg / mL endolysin) wells contain a total of 20 μL / well of PBS (pH 7.0). Start the PGN assay by dispensing 80 μL / well of PGN assay stock, effectively diluting each extract 10-fold. The amount of extract loaded in each well corresponds to the indicated row and column loading concentrations.

[0161] Fig.58: Synergistic effect of Chlamydomonas extracts crAL041 (expressing GH25CPFORC3) and crAL038 (expressing AMI2phiZP2) on PGN degradation of Clostridium perfringens strain Cp6. (A) PGN degradation curves using 500 μg TSP / mL crAL041, 500 μg TSP / mL crAL038, and 500 μg TSP / mL crAL041+500 μg TSP / mL crAL038. (B) PGN degradation curves using 250 μg TSP / mL crAL041, 250 μg TSP / mL crAL038, and 250 μg TSP / mL crAL041+250 μg TSP / mL crAL038. (C) PGN degradation curves using 125μg TSP / mL crAL041, 125μg TSP / mL crAL038, and 125μg TSP / mL crAL041+125μg TSP / mL crAL038. (D) PGN degradation curves using 62.5μg TSP / mL crAL041, 62.5μg TSP / mL crAL038, and 62.5μg TSP / mL crAL041+62.5μg TSP / mL crAL038. (E) Summary of initial PGN degradation rates. The degradation curve labels correspond to the Chlamydomonas extracts and their loading amounts. In addition, the accompanying labels in brackets describe the initial rates of the PGN degradation curves. The results show that the crAL041 and crAL038 extracts are synergistic when used in combination. The initial rates summarized in the bar graph show that the combined rate when the two extracts are used simultaneously is higher than the sum of the rates when the extracts are used alone.

[0162] Fig.59: Synergistic effect of Chlamydomonas extract crAL041 (expressing GH25CPFORC3) and crAL080 (expressing GH25CPF4969) on PGN degradation of Clostridium perfringens strain Cp6. (A) PGN degradation curves using 250μg TSP / mL crAL041, 250μg TSP / mL crAL080, and 250μg TSP / mL crAL041+250μg TSP / mL crAL080. (B) PGN degradation curves using 125μg TSP / mL crAL041, 125μg TSP / mL crAL080, and 125μg TSP / mL crAL041+125μg TSP / mL crAL080. (C) Summary of initial PGN degradation rates. Degradation curve labels correspond to Chlamydomonas extracts and their loadings. In addition, the accompanying labels in brackets describe the initial rates of the PGN degradation curves. The results showed that the crAL041 and crAL080 extracts were synergistic when used in combination. The initial rates summarized in the bar graph showed that the combined rate when the two extracts were used simultaneously was higher than the sum of the rates when the extracts were used individually.

[0163] Fig.60 : Synergistic effect of Chlamydomonas extracts crAL045 (expressing GH25CPFORC3) and crAL076 (expressing AMI3CPFORC25) on PGN degradation of Clostridium perfringens strain Cp6. (A) PGN degradation curves using 500 μg TSP / mL crAL045, 500 μg TSP / mL crAL076, and 500 μg TSP / mL crAL045+500 μg TSP / mL crAL076. (B) PGN degradation curves using 250 μg TSP / mL crAL045, 250 μg TSP / mL crAL076, and 250 μg TSP / mL crAL045+250 μg TSP / mL crAL076. (C) PGN degradation curves using 125μg TSP / mL crAL045, 125μg TSP / mL crAL076, and 125μgTSP / mL crAL045+125μg TSP / mL crAL076. (D) Summary of initial PGN degradation rates. The degradation curve labels correspond to the Chlamydomonas extracts and their loading amounts. In addition, the accompanying labels in brackets describe the initial rates of the PGN degradation curves. The results show that the crAL045 and crAL076 extracts are synergistic when used in combination. The initial rates summarized in the bar graph show that the combined rate when the two extracts are used simultaneously is higher than the sum of the rates when the extracts are used alone.

[0164] Fig.61: Synergistic effect of Chlamydomonas extracts crAL045 (expressing GH25CPFORC3) and crAL078 (expressing AMI3phi24R) on PGN degradation of Clostridium perfringens strain Cp6. (A) PGN degradation curves using 500 μg TSP / mL crAL045, 500 μg TSP / mL crAL078, and 500 μg TSP / mL crAL045+500 μg TSP / mL crAL078. (B) PGN degradation curves using 250 μg TSP / mL crAL045, 250 μg TSP / mL crAL078, and 250 μg TSP / mL crAL045+250 μg TSP / mL crAL078. (C) PGN degradation curves using 125μg TSP / mL crAL045, 125μg TSP / mL crAL078, and 125μg TSP / mL crAL045+125μg TSP / mL crAL078. (D) PGN degradation curves using 62.5μg TSP / mL crAL045, 62.5μg TSP / mL crAL078, and 62.5μg TSP / mL crAL045+62.5μg TSP / mL crAL078. (E) Summary of initial PGN degradation rates. The degradation curve labels correspond to the Chlamydomonas extracts and their loading amounts. In addition, the accompanying labels in brackets describe the initial rates of the PGN degradation curves. The results show that the crAL045 and crAL078 extracts are synergistic when used in combination. The initial rates summarized in the bar graph show that the combined rate when the two extracts are used simultaneously is higher than the sum of the rates when the extracts are used alone.

[0165] Fig.62: Synergistic effect of Chlamydomonas extracts crAL079 (expressing AMI3CPF4969) and crAL076 (expressing AMI3CPFORC25) on PGN degradation of Clostridium perfringens strain Cp6. (A) PGN degradation curves using 500 μg TSP / mL crAL079, 500 μg TSP / mL crAL076, and 500 μg TSP / mL crAL079+500 μg TSP / mL crAL076. (B) PGN degradation curves using 250 μg TSP / mL crAL079, 250 μg TSP / mL crAL076, and 250 μg TSP / mL crAL079+250 μg TSP / mL crAL076. (C) PGN degradation curves using 125μg TSP / mL crAL079, 125μg TSP / mL crAL076, and 125μg TSP / mL crAL079+125μg TSP / mL crAL076. (D) PGN degradation curves using 62.5μg TSP / mL crAL079, 62.5μg TSP / mL crAL076, and 62.5μg TSP / mL crAL079+62.5μg TSP / mL crAL076. (E) Summary of initial PGN degradation rates. The degradation curve labels correspond to Chlamydomonas extracts and their loading amounts. In addition, the accompanying labels in brackets describe the initial rates of the PGN degradation curves. The results show that the crAL079 and crAL076 extracts are synergistic when used in combination. The initial rates summarized in the bar graph show that the combined rate when the two extracts are used simultaneously is higher than the sum of the rates when the extracts are used alone.

[0166] Fig.63: Synergistic effect of Chlamydomonas extracts crAL076 (expressing AMI3CPFORC25) and crAL038 (expressing AMI2phiZP2) on PGN degradation of Clostridium perfringens strain Cp6. (A) PGN degradation curves using 500 μg TSP / mL crAL076, 500 μg TSP / mL crAL038, and 500 μg TSP / mL crAL076+500 μg TSP / mL crAL038. (B) PGN degradation curves using 250 μg TSP / mL crAL076, 250 μg TSP / mL crAL038, and 250 μg TSP / mL crAL076+250 μg TSP / mL crAL038. (C) PGN degradation curves using 125μg TSP / mL crAL076, 125μg TSP / mL crAL038, and 125μgTSP / mL crAL076+125μg TSP / mL crAL038. (D) Summary of initial PGN degradation rates. Degradation curve labels correspond to Chlamydomonas extracts and their loading amounts. In addition, the accompanying labels in brackets describe the initial rates of the PGN degradation curves. The results show that crAL076 and crAL038 extracts are synergistic when used in combination. The initial rates summarized in the bar graph show that the combined rate when the two extracts are used simultaneously is higher than the sum of the rates when the extracts are used alone.

[0167] Fig.64: Synergistic effect of Chlamydomonas extracts crAL080 (expressing GH25CPF4969) and crAL076 (expressing AMI3CPFORC25) on PGN degradation of Clostridium perfringens strain Cp6. (A) PGN degradation curves using 500 μg TSP / mL crAL080, 500 μg TSP / mL crAL076, and 500 μg TSP / mL crAL080+500 μg TSP / mL crAL076. (B) PGN degradation curves using 500 μg TSP / mL crAL080, 250 μg TSP / mL crAL076, and 500 μg TSP / mL crAL080+250 μg TSP / mL crAL076. (C) PGN degradation curves using 250μg TSP / mL crAL080, 500μg TSP / mL crAL076, and 250μgTSP / mL crAL080+500μg TSP / mL crAL076. (D) PGN degradation curves using 250μg TSP / mL crAL080, 250μg TSP / mL crAL076, and 250μg TSP / mL crAL080+250μg TSP / mL crAL076. (E) Summary of initial PGN degradation rates. The degradation curve labels correspond to the Chlamydomonas extracts and their loading amounts. In addition, the accompanying labels in brackets describe the initial rates of the PGN degradation curves. The results show that the crAL080 and crAL076 extracts are synergistic when used in combination. The initial rates summarized in the bar graph show that the combined rate when the two extracts are used simultaneously is higher than the sum of the rates when the extracts are used alone.

[0168] Fig.65: Synergistic effect of Chlamydomonas extracts crAL058 (expressing GH25CPFORC3 and AMIphiZP2) and crAL080 (expressing GH25CPF4969) on PGN degradation of Clostridium perfringens strain Cp6. (A) PGN degradation curves using 500 μg TSP / mL crAL058, 500 μg TSP / mL crAL080, and 500 μg TSP / mL crAL058+500 μg TSP / mL crAL080. (B) PGN degradation curves using 250 μg TSP / mL crAL058, 250 μg TSP / mL crAL080, and 250 μg TSP / mL crAL058+250 μg TSP / mL crAL080. (C) PGN degradation curves using 125μg TSP / mL crAL058, 125μg TSP / mL crAL080, and 125μg TSP / mL crAL058+125μg TSP / mL crAL080. (D) Summary of initial PGN degradation rates. The degradation curve labels correspond to the Chlamydomonas extracts and their loading amounts. In addition, the accompanying labels in brackets describe the initial rates of the PGN degradation curves. The results show that the crAL058 and crAL080 extracts are synergistic when used in combination. The initial rates summarized in the bar graph indicate that the combined rate when the two extracts are used simultaneously is higher than the sum of the rates when the extracts are used alone. The presence of a synergistic effect between crAL058 and crAL080 indicates that the three endolysins GH25CPFORC3, AMI2phiZP2, and GH25CPF4969 are also synergistic when used in combination.

[0169] Fig.66: Synergistic effect of Chlamydomonas extract crAL058 (expressing GH25CPFORC3 and AMIphiZP2) and crAL076 (expressing AMI3CPFORC25) on PGN degradation of Clostridium perfringens strain Cp6. (A) PGN degradation curves using 500μg TSP / mL crAL058, 500μg TSP / mL crAL076, and 500μg TSP / mL crAL058+500μg TSP / mL crAL076. (B) PGN degradation curves using 250μg TSP / mL crAL058, 250μg TSP / mL crAL076, and 250μg TSP / mL crAL058+250μg TSP / mL crAL076. (C) Summary of initial PGN degradation rates. Degradation curve labels correspond to Chlamydomonas extracts and their loadings. In addition, the accompanying labels in brackets describe the initial rates of the PGN degradation curves. The results showed that the crAL058 and crAL076 extracts were synergistic when used in combination. The initial rates summarized in the bar graph showed that the combined rate when the two extracts were used together was higher than the sum of the rates when the extracts were used alone. The synergistic effect between crAL058 and crAL076 also showed that the three endolysins GH25CPFORC3, AMI2phiZP2, and AMI3CPFORC25 were synergistic when used in combination.

[0170] Fig.67 : 96 microwell checkerboard setup and extract loading concentrations. Checkerboard MIC assays were repeated with modified extract loading concentrations and conditions. Similarly, 20× concentrated stocks of each extract were prepared and serially diluted 2-fold. The crAL045 extract was serially diluted to ˜7.3 μg TSP / mL, while the crAL039 extract was serially diluted to ˜104.7 μg TSP / mL. 5 μL / well of the corresponding crAL045 stock extract was dispensed into the appropriate columns, and similarly, 5 μL / well of the corresponding crAL039 stock extract was dispensed into the appropriate rows. ～ 10 4 The MIC assay was initiated by dispensing C. perfringens strain Cp6 in BHI+C medium at 10 cells / mL into a microplate and effectively diluting each extract 20-fold. The H row and column 12 wells contained only the crAL045 and crAL039 extracts at the 2-fold serial dilution loading concentrations, respectively. The H12 wells were control growth wells with no added extracts. The crAL045 and crAL039 extract loadings in each well corresponded to the indicated row and column loading concentrations.

[0171] Fig.68: Calculation of fractional inhibitory concentration index value. The fractional inhibitory concentration (FIC) index calculation is used to determine the synergistic effect between antimicrobial agents. A synergistic combination refers to a combination where the FIC value ≤ 0.5. An additive effect is defined as 0.5 < FIC ≤ 4, while an antagonistic effect occurs when FIC > 4.

[0172] Fig.69 : Synergistic effect of endolysin extracts crAL045 and crAL039 expressed in Chlamydomonas (checkerboard MIC assay). Incubation of extracts of crAL045 and crAL039 at different loading concentrations with ~10 4 CFU / mL of Clostridium perfringens strain Cp6 overnight confirmed that they were synergistic in inhibiting the growth of C. perfringens cells (A). Well values greater than 0.10 OD620nm corresponded to cell growth in the growth control well (H12) with 0.29 OD620nm. Wells with inhibition were evaluated by OD620nm readings and visually. Various levels of partial inhibition were also observed. The MIC assay for the crAL045 extract alone was 23.4 μg TSP / mL (H5, *), while the MIC assay for the crAL039 extract alone was 167.5 μg TSP / mL (B12, **). At the combined loading of 5.9 μg TSP / mL crAL045 extract and 41.9 μg TSP / mL crAL039 extract (D7, ***), the combination was calculated to be synergistic, with a fractional inhibitory concentration of 0.5 (calculation: 5.9 / 23.4 + 41.9 / 167.5 = 0.5). (B) The summary bar graph shows that the amount of each extract, crAL045 and crAL039, required to inhibit Cp6 cell growth decreased significantly compared to when each extract was used alone. Detailed implementation

[0173] Endolysin polypeptides, fragments and variants thereof

[0174] The inventors have identified novel bacteriophage-encoded endolysin polypeptides that can be used as antimicrobial agents ("endolysins"). The present invention includes specific endolysins having the amino acid sequences shown in the SEQ ID NOs disclosed herein, each of which is identified herein as a polypeptide of the present invention. These endolysins have remarkable and advantageous functional antimicrobial properties. These endolysins have antimicrobial activity. These endolysins have antibacterial activity against Clostridium perfringens species. Clostridium perfringens may also be referred to as "Clostridium perfringens (C. perfringens)" or "Cp". These endolysins can have antibacterial activity against type A species and strains of C. perfringens.

[0175] In addition, the present invention also includes variants of specific endolysins having an amino acid sequence as shown in SEQ ID NO disclosed herein and identified as polypeptides of the present invention herein. A "variant" can be a fragment / truncate, mutant or derivative of a specific endolysin having an amino acid sequence as shown in SEQ ID NO disclosed herein and identified as polypeptides of the present invention herein. For example, a variant can be different from a specific endolysin having an amino acid sequence as shown in SEQ ID NO disclosed herein by one or more amino acid substitutions. Therefore, the amino acid sequence of an endolysin variant can be related to the amino acid sequence of a specific SEQ ID NO by reference to the percent identity, as defined in more detail herein. In all cases, the variant endolysin also has antimicrobial activity. All variant endolysins have antibacterial activity, especially antibacterial activity against species of Clostridium perfringens. Variant endolysins can have antibacterial activity against type A species and strains of Clostridium perfringens. Variant endolysins that do not have the above-mentioned antimicrobial and antibacterial activities are not within the scope of the present invention.

[0176] As described herein, a "fragment" of an endolysin polypeptide or a "fragment" of a domain of an endolysin polypeptide is any polypeptide having an amino acid sequence shorter than a full-length endolysin polypeptide or a full-length domain of an endolysin polypeptide. Endolysins are well-characterized enzymes, and sequence features defining full-length endolysin polypeptides or full-length domains of endolysin polypeptides can be easily delineated by a person skilled in the art, such as by sequence alignment and analysis. Thus, such "fragments" can be easily delineated by a person skilled in the art.

[0177] The specific endolysin having an amino acid sequence as shown in the SEQ ID NO disclosed herein and identified herein as a polypeptide of the invention, as well as all variant endolysins, may be collectively referred to herein as an "endolysin" and / or an "endolysin of the invention" and / or an "endolysin polypeptide" and / or an "endolysin polypeptide of the invention".

[0178] Reference will be made herein to an "isolated" endolysin polypeptide or fragment thereof. This is merely to distinguish the endolysin polypeptide or fragment thereof of the present invention from the endolysin polypeptide or fragment thereof present in nature. In the context of the present invention, the term "isolated" may be used when referring to such an endolysin polypeptide or fragment of the present invention when expressed in a host cell from a nucleic acid and / or from an expression vector or when present in a lysate derived from such a host cell and a composition derived from such a host cell and lysate, etc. It should be understood that in this case, the term "isolated" should not be interpreted literally, but rather used synonymously with terms such as "recombinant" and "exogenous", meaning that the endolysin polypeptide or fragment thereof of the present invention has been artificially introduced into a cell, lysate, composition, etc. by humans.

[0179] Endolysin polypeptides of the invention - general structural features

[0180] The endolysin of the present invention has an N-terminal Clostridium perfringens cell wall peptidoglycan catalytic domain, also referred to herein as the N-terminal catalytic domain. The endolysin of the present invention may have one or more N-terminal Clostridium perfringens cell wall peptidoglycan catalytic domains.

[0181] The endolysins of the invention may additionally have one or more C-terminal Clostridium perfringens cell wall binding domains, also referred to herein as C-terminal binding domains.

[0182] The endolysin of the present invention may additionally have one or more linkers connecting the N-terminal catalytic domain and the C-terminal binding domain, and / or one or more linkers connecting multiple C-terminal binding domains (if present), and / or one or more linkers connecting multiple N-terminal catalytic domains (if present).

[0183] N-terminal catalytic domain

[0184] The N-terminal catalytic domain of the endolysin of the invention as described herein is the catalytic domain responsible for cleaving the peptidoglycan layer of the bacterial cell wall. Therefore, the catalytic domain has an impact on the specificity of the endolysin for its target species, genus or strain.

[0185] The N-terminal catalytic domain can have N-acetyl-β-D-glucosaminidase activity, N-acetyl-β-D-muramic acid enzyme activity, N-acetylmuramyl-L-alanine amidase activity and / or endopeptidase activity.

[0186] C-terminal binding domain

[0187] The C-terminal cell wall binding domain of the endolysin of the present invention as described herein includes a bacterial cell wall binding domain. Therefore, the C-terminal cell wall binding domain is also responsible for the specificity of the endolysin to its target species, genus or strain. This domain is non-covalently bound to the cell envelope, which can be part of a peptidoglycan or other cell wall-related molecule.

[0188] In some polypeptides, an endolysin may contain only an N-terminal catalytic domain and still be highly specific to its target bacterial species. A C-terminal binding domain may enhance the specificity of an endolysin, but it may not be necessary. An endolysin of the present invention may also have more than one C-terminal binding domain in the sequence, such as having two C-terminal binding domains in the sequence. It is speculated that the binding of the C-terminal binding domain to the cell wall inside the cell serves to prevent the endolysin from lysing other bacteria that the Clostridium perfringens phage is to be infected with. Therefore, the presence of a C-terminal binding domain may be an evolutionary feature that ensures the survival of phage progeny.

[0189] Connectors

[0190] In certain polypeptides, the endolysins of the invention may comprise one or more linkers connecting the N-terminal and C-terminal domains, and / or one or more linkers connecting multiple C-terminal binding domains (if present), and / or one or more linkers connecting multiple N-terminal catalytic domains (if present).

[0191] The linker connecting the domains is preferably a flexible linker region.

[0192] Any suitable linker can be used to connect the domains. The linker can be a naturally occurring linker, such as an endolysin linker defined by the SEQ ID NO herein, or can be an artificial linker. Examples of linkers that can be used are described in Chen et al. Adv Drug Deliv Rev. 2013 Oct 15; 65(10): 1357–1369 and Chichili et al. Protein Sci. 2013 Feb; 22(2): 153–167.

[0193] The joints can be linear joints or branched joints.

[0194] The joint may comprise a hydrocarbon chain. The hydrocarbon chain may comprise 2 to about 2000 or more carbon atoms. The hydrocarbon chain may comprise an alkylene group, such as C2 to about 2000 or more alkylene groups. The hydrocarbon chain may have the general formula of -(CH2)n-, wherein n is 2 to about 2000 or more. The hydrocarbon chain may optionally be interrupted by one or more ester groups (i.e. -C(O)-O-) or one or more amide groups (i.e. -C(O)-N(H)-).

[0195] Any linker selected from the group comprising PEG, polyacrylamide, poly(2-hydroxyethyl methacrylate), poly-2-methyl-2-oxazoline (PMOXA), zwitterionic polymers (e.g., poly(carboxybetaine methacrylate) (PCBMA), poly[N-(3-sulfopropyl)-N-methacryloyloxyethyl-N,N-dimethylammonium betaine] (PSBMA)), glycopolymers, and polypeptides can be used.

[0196] The linker may comprise polyethylene glycol (PEG) having the general formula: -(CH2-CH2-O)n-, wherein n is 1 to about 600 or more.

[0197] The linker may comprise an oligoethylene glycol-phosphate unit having the general formula: -[(CH2-CH2-O)n-PO2--O]m-, wherein n is 1 to about 600 or more, and m may be 1-200 or more.

[0198] Changes in domain / linker conformation

[0199] As disclosed herein, a "full length" Clostridium perfringens bacteriophage endolysin polypeptide as set forth in any one of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7 or 8 has an N-terminal Clostridium perfringens cell wall peptidoglycan catalytic domain, as described and defined herein.

[0200] These sequences may additionally comprise a C-terminal Clostridium perfringens cell wall binding domain, and / or they may also comprise more than one C-terminal Clostridium perfringens cell wall binding domain, as described and defined herein. In addition, they may also comprise one or more linker sequences as described and defined herein.

[0201] Any amino acid sequence connecting the N-terminal Clostridium perfringens cell wall peptidoglycan catalytic domain defined herein and the C-terminal Clostridium perfringens cell wall binding domain defined herein can be defined as a linker sequence herein.

[0202] Any amino acid sequence that connects one C-terminal Clostridium perfringens cell wall binding domain as defined herein to another C-terminal Clostridium perfringens cell wall binding domain as defined herein may be defined as a linker sequence herein.

[0203] In any endolysin polypeptide of the invention comprising an N-terminal Clostridium perfringens cell wall peptidoglycan catalytic domain or a fragment thereof as defined herein and one or more C-terminal Clostridium perfringens cell wall binding domains or fragments thereof as defined herein, and optionally one or more linker sequences or fragments thereof as defined herein, the N-terminal catalytic domain or fragment thereof, the C-terminal binding domain or fragment thereof (if present) and the linker or fragment thereof (if present) may be configured in any order.

[0204] Thus, for example, a Clostridium perfringens cell wall peptidoglycan catalytic domain (or a fragment or variant thereof) that is located at the N-terminus of the polypeptide in a naturally occurring endolysin polypeptide may instead be located at the C-terminus of a polypeptide of the invention.

[0205] Similarly, a Clostridium perfringens cell wall binding domain (or a fragment or variant thereof) that in a naturally occurring endolysin polypeptide is located at the C-terminus of the polypeptide may instead be located at the N-terminus of a polypeptide of the present invention.

[0206] Any one or more linker sequences or fragments thereof in any order can connect any two or more N-terminal domain sequences or fragments thereof in any order and any two or more C-terminal domain sequences or fragments thereof in any order, or any N-terminal domain sequence or fragment thereof and any C-terminal domain sequence or fragment thereof in any order.

[0207] Endolysin polypeptides of the present invention - structural features

[0208] Endolysin polypeptide containing an N-terminal catalytic domain

[0209] As described above, the endolysin of the present invention has an N-terminal Clostridium perfringens cell wall peptidoglycan catalytic domain (also referred to herein as the N-terminal catalytic domain) or a fragment thereof. Therefore, the endolysin of the present invention can be an isolated endolysin polypeptide having antimicrobial activity, and wherein the isolated polypeptide comprises or consists of the following amino acid sequence: the amino acid sequence is an N-terminal Clostridium perfringens cell wall peptidoglycan catalytic domain polypeptide, and is at least 80% identical to the amino acid sequence of the N-terminal cell wall peptidoglycan catalytic domain of the Clostridium perfringens bacteriophage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7 or 8; or the amino acid sequence is a fragment of the N-terminal catalytic domain polypeptide, and is at least 80% identical to the amino acid sequence of the amino acid sequence corresponding to the fragment of the sequence shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7 or 8.

[0210] The isolated endolysin polypeptide may comprise or consist of an amino acid sequence that is an N-terminal Clostridium perfringens cell wall peptidoglycan catalytic domain and is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of the Clostridium perfringens bacteriophage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7 or 8. In the case of a fragment of the amino acid sequence, the endolysin polypeptide may comprise or consist of an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of the sequence shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7 or 8 corresponding to the amino acid sequence of the fragment.

[0211] The N-terminal Clostridium perfringens cell wall peptidoglycan catalytic domain of the endolysin polypeptide defined according to the amino acid sequence shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7 or 8 is represented by the amino acid sequence shown in SEQ ID NO: 12, 13, 14, 15, 16, 17, 19 and 20, respectively. In addition, the N-terminal Clostridium perfringens cell wall peptidoglycan catalytic domain of the endolysin polypeptide defined according to the amino acid sequence shown in SEQ ID NO: 6 can be represented by the amino acid sequence shown in SEQ ID NO: 18.

[0212] Any endolysin polypeptide defined above may have any antimicrobial activity as defined herein.

[0213] Endolysin polypeptide comprising an N-terminal catalytic domain and a C-terminal binding domain

[0214] As described above, the endolysins of the present invention have an N-terminal Clostridium perfringens cell wall peptidoglycan catalytic domain and may additionally have one or more C-terminal Clostridium perfringens cell wall binding domains.

[0215] The endolysin of the present invention may have a "full-length" N-terminal Clostridium perfringens cell wall peptidoglycan catalytic domain of the Clostridium perfringens phage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7 or 8, or a fragment thereof, in combination with a "full-length" C-terminal Clostridium perfringens cell wall binding domain of the Clostridium perfringens phage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8, or a fragment thereof, and optionally, in combination with a "full-length" linker of the Clostridium perfringens phage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8, or optionally with a linker fragment.

[0216] The C-terminal Clostridium perfringens cell wall binding domain of the endolysin polypeptide defined according to the amino acid sequence shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8 is represented by the amino acid sequence shown in SEQ ID NO: 33, 36, 37, 38, 41 and 43, respectively.

[0217] In addition, the C-terminal Clostridium perfringens cell wall binding domain of the endolysin polypeptide defined according to the amino acid sequence shown in SEQ ID NO: 1 can be represented by the amino acid sequence shown in SEQ ID NO: 34. In addition, the C-terminal Clostridium perfringens cell wall binding domain of the endolysin polypeptide defined according to the amino acid sequence shown in SEQ ID NO: 1 can be represented by two C-terminal Clostridium perfringens cell wall binding domains as defined by the amino acid sequence shown in SEQ ID NO: 35.

[0218] In addition, the C-terminal Clostridium perfringens cell wall binding domain of the endolysin polypeptide defined according to the amino acid sequence shown in SEQ ID NO: 5 can be represented by the amino acid sequence shown in SEQ ID NO: 39. In addition, the C-terminal Clostridium perfringens cell wall binding domain of the endolysin polypeptide defined according to the amino acid sequence shown in SEQ ID NO: 1 can be represented by two C-terminal Clostridium perfringens cell wall binding domains as defined by the amino acid sequence shown in SEQ ID NO: 40.

[0219] Furthermore, the C-terminal Clostridium perfringens cell wall binding domain of the endolysin polypeptide defined according to the amino acid sequence shown in SEQ ID NO:6 can be represented by the amino acid sequence shown in SEQ ID NO:42.

[0220] The linker sequence of the endolysin polypeptide defined by the amino acid sequence shown in SEQ ID NO: 1 can be composed of

[0221] The linker sequence of the endolysin polypeptide defined according to the amino acid sequence shown in SEQ ID NO: 24 or 25 can be represented by the amino acid sequence shown in SEQ ID NO: 2 and 3. The linker sequence of the endolysin polypeptide defined according to the amino acid sequence shown in SEQ ID NO: 26 and 27 can be represented by the amino acid sequence shown in SEQ ID NO: 28 or 29. The linker sequence of the endolysin polypeptide defined according to the amino acid sequence shown in SEQ ID NO: 6 and 8 can be represented by the amino acid sequence shown in SEQ ID NO: 30 and 31, respectively.

[0222] In the present disclosure, each N-terminal Clostridium perfringens cell wall peptidoglycan catalytic domain, each C-terminal Clostridium perfringens cell wall binding domain (if any) and each linker (if any) disclosed in any polypeptide shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7 or 8 is defined according to homology search using Pfam software. In addition, any N-terminal Clostridium perfringens cell wall peptidoglycan catalytic domain, any C-terminal Clostridium perfringens cell wall binding domain (if any) and any linker (if any) disclosed in any polypeptide shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7 or 8 can alternatively be defined according to homology search using HHpred software, InterProScan software or Structural Classification of Proteins (SCOP) database.

[0223] Therefore, the endolysin of the present invention may be an isolated endolysin polypeptide having antimicrobial activity as defined above, further wherein the isolated polypeptide comprises: an N-terminal Clostridium perfringens cell wall peptidoglycan catalytic domain polypeptide or a fragment thereof, a C-terminal Clostridium perfringens cell wall binding domain polypeptide or a fragment thereof, and optionally a linker polypeptide or a fragment thereof connecting the N-terminal domain and the C-terminal domain; wherein the isolated polypeptide comprises:

[0224] d) an amino acid sequence that is at least 80% identical to the amino acid sequence of the N-terminal cell wall peptidoglycan catalytic domain of the Clostridium perfringens bacteriophage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7 or 8, or an amino acid sequence that is a fragment of the N-terminal catalytic domain polypeptide and is at least 80% identical to the amino acid sequence of the amino acid sequence corresponding to the fragment of the sequence shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7 or 8; and

[0225] e) an amino acid sequence that is at least 80% identical to an endolysin C-terminal Clostridium perfringens cell wall binding domain polypeptide or a fragment of said polypeptide; or an amino acid sequence that is at least 80% identical to the amino acid sequence of the C-terminal cell wall binding domain of the Clostridium perfringens bacteriophage endolysin polypeptide as shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8, or an amino acid sequence that is a fragment of said C-terminal binding domain polypeptide and is at least 80% identical to the amino acid sequence of the amino acid sequence corresponding to the fragment as shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8; and

[0226] f) an optional amino acid sequence that is at least 80% identical to the linker of an endolysin polypeptide or a fragment of the polypeptide; or an optional amino acid sequence that is at least 80% identical to the amino acid sequence of the linker of the Clostridium perfringens phage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8, or an amino acid sequence that is a fragment of the linker and is at least 80% identical to the amino acid sequence of the amino acid sequence corresponding to the fragment of the sequence shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8.

[0227] The endolysin of the present invention may be an isolated endolysin polypeptide having antimicrobial activity as defined above, wherein the isolated polypeptide comprises: an N-terminal Clostridium perfringens cell wall peptidoglycan catalytic domain polypeptide or a fragment thereof, a C-terminal Clostridium perfringens cell wall binding domain polypeptide or a fragment thereof, and a linker polypeptide or a fragment thereof connecting the N-terminal domain and the C-terminal domain; wherein the isolated polypeptide comprises:

[0228] d) an amino acid sequence that is at least 80% identical to the amino acid sequence of the N-terminal cell wall peptidoglycan catalytic domain of the Clostridium perfringens bacteriophage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7 or 8, or an amino acid sequence that is a fragment of the N-terminal catalytic domain polypeptide and is at least 80% identical to the amino acid sequence of the amino acid sequence corresponding to the fragment of the sequence shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7 or 8; and

[0229] e) an amino acid sequence that is at least 80% identical to the amino acid sequence of the C-terminal Clostridium perfringens cell wall binding domain of the Clostridium perfringens phage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8, or an amino acid sequence that is a fragment of said C-terminal binding domain polypeptide and is at least 80% identical to the amino acid sequence of the amino acid sequence corresponding to the fragment of the sequence shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8; and

[0230] f) an amino acid sequence that is at least 80% identical to the amino acid sequence of the linker of the Clostridium perfringens phage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8, or an amino acid sequence that is a fragment of the linker and is at least 80% identical to the amino acid sequence of the amino acid sequence corresponding to the fragment shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8.

[0231] The endolysin of the present invention may be an isolated endolysin polypeptide having antimicrobial activity as defined above, wherein the isolated polypeptide comprises: an amino acid sequence, wherein the N-terminal catalytic domain, the C-terminal cell wall binding domain and the linker are at least 80% identical to the corresponding amino acid sequences of the N-terminal domain, the C-terminal domain and the linker of the Clostridium perfringens phage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7 or 8, respectively.

[0232] The endolysin of the present invention may be an isolated endolysin polypeptide having antimicrobial activity as defined above, wherein the isolated polypeptide comprises:

[0233] d) an amino acid sequence consisting of a fragment of the N-terminal catalytic domain and being at least 80% identical to the amino acid sequence of the sequence shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7 or 8 corresponding to the amino acid sequence of the fragment; and / or

[0234] e) an amino acid sequence consisting of a fragment of the C-terminal binding domain and being at least 80% identical to the amino acid sequence of the sequence shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8 corresponding to the amino acid sequence of the fragment; and / or

[0235] f) an amino acid sequence consisting of a fragment of said linker and being at least 80% identical to the amino acid sequence of the sequence shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8 corresponding to the amino acid sequence of the fragment.

[0236] In any of the above-mentioned endolysin polypeptides of the present invention having an N-terminal amino acid sequence of a Clostridium perfringens cell wall peptidoglycan catalytic domain or a fragment thereof and a C-terminal Clostridium perfringens cell wall binding domain or an amino acid sequence of a fragment thereof, and an optional linker or an amino acid sequence of a fragment thereof, the percent identity with the reference sequence may be higher than 80%.

[0237] Thus, in any such isolated endolysin polypeptide, the endolysin polypeptide may comprise or consist of an amino acid sequence that is an N-terminal Clostridium perfringens cell wall peptidoglycan catalytic domain and is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of the Clostridium perfringens bacteriophage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7 or 8. In the case where the amino acid sequence is a fragment of the amino acid sequence, the endolysin polypeptide may comprise or consist of an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of the amino acid sequence corresponding to the fragment of the sequence shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7 or 8. In any such isolated endolysin polypeptide, the endolysin polypeptide may comprise or consist of an amino acid sequence that is a C-terminal Clostridium perfringens cell wall binding domain and is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of a known endolysin C-terminal Clostridium perfringens cell wall binding domain polypeptide. In the case of a fragment of the amino acid sequence, the endolysin polypeptide may comprise or consist of an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of the known endolysin C-terminal Clostridium perfringens cell wall binding domain polypeptide corresponding to the amino acid sequence of the fragment. Alternatively, in any such isolated endolysin polypeptide, the endolysin polypeptide may comprise or consist of an amino acid sequence that is a C-terminal Clostridium perfringens cell wall binding domain and is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of the Clostridium perfringens bacteriophage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8. In the case of a fragment of the amino acid sequence, the endolysin polypeptide may comprise or consist of an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of the sequence shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8 corresponding to the amino acid sequence of the fragment.In any such isolated endolysin polypeptide, the endolysin polypeptide may optionally comprise or consist of an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of a linker of a known endolysin polypeptide. In the case of a fragment of the amino acid sequence, the endolysin polypeptide may comprise or consist of an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of a linker of a known endolysin polypeptide corresponding to the amino acid sequence of the fragment. Alternatively, in any such isolated endolysin polypeptide, the endolysin polypeptide may comprise or consist of an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of the linker of the Clostridium perfringens bacteriophage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8. In the case of a fragment of the amino acid sequence, the endolysin polypeptide may comprise or consist of an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of the sequence shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8 corresponding to the amino acid sequence of the fragment.

[0238] Any endolysin polypeptide defined above may have any antimicrobial activity as defined herein.

[0239] The endolysin of the present invention may be an isolated endolysin polypeptide having antimicrobial activity as defined above, wherein

[0240] The peptide contains:

[0241] c) an amino acid sequence comprising all of the N-terminal domain, C-terminal domain, and linker of a Clostridium perfringens phage endolysin polypeptide as shown in SEQ ID NO: 1, 2, 3, 6, or 8, and wherein the amino acid sequence is 100% identical to the sequence of the N-terminal domain, C-terminal domain, and linker of a Clostridium perfringens phage endolysin polypeptide as shown in SEQ ID NO: 1, 2, 3, 5, 6, or 8; or

[0242] d) an amino acid sequence of a fragment comprising all of the N-terminal domain, C-terminal domain and linker of the Clostridium perfringens phage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8, and wherein the amino acid sequence of each fragment is 100% identical to the sequence of the Clostridium perfringens phage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8 corresponding to the amino acid sequence of the fragment.

[0243] The endolysin of the present invention may be an isolated endolysin polypeptide having antimicrobial activity as defined above, wherein the polypeptide comprises an amino acid sequence that is 100% identical to the amino acid sequence of the Clostridium perfringens phage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7 or 8.

[0244] Endolysin polypeptides comprising one or more fragments and variants

[0245] Any of the above fragments may be truncated relative to the full-length amino acid sequence shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7 or 8 or relative to the domains / linkers defined in the amino acid sequence shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7 or 8, provided that any such fragment has any antimicrobial activity as defined herein. Such fragments may be truncated at any number of amino acids at the N-terminus and / or C-terminus of the polypeptide.

[0246] The endolysin polypeptide according to the present invention can be derived from any one of the Clostridium perfringens phage endolysin polypeptides shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7 or 8 by replacing, inserting, deleting or adding any number of amino acids (such as 1 or more, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 20 or more, 25 or more, 30 or more, 35 or more, 40 or more, 45 or more or 50 or more amino acids) at any position, provided that any such fragment has any antimicrobial activity defined herein. More than one or all of the amino acid substitutions may be conservative amino acid substitutions.

[0247] An endolysin polypeptide according to the invention may be derived from one of the sequences as identified herein by the addition of one or more additional N-terminal or C-terminal amino acids or chemical moieties to increase stability, solubility and activity.

[0248] Endolysin polypeptides according to the invention may have a length of at least 100 or more, 150 or more, 200 or more, 250 or more, 300 or more, 350 or more, 400 or more, 450 or more, 500 or more, 550 or more, 600 or more, 650 or more, 700 or more, 750 or more, 800 or more, 850 or more, 900 or more, 950 or more, 1000 or more, 1100 or more, 1200 or more, 1300 or more, 1400 or more, 1500 or more, or 2000 or more amino acids.

[0249] The variant endolysin polypeptide may be any non-naturally occurring or genetically engineered form of an endolysin polypeptide according to the invention, including any fragment or derivative thereof, provided that any such variant has any antimicrobial activity as defined herein. The endolysin polypeptide variant may differ from any polypeptide disclosed herein with reference to a SEQ ID NO in some engineered manner. For example, a variant endolysin polypeptide according to the invention may be prepared by site-directed mutagenesis starting from a nucleotide sequence encoding a polypeptide defined by any one of the SEQ ID NOs disclosed herein.

[0250] Fragments of variant endolysin polypeptides according to the present invention can be defined according to the percentage of identity relative to a reference amino acid sequence or a reference polynucleotide sequence. For example, fragments of variant endolysin polypeptides according to the present invention can be defined according to the percentage of identity relative to the sequence shown in any one of SEQ ID NO: 1 to 8 as a reference amino acid sequence or a subsequence shown in any one of SEQ ID NO: 1 to 8 as a reference amino acid sequence (such as the sequence of any domain or linker defined therein or a sequence portion of such a domain or linker) of an endolysin polypeptide defined by the amino acid sequence.

[0251] Any suitable algorithm can be used to calculate amino acid identity. For example, PILEUP and BLAST algorithms can be used to calculate identity or align sequences (e.g., identify equivalent or corresponding sequences (usually under their default settings), for example, as described in Altschul SF, 1993, J Mol Evol 36:290-300; Altschul, S, F et al., 1990, J Mol Biol 215:403-10. Software for implementing BLAST analysis can be obtained from the National Center for Biotechnology Information (NCBI). Information) is publicly available (http: / / www.ncbi.nlm.nih.gov / ). This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence that match or satisfy a certain positive threshold score T when aligned with a word of the same length in the database sequence. T is called the neighborhood word score threshold (Altschul et al., supra). These initial neighborhood word hits are used to initiate searches to find seeds containing their HSPs. The word hits are extended in both directions along each sequence as far as the cumulative alignment score can be increased. The expansion of the word hits in each direction will stop when: the cumulative alignment score drops by an amount X from its maximum achieved value; the cumulative score becomes zero or lower due to the accumulation of one or more negatively scored residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLAST program uses a word length (W) of 11 and a BLOSUM62 scoring matrix by default (see Henikoff and Henikoff, 1992, Proc. Natl. Acad. Sci. USA 89:10915-10919) Alignment (B) 50, expectation (E) 10, M=5, N=4, and comparison of the two chains.

[0252] The BLAST algorithm performs a statistical analysis of the similarity between two sequences; see, for example, Karlin and Altschul, 1993, Proc. Natl. Acad. Sci. USA 90: 5873-5787. A similarity metric provided by the BLAST algorithm is the minimum sum probability (P (N)), which provides an indication of the probability of a match occurring accidentally between two polynucleotide or amino acid sequences. For example, if the minimum sum probability of the comparison of the first sequence to the second sequence is less than about 1, preferably less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001, then a sequence is considered to be similar to another sequence. Alternatively, the UWGCG package provides the BESTFIT program (e.g., for its default settings) that can be used to calculate identity (Devereux et al., 1984 Nucleic Acids Research 12, 387-395).

[0253] As described herein, the amino acid sequence of the polypeptide of the present invention may comprise the amino acid sequence of all or part of the reference sequence defined by SEQ ID NO, wherein modifications such as amino acid addition, deletion or substitution are performed relative to the reference sequence or a portion thereof. The modification may be a conservative or non-conservative amino acid substitution. In the case of multiple modifications in a single polypeptide, the modification in the polypeptide sequence may be a combination of conservative and non-conservative amino acid substitutions. Conservative substitutions replace amino acids with other amino acids of similar chemical structure, similar chemical properties or similar side chain volumes. The introduced amino acids may have similar polarity, hydrophilicity, hydrophobicity, alkalinity, acidity, neutrality or charge to the amino acids they replace. Alternatively, conservative substitutions may introduce another aromatic or aliphatic amino acid to replace a pre-existing aromatic or aliphatic amino acid. Conservative amino acid changes are well known in the art and may be selected according to the characteristics of the 20 main amino acids defined in the following table.

[0254] Table - Chemical properties of amino acids

[0255]

[0256] In the case of amino acids of similar polarity, this can be determined by reference to the hydrophilicity ranking of the amino acid side chains in the table below.

[0257] Table - Hydrophilicity Grade

[0258]

[0259]

[0260] One skilled in the art can determine whether any fragment or variant endolysin has antimicrobial activity by performing a functional test for antimicrobial activity as further described herein.

[0261] Endolysin polypeptides of the invention - functional characteristics

[0262] The endolysins of the invention may provide an antimicrobial effect that can be defined by lytic activity. Turbidity reduction assays, t50% lysis values ​​(the time required for the endolysin to lyse 50% of its initial cell population) and / or cell viability assays (log plotted against the ratio of control to increasing endolysin concentrations or endolysin-treated cell responses) may be used. 10 The lytic activity was measured by using the minimum bactericidal concentration (MBC) to calculate the percentage reduction of viable bacteria for each endolysin. The lytic activity can be defined by the minimum bactericidal concentration (MBC).

[0263] The endolysins of the present invention can provide an antimicrobial effect that can be defined by bacteriostatic activity or growth inhibitory activity. Bacteriostatic activity or growth inhibitory activity can be defined by the minimum inhibitory concentration (MIC).

[0264] Endolysins of the present invention can provide an antimicrobial effect against Clostridium perfringens bacteria that is higher than the effect observed for the relevant control bacteria. The relevant control can be any bacterial strain of non-Clostridium perfringens (referred to herein as "non-Cp" strains). Non-Cp strains with their DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen) numbers in brackets include Clostridium colinum (DSMZ 6011), Clostridium leptum (DSMZ 753), Clostridium cellobioparum (DSMZ 1351) and Bifidobacterium adolescentis (DSMZ 20083) (see also Example 6). These are four common non-Cp bacterial strains in the poultry intestine and can be used to determine whether the endolysin activity and antimicrobial activity are specific to Clostridium perfringens.

[0265] Clostridium perfringens strains can be used to determine the antimicrobial activity of the endolysin of the present invention. Clostridium perfringens strains include NCTC (National Collection of Type Cultures, National Type Culture Collection) A-type strains, which are obtained from Public Health England Culture Collection (Public Health England culture collection), and the preservation numbers are: 2837, 8235, 8237, 8238, 8239, 8359, 8678, 10578. These Clostridium perfringens strains may be referred to as "reference strains" herein. Clostridium perfringens strains may also include A-type field isolates obtained from the United Kingdom Animal and Plant Health Agency (APHA), and the preservation numbers are: B00907, B00917, B00954, B00964, B00976, G00033, W000101, W00102. These Clostridium perfringens type A field isolates may be referred to herein as "field isolates."

[0266] The endolysin polypeptides of the present invention can exhibit an antimicrobial effect against one or more of the Clostridium perfringens reference strains and Clostridium perfringens type A field isolates disclosed herein. The endolysins of the present invention can exhibit an antimicrobial effect against NCTC strains 2837, 8235, 287, 823, 8237, 8238, 8239, 8359, 8678 and / or 10578.

[0267] ΔLog can be calculated using a standard cell viability assay as disclosed herein. 10 The ΔLog value of the endolysin polypeptide or fragment can be determined against the Clostridium perfringens reference strain NCTC 8237 using an endolysin or fragment of the invention at a concentration of 5 μg / ml. 10 Value. ΔLog 10 Values ​​may be about 0.40 or greater, 2.00 or greater, or 3.70 or greater. About means + / - 10% or + / - 5%.

[0268] Antimicrobial activity can be determined by using a standard cell viability assay as disclosed herein to calculate a % reduction in cell viability. The cell viability reduction value % exhibited by the endolysin polypeptide or fragment of the present invention can be determined for the Clostridium perfringens reference strain NCTC 8237 using an endolysin or fragment of the present invention at a concentration of 5 μg / ml. The cell viability reduction value % can be about 60% or greater, 70% or greater, 80% or greater, 90% or greater, or 100%. About refers to + / -10% or + / -5%.

[0269] Antimicrobial activity can be determined by using a standard cell turbidity reduction assay as disclosed herein to calculate a t50 lysis value. The t50 lysis value exhibited by the endolysin polypeptide or fragment is determined against the Clostridium perfringens reference strain NCTC 8237 using an endolysin or fragment of the invention at a concentration of 5 μg / ml. The t50 lysis value provided can be about 7 minutes or less; or it can provide a t50% lysis value of 3 minutes or less. About refers to + / -10% or + / -5%.

[0270] The antimicrobial activity can be determined using standard minimum inhibitory concentration (MIC) assays and / or minimum bactericidal concentration (MBC) assays. 4 Cells / mL are subjected to a standard minimum inhibitory concentration (MIC) assay or a minimum bactericidal concentration (MBC) assay against Clostridium perfringens strain Cp6; wherein the endolysin or fragment of the present invention exhibits a MIC value or MBC value of 17 μg / mL or less, preferably 1.7 μg / mL or less; or it exhibits a MIC value or MBC value of 0.65 μM or less, preferably 0.05 μM or less. About refers to + / -10% or + / -5%.

[0271] By assessing the in vitro degradation rate of purified peptidoglycan (PGN), endolysin activity (i.e., hydrolytic activity) can be determined, and therefore antimicrobial activity can be determined. This can be assessed by measuring the spontaneous rate of PGN degradation in any suitable buffer. The in vitro degradation rate of purified PGN can be assessed by optical density. In order to use in this assay, preferably PGN is purified from bacterial species, more preferably from Clostridium perfringens strains, such as Clostridium perfringens Cp6 strains. The scheme of purifying PGN from bacterial species is provided in Example 20 below.

[0272] If the endolysin polypeptide of the invention promotes a statistically significant increase in the in vitro degradation rate of purified PGN, it can be determined that the endolysin polypeptide of the invention has endolysin hydrolysis activity and, therefore, antimicrobial activity. The ability of a given endolysin polypeptide to promote a statistically significant increase in the in vitro degradation rate of purified PGN can be assessed with reference to the background rate of PGN degradation, i.e., with reference to a control formulation that does not contain the endolysin polypeptide.

[0273] The ability of a given endolysin polypeptide to promote a statistically significant increase in the in vitro degradation rate of purified PGN can be assessed by reference to the PGN degradation rate of a reference polypeptide or a control polypeptide. The reference polypeptide or control polypeptide should be a polypeptide that does not promote a statistically significant increase in the in vitro degradation rate of purified PGN. The reference polypeptide or control polypeptide can be a polypeptide that is an endolysin without PGN catalytic activity; or any other suitable polypeptide that is not an endolysin, such as bovine serum albumin.

[0274] If any endolysin polypeptide of the present invention promotes a statistically significant reduction in the absolute amount of purified in vitro PGN at the endpoint (completion) of the PGN degradation assay (i.e., the purified in vitro PGN is statistically significantly degraded), then any endolysin polypeptide of the present invention can be determined to have endolysin hydrolytic activity, and therefore antimicrobial activity.

[0275] The ability of a given endolysin polypeptide to promote a statistically significant reduction in the absolute amount of purified PGN in vitro can also be assessed with reference to the background reduction in the absolute amount of purified PGN, ie, with reference to a control preparation that does not contain the endolysin polypeptide.

[0276] The ability of a given endolysin polypeptide to promote a statistically significant reduction in the absolute amount of purified PGN in vitro can also be assessed by reference to the reduction in the absolute amount of purified PGN degradation caused by a reference polypeptide or control polypeptide. The reference polypeptide or control polypeptide should be a polypeptide that does not promote a statistically significant reduction in the absolute amount of purified PGN in vitro. The reference polypeptide or control polypeptide can be a polypeptide that is an endolysin without PGN catalytic activity; or any other suitable polypeptide that is not an endolysin, such as bovine serum albumin.

[0277] Endolysin hydrolytic activity can be assessed in this manner for purified endolysins, such as explained in the Examples (including, for example, Example 21 below), and for endolysins contained in cell extracts, as explained in the Examples (including, for example, Example 24 below).

[0278] In the case of purified endolysins, the activity can be assessed by reference to the background rate of degradation of purified PGN or the background reduction in absolute amount, i.e., by reference to a control preparation that does not contain the purified endolysin polypeptide. Alternatively, the activity can be assessed by reference to a control preparation containing a purified control polypeptide, which can be a polypeptide that is an endolysin without PGN catalytic activity; or any other suitable polypeptide that is not an endolysin, such as bovine serum albumin. In the case of endolysins contained in cell extracts, the activity can be assessed by reference to the background rate of degradation of purified PGN or the background reduction in absolute amount, i.e., by reference to a control preparation that does not contain a cell extract containing the endolysin polypeptide. Preferably, the control contains a cell extract that is equivalent to the test sample but minus the endolysin polypeptide. Alternatively, the activity can be assessed by reference to a control preparation that contains a control polypeptide contained in a comparable cell extract. The control polypeptide can be a polypeptide that is an endolysin without PGN catalytic activity; or any other suitable polypeptide that is not an endolysin, such as bovine serum albumin.

[0279] Antimicrobial activity, such as bacteriolytic activity and bacteriostatic activity, can be determined according to the assays described in the following sections and in any relevant examples.

[0280] Methods for determining lytic activity include spot assays (see Examples 8, 11 and 16), in which the endolysin polypeptides of the invention and fragments thereof are added to a lawn of Clostridium perfringens cells established on a suitable medium (e.g., an agar plate). Any relevant negative control may be used, such as PBS. Any positive control may be used, such as any antibiotic (e.g., ampicillin may be used) or any other product that exhibits an antimicrobial and / or lytic effect on Clostridium perfringens. Lytic activity is indicated by the presence of a clearance zone, and the extent of the lytic activity may be determined by the size of the clearance zone.

[0281] Bacteriostatic (growth inhibition) activity can be determined as described herein and in Examples 8, 11 and 16. Methods for determining bacteriostatic activity include spot assays, in which a strain of Clostridium perfringens is freshly plated on a suitable medium (e.g., an agar plate) and varying concentrations of an endolysin polypeptide of the invention are added to the freshly plated bacteria. The extent of bacteriostatic activity can be determined by the lack of growth of Clostridium perfringens colonies compared to an untreated control or a control treated with a product that does not affect bacterial growth.

[0282] The lytic / log relative activity of any endolysin polypeptide of the invention compared to a reference endolysin polypeptide of a relevant control strain can be assessed by any suitable means. 10 / t50% lysis value relative increase, or relative decrease in cell viability associated with any endolysin polypeptide of the present invention. Any such relative increase or any such relative decrease associated with any endolysin polypeptide of the present invention should be a statistically significant increase or decrease in the relevant property being evaluated compared to the reference or control. The reference or control can be a reference to the background, i.e., a reference to a control preparation that does not contain the endolysin polypeptide. The reference or control can refer to a reference preparation or a control preparation that contains a reference polypeptide or a control polypeptide. The reference polypeptide or control polypeptide should be a polypeptide that cannot increase or decrease the relevant property being evaluated. The reference polypeptide or control polypeptide can be a polypeptide that is an endolysin without PGN catalytic activity; or any other suitable polypeptide that is not an endolysin, such as bovine serum albumin.

[0283] The purified protein of the present invention can be dissolved / lysed / log 10 / t50% lysis value / cell viability activity is compared to any suitable control protein to assess the relative increase. For example, enzyme, lysozyme or bovine serum albumin can be used as a control protein.

[0284] Preferably, when the polypeptide is expressed alone in a host cell, preferably in E. coli or an algal host cell, the expression of the polypeptide can be determined by comparing the endolytic / lytic / log 10The relative increase was evaluated by calculating the value of / t50% lysis value / cell viability activity.

[0285] More specifically, the antimicrobial activity of the endolysin polypeptides of the invention can be determined using the assays outlined in the following sections and examples:

[0286] Method for determination of antimicrobial effect (ΔLog10 and cell viability) of endolysins:

[0287] ΔLog10, which is the logarithm of the ratio of the response of untreated cell controls to the response of endolysin-treated cells 10 , can be calculated according to the following method (see also Example 13):

[0288] 1. Inoculate Clostridium perfringens strain NCTC 8237 into BHI+C medium and culture at 37°C overnight under anaerobic conditions until the stationary phase;

[0289] 2. Inoculate the overnight culture into fresh BHI+C medium and grow at 37°C under anaerobic conditions until OD600nm is about 0.6;

[0290] 3. Centrifuge 1.8 mL of the culture at 16,600 × g for 5 minutes at room temperature under anaerobic conditions;

[0291] 4. Remove the supernatant and resuspend the cell pellet in 0.9 mL of resuspension buffer (NaCl 127 mM, Na2HPO4 70 mM, NaH2PO4 30 mM pH 7.0) under anaerobic conditions;

[0292] 5. Dilute the cell suspension to OD 600nm 0.6 with resuspension buffer under anaerobic conditions;

[0293] 6. Add purified endolysin polypeptide or fragment to a concentration of 5 μg / mL under anaerobic conditions;

[0294] 7. Incubate at 25°C under anaerobic conditions for 1 hour;

[0295] 8. Determine viable cell counts by serial dilution, plating cells on RCM solid medium and incubating under anaerobic conditions at 37°C until colonies form; and

[0296] 9. Calculate the log10 reduction as the log10 of the ratio of the untreated cell control to the cells treated with the endolysin polypeptide or fragment.

[0297] Cell viability can be calculated according to the following method (see also Examples 13 and Fig. 20 ):

[0298] 1. Inoculate Clostridium perfringens strain NCTC 8237 into BHI+C medium and culture at 37°C overnight under anaerobic conditions until the stationary phase;

[0299] 2. Inoculate the overnight culture into fresh BHI+C medium and grow at 37°C under anaerobic conditions until OD600nm is about 0.6;

[0300] 3. Centrifuge 1.8 mL of the culture at 16,600 × g for 5 minutes at room temperature under anaerobic conditions;

[0301] 4. Remove the supernatant and resuspend the cell pellet in 0.9 mL of resuspension buffer (NaCl 127 mM, Na2HPO4 70 mM, NaH2PO4 30 mM pH 7.0) under anaerobic conditions;

[0302] 5. Dilute the cell suspension to OD 600nm 0.6 with resuspension buffer under anaerobic conditions;

[0303] 6. Add purified endolysin polypeptide or fragment to a concentration of 5 μg / mL under anaerobic conditions;

[0304] 7. Incubate at 25°C under anaerobic conditions for 1 hour;

[0305] 8. Determine the viable cell count by serial dilution, plating the cells on RCM solid medium and incubating under anaerobic conditions at 37°C until colonies form;

[0306] 9. calculating the log10 reduction as the log10 of the ratio of the untreated cell control to the cells treated with the endolysin polypeptide or fragment; and

[0307] 10. Use the log10 reduction values ​​to calculate the percent reduction of viable bacteria.

[0308] The t50% lysis value, which is defined as the time required for the endolysin to lyse 50% of its initial cell suspension, can be calculated as follows (see also Example 12):

[0309] 1. Inoculate Clostridium perfringens strain NCTC 8237 into BHI+C medium and culture at 37°C overnight under anaerobic conditions until the stationary phase;

[0310] 2. Inoculate the overnight culture into fresh BHI+C medium and grow at 37°C under anaerobic conditions until the culture reaches the exponential phase (OD 620nm approximately 1.0);

[0311] 3. Centrifuge a certain volume of exponential phase culture at 3800 × g for 30 min at 10°C and remove the supernatant;

[0312] 4. Resuspend the cells in a volume of PBS (pH 7.0) that is half the volume of the initial pre-centrifuged culture to concentrate the cells;

[0313] 5. Transfer 90 μL of resuspended cells to a well of a 96-well microplate and add 10 μL of a 10-fold concentrated endolysin polypeptide or fragment in PBS (pH 7.0) to a final concentration of 5 μg / mL;

[0314] 6. Monitor the decrease in turbidity by taking kinetic readings of OD 620 nm at appropriate intervals on a microplate reader at room temperature;

[0315] 7. Monitor turbidity for 30-60 minutes, or until OD 620nm decreases to a level at which it begins to stabilize;

[0316] 8. Calculate t50% lysis (minutes), the time when 50% of cells are lysed, from the turbidity reduction curve using the following formula:

[0317]

[0318] Wherein, ODb_t=0 is the optical density of the initial cell suspension at the beginning of the test before the addition of the endolysin polypeptide or fragment; and

[0319] Herein, ODE_t50% lysis is the optical density of the cell suspension corresponding to a 50% decrease in the initial cell density after the addition of the endolysin polypeptide or fragment.

[0320] Method for determining the minimum inhibitory concentration (MIC) / minimum bactericidal concentration (MBC) of endolysin:

[0321] The MIC / MBC value, which is defined as the lowest concentration of purified endolysin that causes cell growth arrest for a given C. perfringens cell density, can be calculated according to the following method (see also Example 15):

[0322] 1. Inoculate the Clostridium perfringens strain Cp6 into BHI+C medium and culture it at 37°C overnight under anaerobic conditions until the stable phase;

[0323] 2. Dilute the stationary phase culture into fresh LB medium under anaerobic conditions;

[0324] 3. Prepare serial dilutions of purified endolysin stock solution in PBS (pH 7.0) under anaerobic conditions to a concentration 10-fold higher than the final desired protein loading concentration;

[0325] 4. Under anaerobic conditions, serially diluted purified endolysin was mixed with diluted stationary phase culture in the wells of a microtiter plate, wherein for each well, 45 μL of diluted stationary phase culture was mixed with 5 μL of 10-fold concentrated and purified endolysin to a final cell load of approximately 10 4 cells / mL;

[0326] 5. Incubate the cells overnight at 41°C under anaerobic conditions for 12-20 hours;

[0327] 6. Determine the degree of growth inhibition by measuring the change in OD on a microplate reader and compare with the culture medium and growth control;

[0328] 7. Determine the minimum inhibitory concentration (MIC) of the endolysin, wherein the MIC is the lowest concentration of the endolysin that causes cell growth arrest and no visible growth is observed;

[0329] 8. Under anaerobic conditions, transfer 5 μL of culture from each well to a separate well and make up to 100 μL with BHI+C medium;

[0330] 9. Incubate the transferred culture under anaerobic conditions at 41°C overnight for 12-20 hours;

[0331] 10. Determine the extent of growth and therefore the extent of remaining viable Cp cells after exposure to endolysin by measuring the change in OD on a microplate reader after incubation and compare with culture medium and growth controls;

[0332] 11. Determine the minimum bactericidal concentration (MBC) of the endolysin, where the MBC is the lowest concentration of endolysin that kills all of the initial cell load and no visible growth is observed.

[0333] Synergistic effects between endolysin peptides

[0334] The endolysin variants of the present invention can also be combined to produce a synergistic antimicrobial effect (Examples 16-18, Example 21, Example 30). Therefore, the present invention provides a combination of two or more endolysin polypeptides of the present invention used together, wherein the antimicrobial activity exhibited is a synergistic activity.

[0335] The synergistic activity of the endolysin polypeptides of the invention used together can be evaluated according to any suitable assay method described herein. The PGN degradation assay described herein is a particularly suitable assay method. The synergistic activity of multiple endolysin polypeptides of the invention used together has been demonstrated in the PGN degradation assay described herein, both as purified proteins (e.g., Example 21) and as components of cell extracts (e.g., Example 30).

[0336] The invention provides any host cell, cell lysate, composition, whole cell composition, dried biomass composition or antimicrobial preparation as described and defined herein, wherein the antimicrobial activity exhibited is a synergistic activity.

[0337] The present invention also provides any host cell, cell lysate, composition, whole cell composition or antimicrobial preparation as described and defined herein (wherein the antimicrobial activity exhibited is a synergistic activity), comprising two endolysin polypeptides defined according to the amino acid sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2 and exhibiting synergistic antimicrobial activity, or any combination of fragments and variants of two endolysin polypeptides defined according to the amino acid sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2 and exhibiting synergistic antimicrobial activity. Polynucleotide encoding the endolysin polypeptide of the present invention Acid and carrier

[0338] The present invention also provides nucleic acid molecules and vectors encoding the polypeptides of the present invention. Exemplary polynucleotide molecules encoding the polypeptides disclosed herein are provided as SEQ ID NOs: 1 to 8. Each of these sequences can include a codon for an N-terminal methionine (ATG) at the 5' end, and a 3x glycine linker and a 6x histidine tag before a stop codon (TAA) at the 3' end, which can optionally be excluded.

[0339] The present invention also provides polynucleotides encoding endolysin polypeptides, such that the polynucleotides are codon optimized for efficient expression in a specific host. Codon optimization can be implemented according to Example 2, wherein the endogenous tryptophan "TGG" codon is replaced with a "TGA" stop codon to minimize potential toxic effects on E. coli cloning strains. Those skilled in the art also know how to optimize codons and / or codon pairs.

[0340] The terms "nucleic acid molecule" and "polynucleotide" are used interchangeably herein and refer to a polymeric form of nucleotides (deoxyribonucleotides or ribonucleotides, or analogs thereof) of any length. Non-limiting examples of polynucleotides include genes, gene fragments, messenger RNA (mRNA), cDNA, recombinant polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes and primers. The polynucleotides of the present invention can be provided in an isolated or substantially isolated form. Substantially isolated means that the polypeptide can be substantially separated from any surrounding medium, but not completely isolated. The polynucleotides can be mixed with a carrier or diluent that does not interfere with their intended use and is still considered to be substantially isolated. A nucleic acid sequence "encoding" a selected polypeptide is a nucleic acid molecule that is transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vivo when placed under the control of appropriate regulatory sequences, such as in an expression vector. The boundaries of the coding sequence are determined by the start codon at the 5' (amino) end and the translation stop codon at the 3' (carboxyl) end. For the purposes of the present invention, such nucleic acid sequences may include, but are not limited to, cDNA from a virus, prokaryotic or eukaryotic mRNA, genomic sequences from viral or prokaryotic DNA or RNA, and even synthetic DNA sequences. The transcription termination sequence may be located 3' to the coding sequence.

[0341] Polynucleotides can be synthesized according to methods well known in the art, as described by way of example in Sambrook et al. (1989, Cold Spring Harbor Press) Molecular Cloning-a laboratory manual. The nucleic acid molecules of the present invention can be provided in the form of an expression cassette comprising a control sequence operably linked to an insertion sequence, thereby allowing the polypeptide of the present invention to be expressed in vivo. These expression cassettes are generally provided in vectors (e.g., plasmids or recombinant viral vectors). Such expression cassettes can be directly administered to a host subject. Alternatively, a vector comprising a polynucleotide of the present invention can be administered to a host subject. Preferably, a genetic vector is used to prepare and / or administer the polynucleotide. A suitable vector can be any vector capable of carrying a sufficient amount of genetic information and allowing the polypeptide of the present invention to be expressed.

[0342] The expression vector for expressing the polypeptide of the present invention may include two multiple cloning sites (MCS), which place the selected DNA sequence under the control of two independent T7 polymerase promoters, wherein the promoter is engineered to respond to the presence of IPTG in the culture medium, thereby allowing controlled gene expression. This vector may be a pETDuet (Merck Millipore) expression vector. The vector may include additional or alternative measures for controlling gene expression. In addition, the expression vector is modified according to Example 2 so that the first tryptophan codon "TGG" or the first and second tryptophan codons present in the nucleotide sequence encoding the endolysin of the present invention are mutated into "TGA" termination codons to prevent the toxicity to the Escherichia coli clone strain caused by the undesirable expression of the endolysin of the present invention. In these cases, when expressing the endolysin polypeptide of the mutation in a host cell, the coexpression of the t-RNA molecule in which the anticodon is "TCA" is required. The t-RNA molecule may be a molecule identified in an Escherichia coli strain. The t-RNA molecule can be as described in Example 2, as identified from E. coli k-12 strain (GenBank Accession No. CP028306), wherein the anticodon "CCA" is replaced with "TCA". Any polynucleotide sequence, such as the endolysin and t-RNA molecules disclosed herein, can further comprise additional sequences homologous to the MCS to facilitate cloning into the MCS.

[0343] Therefore, the present invention includes expression vectors comprising such polynucleotide sequences. Such expression vectors are conventionally constructed in the field of molecular biology, and for example may involve the use of plasmid DNA and suitable initiators, promoters, enhancers and other elements, such as polyadenylation signals that may be necessary and positioned in the correct direction, to allow expression of the peptide of the present invention. Other suitable vectors are apparent to those skilled in the art. As further examples in this regard, we refer to Sambrook et al. Depending on the host / vector system used, any of many suitable transcription and translation control elements may be used in the expression vector, including constitutive and inducible promoters, transcription enhancer elements, transcription terminators, etc. (e.g., U6 promoter, HI promoter, etc.).

[0344] Therefore, the present invention may relate to an expression vector comprising a nucleic acid construct or polynucleotide according to the present invention. An expression vector according to the present invention may be a recombinant expression vector. This vector may constitute a plasmid, a cosmid, a phage or a virus or a part thereof, which is transformed by introducing a nucleic acid construct or polynucleotide according to the present invention. This host organism to be transformed has a specific transformation vector that is well known to those skilled in the art and is widely described in the literature. In order to produce a polynucleotide or endolysin polypeptide according to the present invention in a host, it may be suitable to be used for the transformation of a host organism and for the integration of a polynucleotide, a nucleic acid construct or an expression vector according to the present invention. This transformation may be implemented by any suitable known means that is widely described in the professional literature and is well known to those skilled in the art.

[0345] As used herein, "promoter" is a DNA regulatory region that can bind RNA polymerase and initiate transcription of downstream (3' direction) coding or non-coding sequences. For the purpose of defining the present invention, the promoter sequence is bounded by the transcription initiation site at its 3' end, and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at a detectable level higher than background. A transcription initiation site can be found in the promoter sequence, as well as the protein binding domain responsible for binding RNA polymerase. Non-limiting examples of suitable promoters include promoters from cytomegalovirus (CMV) immediate early, herpes simplex virus (HSV) thymidine kinase, early and late SV40, long terminal repeats (LTR) from retroviruses, and mouse metallothionein-I. Selecting suitable vectors and promoters is completely within the level of the technician. The expression vector may also contain a ribosome binding site for translation initiation and transcription terminator. The expression vector may also include a suitable sequence for amplifying expression. The expression vector may also include a nucleotide sequence encoding a protein tag (e.g., 6xHis tag, hemagglutinin tag, green fluorescent protein, thioredoxin, etc.) fused to the site-directed modifying polypeptide, thereby resulting in a chimeric polypeptide. Such a tag may also be cleavable, for example using TEV protease.

[0346] A promoter can be a constitutively active promoter (i.e., a promoter that is constitutively active / "ON" state), it can be an inducible promoter (i.e., a promoter whose state - active / "ON" or inactive / "OFF" is controlled by an external stimulus, such as the presence of a specific temperature, compound, or protein), it can be a spatially restricted promoter (i.e., transcriptional control elements, enhancers, etc.) (e.g., subtissue or tissue-specific promoters, cell type-specific promoters, etc.), and it can be a temporally restricted promoter (i.e., the promoter is in the "ON" state or the "OFF" state during a specific stage of development or a specific stage of a biological process (e.g., the cell cycle).

[0347] Examples of inducible promoters include, but are not limited to, T7 RNA polymerase promoter, T3 RNA polymerase promoter, isopropyl-β-D-thiogalactopyranoside (IPTG) regulated promoter, lactose inducible promoter, heat shock promoter, tetracycline regulated promoter, steroid regulated promoter, metal regulated promoter, estrogen receptor regulated promoter, etc. Thus, inducible promoters can be regulated by molecules including, but not limited to, doxycycline; RNA polymerases, such as T7 RNA polymerase; estrogen receptors; estrogen receptor fusions, etc.

[0348] The terms "DNA regulatory sequence," "control element," and "regulatory element," which are used interchangeably herein, refer to transcriptional and translational control sequences, such as promoters, enhancers, polyadenylation signals, terminators, protein degradation signals, and the like, which provide and / or regulate the transcription of non-coding sequences (e.g., promoters) or coding sequences and / or regulate the translation of the encoded polypeptide.

[0349] A "vector" or "expression vector" is a replicon, such as a plasmid, phage, virus or cosmid, to which another DNA fragment, i.e., an "insert fragment", can be attached to cause replication of the attached fragment in the cell. An "expression cassette" comprises a DNA coding sequence operably linked to a promoter. "Operably linked" refers to a juxtaposition in which the components described so far are in a relationship that allows them to function in their intended manner. For example, a promoter is operably linked to a coding sequence if the promoter affects its transcription or expression. Many suitable expression vectors are known to those skilled in the art, and many are commercially available. The following vectors are provided as examples for use in eukaryotic host cells: pXT1, pSG5 (Stratagene), pSVK3, pBPV, pMSG and pSVLSV40 (Pharmacia). However, any other vector may be used as long as it is compatible with the host cell.

[0350] The terms "recombinant expression vector" or "DNA construct" are used interchangeably herein to refer to a DNA molecule comprising a vector and at least one insert. Recombinant expression vectors are typically generated for the purpose of expressing and / or propagating the insert, or for use in constructing other recombinant nucleotide sequences. The insert may or may not be operably linked to a promoter sequence, and may or may not be operably linked to a DNA regulatory sequence.

[0351] Affinity tag and signal peptide sequence

[0352] The endolysin polypeptides of the invention may also comprise the endolysin sequence together with an affinity tag at the N-terminus and / or C-terminus to further facilitate isolation from standard expression systems such as those described herein.Any suitable affinity tag may be used.

[0353] The affinity tag of suitable affinity marker can be directly joined to the N or C-terminal of polypeptide, or indirectly joined by any suitable linker sequence (such as 3,4 or 5 glycine residues), such as 3,4 or 5 glycine residues. A kind of such suitable affinity marker affinity tag is histidine tag. This histidine tag is usually composed of 6 histidine residues, although it can be longer (such as up to 7,8,9,10 or 20 amino acids) or shorter (such as 5,4,3,2 or 1 amino acids) than this. Alternative affinity marker affinity tag comprises AviTag, FLAG-tag, HA-tag, Myc-tag, Strep-tag, V5-tag, poly-arg, HAT-tag, calmodulin binding peptide tag, GST tag, MBP tag, Fh8 tag, Strep-II tag, cellulose binding peptide tag, chitin binding peptide tag, protein A tag, ubiquitin tag, DHFR tag, SBR tag.

[0354] Every kind of endolysin of the present invention can also comprise the endolysin sequence together with the expression enhancing peptide sequence to further assist expression.Assisting expression means that the total amount of the endolysin polypeptide produced by the host cell can be increased, or the ratio of the soluble endolysin polypeptide produced by the host cell can be increased.Therefore, the expression enhancing peptide sequence can be any peptide sequence that can promote the increase of the amount of the endolysin secreted into the culture medium by the host cell (such as Escherichia coli or algae host cell).Any suitable expression enhancing peptide sequence can be used together with any endolysin of the present invention, including any expression enhancing peptide sequence described herein.The expression enhancing peptide can be selected from secretion enhancing peptides, which include: OmpA, emal, gIII, pelB, phoA, ompC, ompT, dsbA, torT, sufI, torA, STII, EOX, lamb, MglB, SfmC, TolB and MmAp. The expression enhancing peptide may be selected from the group consisting of solubility enhancing peptides PDI, GST, Trx, MBP, NusA-tag, SUMO, DsbC, Skp, Fh8, ZZ, GB1, T7PK, DsbA and SET.

[0355] Any endolysin of the invention may comprise an endolysin sequence together with any expression enhancing peptide sequence and additionally any affinity tag.

[0356] Affinity purification of the endolysins of the present invention can be used as a means to produce purified and concentrated endolysin stocks free of contaminating native E. coli lysate proteins.

[0357] Host cells and expression systems

[0358] The present invention also provides a host cell comprising a polynucleotide according to the present invention, a nucleic acid construct according to the present invention or an expression construct according to the present invention. The host cell according to the present invention can be any microbial, prokaryotic or eukaryotic cell suitable for the expression of the polypeptide of the present invention. Preferably, the cell is an Escherichia coli or an algae cell.

[0359] E. coli cells can be derived from the expression strain Rosetta TM (DE3) pLysS. Thus, the E. coli cells used for expression can be BL21 E. coli derivatives, which are intended to enhance the expression of eukaryotic proteins containing codons rarely used in E. coli, and E. coli cells suitable for producing proteins from target genes cloned from pET vectors by IPTG induction and expressing T7 lysozyme, which further suppress the basal expression of T7 RNA polymerase before induction. Examples of host cells of the present invention are those strains: DH5alpha, HB101, JM 109BL21 strains, C41 (DE3), C43 (DE3), DH10B, W3110, CyDisCo, K12 strains, Lemo21 (DE3), T7 Express strains, Rosetta strains, SHuffle strains, Tuner strains, Origami strains, ArticExpress strains, AD 494, BL21 and trxB.

[0360] The endolysin polypeptides of the present invention can be directly expressed in a host cell, preferably in an E. coli or algae host cell, in its soluble and functional (catalytically active) form. Thus, steps of solubilization and / or refolding of the expressed protein can be avoided. The ability to express a soluble and functional endolysin polypeptide of the present invention is revealed when the polypeptide of the present invention is contained in any suitable expression vector, when the vector is transformed into a host cell, when the transformed host cell is subsequently cultured under suitable conditions to promote expression of the polypeptide, and when the activity of the polypeptide is assessed.

[0361] Endolysin polypeptides of the present invention can also be expressed in algae expression systems. For example, algae expression systems can be expressed using algae host cells, such as Chlamydomonas reinhardtii or Synechococcus elongatus. Such algae systems, including related vectors, are known in the art. The polypeptides of the present invention can be retained in algae host cells to produce whole-cell algae compositions comprising the polypeptides. Alternatively, the polypeptides can be purified after expression in algae cells. Such algae systems also allow the use of known tags (such as tags disclosed herein) for affinity purification of endolysin polypeptides of the present invention.

[0362] Algae can be used as host cell and / or expression system, for expressing any polypeptide of the present invention disclosed herein, and therefore for any composition disclosed herein or preparation. This algae covers both prokaryotic algae and eukaryotic algae, and they are preferably microalgae and more preferably unicellular algae. Unicellular algae is also referred to as microalgae. Therefore, microalgae can be used as host cell and / or expression system, for expressing any polypeptide of the present invention disclosed herein, and therefore for any composition disclosed herein or preparation. In some preferred embodiments, the algae is green algae (Chlorophyta), brown algae (Phaeophyta) or diatom (Bacillariophyta).

[0363] Examples of green algae that are particularly suitable for use include members of the Chlamydomonas species, particularly Chlamydomonas reinhardtii, Chlorella species, Volvox species and some large seaweeds.

[0364] Overview of genetically transformed algal species, any of which can be used.

[0365]

[0366]

[0367] Examples of algal expression systems for expressing endolysin polypeptides of the invention are provided in Example 14. For additional information on the use of algae for recombinant polypeptide expression, see the following additional references:

[0368] Dyo,YM,&Purton,S.(2018).The algal chloroplast as a syntheticbiology platform for production of therapeutic proteins.Microbiology(Reading, UK).doi:10.1099 / mic.0.000599.

[0369] Spicer,A.,&Purton,S.(2017).Genetic engineering of microalgae:Currentstatus and future prospects.Microalgal Production for Biomass and High-ValueProducts(pages 139-164).doi:10.1201 / b19464.

[0370] Wannathong,T.,Waterhouse,J.C.,Young,R.E.B.,Economou,C.K.,&Purton,S.(2016).New tools for chloroplast genetic engineering allow the synthesis ofhuman growth hormone in the green alga Chlamydomonas reinhardtii.APPLIEDMICROBIOLOGY AND BIOTECHNOLOGY,100(12),5467-5477.doi:10.1007 / s00253-016-7354-6.

[0371] Purton,S.(2015).Algal chloroplast engineering:new tools,technologiesand applications.European Journal of Phycology,50,94-95.

[0372] Gangl,D.,Zedler,J.A.Z.,Rajakumar,P.D.,Martinez,E.M.R.,Riseley,A.,Wlodarczyk,A.,...Robinson,C.(2015).Biotechnological exploitation ofmicroalgae.JOURNAL OF EXPERIMENTAL BOTANY,66(22),6975-6990.doi:10.1093 / jxb / erv426.

[0373] Production of therapeutic proteins in algae,analysis of expression ofseven human proteins in the chloroplast of Chlamydomonas reinhardtii.BARasala,M Muto,PA Lee,M Jager,RMF Cardoso,CA Behnke,P Kirk,Plant biotechnologyjournal 8(6),719-733.

[0374] Micro-algae come of age as a platform for recombinant protein production E Specht,S Miyake-Stoner,S Mayfield Biotechnology letters 32(10),1373-1383.

[0375] Regulation of chloroplast gene expression SP Mayfield,CB Yohn,ACohen,A Danon.Annual review of plant biology 46(1),147-166.

[0376] Chlamydomonas reinhardtii chloroplasts as protein factories. SP Mayfield, AL Manuell, S Chen, J Wu, M Tran, D Siefker, M Muto Current opinion in biotechnology 18(2),126-133.

[0377] Therefore, the present invention provides a host cell comprising a population of nucleic acid molecules encoding any endolysin polypeptide of the present invention, optionally wherein the host cell is a cell of a unicellular microorganism, optionally a yeast cell, a bacterial cell (such as a lactobacillus), a fungal cell or an algae cell. The present invention further provides a host cell comprising a population of nucleic acid molecules encoding any endolysin polypeptide of the present invention, optionally wherein the host cell is a plant cell.

[0378] The host cell may further comprise any endolysin polypeptide or fragment thereof as defined herein and expressed from said vector. Each of the molecules or vectors of the population may encode the same endolysin polypeptide or fragment as defined herein, or the molecules or vectors of the population may encode two or more different endolysin polypeptides or fragments as defined herein.

[0379] The present invention further provides a cell lysate comprising: a population of any endolysin polypeptide or fragment thereof as defined herein, optionally wherein the population consists of the same endolysin polypeptide or fragment, or wherein the population consists of two or more different endolysin polypeptides or fragments. The lysate may be produced after expressing the endolysin polypeptide or fragment thereof in a host cell as defined herein, the host cell may be a cell of a unicellular microorganism, optionally a yeast cell, a bacterial cell (such as a lactobacillus), a fungal cell, or an algae cell or a plant cell.

[0380] Reagents and systems for expressing proteins in yeast are described in: Protein expression-yeast, Nielsen K.H., Methods Enzymol. 2014; 536: 133-47.

[0381] Reagents and systems for expressing proteins in fungi are described in: Gene expression in fungi, Kalkanci, A et al. IMA Fungus. 2011 Jun;2(1):29-32.

[0382] Reagents and systems for expressing proteins in yeast are described inter alia in: Micro-algae come of age as a platform for recombinant protein production, Specht, E. et al. Biotechnol Lett. 2010 Oct;32(10):1373-1383.

[0383] Reagents and systems for expressing proteins in plants are described in: Plants as Expression Systems for Recombinant Proteins, Kawaka et al., Asian Journal of Biology 3(3): 1-8, 2017.

[0384] The host cell may be a cell of a host organism that is a GRAS organism ("generally recognized as safe") or a cell of a host organism listed in the Qualified Presumption of safety (QPS) list published by the European Food Safety Authority, including any organism routinely included in poultry diets.

[0385] Compositions and formulations comprising the endolysins of the invention

[0386] Compositions and preparations

[0387] In another aspect, the present invention provides a composition comprising any of the endolysin polypeptides of the present invention.

[0388] The composition may comprise a population of any endolysin polypeptide or fragment as defined herein. The population may consist of the same endolysin polypeptide or fragment as defined herein. The population may consist of two or more different endolysin polypeptides or fragments as defined herein, in which case the antimicrobial activity exhibited may be a synergistic activity.

[0389] The composition may comprise a population of host cells, wherein the host cells of the population may comprise any endolysin polypeptide or fragment as defined herein.

[0390] The composition may comprise: a whole cell composition comprising a population of whole cells, wherein the cells of the population comprise any endolysin polypeptide or fragment as defined herein. The cells of the population may be cells of a unicellular microorganism, optionally yeast cells, bacterial cells (such as lactobacilli), fungal cells or algae cells, or may be plant cells, and the cells comprise any endolysin polypeptide or fragment as defined herein, for example by expressing the polypeptide or fragment.

[0391] Any of the above compositions may comprise a polypeptide or fragment, host cells and whole cells and a suitable carrier or excipient, such as water or a physiologically acceptable buffer.

[0392] In another aspect, the present invention provides a formulation comprising any endolysin polypeptide of the present invention. Preferably, the formulation is an antimicrobial formulation, an antibacterial formulation and / or a pharmaceutical formulation.

[0393] The preparation may comprise a population of host cells, wherein the host cells of the population comprise any endolysin polypeptide of the invention. The preparation may comprise a cell lysate, wherein the lysate comprises any endolysin polypeptide of the invention.

[0394] Any formulation may consist of the same endolysin polypeptide or fragment as defined herein, or may consist of two or more different endolysin polypeptides or fragments thereof as defined herein.The antimicrobial activity exhibited may be a synergistic activity.

[0395] Any such formulation may comprise any endolysin polypeptide of the invention and at least one pharmaceutically acceptable carrier, diluent, solvent or excipient. The carrier, diluent, solvent or excipient must be "acceptable" in the sense of being compatible with the other ingredients of the composition and not harmful to the subject to whom the composition is administered. Typically, the carrier and the final composition are sterile and non-pyrogenic.

[0396] The preparation of suitable compositions can be carried out using standard pharmaceutical preparation chemistry and methodology, all of which are readily available to fairly skilled technicians. For example, the reagent can be combined with one or more pharmaceutically acceptable excipients or solvents. Auxiliary substances, such as wetting agents or emulsifiers, pH buffer substances, reducing agents, etc., can be present in the excipient or solvent. Suitable reducing agents include cysteine, thioglycerol, thiourea pigment poison (thioreducin), glutathione, etc. Excipients, solvents and auxiliary substances are generally agents that do not cause an immune response in the individual receiving the composition, and can be administered without excessive toxicity. Pharmaceutically acceptable excipients include, but are not limited to, liquids such as water, saline, polyethylene glycol, hyaluronic acid, glycerol, thioglycerol and ethanol. Pharmaceutically acceptable salts may also be included therein, for example, inorganic acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, etc.; and organic acid salts such as acetates, propionates, malonates, benzoates, etc. A comprehensive discussion of pharmaceutically acceptable excipients, vehicles, and auxiliary substances is provided in Remington's Pharmaceutical Sciences (Mack Pub. Co., NJ, 1991).

[0397] This composition can be prepared, packaged or sold in a form suitable for push injection or continuous administration. Injectable compositions can be prepared, packaged or sold in unit dose form, for example, in ampoules or multi-dose containers containing preservatives. Compositions include, but are not limited to suspensions, solutions, emulsions, pastes and implantable sustained-release or biodegradable preparations in oily or aqueous solvents. This composition may also include one or more additional ingredients, including but not limited to suspending agents, stabilizers or dispersants. In one embodiment of the composition for parenteral administration, the active ingredient is provided in a dry (e.g., powder or granular) form for reconstitution with a suitable solvent (e.g., sterile pyrogen-free water) before the reconstructed composition is administered parenterally. The composition can be prepared, packaged or sold in the form of a sterile injectable aqueous or oily suspension or solution. The suspension or solution can be prepared according to known techniques and may also include additional ingredients, such as dispersants, wetting agents or suspending agents described herein, in addition to the active ingredient. For example, non-toxic parenteral acceptable diluents or solvents, such as water or 1,3-butanediol, can be used to prepare this sterile injectable preparation. Other acceptable diluents and solvents include, but are not limited to, Ringer's solution, isotonic sodium chloride solution, and fixed oils such as synthetic mono- or diglycerides.

[0398] Other useful parenterally-administrable compositions include those containing active ingredients in microcrystalline form, in liposomal formulations, or as components of biodegradable polymer systems. Compositions for sustained release or implantation may contain pharmaceutically acceptable polymeric materials or hydrophobic materials, such as emulsions, ion exchange resins, sparingly soluble polymers or sparingly soluble salts. The composition may be suitable for administration by any suitable route, including, for example, intradermal, subcutaneous, percutaneous, intramuscular, intraarterial, intraperitoneal, intraarticular, intraosseous or other suitable administration routes. Preferred compositions are suitable for administration by intravenous infusion.

[0399] Examples of formulations include topical lotions, creams, soaps, wipes, etc. They can be formulated into liposomes to reduce toxicity or improve bioavailability. Other delivery methods include oral methods that require encapsulation of endolysin in microspheres or proteinoids, aerosol delivery (e.g., to the lungs) or transdermal delivery (e.g., by iontophoresis or transdermal electroporation). Other conventional administration methods are known to those skilled in the art.

[0400] Pharmaceutical formulations suitable for oral administration may be presented in convenient unit forms including capsules, tablets, gels, pastes, ointments and the like.

[0401] The formulations and compositions may contain a thickener. Suitable thickeners include synthetic hectorite, Irish moss, i-carrageenan, tragacanth gum, starch, polyvinylpyrrolidone, hydroxyethylpropylcellulose, hydroxybutylmethylcellulose, hydroxypropylmethylcellulose, hydroxyethylcellulose, sodium carboxymethylcellulose and silica sol.

[0402] The formulations and compositions may include solubilizers. Solubilizers may include agents such as wetting agent polyols (such as propylene glycol, dipropylene glycol, and hexylene glycol); cellosolves (such as methyl cellosolve and ethyl cellosolve); vegetable oils and waxes containing at least about 12 carbons in a straight chain, such as olive oil, castor oil, and petrolatum; and esters such as amyl acetate, ethyl acetate, and benzyl benzoate.

[0403] Pharmaceutically acceptable excipients suitable for tablet formulations include, for example, inert diluents such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating agents and disintegrants such as corn starch or alginic acid; binders such as starch, gelatin or gum arabic; and lubricants such as magnesium stearate, stearic acid or talc. Tablets may be uncoated or they may be coated by known techniques to delay disintegration and absorption in the gastrointestinal tract, thereby providing a longer sustained action. For example, time-delay materials such as glyceryl monostearate or glyceryl distearate may be used.

[0404] For hard gelatin capsule preparations, the active ingredient can be mixed with an inert solid diluent (such as calcium carbonate, calcium phosphate or kaolin). For soft gelatin capsule preparations, the active ingredient can be mixed with water or an oil medium (such as peanut oil, liquid paraffin or olive oil).

[0405] Suitable excipients for making aqueous suspensions include suspending agents, for example, sodium carboxymethylcellulose, methylcellulose, hydroxypropyl methylcellulose, sodium alginate, polyvinyl pyrrolidone, gum tragacanth and gum arabic; dispersants or wetting agents may be naturally occurring phosphatides (e.g., lecithin), or condensation products of alkylene oxides with fatty acids (e.g., polyoxyethylene stearate), or condensation products of ethylene oxide with long-chain fatty alcohols (e.g., heptadecaethyleneoxyhexadecanoate), or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol (e.g., polyoxyethylene sorbitan monooleate), or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides (e.g., polyethylene sorbitan monooleate).

[0406] The aqueous suspension may also contain one or more preservatives, for example a benzoate, such as ethyl or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents and one or more sweetening agents, such as sucrose or saccharin.

[0407] Oily suspensions can be prepared by suspending the active ingredient in a vegetable oil (e.g., peanut oil, olive oil, sesame oil, or coconut oil) or a mineral oil (e.g., liquid paraffin). Oily suspensions may contain thickeners, such as beeswax, hard paraffin, or cetyl alcohol. Sweeteners and flavorings may be added. These compositions may be preserved by adding an antioxidant (e.g., ascorbic acid).

[0408] Any composition or formulation described herein may also be formulated for parenteral administration, such as by injection, eg, bolus injection or continuous infusion, and may be provided in unit dosage form in ampoules, prefilled syringes, small volume infusions or multi-dose containers, eg, with an added preservative.

[0409] Preparations for parenteral administration of the preparations and compositions described herein include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents include propylene glycol, polyethylene glycol, vegetable oils (e.g., olive oil), and injectable organic esters (e.g., ethyl oleate). Examples of aqueous carriers include water, saline, and buffered media, alcoholic solutions / aqueous solutions, and emulsions or suspensions. Examples of parenteral vehicles include sodium chloride solutions, Ringer's dextrose, glucose and sodium chloride, lactated Ringer's, and fixed oils. Intravenous vehicles include fluids and nutritional supplements, electrolyte supplements (e.g., those based on Ringer's dextrose), etc. Preservatives and other additives may also be included, such as other antimicrobial agents, antioxidants, chelating agents, inert gases, etc.

[0410] For topical application to the epidermis, any formulation and composition described herein can be formulated into an ointment, cream or lotion. For example, ointments and creams can be formulated with aqueous or oily bases and with the addition of suitable thickeners and / or gelling agents. Lotions can be formulated with aqueous or oily bases and typically also include one or more emulsifiers, stabilizers, suspending agents, thickeners or coloring agents. Preparations suitable for topical application in the oral cavity include lozenges, such as in a flavoring base, typically sucrose and gum arabic or tragacanth; lozenges containing active ingredients in an inert base (such as gelatin and glycerol or sucrose and gum arabic); and mouthwashes containing active ingredients in a suitable liquid carrier.

[0411] For topical administration to the eye, any formulation and composition described herein can be prepared as a solution or suspension in a suitable sterile aqueous or non-aqueous vehicle. Additives such as buffers (such as sodium metabisulfite or disodium edetate) and thickeners (such as hydroxypropyl methylcellulose) may also be included.

[0412] For intranasal administration, any formulation and composition described herein may be provided as a liquid spray or dispersible powder or in the form of drops. Drops may be formulated with an aqueous or non-aqueous base which also contains one or more dispersing agents, solubilizing agents or suspending agents.

[0413] For administration by inhalation, any formulation and composition described herein can be delivered by an insufflator (e.g., a nebulizer or pressurized pack), or other convenient means of delivering an aerosol spray. The pressurized pack may contain a suitable propellant. In the case of a pressurized aerosol, the dosage unit may be determined by providing a value for delivering a metered amount.

[0414] Any of the formulations and compositions described herein may take the form of a dry powder composition, for example a powder mix of the active ingredient and a suitable powder base such as lactose or starch. The powder composition may be presented in unit dosage form in, for example, capsules, cartridges or gelatin blister packs from which the powder may be administered with the aid of an inhaler or insufflator.

[0415] Any preparation and composition described herein can be incorporated into a liquid disinfecting solution. Such solutions can also include antimicrobial or antifungal agents, such as alcohol, povidone-iodine solution and antibiotics and preservatives. These solutions can be used as disinfectants for example for the skin or surrounding areas, for example before insertion or implantation of a device such as a catheter, as catheter blockade and / or flushing solutions, and as disinfecting flushing solutions suitable for any medical device, including but not limited to catheter assemblies, such as needles, Luer-Lok connectors, needleless connectors and hubs and other implantable devices. These solutions can also be used for coating or disinfecting surgical instruments.

[0416] The amount of endolysin polypeptide required for treatment will of course vary not only with the specific polypeptide, but also with the route and form of administration, the nature and severity of the condition being treated, and the type, age and condition of the organism. Thus, appropriate concentrations of active agents for incorporation into compositions and formulations can be routinely determined by those skilled in the art according to standard practice.

[0417] additive

[0418] Any of the above compositions, lysates or preparations may further comprise one or more additives with antimicrobial activity, wherein the additive is not an endolysin polypeptide or fragment. The one or more additives may be selected from the group consisting of an antibiotic agent, a biofilm degrader, a biofilm inhibitor, a chelating agent (such as chitosan, EDTA and citric acid), an antibacterial agent (such as glycerol). The one or more additives may be selected from the group consisting of a stabilizer, an anti-caking agent, a prebiotic, a probiotic and an edible gel (such as a water-condensing nutrient matrix).

[0419] Any formulation and composition described herein may additionally include an antimicrobial agent other than an endolysin, such as a detergent and an antibiotic, together with the endolysin. Suitable antibiotics include: aminoglycosides (e.g., gentamicin, kanamycin, and streptomycin), beta-lactams (e.g., penicillin, ampicillin, imipenem, and cephalosporins, such as ceftazidime), quinolones (e.g., ciprofloxacin), macrolides (e.g., azithromycin, clarithromycin, dirithromycin, erythromycin, roxithromycin, and telithromycin), oxazolidinones (e.g., linezolid), ansamycins (e.g., rifamycin), sulfonamides, tetracyclines (e.g., doxycycline). Additional antibiotics include glycopeptides (e.g., vancomycin), sulfisoxazole, trimethoprim, neomycin, daptomycin, and linezolid.

[0420] Typically, the antimicrobial agent is applied in a microbicidal amount. However, the antimicrobial agent can also be applied in a bacteriostatic amount.

[0421] Antiparasitic compounds that may be included in the formulations and compositions described herein include: benzoazoles (albendazole, mebendazole, thiabendazole, etc.), azoles (metronidazole, tinidazole, etc.), macrocyclics (amphotericin B, rifampicin, ivermectin, etc.), and others, such as pyrantel pamoate, diethylcarbamazine, niclosamide, praziquantel, melarsoprol, and eflornithine.

[0422] Antiviral compounds that may be included in the formulations and compositions described herein include: nucleoside analog reverse transcriptase inhibitors (acyclovir, didanosine, stavudine, zidovudine, lamivudine, abacavir, emtricitabine, entecavir, etc.), decapping inhibitors (amantadine, rimantadine, pralconarib, etc.), protease inhibitors (saquinavir, ritonavir, indinavir, nelfinavir, amprenavir, etc.) and others, such as zanamivir, oseltamivir, rifampicin.

[0423] Antiviral compounds that can be included in the formulations and compositions described herein include azoles, such as miconazole, ketoconazole, clotrimazole, econazole, omoconazole, bifonazole, butoconazole, fenticonazole, isoconazole, sertaconazole, sulconazole, tioconazole, fluconazole, itraconazole, isavuconazole, ravuconazole, posaconazole, voriconazole, terconazole, and abafungin. ngin); macrocyclics, such as natamycin, rimocidin, filipin, nystatin, amphotericin B, candesin, hamycin; allylamines, such as terbinafine, naftifine and butenafine; echinocandins, such as anidulafungin, caspofungin and micafungin; or others, such as polygodial, ciclopirox, tolnaftate, benzoic acid, undecylenic acid, flucytosine and griseofulvin.

[0424] Antifungal compounds that can be included in the formulations and compositions described herein include: azoles, such as miconazole, ketoconazole, clotrimazole, econazole, omoconazole, bifonazole, butoconazole, fenticonazole, isoconazole, sertaconazole, sulconazole, tioconazole, fluconazole, itraconazole, isavuconazole, ravuconazole, posaconazole, voriconazole, terconazole and abafungin; macrocycles, such as natamycin, cytomycin, filipin, nystatin, amphotericin B, candesin, hamycin; allylamines, such as terbinafine, naftifine and butenafine; echinocandins, such as anidulafungin, caspofungin and micafungin; or others, such as polygonalide, ciclopirox, tolnaftate, benzoic acid, undecylenic acid, flucytosine and griseofulvin.

[0425] Biomass composition

[0426] Any of the endolysin polypeptides of the invention may be comprised in a biomass composition.

[0427] Endolysins can be expressed in host cells, harvested host cells and formed biomass compositions. For example, host cells expressing an endolysin polypeptide of the invention as described and defined herein can be harvested and used to form a biomass composition comprising the host cells.

[0428] The host cell can be cracked, and the lysate can be used to form a biomass composition comprising the lysate, for example, the lysate can be dried to form a dry biomass composition comprising the dry lysate. The lysate can include the host cell fragments after the cracking. Alternatively, the lysate can include a host cell extract, wherein the host cell fragments have been removed, for example, the host cell fragments can be removed by centrifugation, and the supernatant can be collected and used, while discarding the precipitated host cell fragments.

[0429] Biomass compositions can include cracked and partially cracked host cell fragments. Biomass compositions can include host cell extracts, wherein the host cell fragments have been removed or substantially removed. Biomass compositions can include mixtures of cracked host cell fragments, partially cracked host cell fragments, and host cell extracts in any combination.

[0430] In the methods of the present invention, algal cells as further described herein are preferred host cells. Any endolysin polypeptide of the present invention can be contained in an algal host cell after being expressed in an algal host cell, or contained in an algal host cell lysate / extract after being expressed in an algal host cell. As described above, such cells and lysates / extracts can be used to form a biomass composition.

[0431] The method for cultivating algae biomass includes the production of photoautotrophy, heterotrophy and mixotrophy. The culture system for producing algae biomass includes open ponds, such as unmixed open ponds, circular ponds and open raceway ponds. Other culture systems include closed photobioreactors (PBR), such as tubular PBR, flat plate PBR, column PBR, continuous stirred tank reactor and batch fed bioreactor. Culture system also includes mixed production system.

[0432] After cultivation, the algal biomass can be harvested using methods such as flocculation, chemical coagulation, combined flocculation, centrifugation, and gravity sedimentation.

[0433] Any of the above biomass compositions can be dried. Dry biomass can be obtained by known methods, such as spray drying and freeze drying. For example, dry biomass, such as the biomass of Chlamydomonas reinhardtii, can be obtained by first cultivating algae (for example in a fermentation tank), then harvesting algae, centrifugal precipitation and spray drying biomass to obtain (see, for example, Kightlinger et al. Elec. J. Biotech. Vol. 17, 2014). Algae cells can be optionally cracked, for example, by autolysis. The cracked cells can then be dried, for example, dried in a rotary evaporator under vacuum. Then, a vacuum pump can be used to dry the resulting products overnight and grind to produce algae extract powder. Algae extract can also be prepared by grinding or ultrasonic treatment in a bead mill by spray-dried biomass. Algae extract powder can be appropriately used, for example, added to animal food.

[0434] Animal food

[0435] The present invention also provides a food, preferably an animal food, comprising: one or more foods and a composition comprising a colony of host cells. The host cells may comprise an endolysin polypeptide or fragment as described herein. The food may also comprise any host cell, cell lysate, composition or whole cell composition as described herein. The food may also comprise an antimicrobial agent as described herein.

[0436] The food of the present invention is suitable for consumption by animals, including poultry, optionally broilers, preferably chickens; pigs, preferably pigs; or wherein the food is suitable for consumption by rodents, which are optionally mice or rats. Consumption of the food may have a preventive or therapeutic effect on the animal. For example, consumption may reduce the population of Clostridium perfringens that thrives in the animal, thereby treating the animal or an infection caused by Clostridium perfringens. Consumption of the food by the animal may also prevent infection with Clostridium perfringens, or if the animal previously had an infection with Clostridium perfringens, consumption of the food by the animal will have the effect of preventing further infection and curing the infection.

[0437] The food comprising the endolysin of the invention may contain preservatives or any additives commonly used in the preparation of food for consumption and / or to extend the shelf life.

[0438] The food comprising the endolysin of the present invention can be provided in any suitable edible form, such as in powder or ground form, animal feed, animal paste or pellet form. The food comprising the endolysin of the present invention can be provided in a soluble form for drinking, such as a soluble aqueous composition comprising the endolysin of the present invention.

[0439] Methods of using the endolysin polypeptides of the invention

[0440] The present invention provides the use of the polypeptides of the present invention in various methods. For example, the polypeptides according to the present invention can also be used for treatment or prevention. In therapeutic applications, the polypeptide or composition is administered to a subject who has suffered from a disease or condition in an amount sufficient to cure, alleviate or partially inhibit the condition or one or more symptoms thereof. Therefore, the present invention can have antibacterial and / or bactericidal properties.

[0441] This therapeutic treatment can result in a decrease in the severity of disease symptoms, or an increase in the frequency or duration of symptom-free periods. An amount sufficient to achieve this is defined as a "therapeutically effective amount". In preventive applications, the polypeptide or composition is administered to a subject who has not yet shown symptoms of the disease or condition in an amount sufficient to prevent or delay the development of symptoms. This amount is defined as a "prophylactic effective amount". The subject may have been identified as being at risk of developing a disease or condition by any suitable means. Therefore, the present invention also provides polypeptides of the present invention for use in treating the human or animal body.

[0442] Also provided herein is a method for preventing or treating a disease or condition in a subject, the method comprising: administering a polypeptide of the present invention to a subject in a preventive or therapeutically effective amount. The polypeptide may be administered in conjunction with another agent. The polypeptide is preferably administered orally, but may be administered by any suitable route, including, for example, intravenous infusion, intradermal, subcutaneous, transdermal, intramuscular, intraarterial, intraperitoneal, intraarticular, intraosseous or other suitable routes of administration. The amount of the polypeptide administered may be 0.01 mg / kg BW to 2 mg / kg BW, 0.04 mg / kg BW to 2 mg / kg BW, 0.12 mg / kg BW to 2 mg / kg BW, preferably 0.24 mg / kg BW to 2 mg / kg BW, and most preferably 1 mg / kg BW to 2 mg / kg BW. The polypeptide may be administered to the same subject multiple times.

[0443] The polypeptides of the invention are particularly useful for treating or preventing diseases or conditions mediated by bacterial infection, such as bacterial infection caused by Clostridium perfringens, for example bacterial infection caused by colonization of the gastrointestinal tract by Clostridium perfringens. Thus, the invention provides polypeptides of the invention for use in treating or preventing diseases or conditions characterized by the presence of Clostridium perfringens, for example in the gastrointestinal tract.

[0444] The present invention also provides a method for treating or preventing a disease or condition mediated by Clostridium perfringens, comprising administering a polypeptide of the present invention to an individual. The disease or condition may be a disease or condition caused by infection with Clostridium perfringens, optionally an infection caused by a type A strain of Clostridium perfringens, such as food poisoning, gas gangrene, necrotic enteritis, intestinal lesions and / or gastrointestinal infections.

[0445] The method may comprise repeated administration of the polypeptide.The present invention also provides a polypeptide of the present invention for use in the manufacture of a medicament for treating or preventing a disease or condition mediated by Clostridium perfringens.

[0446] The polypeptide of the present invention can be administered by one or more routes of administration using one or more of a variety of methods known in the art. The route of administration and / or mode of administration will vary according to the desired result. Preferred routes of administration include oral administration. Other routes of administration include intravenous, intramuscular, intradermal, intraperitoneal, subcutaneous, spinal or other parenteral routes of administration, such as by injection or infusion. The phrase "parenteral administration" used herein refers to a mode of administration other than enteral and topical administration, usually by injection. Alternatively, the polypeptide can be administered by non-parenteral routes, such as topical, epidermal or mucosal routes of administration. Topical administration is also preferred, including peritumoral, paratumoral, intratumoral, intralesional, perilesional, intracavitary infusion, intravesical administration and inhalation. In a preferred embodiment, the present invention is administered orally in the form of food. Other useful approaches are those that can be used to deliver the endolysin of the present invention to a subject, preferably to the intestinal tract.

[0447] The appropriate dosage of the peptides of the present invention can be determined by a skilled medical practitioner. The actual dosage level of the peptide can be varied to obtain an amount of active ingredient that is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration without causing toxicity to the patient. The selected dosage level will depend on a variety of pharmacokinetic factors, including: the activity of the particular antibody employed, the route of administration, the time of administration, the excretion rate of the antibody, the duration of treatment, other drugs, compounds, and / or materials used in combination with the particular composition employed, the age, sex, weight, condition, general health, and past medical history of the patient being treated, and similar factors well known in the medical field.

[0448] Suitable dosages of the peptides may, for example, be in the range of about 0.1 μg / kg to about 100 mg / kg of the patient's body weight to be treated. For example, a suitable dosage may be from about 1 μg / kg to about 10 mg / kg body weight per day or from about 10 μg / kg to about 5 mg / kg body weight per day.

[0449] The dosage regimen can be adjusted to provide the optimal desired response (e.g., a therapeutic response). For example, a single bolus can be administered, or the method can include several divided doses administered over time at desired intervals, or the dose can be proportionally reduced or increased according to the exigencies of the therapeutic situation. It is particularly advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. The dosage unit form used herein refers to physically discrete units suitable as single doses for a subject to be treated; each unit contains a predetermined amount of active compound calculated to produce the desired therapeutic effect and a desired pharmaceutical carrier.

[0450] Any formulation and composition described herein can be formulated into a vaccine to be administered for prevention. Any such vaccine formulation can be directly administered to an animal for prevention. For example, the vaccine formulation can be administered (e.g., injected) into an egg within a region defined by an amnion or yolk sac. The vaccine formulation can be administered, e.g., injected into amniotic fluid. Any such vaccine formulation can be in the form of a composition of an endolysin polypeptide of the present invention expressed in an algal host cell.

[0451] Endolysin / compositions comprising endolysin for use in therapy

[0452] The composition according to the present invention can be used to treat animals infected with Clostridium perfringens, including humans, preferably broilers, such as chickens. The composition can be administered using any suitable route of administration, including but not limited to: oral, aerosol or other devices for delivery to the lungs, nasal spray, intravenous, intramuscular, intraperitoneal, intrathecal, vaginal, rectal, topical, lumbar puncture, intrathecal, and direct application to the brain and / or meninges.

[0453] When a composition according to the invention comprising a polynucleotide or a nucleic acid construct or an endolysin polypeptide or a vector or a cell according to the invention reduces the amount of Clostridium perfringens species present in a patient or a cell or a cell line or a cell-free in vitro system of said patient, it is preferably referred to as being active, functional or therapeutically active or capable of treating, preventing and / or delaying an infectious disease, and preferably means that 99%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or less of the initial amount of Clostridium perfringens species is still detectable after treatment. Preferably, no Clostridium perfringens species is detected after treatment. In this paragraph, the expression "amount of Clostridium perfringens" preferably refers to viable Clostridium perfringens. Clostridium perfringens species can be detected using standard techniques known to the skilled person, such as immunohistochemical techniques using Clostridium perfringens-specific antibodies. C. perfringens species (live and / or dead) can be detected using standard techniques known to the skilled person, such as microbial bacterial culture techniques and / or real-time quantitative reverse transcription polymerase chain reaction to measure bacterial mRNA. Examples of how to detect C. perfringens include: counting C. perfringens from the intestinal contents and face of a subject using standard plate counts or PCR methods (such as real-time PCT or conventional PCR). For PCR-based methods, any probe specific for C. perfringens can be used. Probe types can include fluorescent and hydrolytic (5' nuclease) probes (see, e.g., https: / / aem.asm.org / content / 71 / 7 / 3911 ).

[0454] The effectiveness of Clostridium perfringens treatment is preferably assessed in a sample from a subject (e.g., a stool sample, tissue or cells from a subject) by comparison with the amount present in the subject prior to treatment with the composition or polypeptide according to the invention. Alternatively, where treatment is local, a sample, tissue or cell of the individual or patient that has not been treated with the composition or polypeptide may be compared.

[0455] The composition comprising the polynucleotide or nucleic acid construct or polypeptide or vector or cell according to the present invention can be administered to a subject or cell, tissue or organ or the patient in need thereof for at least one week, one month, six months, one year or longer.

[0456] Thus, the present invention provides a composition according to the present invention for use as a medicament for treating a subject in need thereof. Preferably, the composition is for use as a medicament for treating a condition associated with infection of a subject with Clostridium perfringens, preferably a type A strain of the bacteria.

[0457] The present invention also provides a method for treating, delaying and / or preventing a disease associated with infection of a subject with Clostridium perfringens (preferably a bacterium of type A strain), comprising administering an endolysin polypeptide according to the present invention, or a polynucleotide according to the present invention, or a nucleic acid construct according to the present invention, or an expression construct according to the present invention, or a host cell according to the present invention, or a composition according to the present invention. Therefore, treatment may include treating food poisoning in a subject.

[0458] The medical uses described herein can be represented as products according to the present invention, used as medicaments for treating the disease, but can also be represented as methods for treating the disease using products according to the present invention, products according to the present invention for preparing medicaments for treating the disease, and uses of products according to the present invention for treating the disease. These medical uses can all be contemplated by the present invention. Subjects in need of treatment, delay and / or prevention of conditions associated with infection can be any animal subject, preferably mammals, more preferably broilers, such as chickens. Therefore, subjects can include livestock, such as pigs (e.g., domestic pigs). Examples of subjects also include dogs or cats, or human subjects.

[0459] The compound specifically targeting bacterial cells may be an endolysin polypeptide according to the invention, or a polynucleotide according to the invention, or a nucleic acid construct according to the invention, or an expression construct according to the invention, or a host cell according to the invention or a composition according to the invention.

[0460] The endolysin polypeptide according to the invention, or the polynucleotide according to the invention, or the nucleic acid construct according to the invention, or the expression construct according to the invention, or the host cell according to the invention or the composition according to the invention can be conveniently used in a method for treating an intracellular bacterial infection in a subject in need thereof, comprising:

[0461] An effective amount of an agent that increases the intracellular pH of the host cell and / or an intracellular compartment of the host cell is administered, and an effective amount of an antimicrobial agent is administered. Said method is herein referred to as the method according to the invention.

[0462] The inventors have surprisingly identified that the treatment of certain diseases or illnesses in animals can be achieved by an antimicrobial preparation comprising a whole cell composition, wherein the whole cell of the composition is a microalgae host cell, which comprises an endolysin polypeptide with antimicrobial activity or comprises a fragment or variant of an endolysin polypeptide, wherein the fragment or variant has antimicrobial activity. The endolysin polypeptide or a fragment or variant of an endolysin polypeptide can be any endolysin polypeptide disclosed herein, or a fragment or variant of an endolysin polypeptide. Alternatively, the endolysin polypeptide or a fragment or variant of an endolysin polypeptide can be any endolysin polypeptide or any fragment or any variant of an endolysin polypeptide having any surprising favorable functional antimicrobial activity described and defined herein. Any such endolysin polypeptide, fragment or variant can therefore be considered to be functionally equivalent to a specific polypeptide disclosed herein. In any such antimicrobial preparation, the endolysin polypeptide, fragment or variant mentioned covers a combination of one or more endolysin polypeptides and / or one or more fragments and / or one or more variants.

[0463] Therefore, the present invention also provides an antimicrobial preparation for use as a medicament, comprising a whole cell composition, wherein the whole cell of the composition is a microalgae host cell, which comprises an endolysin polypeptide having antimicrobial activity, or comprises a fragment or variant of an endolysin polypeptide (wherein the fragment or variant has antimicrobial activity).

[0464] Any such antimicrobial preparation can be used to treat bacterial infections in animals. Any such antimicrobial preparation can be used to treat bacterial infections that are infected by Clostridium perfringens, optionally infections caused by Clostridium perfringens type A strains. Any such antimicrobial preparation can be used to treat diseases or illnesses caused by Clostridium perfringens infection, and Clostridium perfringens infection is optionally an infection caused by Clostridium perfringens type A strains. Diseases or illnesses caused by Clostridium perfringens infection can be food poisoning, gas gangrene, necrotic enteritis, intestinal lesions and / or gastrointestinal infections.

[0465] The present invention also provides a method for preventing or treating a disease or illness in an animal, the method comprising administering to the animal a preventively or therapeutically effective amount of an antimicrobial preparation, the preparation comprising a whole-cell composition, wherein the whole cells of the composition are microalgae host cells, which contain an endolysin polypeptide having antimicrobial activity or a fragment or variant of the endolysin polypeptide, wherein the fragment or variant has antimicrobial activity.

[0466] In any such method, the disease or illness can be a bacterial infection of the animal. In any such method, the bacterial infection can be a Clostridium perfringens infection, optionally an infection caused by a Clostridium perfringens type A strain. In any such method, the disease or illness can be caused by a Clostridium perfringens infection, optionally an infection caused by a Clostridium perfringens type A strain. The disease or illness caused by a Clostridium perfringens infection can be food poisoning, gas gangrene, necrotic enteritis, intestinal lesions and / or gastrointestinal infections.

[0467] In any of the above antimicrobial formulations or methods, the animal can be a poultry animal, optionally a broiler chicken, preferably a chicken; or wherein the animal is a pig, preferably a pig.

[0468] In any of the above antimicrobial preparations or methods, the antimicrobial activity of the endolysin polypeptide, fragment or variant may be bacteriolytic activity and / or bacterial growth inhibitory activity. The bacteriolytic activity and / or bacterial growth inhibitory activity of the endolysin polypeptide, fragment or variant may be bacteriolytic activity and / or bacterial growth inhibitory activity against Clostridium perfringens (preferably type A strains of Clostridium perfringens).

[0469] In any of the above antimicrobial formulations or methods, when the endolysin polypeptide, fragment or variant is tested at a concentration of 5 μg / ml in a standard cell viability assay for Clostridium perfringens strain NCTC8237, it can exhibit a ΔLog10 value of about 0.40 or greater, 2.00 or greater, or 3.70 or greater. In any of the above antimicrobial formulations or methods, when the endolysin polypeptide, fragment or variant is tested at a concentration of 5 μg / ml in a standard cell viability assay for Clostridium perfringens strain NCTC8237, it can exhibit a % reduction in cell viability of about 60% or greater, 70% or greater, 80% or greater, 90% or greater, or 100%. In any of the above antimicrobial formulations or methods, when the endolysin polypeptide, fragment or variant is tested against Clostridium perfringens strain NCTC8237 at a concentration of 5 μg / ml in a standard cell turbidity reduction assay, it may exhibit a t50% lysis value of 7 minutes or less; or it may exhibit a t50% lysis value of 3 minutes or less. In any of the above antimicrobial formulations or methods, when the endolysin polypeptide, fragment or variant is tested against Clostridium perfringens strain NCTC8237 at a concentration of 5 μg / ml in a standard cell turbidity reduction assay, it may exhibit a t50% lysis value of 7 minutes or less; or it may exhibit a t50% lysis value of 3 minutes or less. 4When the endolysin polypeptide, fragment or variant is tested against Clostridium perfringens strain Cp6 at 10 cells / mL, it may exhibit a MIC / MBC value of 17 μg / mL or less, preferably 1.7 μg / mL or less; or it may exhibit a MIC / MBC value of 0.65 μM or less, preferably 0.05 μM or less.

[0470] Method for obtaining the endolysin of the present invention

[0471] The present invention also provides a method for producing the endolysin polypeptide according to the present invention, comprising:

[0472] The host cell according to the invention is cultured under conditions conducive to the production of the endolysin polypeptide, the endolysin polypeptide is optionally isolated and purified from the culture broth, and the endolysin polypeptide is optionally freeze-dried.

[0473] Polypeptides as disclosed herein can be produced by any suitable means. For example, the polypeptide can be directly synthesized using standard techniques known in the art, such as Fmoc solid phase chemistry, Boc solid phase chemistry or by solution phase peptide synthesis. Alternatively, the polypeptide can be produced by transforming a host cell (usually a bacterium, such as an Escherichia coli cell) with a nucleic acid molecule or a vector encoding the polypeptide. Producing polypeptides by expression in bacterial host cells is described herein and summarized in the examples (see Example 2). The polypeptide of the present invention can also be produced by being transformed into an algae host cell.

[0474] When exogenous DNA has been introduced into a host cell, the host cell has been "genetically modified" or "transformed" or "transfected" by exogenous DNA (e.g., a recombinant expression vector). The presence of exogenous DNA results in permanent or temporary genetic changes. The transforming DNA may or may not be integrated (covalently linked) into the genome of the cell. For example, in prokaryotes (e.g., E. coli), yeast, and mammalian cells, the transforming DNA may be maintained on an episomal element such as a plasmid. For eukaryotic cells, stably transformed cells are cells in which the transforming DNA has been integrated into the chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of eukaryotic cells to establish cell lines or clones containing a population of daughter cells containing the transforming DNA. A "clone" is a population of cells derived from a single cell or a common ancestor by mitosis. A "cell line" is a clone of a primary cell that is able to stably grow for multiple generations in vitro.

[0475] Suitable gene modification (also referred to as "transformation") methods include, for example, viral or bacteriophage infection, transfection, conjugation, protoplast fusion, lipofection, electroporation, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran-mediated transfection, liposome-mediated transfection, particle gun technology, calcium phosphate precipitation, direct microinjection, nanoparticle-mediated nucleic acid delivery, etc. The choice of the gene modification method generally depends on the type of cell to be transformed and the environment in which the transformation occurs, and will be apparent to the skilled person.

[0476] The present invention also includes cells that have been modified to express the polypeptides of the present invention. Such cells can be modified to carry expression vectors encoding the polypeptides of the present invention. Such cells generally include prokaryotic cells, such as bacterial cells, e.g., E. coli. Such cells can be cultured using conventional methods to produce the polypeptides of the present invention. Preferably, the cells of the present invention are cells of algal cells.

[0477] The polypeptides may be derivatized or modified to facilitate their production, separation or purification. For example, when the polypeptides of the invention are produced by recombinant expression in bacterial host cells, the sequence of the polypeptide may include an additional methionine (M) residue at the N-terminus to improve expression.

[0478] As another example, the polypeptide of the present invention can be derivatized or modified by adding a ligand that can directly and specifically bind to the separation tool. Alternatively, the polypeptide can be derivatized or modified by adding a component of the binding pair, and the separation tool comprises a reagent derivatized or modified by adding another component of the binding pair. Any suitable binding pair can be used. In a preferred embodiment in which the polypeptide of the present invention is derivatized or modified by adding a component of the binding pair, the polypeptide is preferably histidine-tagged or biotin-tagged. Usually, the amino acid coding sequence containing histidine or biotin tags at the gene level is contained at the gene level, and the polypeptide is recombinantly expressed in Escherichia coli. The histidine or biotin tag is usually present at either end of the polypeptide, preferably at the C-terminus. It can be directly connected to the polypeptide or indirectly connected by any suitable linker sequence (such as 3, 4 or 5 glycine residues), such as 3, 4 or 5 glycine residues. The histidine tag is usually composed of 6 histidine residues, although it can be longer than this (usually up to 7, 8, 9, 10 or 20 amino acids) or shorter (such as 5, 4, 3, 2 or 1 amino acids).

[0479] The amino acid sequence of a polypeptide can be modified to include non-naturally occurring amino acids, for example to increase stability. When the polypeptide is produced by synthetic means, such amino acids can be introduced during the production process. The polypeptide can also be modified after synthesis or recombinant production. The polypeptide can also be produced using D-amino acids. In these cases, the amino acids will be linked in reverse sequence in the C to N direction. This is conventional in the art for producing such polypeptides.

[0480] Many side chain modifications are known in the art, and the side chains of a polypeptide may be modified provided that the polypeptide retains any further desired activity or characteristics as may be specified herein. It will also be appreciated that polypeptides may be chemically modified, such as post-translationally modified. For example, they may be glycosylated, phosphorylated or contain modified amino acid residues.

[0481] The polypeptide may be pegylated. The polypeptide of the invention may be in substantially isolated form. It may be mixed with a carrier or diluent (as described below) that does not interfere with the intended use and still be considered substantially isolated. It may also be in substantially purified form, in which case it will generally account for at least 90% (e.g., at least 95%, 98%, or 99%) of the protein in the preparation.

[0482] Example

[0483] The following examples are provided to illustrate the present invention but are not intended to limit the present invention.

[0484] Example 1: Bioinformatics search

[0485] There are many genome sequences of C. perfringens strains and C. perfringens phages available. The Clostridium perfringens genomes NC_008261.1, NC_003366.1, CP000312.1, NZ_CP009557.1, NZ_CP010993.1, NZ_CP010994.1, NZ_AP017630.1, NZ_CP013101.1, NZ_CP023410.1, and bacteriophage genomes NC_003524, NC_019506, NC_019496, NC_019508, NC_011318, NC_017980, NC_018083, NC_017978, NC_018084, NC_021325, JF767210, and NC_008265 were selected for sequence similarity searches of endolysin genes. The BLAST tool of National Center for Biotechnology Information (NCBI) is used to identify similarity sequences with the following endolysin genes (Ply3626, CP51L, PlyCP26F, Ply39O and plyS9) at the amino acid level, but the identity is less than 75%. In addition, PHASTER software (phaster.ca) is used to analyze Clostridium perfringens genome sequence to search for potential prophage regions. The prophage regions of screening and identification are subsequently to find potential endolysin sequences. Interested endolysin sequences (SEQ ID NO:1 to 11) are listed in Table 1 below.

[0486] Example 2: Construction of E. coli expression vector for co-expression of synthetic tRNA

[0487] Endolysin is a protein with antimicrobial activity and can be potentially toxic to E. coli cloning strains. Therefore, a cloning strategy is implemented to minimize unwanted recombinant endolysin expression. The endolysin coding sequence is engineered to replace the endogenous tryptophan "TGG" codon with a "TGA" stop codon. This is done to the first Trp codon or the first and second Trp codons of the endolysin coding sequence. Therefore, unless the tryptophan tRNA (i.e., tRNA-Wtca) with an anticodon sequence that is mutated to "TCA" is co-expressed with the endolysin gene, accumulation of recombinant endolysin should not be observed.

[0488] After the successful cloning of the potentially toxic endolysin gene, an E. coli expression strain capable of producing the endolysin is also necessary. The expression vector system pETDuet (Merck Millipore) was selected for recombinant expression of endolysins in E. coli. This system has two advantages: (i) the pETDuet vector has two multiple cloning sites (MCS) that place the selected DNA sequence under the control of two independent T7 polymerase promoters, and (ii) both T7 polymerase promoters are engineered to respond to the presence of IPTG in the culture medium, allowing for tight control of gene expression. The latter feature is important because 36% of the stop codons in E. coli are TGA, and the production of tRNA-Wtca may cause additional toxic effects if expression is not controlled. The mutant tRNA-Wtca DNA sequence was cloned into one of the MCSs, while the endolysin coding sequence with a mutated tryptophan codon (TGG->TGA) was cloned into the second MCS.

[0489] For the cloning of tRNA-Wtca coding sequence, a 179-bp DNA sequence encoding natural tryptophan tRNA was identified in the genome of Escherichia coli k-12 (GenBank accession number CP028306). The anticodon ("CCA") of the tRNA was replaced by the triplet "TCA". In addition, two 18-bp sequences were added to either end of the DNA sequence to facilitate its cloning into the pETDuet vector by a recombinant method, wherein the entire sequence was externally synthesized (Eurofins Genomics). The 5' and 3' end 18-bp sequences were homologous to the MCS1 sequence of pETDuet, which allowed the use of the Gibson assembly method (New England Biolabs) to direct the cloning of the synthesized gene. The resulting plasmid was sequence verified and named ecAL002.

[0490] To test that the cloned tRNA-Wtca was functional, a red fluorescent protein (RFP) gene containing three WTGG-TGA codons in its coding sequence was cloned into MCS2 of empty ecAL002, generating plasmid ecAL004. The RFP sequence was synthesized externally (Eurofins Genomics) and contained 18-bp flanking sequences at both ends. Directed cloning of the gene into MCS2 of the pETDuet vector was achieved by the Gibson assembly method. As an additional control, another plasmid was constructed in which the tRNA-Wtca sequence was removed from MCS1 of plasmid ecAL004. This plasmid was named ecAL003. Plasmids ecAL002 (tRNA-Wtca only), ecAL003 (RFP only) and ecAL004 (RFP+tRNA-Wtca) were transformed into the Escherichia coli expression strain Rosetta TM (DE3) pLysS (Merck). Transformants were selected based on the ampicillin resistance conferred by the bla gene present on the main chain of the pETDuet-derived plasmid. In order to induce RFP expression, these three strains were grown overnight at 37°C in 5ml Luria broth (LB) medium supplemented with 100μg / ml ampicillin and 25μg / ml chloramphenicol. 1mL overnight culture was used to inoculate 100mL LB-ampicillin-chloramphenicol medium. The culture was grown at 37°C for 2.5 hours, and then IPTG was added to the medium at a final concentration of 1mM to induce the expression of the T7 polymerase promoter. The culture was incubated at 30°C with shaking, and cells were collected by centrifugation after 5 hours.

[0491] Successful expression of RFP was determined by visual inspection and SDS-PAGE. Briefly, protein extracts were obtained from each cell culture. Cell pellets from 25 mL of culture were resuspended in 1 mL of phosphate-buffered saline, pH 7.4 (PBS, pH 7.4) and the cells were lysed after 10 cycles of sonication (10 sec on / off, 10 μm amplitude, for 10 cycles) using Soniprep 150 (MSE). Cells were incubated on an ice bath during sonication to prevent overheating of the sample. The crude lysate was centrifuged at 16,600 × g for 5 min at 4 °C and the clarified lysate (supernatant) was collected. The clarified lysate samples were analyzed by SDS-PAGE using a 3-electrophoresis system (Bio-rad) to assess the expression level of RFP. The clarified lysate samples were mixed with 2× Laemmli buffer (Bio-rad) and 100 mM DTT in a 1:1 ratio and then denatured at 100°C for 5 minutes. The denatured Laemmli samples were then loaded and dissolved in 4-15% precast polyacrylamide, 15-well Mini-Protean TGX gels (Bio-rad).

[0492] Regarding the growth of the three strains, they all reached comparable OD600nm after IPTG induction, indicating that the expression of tRNA-Wtca had no significant toxicity to the cells. When the cells carrying the ecAL004 plasmid were obviously red 6 hours after induction ( Figure 1 A) and emits clear fluorescence when illuminated under ultraviolet light ( Figure 1 In contrast, cells carrying the ecAL002 or ecAL003 plasmids showed neither color nor fluorescence. SDS-PAGE analysis of clarified lysates provided additional confirmation. Gel staining with InstantBlue (Expedeon) revealed a protein band at the 25 kDa protein marker that was only present in extracts of cells carrying the ecAL004 plasmid and containing the tRNA-Wtca and RFP coding sequences ( Figure 1 C). Since the expected molecular weight of RFP is 27 kDa, it was confirmed that RFP was being expressed, as the sample also agreed with the indicated visual inspection. In contrast, this band at 27 kDa was absent in the protein extracts obtained from the other two strains. Therefore, the results strongly suggest that the tRNA-Wtca sequence cloned into the pETDuet construct is correctly transcribed and processed, while without it, expression of the synthetic gene with the WTGG-TGA codons could not be observed.

[0493] Example 3: Construction of endolysin expression vector and transformation of E. coli

[0494] The ecAL002 vector described in Example 2 was used as an expression vector for phage-derived endolysin. The endolysin coding sequence described in Example 1 was modified to replace one or two tryptophan codons "TGG" (ie, WTGG-TGA) with the stop codon "TGA" (ie, WTGG-TGA). In this way, the recombinant endolysin will only be translated when the modified tRNA-Wtca molecule is co-expressed at the same time, as described in Example 2. In addition, N-terminal FLAG (DYKDDDDK), C-terminal HA (YPYDVPDYA), C-terminal Strep (WSHPQFEK) or C-terminal 6×HIS (HHHHHH) tags were added to the endolysin coding sequence (Table 5). A FLAG-tag was added to the N-terminus of endolysins AMI3CPF4969 (SEQ ID NO: 11), GH25CPFORC3 (SEQ ID NO: 1) and GH25phiS63 (SEQ ID NO: 5); an HA-tag was added to the C-terminus of endolysins AMI2CPJP838 (SEQ ID NO: 9), AMI2phiZP2 (SEQ ID NO: 3), AMI2phiCPV4 (SEQ ID NO: 2) and GH25CPF4969 (SEQ ID NO: 8); and a Strep-tag was added to the C-terminus of endolysins AMI3CPFORC25 (SEQ ID NO: 6), AMI3CPJP55 (SEQ ID NO: 10), AMI3CPSM101 (SEQ ID NO: 4) and AMI3phi24R (SEQ ID NO: 7). Additional expression vectors were constructed to express AMI2phiCPV4 (SEQ ID NO: 2) and GH25CPF4969 (SEQ ID NO: 8) endolysins with a C-terminal 6×HIS-tag. For C-terminal HA-, Strep- and 6×HIS-tags, a 'GSAGSG' flexible linker was also included between the tag and the endolysin protein. Endolysin coding sequences with W (TGG->TGA) codon modifications fused to an N-terminal FLAG tag or C-terminal HA and Strep tags were synthesized externally (Eurofins Genomics). The synthetic genes were then PCR amplified using specific primers with a 20-nt tail matching the sequence of MCS2 on ecAL002 (Table 18). This allowed directional cloning into the vector by the Gibson assembly method. PCR conditions consisted of an initial denaturation step at 94° C. for 5 min, followed by 30 cycles at 98° C. for 10 s, 63-68° C. for 30 s, and 72° C. for 50 s, and a final extension step at 72° C. for 10 min. PCR was performed using the high-fidelity DNA polymerase Phusion (New England Biolabs) according to the manufacturer's instructions.The amplified DNA fragments were purified using the QIAquick Gel Extraction Kit (QIAgen) following the manufacturer's instructions and cloned into the ecAL002 vector using the NEBuilder HiFi DNA Assembly Kit (New England Biolabs). The cloning reactions were transformed into coli cells, and transformants were selected on LB medium containing 100 μg / mL ampicillin. DNA plasmids were extracted from transformant cultures using the QIAprep Miniprep Kit (QIAgen) and sequenced by Sanger sequencing (Eurofins Genomics).

[0495] Plasmids ecAL006 and ecAL007 described in Table 5 were modified to replace the C-terminal HA tag fused to AMI2phiZP2 and AMI2phiCPV4 with a C-terminal 6×HIS tag. Plasmid modifications were performed by site-directed mutagenesis using the Q5 site-directed mutagenesis kit (New England Biolabs). Primer pairs O_341 / O_351 and O_342 / O_351 described in Table 18 were used to amplify the full length of ecAL006 and ecAL007, respectively, by PCR. Primer O_351 carries the sequence required for the synthesis of the 6×HIS tag. Amplified DNA fragments were amplified and enzymatically modified according to the recommendations of the manufacturer of the site-directed mutagenesis kit. The reactions were transformed into coli cells, and transformants were selected on LB medium containing 100 μg / mL ampicillin. The resulting plasmids plAL073 (encoding 6×HIS-tagged AMI2phiZP2) and plAL071 (encoding 6×HIS-tagged AMI2phiCPV4) were extracted from the transformant culture using the QIAprep Miniprep Kit (QIAgen) and then sequenced (Eurofins Genomics).

[0496] Table 5 lists the vectors constructed for expressing the tagged endolysin in E. coli, and Table 18 lists the primer sequences used to construct the expression vectors. The plasmids were then transformed into Rosetta Stone® according to the manufacturer's instructions. TM (DE3)pLysS Escherichia coli strain (Merck Millipore). The corresponding bacterial strain IDs are also listed in Table 5.

[0497] Example 4: Expression of endolysins from E. coli

[0498] In addition to the bAL002 control strain, E. coli strains bAL007 to bAL017 (Table 5), prepared as described in Example 3, were cultured to confirm endolysin expression prior to any biochemical analysis.

[0499] By inoculating the 5mL LB substratum containing 100μg / mL ampicillin and 25μg / mL chloramphenicol with a scraping sample of a small amount of freezing 50% glycerol stock, start the culture of interested expression strain.By 5mL inoculum in incubator at 37 ℃ with 275RPM shaking culture overnight (14-18 hours).After overnight growth, when E. coli culture has reached stationary phase, 1mL overnight inoculum is inoculated into the 100mL LB substratum containing 100μg / mL ampicillin and 25μg / mL chloramphenicol (i.e. effectively diluted 100 times).The 100mL LB substratum in 500mL shaking flask is cultured at 37 ℃ with 275RPM shaking culture.After pre-induction, growth for 2.5 hours before, by in 100mL culture, add 1mM IPTG induction endolysin expression.Then, incubator temperature is reduced to 30 ℃ and continue to incubate culture culture for other 5 hours. Cells were harvested by transferring 25 mL of each culture to 50 mL Falcon tubes and centrifuged at 3800 × g at 4 ° C for 15 minutes in a centrifuge. If not used immediately, the culture medium is removed and the cell pellet is stored at -20 ° C. Protein was extracted from the cell pellet derived from 25 mL culture by ultrasonic lysis. The cell pellet was first resuspended in 1 mL PBS (pH 7.4) and then lysed using ultrasonic treatment (10 seconds on / off, by 10 μm amplitude, for 10 cycles). Then, the crude lysate was centrifuged at 15 ° C for 30 minutes at 16600 × g. The clarified lysate was subsequently diluted in the PBS of pH 7.4 for SDS-PAGE analysis.

[0500] Endolysin expression was confirmed using SDS-PAGE. Clarified lysates were prepared for SDS-PAGE by mixing with 2×Laemmli buffer at 1:1 and adding 100mM DTT. Then, the samples were boiled at 99°C for 15 minutes. 500μg / ml BSA standards were also prepared as references. 10μL of the prepared samples and BSA standards were loaded into a 4-15%, 15-well TGX gel setup in a Bio-rad Mini Protean gel tank (Bio-rad) with 1×TGS running buffer (Bio-rad). SDS-PAGE was run at a constant 150V for 60 minutes using a PowerPac Basic power supply (Bio-rad). After the SDS-PAGE run, the protein gel was stained with InstantBlue (Expedeon) and then destained with MQ H2O. The destained gel was imaged on a Vilber Bio-Print imager (Vilber) using Bio-Vision software (Vilber).

[0501] SDS-PAGE results showed that endolysin was expressed in all strains except bAL014 when compared with the background protein profile of the control strain bAL002 ( Figure 2 ).

[0502] Example 5: Cultivation and storage of Clostridium perfringens reference strain

[0503] Since Clostridium perfringens is an anaerobic bacterium, in order to maintain the viability of the bacteria, all plastic consumables, buffers, growth media and agar plates were pre-reduced in a Don Whitley MACS MG 500 anaerobic workstation (Don Whitley Scientific) to exclude oxygen exposed to the organism. Unless otherwise stated, all bacterial manipulations were also performed in this anaerobic workstation.

[0504] 8 A-type Clostridium perfringens A-type reference strains (NCTC: 2837, 8235, 8237, 8238, 8239, 8359, 8678, 10578) were obtained from the Public Health England culture collection center and stored for future use in enzybiotic analysis. Briefly, the lyophilized culture powder was reconstituted and resuspended in 500 μL RCM (Oxoid). Afterwards, 150 μL of the reconstructed mixture was used to inoculate the double blister medium (Southern Group Laboratory) in a universal glass bottle. The culture was grown overnight at 37°C in an anaerobic workstation. The stock solution of each strain was stored at 4°C.

[0505] Example 6: Cultivation and storage of DSMZ strains

[0506] Since the non-perfringens strains obtained were anaerobic and to maintain bacterial viability, all plastic consumables, buffers, growth media and agar plates were pre-reduced in a Don Whitley MACS MG 500 anaerobic workstation to exclude oxygen exposure to the organisms. Unless otherwise stated, all manipulations of bacteria were also performed in this anaerobic workstation.

[0507] Clostridium coli (DSMZ 6011), Clostridium tenella (DSMZ 753), Clostridium cellobiose (DSMZ1351) and Bifidobacterium adolescentis (DSMZ 20083) were obtained from the Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures and stored for future use in antibiotic enzyme analysis. In brief, the lyophilized culture powder was reconstituted and resuspended in 500 μL RCM. Afterwards, 150 μL of the reconstructed mixture was used to inoculate the bifidobacterium culture medium in a universal glass bottle. The culture was grown overnight at 37°C in an anaerobic chamber. The stock solution of each strain was stored at 4°C.

[0508] Example 7: Cultivation and storage of field isolates of Clostridium perfringens

[0509] Since C. perfringens is an anaerobe and to maintain bacterial viability, all plastics, buffers, growth media, and agar plates were pre-reduced in a Don Whitley MACS MG 500 anaerobic workstation to exclude oxygen exposure of the organisms. All manipulations of bacteria were also performed in an anaerobic chamber unless otherwise stated.

[0510] Eight field isolates of Clostridium perfringens type A (APHA: B00907, B00917, B00954, B00964, B00976, G00033, W000101, W00102) were obtained from the United Kingdom Animal and Plant Health Agency and stored for future use in antibiosis analysis. Briefly, culture swabs shipped in Amies agar were used to inoculate 15 mL of bibulous meat medium in universal glass bottles. Cultures were grown overnight at 37°C in an anaerobic chamber. Stock solutions of each strain were stored at 4°C.

[0511] Example 8: Screening of Clostridium perfringens reference strains using clarified lysate

[0512] Using a spot assay, clarified lysates obtained from shake flask cultures expressing AMI2CPF4969, AMI2CPJP838, AMI2phiCPV4, AMI2phiZP2, AMI3CPFORC25, AMI3CPJP55, AMI3CPSM101, AMI3phi24R, GH25CPF4969, and GH25CPFORC3, as well as from cultures transformed with the blank plasmid ecAL002, were tested for endolysin lytic activity against the eight C. perfringens reference strains described in Example 5. Clarified lysates from the strain expressing AMI3phi24R were also screened because endolysin may still be expressed but not sufficiently to be observed on a protein gel.

[0513] The working stock culture of each reference strain was inoculated in BHI+C medium with a 100-fold dilution and incubated overnight at 37°C in a DonWhitley MACS MG 500 anaerobic workstation. For each strain, the overnight stationary phase Cp culture was diluted 10 times using RCM, and 900 μL of the diluted culture was plated on RCM+1% agar plates. After incubation overnight at 37°C in an anaerobic workstation, these plates were grown with cell moss. These plates were named "cell moss" plates. In addition, another set of RCM+1% agar plates were plated with 900 μL of 10-fold diluted cultures. These plates were named "newly plated cells" plates and were used immediately for spot determination. bAL002 and bAL007–bAL017 E. coli cell pellets from 20 mL cultures were resuspended in 500 μL in vitro GIT buffer (2.4 g / L beef extract, 5.0 g / L yeast extract, 2.5 g / L glucose, 10.0 g / L tryptone, 0.6 g / L cysteine ​​hydrochloride, and 5.0 g / L sodium chloride; pH 6.4). Resuspended cells were lysed by sonication (10 s on / off, 10 μm amplitude for 10 cycles). Crude lysates were then centrifuged at 16,600 × g for 30 min at 15°C. 10 μL of the clarified lysate was dispensed onto Whatman filter paper placed on cell lawns or freshly plated cells. 10 μL of the clarified lysate from bAL002 culture was spotted on the plate as a negative control. Other negative controls spotted included PBS 7.4 and in vitro GIT buffer with and without overnight pre-reduction in an anaerobic chamber. Positive controls prepared and spotted included 20 μg / ml ampicillin, 10 μg / ml chloramphenicol, 20 μg / ml spectinomycin, 1 mg / mL lysozyme, 1 mg / mL or 10 mM EDTA disodium (pH 7.8), and 1 mg / mL lysozyme + 1 mg / mL or 10 mM EDTA disodium. After spotting 10 μL of sample onto cell lawns prepared from each strain and freshly plated cells, the agar plates were incubated overnight at 37°C in an anaerobic workstation. Spot assay results were imaged on a Vilber Bio-Print using Bio-vision software. The Clostridium perfringens strains were screened in two groups: 1) NCTC 2837, 8235, 8238, 8678 and 10578; 2) NCTC 8237, 8239 and 8359.

[0514] The relative antimicrobial activity of endolysins against eight reference strains was qualitatively assessed based on the presence and size of clearance zones generated by freshly plated cells and cell lawns. Spot assays on freshly plated cells (FP) were used to assess the inhibitory effect of endolysins on bacterial growth. Alternatively, spot assays on cell lawns (CL) were used to assess the lytic activity of endolysins. In both tests, if the endolysin showed an inhibitory effect or lytic activity, a clearance zone would appear around the filter paper to which the endolysin was added. Exemplary spot assay results for each screening group are shown in Figure 3 and Figure 4 In. A summary of the antimicrobial response of various Clostridium perfringens strains to endolysate lysates expressed by Escherichia coli is shown in Table 6. Screening Group 1 shows that the expressed endolysins are generally active against the strains tested, and their relative activity depends on the strains screened. The lytic activity of the endolysins varies depending on whether the Clostridium perfringens strain is screened on freshly paved cells or cell mosses. These differences can be caused by the growth rate of the strain, the remodeling of the cell wall during the stationary phase, and / or the bacterial load on the agar plate surface. In addition, the results of Group 1 show that ampicillin is effective for freshly paved cells, but ineffective for already grown cell mosses. This result is consistent with the antibacterial activity of ampicillin. In contrast, some endolysins exhibit antimicrobial activity against both types of plated cells. Chloramphenicol and spectinomycin antibiotics generally have no effect on inhibiting the growth of Clostridium perfringens, and 1 mg / mL lysozyme and 1 mg / mL disodium EDTA have no effect. Similar results were observed in Screening Group 2. In this group, lysates bAL007 and bAL012 were not screened because they did not show activity at all in the previous screening. Higher concentrations of EDTA (10 mM) showed an inhibitory effect on freshly plated cells. 1 mg / mL lysozyme had little effect on the strains tested in Group 2, but only in the case of fresh plating. From this semi-quantitative assay, five endolysins (AMI2phiCPV4 (bAL009), AMI2phiZP2 (bAL010), AMI3phi24R (bAL014), GH25CPFORC3 (bAL016) and GH25phiS63 (bAL017)) were selected for additional characterization. They were selected based on their broad-spectrum antimicrobial activity against different Clostridium perfringens strains, activity against freshly plated cells and cell mosses, including estimation of their expression levels according to the SDS-PAGE analysis performed in Example 4.

[0515] Example 9: Screening of E. coli-expressed endolysins on four non-CP bacterial species

[0516] In addition to the screening against C. perfringens strains, the E. coli expressed endolysins were screened against four non-Cp bacterial species commonly found in the poultry gut to determine if the identified endolysins were specific only for Cp. The screening of the four non-CP species C. coli (DSMZ 6011), C. tenella (DSMZ 753), C. cellobiose-producing (DSMZ 1351), and B. adolescentis (DSMZ 20083) was performed in parallel with the screening set 2 in Example 8. Therefore, the method and spot assay sample layout were also as described previously.

[0517] The screening results and summary of the endolysins expressed in E. coli against four non-target bacterial species are shown in Figure 5 and Table 7. Based on species, both 20 mM ampicillin and 10 mM disodium EDTA showed inhibitory effects on freshly plated cells, but had no effect on cell lawns. This is similar to what was observed with chloramphenicol. Endolysin clarified lysates and lysozymes had no antimicrobial activity against any of the non-target bacterial species screened. This result suggests that the identified endolysins may be specific only to Cp strains.

[0518] Example 10: Affinity Purification of AMI2phiCPV4, AMI2phiZP2 and GH25CPFORC3 Endolysins

[0519] The first three endolysins from bAL009 (AMI2phiCPV4), bAL010 (AMI2phiZP2), and bAL016 (GH25CPFORC3) E. coli strains were affinity purified in order to produce purified and concentrated endolysin stocks free of contaminating native E. coli lytic proteins, which were found to interfere with preliminary antimicrobial assays (unpublished results).

[0520] The shake flask expression of each endolysin from bAL009, bAL010 and bAL016 E. coli strains was performed as previously described in Example 4. 200 mL LB growth medium was used for each endolysin expression instead of 100 mL in a 1 L shake flask. The inoculum size and antibiotic amount were also adjusted accordingly. After harvest, 4 cell pellets derived from approximately 50 mL of culture were obtained for each strain. Protein was extracted from each cell pellet by ultrasonic lysis. The cell pellet was first resuspended in 1 mL PBS (pH 7.0) and then lysed using ultrasonic treatment (5 seconds on / off, at 10 μm amplitude, for 10 cycles). Then, the crude lysate was centrifuged at 16,600 × g for 30 minutes at 15 ° C. In a 50 mL Falcon tube, the clarified lysate from each precipitation was mixed with 24 mL PBS (pH 7.0) and 10% glycerol. A piece of cOmplete micro-EDTA-free protease inhibitor was added to each tube. Monoclonal anti-HA agarose, clone HA-7 affinity matrix was used to bind HA-tagged AMI2phiCPV4 and AMI2phiZP2 endolysin, while anti-FLAG M2 affinity gel was used to bind FLAG-tagged GH25CPFORC3 endolysin. After cleaning the affinity matrix according to the supplier's instructions, 400 μL of the corresponding matrix suspension in PBS (pH 7.4) was mixed with 25 mL of lysate / PBS / glycerol solution. The labeled endolysin was bound to the affinity matrix and gently mixed overnight (~14-16 hours) at 4°C. After binding overnight, each protein-bound suspension was centrifuged at 3800 × g for 5 minutes at 20°C to precipitate the affinity matrix. Carefully remove the supernatant from each tube, carefully resuspend the affinity matrix in 500 μL PBS (pH 7.0) buffer, and transfer to a Pierce spin column (Thermofisher). Each centrifugal column with affinity matrix was centrifuged at 8000RPM for 30 seconds to remove PBS. 500 μL PBS (pH 7.0) buffer was added to the centrifugal column and centrifuged again to wash the affinity matrix. The process was repeated 6 times. The endolysin of FLAG-labeled and HA-labeled was eluted by incubating the affinity matrix in PBS (pH 7.0) of 500 μL 100 μg / mL FLAG peptide or PBS (pH 7.0) of 100 μg / mL HA peptide, respectively. Each elution was gently mixed and incubated at room temperature for more than 15 minutes. By centrifuging the centrifugal column at 8000RPM for 30 seconds, the eluted fraction was collected in a new 2mL microcentrifuge tube. For each centrifugal column with affinity matrix, the process was repeated 6 times. Vivaspin 20,10MWCO PES membrane concentrator (Sartorius AG) was used to collect and concentrate the eluted fractions derived from the same endolysin expression. The concentrator was centrifuged at 3000 x g at 20°C for 30 minutes or until the concentrate was less than 200 μL.10mL PBS (pH 7.0) buffer was added to the concentrate and centrifuged again under the same conditions to remove residual eluted peptides. The concentrate was concentrated until it was less than 200 μL, and then transferred to a 1.5mL microcentrifuge tube. After aliquoting the purified and concentrated endolysin stock solution analyzed by SDS-PAGE, 5 μL aliquots were distributed in 8-well strip tubes (strip tube) wells and stored frozen at -80°C.

[0521] The purified endolysin stock solution was subjected to SDS-PAGE and densitometric analysis to quantify the concentration of the purified endolysin. A BSA standard curve consisting of the following final concentrations in 2× Laemmli buffer was prepared: 12.5μg / mL, 25μg / mL, 50μg / mL, 100μg / mL, 200μg / mL. The purified endolysin stock solution was diluted 10-fold, 20-fold, and 40-fold using 2× Laemmli buffer. 100mM DTT was added to BSA and diluted endolysin Laemmli samples and boiled at 99°C for 15 minutes. 10uL of the prepared samples and BSA standards were loaded into a 4-15%, 15-well TGX gel setup in a Bio-rad Mini Protean gel tank with 1× TGS running buffer. SDS-PAGE was run at a constant 150V for 80 minutes. After the SDS-PAGE run, the protein gel was stained with InstantBlue and destained with MQ H2O. Destained gels were imaged on a Vilber Bio-Print using Bio-Vision software. Densitometric analysis to quantify the concentration of purified endolysin stocks was also performed using the onboard software.

[0522] SDS-PAGE analysis of the buffer-exchanged and concentrated elution fractions showed that the enzyme was purified. The SDS-PAGE migration of the endolysin protein bands was not completely consistent with the theoretical molecular weights of GH25CPFORC3 (~40 kDa, lanes 7-9), AMI2phiCPV4 (~26 kDa, lanes 10-12) and AMI2phiZP2 (~26 kDa, lanes 13-15). The reasons for this were not further investigated, but it is clear that the proteins of interest were fully purified with minimal amounts of contaminant proteins. A BSA standard curve was used for densitometry analysis and quantification of the purified endolysin stock solution. Although the BSA standard showed some degraded protein fragments, it was considered negligible compared to its major band at ~66.5 kDa. Densitometry analysis and quantification showed that the stock concentrations of GH25CPFORC3, AMI2phiCPV4, and AMI2phiZP2 were approximately 2400 μg / mL, 750 μg / mL, and 1000 μg / mL, respectively.

[0523] Example 11: Spot Assay on Clostridium perfringens Strains Using Purified Endolysins

[0524] In Example 8, a spot assay was performed using clarified lysates to screen the antimicrobial activity of E. coli expressed endolysins. In this example, the antimicrobial activity of endolysins using purified proteins was examined and tested against additional strains of C. perfringens.

[0525] NCTC reference strains and APHA field isolates were cultured as described in Examples 5 and 7, respectively. Purified endolysins were immunopurified as described in Example 10. The antimicrobial activity of each endolysin was evaluated using freshly plated cells or cell lawns, and the preparation method was similar to that described in Example 8, except that 750 μL of stationary phase culture was used to inoculate 140 mm diameter RCM, 1% agar plates. Endolysins at concentrations of 100 μg / mL, 50 μg / mL, and 10 μg / mL were also similarly spotted on freshly plated cells and cell lawns. In short, a 10 mm paper disk was placed on top of freshly plated cells or cell lawns, and 10 μL of purified endolysin (100 μg / mL, 50 μg / mL, or 10 μg / mL) was spotted on the disk. Two replicates of a buffer control (PBS, pH 7.4) and a 50 μg / mL lysozyme control were also spotted. The agar plates were then incubated at 37°C for 44-48 hours to allow the clearing zone to form.

[0526] The summary of the point determination results is shown in Table 8 and Table 9.GH25CPFORC3 endolysin can inhibit the bacterial growth of most bacterial strains and isolates, while AMI2phiCPV4 and AMI2phiZP2 can not inhibit bacterial growth (Table 8) under test concentration.The inhibition level of GH25CPFORC3 varies with bacterial strains, although field isolates are often more sensitive to the endolysin effect than reference strains.Under the concentration tested, GH25CPFORC3 does not show an inhibitory effect to reference strains NCTC 8237 and NCTC 8238.In most bacterial strains, all three kinds of endolysins are lytic and produce a clearance zone, wherein GH25CPFORC3 clearance zone is the most significant (Table 9).In general, GH25CPFORC3 seems to show the maximum antimicrobial activity in the endolysin of three kinds of tests, and also has a wider spectrum of antimicrobial activity to the Clostridium perfringens strains screened.Current point determination results also show that the antimicrobial activity of AMI2phiCPV4 and AMI2phiZP2 is similar. Compared to purified endolysin, 50 μg / mL lysozyme showed neither any inhibitory effect nor any lytic activity against any of the tested strains.

[0527] In conclusion, GH25CPFORC3 was ranked as the highest performing endolysin, while AMI2phiV4 and AMI2phiZP2 performed similarly in the spot assay. In addition, GH25FORC3 exhibited a broad spectrum of antimicrobial activity against different strains of C. perfringens.

[0528] Example 12: Turbidity reduction assay

[0529] The relative lytic activity of the purified endolysins GH25CPFORC3 (i.e. 'FORC3), AMI2phiCPV4 (i.e. 'V4) and AMI2phiZP2 (i.e. 'ZP2) was assessed using a turbidity reduction assay at room temperature (i.e. 23° C.) and in PBS buffer (pH 7.0) (assuming minimal cell growth in this case). The assay was performed to rank the lytic performance between the three endolysins and to characterize the dose response of each endolysin to different strains of C. perfringens. Egg white lysozyme (sigma, known to have a lytic effect on C. perfringens, was also included in the assay as a reference enzyme.

[0530] As described in Example 8, 4 reference strains (NCTC 2837, 8237, 8238, 8239) were inoculated and grown overnight to the stationary phase. The stationary phase cells from each culture were inoculated into fresh BHI+C medium and incubated at 37°C for 1.5-2 hours in an anaerobic chamber to allow the culture to reach the exponential phase. Then when OD620nm was ~1.0, the culture was precipitated at 3800 × g at 10°C for 30 minutes, and the used BHI+C supernatant was removed. The cell pellets were kept at room temperature until they were needed to start the turbidity reduction assay. The cells were resuspended in PBS (pH 7.0) buffer with half volume to concentrate the cells. The resuspended Clostridium perfringens cells were subsequently used to start the turbidity reduction assay by mixing 90 μL of resuspended cells per well with 10 μL of 10-fold concentrated lysozyme (Sigma) or endolysin (prepared as described herein) in the following 96 microplate formats ( Figure 8 ). Each endolysin, except lysozyme, was assayed in triplicate at each loading concentration. Two-fold serial dilutions of lysozyme and endolysin stock solutions were prepared using PBS (pH 7.0) buffer. Columns 1 and 2 correspond to PBS control (100 μL PBS (pH 7.0) per well only) and blank control (10 μL PBS (pH 7.0) per well + 90 μL resuspended cells). The effective loading concentrations for each 96-well turbidity reduction assay plate are also shown in Figure 8 middle.

[0531] The plates were monitored for decreased turbidity by kinetic readings of OD620nm at intervals on a microplate reader at 23°C (i.e. room temperature). The assay plates were monitored for 30-60 minutes, or until the OD620nm decreased significantly such that it began to stabilize with higher endolysin loadings.

[0532] The turbidity reduction assay results showed that all three endolysins had lytic activity against the four C. perfringens strains tested (NCTC2837, 8237, 8238, 8239). Because some background cell lysis was observed, it was compared to blank wells (i.e., cell suspension controls). Two sets of analyses (plots) were prepared for each Cp strain: 1) Ranking of endolysins at each loading concentration ( Fig.10 , Fig.12 , Fig.14 and Fig.16 ) and 2) the dose response of each endolysin ( Fig. 9 , Fig.11 , Fig.13 and Fig.15 ). At high endolysin loading (i.e., 5 μg / mL), the lytic activity among the 3 endolysins ranked in the following order: GH25CPFORC3, AMI2phiCPV4, AMI2phiZP2. However, at loading concentrations below 1.25 μg / mL, AMI2phiCPV4 generally exhibited higher lytic activity than GH25CPFORC3. The dose response of the endolysins for each strain was appropriate, with a greater decrease in turbidity reduction with increasing loading concentration. The dose response varied by endolysin and C. perfringens strain. For a loading concentration of 0.31 μg / mL, the lytic activity of all 3 endolysins against the four C. perfringens strains was virtually similar with background lysis. The lysozymes generally exhibited minimal lytic activity, with the exception of strains NCTC 2837 and NCTC 8238. In addition, at loading concentrations above 31 μg / mL, the lysozyme stock solution precipitated when mixed with resuspended cells in PBS (pH 7.0) buffer. Lysozyme had the most significant lytic activity against NCTC 8238, but required higher loading amounts and incubation times to achieve similar levels of turbidity reduction compared to the three endolysins.

[0533] The comparison of the point assay results carried out in turbidity reduction assay results and embodiment 10 shows that the growth and recovery of newly laid cells may have an impact on the shortage of observed clearance zones. All 3 kinds of endolysins show lytic activity to the NCTC strains harvested in its exponential growth phase. These include AMI2phiCPV4 and AMI2phiZP2 endolysins, which do not present clearance zones to newly laid cells. In addition, NCTC8237 and NCTC 8238 strains that seem to be resistant to GH25CPFORC3 in the point assay for newly laid cells show sensitivity to endolysins at this. Interestingly, NCTC 8237 and NCTC 8238 are found to be respectively the most sensitive and the most resistant Clostridium perfringens strains tested in the turbidity reduction assay. Similarly, the 50 μg / mL lysozyme that shows no antimicrobial activity at all in the point assay is found to have slight activity to the reference strain tested here. Therefore, the turbidity reduction assay on resuspended cells allows for the direct assessment of the bacteriolytic activity of endolysins in the absence of convoluting factors such as C. perfringens growth and recovery.

[0534] The summary of the lytic activity of each endolysin against the four strains is listed in Table 10 and plotted on Fig.17 The table and scatter plot summarize the t50% lysis parameter, which is defined as the time required for the endolysin to lyse 50% of the cell suspension at a specific loading concentration. The calculation is performed by comparing the lysis curve of the endolysin to the blank control OD at the beginning of the kinetic reading (i.e., t=0 h) and the PBS control OD (i.e., 0.03), which is assumed to correspond to complete cell lysis. Equation 1 below describes the calculation performed to extract the t50% lysis parameter from the turbidity reduction curve. This parameter can be more succinctly expressed as Fig.17 The ranking between the endolysins in the strains and the dose response of each endolysin. The scatter plot clearly shows that NCTC 8237 appears to be the most sensitive to the endolysins, while NCTC 8238 is the most resistant. No t50% lysis value could be obtained for the lysozyme turbidity reduction assay, except for NCTC 8238, which was the most sensitive to lysozyme. Interestingly, NCTC 8238 was found to be the strain most resistant to the three endolysins.

[0535] In summary, the turbidity reduction assay results confirmed that GH25CPFORC3 had the highest antimicrobial performance, similar to the spot assay results in Example 11. The turbidity reduction assay also enabled the demonstration that AMI2phiCPV4 was more bacteriolytic than AMI2phiZP2, which was not possible with the spot assay.

[0536] Equation 1

[0537] The formula is used to determine the time at which 50% lysis occurs. This equation is used to solve for OD E _ t50％裂解 , which corresponds to the time 0h (ie OD b_t＝0 ) was reduced by 50% of the initial cell suspension loading. When OD reached OD E _ t50％裂解 The time when 50% lysis occurs (i.e., t 50％裂解 ).

[0538]

[0539] Example 13: LOG 10 Lowering Determination

[0540] To better characterize the antimicrobial activity of the purified endolysins, a log10 reduction assay was performed on each endolysin using four reference strains of Clostridium perfringens (NCTC2837, NCTC8237, NCTC8238, NCTC8239). This assay provides a more accurate determination of the antimicrobial activity of the endolysin because it tests the viability level of the reference strains through treatment.

[0541] The assay includes determining the decrease in viability of actively growing cells after endolysin treatment. Clostridium perfringens strains were grown to about 0.6 OD600nm at 37°C in BHI+C under anaerobic conditions. 1.8 mL of culture was centrifuged at 16600 × g for 5 minutes at room temperature. The culture medium was removed and the cell pellet was resuspended in 0.9 mL of resuspension buffer (NaCl 127mM, Na2HPO470mM, NaH2PO4 30mM, pH 7.0). The cell suspension was then diluted to 0.6 OD600nm (~10-20 million cells / ml) with buffer. 20 μL of purified endolysin was added to 180 μL of bacterial suspension at a concentration of 10 μg / mL or 50 μg / mL, or PBS pH7.4 (for "untreated" cell controls), resulting in a final concentration of 1 μg / mL or 5 μg / mL of endolysin. Reactions were incubated at 25°C for 1 hour and viable cell counts were then determined by serial dilution and plating in RCM medium.

[0542] A summary of the log10 reduction assay results for the three endolysins for each reference strain is shown in Table 11.

[0543] In the diluted culture of 0.6OD600nm, it was observed that the average initial bacterial load of all reference strains for log10 reduction determination was about 15.3 million cells / mL. However, spontaneous cell death was observed in the resuspension buffer for 1 hour, ranging from 10-95% of the initial load. Although the viability of NCTC 8238 and NCTC 8239 cells seemed to be negatively affected after resuspension in PBS (pH7.0) buffer, it was impossible to determine the clear correlation of the observations. In order to correct the cell death that does not depend on endolysin during the determination, the log10 reduction value was calculated as the log10 of the ratio of the untreated cell control to the endolysin-treated cells. In addition, the log10 reduction value was used to calculate the reduction percentage of live bacteria for each endolysin. The results of the determination show that the 3 endolysins are active against all 4 test strains including at the lowest concentration (1 μg / ml), although with different effects. The log10 reduction values ​​ranged from 0.03 to 3.76, with GH25CPFORC3 being the most active endolysin against C. perfringens strains ( Fig.19 ). At the highest concentration (5 μg / mL), the median percent reduction for all strains was 85.80% for GH25CPFORC3, while the median percent reductions for AMI2phiCPV4 and AMI2phiZP2 were 75.79% and 51.37%, respectively. These results support the ranking of endolysin performance established from Example 11, from highest performance to lowest performance: 1) GH25CPFORC3, 2) AMI2phiCPV4, 3) AMI2phiZP2.

[0544] Example 14: Algal expression system for endolysin expression

[0545] The algal expression system for expressing endolysin genes in microalgae comprises the following steps:

[0546] (1) Modified strains of Chlamydomonas reinhardtii;

[0547] (2) DNA vectors designed to integrate endolysin genes into the chloroplast genome of algae;

[0548] (3) algae transformation using the glass bead method [1]; and

[0549] (4) Selection based on restoration of photosynthesis adapted to replace all copies of the original chloroplast genome with the genome containing endolysins (homoplasmy).

[0550] strain

[0551] The recipient C. reinhardtii strain used for endolysin expression was TN72 [1]. This strain is the wild-type isolate 137c, which is an mt+ cell wall-deficient derivative of CC-125 [2]. In the TN72 strain, the psbH gene of the chloroplast genome has been deleted by gene replacement with the spectinomycin resistance gene aadA [1]. The psbH gene encodes a component of photosystem II that is involved in the light assimilation of photosynthesis. Therefore, the absence of the psbH protein results in the cells being unable to grow photoautotrophically and requiring acetate in the culture medium for growth.

[0552] Carrier

[0553] The recombinant endolysin gene was introduced into the Chlamydomonas reinhardtii chloroplasts by partial integration of a plasmid derived from pAxi2.0 or a pL2_psbH plasmid. These plasmids carry a 0.8Kb sequence homologous to the downstream sequence of the psbH gene of the algae chloroplast genome, and a 2.4Kb sequence homologous to the region containing the psbH gene and some upstream sequences. The endolysin coding sequence, flanked by 5' and 3' regulatory sequences, was cloned between the two homologous sequences. The 5' and 3' regulatory sequences that drive endolysin gene expression are derived from psbA, psaA, 16S rDNA, atpA and rbcL chloroplast genes. In addition, pAxi2.0 and pL2_psbH plasmids also carry tRNA-W tca A gene that transcribes a modified tryptophan tRNA molecule that allows the codon "TGA" to be translated as tryptophan instead of STOP. The endolysin gene was synthesized in vitro and cloned into the pAxi2.0 and pL2_psbH plasmids using the BsaI site.

[0554] Transformation method (glass bead method)

[0555] For transformation, TN72 bacterial strain is grown to optical density under constant illumination, 25 ℃ and 165rpm rotary shaking in 400mL TAP medium for 0.3-0.6OD750 nm.Then culture is centrifuged 10 minutes with 2000 × g, and cell pellet is resuspended in 1mL TAP medium.0.5mL algae suspension is mixed with pAxi2.0 or pL2_psbH derivative plasmid containing one or two endolysin genes of 40-100 μ g.Then mixture is transferred to the 15mL FALCON tube containing the glass beads of the diameter 425-600 μ m of 600mg acid-washed, and vibrated on vortex oscillator for 15 seconds at maximum speed.Immediately thereafter, 0.5% (w / v) agar TAP maintained at 42 ℃ of 6mL is added in glass beads / cell suspension, and mixture is poured and laid on 1% (w / v) agar HSM plate. After the top layer containing transformed cells solidifies, the plates are incubated in the dark for 24 h and then transferred to a growth chamber at 25 °C with continuous light.

[0556] Selection and homogeneity drive

[0557] Selection was performed based on restoration of photosynthesis. The TN72 strain was unable to grow on HSM medium lacking a carbon source. After partial integration of pAxi2.0 or pL2_psbH derivative plasmids, psbH gene function was restored, allowing transformants with integrated plasmids to grow on HSM medium. The endolysin gene was integrated downstream of the 3'UTR of the psbH gene. Maintaining cells on HSM for several generations will eventually replace the original chloroplast genome copy and repopulate the chloroplasts with a modified genome containing restored psbH and endolysin genes. To test whether the clones have reached homoplasmy, which refers to the state in which the cells present only one type of chloroplast genome, a multiplex PCR reaction was performed with the following primers:

[0558] O_53(GTAGGTATGATTAGCTTTACTAAGCTAGTCATTG),

[0559] O_172(AAATAGTAACATACTAAAGCGGATGTAACTCAATC) and

[0560] O_328(CACTTTTACAACAAAGTACATTAGGAAAAACACG).

[0561] PCR conditions were as follows: 1 minute at 95° C., 30 cycles of 15 seconds at 95° C., 30 seconds at 61.9° C., and 1 minute 30 seconds at 72° C., and a final extension of 10 minutes at 72° C. In addition, the absence of resistance to spectinomycin was also used to indicate homogeneity.

[0562] Strain storage

[0563] Endolysin-expressing microalgae strains were stored at room temperature in dim light on TAP medium. Long-term storage was performed using the GeneArt Algae Cryopreservation Kit (Thermo Fisher Scientific).

[0564] Medium composition

[0565] TAP and HSM media were prepared as described in [3] and [4].

[0566] References

[0567] 1.Wannathong,T.,Waterhouse,JC,Young,REB,Economou,CK&Purton,S.New tools for chloroplast genetic engineering allow the synthesis of humangrowth hormone in the green alga Chlamydomonas reinhardtii.Appl.Microbiol.Biotechnol.100,5467-5477(2016)

[0568] 2.Davies,DR&Plaskitt,A.Genetical and structural analyzes of cell-wall formation in Chlamydomonas reinhardi.Genet.Res.17,33-43(1971)

[0569] 3.Kropat, J. et al. A revised mineral nutrient supplement increases biomassand

[0570] 4. The Chlamydomonas source book. (Elsevier, 2008).

[0571] Example 15: Determination of the minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of endolysin

[0572] In the embodiments described above, it is shown that when Cp cell growth is minimal, GH25CPFORC3, AMI2phiCPV4 and AMI2phiZP2 endolysins exhibit lytic activity against Cp strains (NCTC2837, 8237, 8238, 8239) screened at room temperature (i.e., ~23C) and in PBS (pH 7.0) buffer. It is also necessary to determine whether endolysins can exhibit antimicrobial activity against Cp cells actively growing in liquid culture. Co-incubation of endolysin serial dilutions with known initial bacterial loads allows determination of the required endolysin minimum inhibitory concentration (MIC). In addition, the minimum bactericidal concentration (MBC) of endolysins can also be determined. Specifically, the MIC and MBC values ​​of endolysins for Cp strain Cp6 (known to induce necrotic enteritis in poultry) were studied.

[0573] As described above, the Cp6 strain was inoculated and grown overnight to stationary phase. 4 , 105 and 10 6 Overnight culture dilutions were inoculated on RCM+1% agar with 3 replicates and grown overnight at 41°C in an anaerobic chamber. Subsequently, colony counts were completed on overnight agar plates to determine the initial bacterial loading (i.e., CFU / mL) used in the following MIC assay plates. Lysozyme positive controls and endolysin stock solutions were prepared in 2-fold serial dilutions using PBS (pH 7.0) buffer. 1000-fold dilutions of overnight stationary phase Cp6 cultures were prepared using LB culture medium. MIC was started by mixing 1000-fold culture dilutions of 45 μL / well with 5uL 10-fold concentrated lysozyme (Sigma, ~89,000U / mg) or endolysin stock solutions (purified as described above) in the following assay plate format (Table 12). Except for AMI2phiZP2, each sample concentration was measured twice. Wells A1-6 (50 μL LB medium only / well) correspond to medium controls, while wells A7-12 (5 μL PBS / well (pH 7.0) + 45 μL 1000-fold culture dilution / well) correspond to growth controls. The effective loading concentrations for the MIC assay plate are also shown in Table 12.

[0574] After the MIC assay plate was activated, the plate was sealed with Xtra-Clear advanced polyolefin StarSeal (Starlabs) and incubated at 41 ° C in an anaerobic chamber for 13 hours. The relative growth inhibition on the overnight MIC assay plate was measured using a microplate reader. In order to determine which sample concentrations were able to completely kill the initial loading of Cp6 cells, the overnight MIC assay plate of 5 μL / well was re-inoculated into 95 μL / well BHI+C medium, sealed with Xtra-Clear advanced polyolefin StarSeal (Starlabs), and incubated overnight at 41 ° C in an anaerobic chamber. The MBC assay plate re-inoculated overnight was then measured on a microplate reader to assess whether there were residual live Cp cells in the overnight MIC assay plate.

[0575] Overnight incubation of live Cp cells with samples showed that all three endolysins were able to inhibit overnight growth, while lysozyme loadings up to 2.5 mg / mL did not give an initial bacterial loading of ~2.1E4 cells / mL (Table 13). Based on weight, the MIC values ​​of GH25CPFORC3, AMI2phiCPV4, and AMI2phiZP2 endolysins were determined to be loadings of about 1.6 μg / mL, 16 μg / mL, and 16 μg / mL, respectively. The MIC values ​​calculated on a molar basis are also shown in Table 13. Comparison with lysozyme showed that, for GH25CPFORC3, AMI2phiCPV4, and AMI2phiZP2, endolysins improved 1563, 156, and 156 times, respectively, compared to lysozyme. Re-inoculation of overnight MBC results showed that endolysins of similar inhibitory concentrations were also bactericidal (Table 13).

[0576] Example 16: Synergistic effect of endolysins used in combination (spot assay)

[0577] The above-mentioned previous embodiments show that the endolysin found shows inhibition and lytic activity to the various Clostridium perfringens strains tested when used alone. It is well known that agents with orthogonal mechanisms of action can often show surprising and improved synergistic effects. The same applies to the endolysin used in combination, to synergistically enhance their respective antimicrobial effects. If the endolysin is different in structure and has a significantly different mechanism of action, this is especially true. When the endolysin used in combination has different N-terminal catalytic domains and / or C-terminal cell wall binding domains, including when there are multiple different catalytic domains and / or cell wall binding domains, it is more likely to enhance synergistic interactions. A study has been initiated to determine whether GH25CPFORC3 endolysin (N-acetyl-β-D-muramic acid enzyme) can synergize when used in combination with AMI2phiCPV4 or AMI2phiZP2 (both N-acetylmuramyl-L-alanine amidase). The reason for testing these endolysin combinations is that bioinformatics sequence and structural analysis suggests that the catalytic domains between N-acetyl-β-D-muramic acid enzymes and N-acetylmuramyl-L-alanine amidases are structurally different and cut at different bonds on the peptidoglycan cell wall. In addition, the GH25CPFORC3 endolysin has two SH3 cell wall binding domains, while the AMI2phiCPV4 and AMI2phiZP2 endolysins each have only one SH3 cell wall binding domain. These structurally different properties suggest that synergistic interactions between endolysins are possible. The study of the presence of synergism between GH25FORC3 and AMI2phiCPV4 was performed using a spot assay similar to that performed in the previous embodiment described above.

[0578] NCTC reference strains 8237 and 8238 were cultured as described in the previous examples above. Purified endolysins GH25CPFORC3 and AMI2phiCPV4 were immunopurified. The antimicrobial activity of each endolysin administered alone or in combination was evaluated using freshly plated cells or cell lawns, and the preparation method was similar to that described above, except that 750 μL of stationary phase culture was inoculated with 140 mm diameter RCM, 1% agar, plates. Individual endolysins were prepared at concentrations of 200 μg / mL, 100 μg / mL, and 50 μg / mL and then similarly spotted onto freshly plated cells and cell lawns. In order to study synergistic interactions, premixed stock solutions of endolysins GH25CPFORC3 and AMI2phiCPV4 at concentrations of 100 μg / mL or 50 μg / mL were also spotted onto freshly plated cells and cell lawns in a similar manner. Briefly, 10 mm paper discs were placed on freshly laid cells or cell mosses, and 10 μL of purified endolysin (200 μg / mL, 100 μg / mL, 50 μg / mL) were spotted on the discs, respectively. The combined endolysin was similarly spotted, but 10 μL of premixed endolysin was used, each at a concentration of 100 μg / mL or 50 μg / mL. Each sample was spotted 2 times. Then, the agar plates were incubated at 37°C overnight for 16-24 hours to form a clearance zone.

[0579] The spot assay results showed a synergistic interaction between the GH25CPFORC3 and AMI2phiCPV4 endolysins. The presence of a synergistic effect was assessed based on whether the clearance zone produced by the combined endolysin spots (e.g., 100 μg / mL each of GH25CPFORC3 and AMI2phiCPV4) was greater than the clearance zone produced by the same total loading of a single endolysin spot (e.g., 200 μg / mL GH25FORC3 or AMI2phiCPV4). An example of a visual assessment and endolysin sample arrangement for studying the synergistic interaction of endolysins on NCTC 8238 cell mosses is provided in Fig.21 The results of the spot assays on freshly plated cells and cell lawns of NCTC 8238 showed that the clearance zone of the combined endolysins was greater than the clearance zone of a single spot at the same total loading. However, no synergistic interaction was observed when the endolysins were spotted on freshly plated cells or cell lawns of NCTC 8237. These results are summarized in Table 14. It is possible to combine the GH25CPFORC3 and AMI2phiCPV4 endolysins to show enhanced synergistic antimicrobial activity, and this can be extended to additional Cp strains.

[0580] Example 17: Synergistic effect of endolysins used in combination (MIC / MBC assay in 96-well liquid culture)

[0581] An alternative approach was used to more quantitatively determine the synergistic effects between different endolysins. This approach allowed determination of the amount of each endolysin loading and the loading ratio of the individual endolysins required to inhibit Cp growth after overnight culture for a given initial bacterial load.

[0582] As described above, the Cp strain was inoculated and grown overnight to stationary phase. 4 , 10 5 and 10 6 Overnight culture dilutions were inoculated on RCM+1% agar with 3 replicates and grown overnight at 41°C in an anaerobic chamber. Subsequently, colony counts were performed on overnight agar plates to determine the initial bacterial loading (i.e., CFU / mL) for the following MIC assay plates. 2-fold serial dilutions of endolysin stock solutions were prepared using LB culture medium. 1000-fold diluted overnight stationary phase cultures were also prepared using LB culture medium. According to the 96 microwell plate format in Table 15, MIC assays were initiated by first distributing 5 μL / well endolysin 1 and 5 μL / well endolysin 2 serial dilution stock solutions. 10 μL / well and 100 μL / well LB culture mediums were distributed to growth control wells and culture medium control wells, respectively. In order to initiate MIC assays, 90 μL / well 1000-fold overnight culture dilutions were distributed to sample wells. After the MIC assay plate was initiated, the plate was sealed with Xtra-Clear advanced polyolefin StarSeal (Starlabs) and incubated overnight at 41°C in an anaerobic chamber. The effective endolysin loading concentrations and the uM loading ratios of endolysin 2 and endolysin 1 are shown in Table 16.

[0583] Relative growth inhibition on overnight MIC assay plates was measured using a microplate reader. To determine which endolysin concentrations and ratios were bactericidal, 5 μL / well overnight MIC assay plates were re-inoculated into 95 μL / well BHI+C medium, sealed with Xtra-Clear advanced polyolefin StarSeal (Starlabs), and incubated overnight at 41°C in an anaerobic chamber. MBC assay plates re-inoculated overnight were then measured on a microplate reader to assess whether there were residual live Cp cells in the overnight MIC assay plates.

[0584] Example 18: Synergistic effect of endolysins used in combination (spot assay on 96-microwell solid culture medium)

[0585] An alternative method was used to more quantitatively determine the synergistic effect between different endolysins, more specifically the synergistic effect between GH25FORC3 and AMI2phiCPV4. This method allowed the determination of the loading amount of each endolysin and the loading ratio of a single endolysin required to inhibit Cp growth after overnight culture. This method is also an improvement on the spot determination method used in the previous examples, and is used to obtain higher accuracy and precision results by relying on OD620nm microplate reader readings rather than by visual inspection.

[0586] As described above, the Cp strain was inoculated and grown overnight to stationary phase. 4 , 10 5 and 10 6 Overnight culture dilutions were layered on RCM+1% agar with 3 repetitions and grown overnight at 41°C in an anaerobic chamber. Subsequently, colony counts were performed on overnight agar plates to determine the initial bacterial load (i.e., CFU / mL) for the following MIC assay plates. LB culture medium was used to prepare 2 times of serially diluted endolysin stock solutions. LB culture medium was also used to prepare 1000 times of overnight stationary phase cultures. Except for agar control wells, 50 μL / well overnight culture dilutions were distributed to 100 μL / well RCM+1% agar placed in 96 microwell plates. Two 96 microwell plates were prepared. The cells in one microwell plate were newly laid (FP), and the cells in another plate were allowed to grow overnight into cell moss (CL). For each prepared plate, the stock solution of endolysin 1 and endolysin 2 serial dilutions premixed by distributing 10 μL / wells was started to determine the effective loading concentration of 96 microwell plate formats to provide Table 15. After the MIC assay plate was initiated, the plate was sealed with Xtra-Clear advanced polyolefin StarSeal (Starlabs) and incubated overnight in an anaerobic chamber at 41°C. The effective endolysin loading concentrations and the uM loading ratios of endolysin 2 and endolysin 1 are shown in Table 15. The inhibitory and lytic effects of the endolysin combinations were evaluated by visual inspection of freshly plated cell plates and cell moss plates, respectively.

[0587] Example 19: Affinity Purification of 6xHis-Tagged AMI2phiZP2, AMI2phiCPV4 and GH25CPF4969 Endolysins change

[0588] 6xHis-tagged AMI2phiZP2 (SEQ ID NO: 3), AMI2phiCPV4 (SEQ ID NO: 2), and GH25CPF4969 (SEQ ID NO: 8) endolysins expressed in E. coli strains bAL187, bAL188, and bAL198 were affinity purified for use in the following examples.

[0589] The pre-culture of 6xHis-tagged AMI2phiZP2, AMI2phiCPV4 and GH25CPF4969 endolysin expressed in Escherichia coli was started in 10mL LB medium (+100μg / mL ampicillin, 25μg / mL chloramphenicol), and incubated overnight at 37°C of shaking (150rpm). The next day, 200mL LB medium (+100μg / mL ampicillin, 25μg / mL chloramphenicol) was inoculated with 2mL pre-culture, and incubated for about 3 hours at 37°C of shaking (~150rpm). The expression of protein was induced by adding IPTG (isopropyl-2-D-thiogalactopyranoside) (Merck) to a final concentration of 1mM, and the culture was cultivated for another 5 hours at 30°C. The bacterial cells were harvested by centrifugation at 3800 × g for 10 minutes using a SIGMA 3-16KL centrifuge, and the bacterial pellet was stored at -20°C until the next day. The pellet was resuspended in 5 mL of binding / wash buffer (20 mM sodium phosphate, 0.5 M NaCl, 20 mM imidazole, pH 7.4) with cOmplete micro EDTA-free protease inhibitor cocktail (Merck). Cells were lysed by sonication (10 μm amplitude, 10 sec on / off for 10 cycles) using an MSE Soniprep 150 ultrasonic pulverizer. The clarified lysate was clarified by centrifugation at 31,030 × g on an Eppendorf 5430R centrifuge and the supernatant was collected. Ni-sepharose was used to lyse the cells. TM 6 fast flow resin (GE Healthcare) carries out affinity chromatography.In 50mL Falcon tube, clarified lysate is mixed with 1mL Ni-sepharose (Ni-sepharose) resin, and the mixture is incubated on ice on a rocking platform for 1 hour.Then lysate / resin suspension is poured into empty PD-10 post (GE Healthcare) and effluent is collected for later analysis.The Ni-sepharose resin buffer (20mM sodium phosphate, 0.5M NaCl, 20mM imidazole, pH7.4) of protein-bound is washed, and then the elution buffer (pH 7.4) composed of 20mM sodium phosphate, 0.5M NaCl, 0.5M imidazole is used to elute the protein.The absorbance at 280nm is measured to confirm the presence of the protein eluted in the elution fraction.The concentration of the elution fractions collected and buffer exchange is carried out similarly to Example 10. Verification of protein purification was determined by SDS-PAGE using 15-20% Mini-Protean TGX precast protein gels (Bio-Rad) in a Bio-Rad Mini-PROTEAN electrophoresis system. SDS-PAGE samples and BSA standard curves were also run similarly to those described in Example 10. The resulting protein gel was stained with InstantBlueTM Staining solution (Expedeon) and destaining with MQ H2O. Destained gels were imaged using the Vilber Bio-print gel documentation system. Densitometric analysis for quantification of purified endolysin was performed using the onboard software.

[0590] SDS-PAGE and optical density analysis ( Fig. 22 ) showed that endolysin was highly enriched with a small amount of contaminating proteins. These contaminating proteins did not interfere with subsequent experiments. Quantification of the protein bands of interest showed that the concentrations of the purified stocks of AMI2phiZP2, AMI2phiCPV4, and GH25CPF4969 were 1700 μg / mL, 1000 μg / mL, and 3600 μg / mL, respectively.

[0591] Example 20: Purification of Cp...

Claims

1. An isolated endolysin polypeptide having antimicrobial activity, wherein: The isolated polypeptide comprises the following amino acid sequence: It is an N-terminal Clostridium perfringens cell wall peptidoglycan catalytic domain polypeptide. Or it is a fragment of the N-terminal catalytic domain polypeptide; or It is at least 80% identical to the amino acid sequence of the N-terminal cell wall peptidoglycan catalytic domain of the Clostridium perfringens phage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8 or 11, Or it is a fragment of the N-terminal catalytic domain polypeptide, and its amino acid sequence corresponding to the amino acid sequence of the fragment shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8 or 11 is at least 80% identical.

2. The isolated endolysin polypeptide or fragment having antimicrobial activity according to claim 1, wherein The isolated polypeptide comprises: an N-terminal Clostridium perfringens cell wall peptidoglycan catalytic domain polypeptide or a fragment thereof, a C-terminal Clostridium perfringens cell wall binding domain polypeptide or a fragment thereof, and optionally a linker polypeptide or a fragment thereof connecting the N-terminal domain and the C-terminal domain; wherein the isolated polypeptide comprises: a) an amino acid sequence that is at least 80% identical to the amino acid sequence of the N-terminal cell wall peptidoglycan catalytic domain of the Clostridium perfringens bacteriophage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8 or 11, or an amino acid sequence that is a fragment of the N-terminal catalytic domain polypeptide and is at least 80% identical to the amino acid sequence of the amino acid sequence corresponding to the fragment shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8 or 11; and b) an amino acid sequence that is at least 80% identical to an endolysin C-terminal Clostridium perfringens cell wall binding domain polypeptide or a fragment of said polypeptide; or an amino acid sequence that is at least 80% identical to the amino acid sequence of the C-terminal cell wall binding domain of the Clostridium perfringens bacteriophage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8, or an amino acid sequence that is a fragment of said C-terminal binding domain polypeptide and is at least 80% identical to the amino acid sequence of the amino acid sequence corresponding to said fragment of the sequence shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8; and c) an optional linker amino acid sequence that is at least 80% identical to a linker of an endolysin polypeptide or a fragment of said polypeptide; or an optional amino acid sequence that is at least 80% identical to the amino acid sequence of a linker of a Clostridium perfringens bacteriophage endolysin polypeptide as shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8, or an amino acid sequence that is a fragment of said linker and is at least 80% identical to the amino acid sequence of the amino acid sequence corresponding to said fragment of the sequence shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8; wherein said linker amino acid sequence connects said amino acid sequence of the N-terminal cell wall peptidoglycan catalytic domain or a fragment thereof of the Clostridium perfringens bacteriophage endolysin polypeptide and the C-terminal cell wall binding domain or a fragment thereof of the Clostridium perfringens bacteriophage endolysin polypeptide.

3. The isolated endolysin polypeptide or fragment with antimicrobial activity according to claim 1 or 2, wherein The isolated polypeptide comprises: an amino acid sequence comprising an N-terminal Clostridium perfringens cell wall peptidoglycan catalytic domain polypeptide or a fragment thereof or consisting of an N-terminal Clostridium perfringens cell wall peptidoglycan catalytic domain polypeptide or a fragment thereof, an amino acid sequence comprising a C-terminal Clostridium perfringens cell wall binding domain polypeptide or a fragment thereof or consisting of a C-terminal Clostridium perfringens cell wall binding domain polypeptide or a fragment thereof, and an amino acid sequence comprising a linker polypeptide connecting the N-terminal domain and the C-terminal domain or a fragment thereof or consisting of a linker polypeptide connecting the N-terminal domain and the C-terminal domain or a fragment thereof; wherein the isolated polypeptide comprises: a) an amino acid sequence that is at least 80% identical to the amino acid sequence of the N-terminal cell wall peptidoglycan catalytic domain of the Clostridium perfringens bacteriophage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8 or 11, or an amino acid sequence that is a fragment of the N-terminal catalytic domain polypeptide and is at least 80% identical to the amino acid sequence of the amino acid sequence corresponding to the fragment shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8 or 11; and b) an amino acid sequence that is at least 80% identical to the amino acid sequence of the C-terminal Clostridium perfringens cell wall binding domain of the Clostridium perfringens phage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8, or an amino acid sequence that is a fragment of said C-terminal binding domain polypeptide and is at least 80% identical to the amino acid sequence of the amino acid sequence corresponding to said fragment of the sequence shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8; and c) an amino acid sequence that is at least 80% identical to the amino acid sequence of the linker of the Clostridium perfringens phage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8, or an amino acid sequence that is a fragment of the linker and is at least 80% identical to the amino acid sequence of the amino acid sequence corresponding to the fragment of the sequence shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8.

4. The isolated endolysin polypeptide having antimicrobial activity according to claim 3, wherein The isolated polypeptide consists of or comprises the following: a) an amino acid sequence consisting of or comprising a fragment of the N-terminal catalytic domain and being at least 80% identical to the amino acid sequence of the amino acid sequence corresponding to the fragment of the sequence shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8 or 11; and / or b) an amino acid sequence consisting of or comprising a fragment of the C-terminal binding domain and being at least 80% identical to the amino acid sequence of the sequence shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8 corresponding to the amino acid sequence of the fragment; and / or c) an amino acid sequence consisting of or comprising a fragment of said linker and being at least 80% identical to the amino acid sequence of the sequence shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8 corresponding to the amino acid sequence of said fragment.

5. An isolated endolysin polypeptide or fragment having antimicrobial activity according to any one of the preceding claims, wherein The amino acid sequence of the N-terminal domain and / or the C-terminal domain and / or the linker is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of the N-terminal domain, C-terminal domain and linker of the Clostridium perfringens phage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8 or 11, respectively; or wherein the amino acid sequence of the fragment of the N-terminal domain or the fragment of the C-terminal domain or the fragment of the linker is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of the amino acid sequence corresponding to the fragment of the sequence shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8 or 11.

6. The isolated endolysin polypeptide or fragment having antimicrobial activity according to claim 3 or 4, wherein The isolated polypeptide comprises: an amino acid sequence, wherein the N-terminal catalytic domain, the C-terminal cell wall binding domain and the linker are at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the corresponding amino acid sequences of the N-terminal domain, C-terminal domain and linker of the Clostridium perfringens phage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8 or 11, respectively.

7. The isolated endolysin polypeptide or fragment having antimicrobial activity according to claim 6, wherein The polypeptide comprises or consists of: a) an amino acid sequence comprising all of the N-terminal domain, the C-terminal domain and the linker of the Clostridium perfringens phage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 6 or 8, or consisting of all of the N-terminal domain, the C-terminal domain and the linker of the Clostridium perfringens phage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 6 or 8, and wherein the amino acid sequence is 100% identical to the sequence of the N-terminal domain, the C-terminal domain and the linker of the Clostridium perfringens phage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 6 or 8; or b) an amino acid sequence comprising all of the N-terminal domain, the C-terminal domain and the linker fragments of the Clostridium perfringens phage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 6 or 8, or consisting of all of the N-terminal domain, the C-terminal domain and the linker fragments of the Clostridium perfringens phage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 6 or 8, and wherein the amino acid sequence of each fragment is 100% identical to the sequence of the amino acid sequence of the Clostridium perfringens phage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 5, 6 or 8 corresponding to the fragment.

8. The isolated endolysin polypeptide having antimicrobial activity according to claim 6, wherein The polypeptide comprises or consists of the following amino acid sequence: the amino acid sequence is 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of the Clostridium perfringens phage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8 or 11.

9. The isolated endolysin polypeptide having antimicrobial activity according to claim 8, wherein The polypeptide comprises or consists of the following amino acid sequence: the amino acid sequence is 100% identical to the amino acid sequence of the Clostridium perfringens phage endolysin polypeptide shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8 or 11.

10. An isolated endolysin polypeptide or fragment having antimicrobial activity according to any one of the preceding claims, wherein The antimicrobial activity is bacteriolytic activity and / or bacterial growth inhibitory activity.

11. An isolated endolysin polypeptide or fragment having antimicrobial activity according to any one of the preceding claims, wherein The isolated polypeptide or fragment has bacteriolytic activity and / or bacterial growth inhibitory activity against Clostridium perfringens.

12. The isolated endolysin polypeptide or fragment having antimicrobial activity according to claim 11, wherein The isolated polypeptide or fragment has bacteriolytic activity and / or bacterial growth inhibitory activity against Clostridium perfringens, preferably type A strain of Clostridium perfringens.

13. The isolated endolysin polypeptide or fragment having antimicrobial activity according to claim 12, wherein When the polypeptide or fragment is tested at a concentration of 5 μg / ml in a standard cell viability assay against Clostridium perfringens strain NCTC8237, it exhibits a ΔLog10 value of about 0.40 or greater, 2.00 or greater, or 3.70 or greater.

14. The isolated endolysin polypeptide or fragment having antimicrobial activity according to claim 12 or 13, wherein When the polypeptide or fragment is tested at a concentration of 5 μg / ml in a standard cell viability assay against Clostridium perfringens strain NCTC8237, it exhibits a % reduction in cell viability of about 60% or greater, 70% or greater, 80% or greater, 90% or greater, or 100%.

15. The isolated endolysin polypeptide or fragment having antimicrobial activity according to claim 12, 13 or 14, wherein When the polypeptide or fragment is tested at a concentration of 5 μg / ml against Clostridium perfringens strain NCTC8237 in a standard cell turbidity reduction assay, it exhibits a t50% lysis value of 7 minutes or less; or it exhibits a t50% lysis value of 3 minutes or less.

16. The isolated endolysin polypeptide or fragment having antimicrobial activity according to any one of claims 12 to 15, wherein When the standard minimum inhibitory concentration (MIC) / minimum bactericidal concentration (MBC) was used as 2.1×10 4 When the polypeptide or fragment is tested against Clostridium perfringens strain Cp6 at 1 cell / mL, it exhibits a MIC and / or MBC value of 17 μg / mL or less, preferably a MIC and / or MBC value of 1.7 μg / mL or less; or it exhibits a MIC and / or MBC value of 0.65 μM or less, preferably a MIC and / or MBC value of 0.05 μM or less.

17. An isolated recombinant nucleic acid molecule comprising a first nucleic acid sequence encoding an endolysin polypeptide or fragment with antimicrobial activity according to any one of the preceding claims, optionally wherein, The isolated recombinant nucleic acid molecule further comprises a second nucleic acid sequence encoding a promoter, and wherein the first nucleic acid sequence is operably linked to the second nucleic acid sequence; optionally wherein the first nucleic acid sequence of the isolated recombinant nucleic acid molecule encodes a cDNA.

18. An isolated recombinant polynucleotide expression vector comprising the nucleic acid molecule according to claim 17 and comprising the first nucleic acid sequence and the second nucleic acid sequence.

19. The isolated recombinant nucleic acid molecule according to claim 17 comprising the first nucleic acid sequence and the second nucleic acid sequence, or the isolated recombinant polynucleotide expression vector according to claim 18 comprising the first nucleic acid sequence and the second nucleic acid sequence, wherein: The promoter is capable of promoting the expression of the endolysin polypeptide or fragment having antimicrobial activity in cells of unicellular microorganisms, wherein the cells are optionally yeast cells, bacterial cells (such as lactobacilli), fungal cells or algae cells, preferably algae cells.

20. The nucleic acid molecule according to claim 17 or 19, or the recombinant polynucleotide expression vector according to claim 18 or 19, wherein: The nucleic acid sequence encoding the endolysin polypeptide or fragment has been codon-optimized for expression in a host cell, optionally wherein the host cell is a cell of a unicellular microorganism, optionally a yeast cell, a bacterial cell (such as a lactobacillus), a fungal cell or an algal cell, preferably an algal cell.

21. A host cell comprising: a population of nucleic acid molecules as defined in any one of claims 17, 19 or 20 and encoding an endolysin polypeptide or fragment as defined in any one of claims 1 to 16, and / or a population of recombinant polynucleotide expression vectors as defined in claims 18, 19 or 20 encoding an endolysin polypeptide or fragment as defined in any one of claims 1 to 16, optionally wherein, The host cell further comprises an endolysin polypeptide or fragment as defined in any one of claims 1 to 16 and which has been expressed from said molecule or vector, optionally wherein the host cell is a cell of a unicellular microorganism, optionally a yeast cell, a bacterial cell (such as a lactobacillus), a fungal cell or an algal cell, preferably an algal cell, or wherein the host cell is a cell of a plant.

22. The host cell according to claim 21, wherein Each molecule or vector of the population encodes the same endolysin polypeptide or fragment as defined in any one of claims 1 to 16, or wherein the molecules or vectors of the population encode two or more different endolysin polypeptides or fragments as defined in any one of claims 1 to 16, optionally wherein the host cell further comprises the endolysin polypeptide or fragment and has been expressed from the molecule or vector, optionally wherein the host cell is a cell of a unicellular microorganism, optionally a yeast cell, a bacterial cell (such as a lactobacillus), a fungal cell or an algal cell, preferably an algal cell, or wherein the host cell is a cell of a plant.

23. A cell lysate comprising: a population of endolysin polypeptides or fragments as defined in any one of claims 1 to 16 and which have been expressed from a nucleic acid molecule as defined in claim 17, 19 or 20 and / or a recombinant polynucleotide expression vector as defined in claim 18, 19 or 20, optionally wherein, The population consists of the same endolysin polypeptide or fragment as defined in any one of claims 1 to 16, or wherein the population consists of two or more different endolysin polypeptides or fragments as defined in any one of claims 1 to 16, optionally wherein a lysate is produced following expression of the endolysin polypeptide or fragment in a host cell, the host cell being a cell of a unicellular microorganism, optionally a yeast cell, a bacterial cell (such as a lactobacillus), a fungal cell or an algal cell, preferably an algal cell, or wherein the host cell is a cell of a plant.

24. A composition comprising a population of endolysin polypeptides or fragments having antimicrobial activity as defined in any one of claims 1 to 16, optionally wherein, The population consists of the same endolysin polypeptide or fragment as defined in any one of claims 1 to 16, or wherein the population consists of two or more different endolysin polypeptides or fragments thereof as defined in any one of claims 1 to 16.

25. The composition according to claim 24, wherein The population of endolysin polypeptides or fragments having antimicrobial activity: (a) is added to the composition as a purified polypeptide or fragment; or (b) wherein, The population of endolysin polypeptides or fragments having antimicrobial activity is added to the composition as a component of one or more cell extracts; or (c) wherein the population of endolysin polypeptides or fragments having antimicrobial activity is added to the composition as a purified polypeptide or fragment and as a component of one or more cell extracts; optionally wherein in (b) or (c) the cell extract is an extract of a unicellular microorganism, the unicellular microorganism is optionally a yeast cell, a bacterial cell (such as a lactobacillus), a fungal cell or an algae cell, preferably an algae cell, or wherein the cell is a plant cell.

26. A composition comprising a population of host cells, wherein: The host cells of the population comprise an endolysin polypeptide or fragment having antimicrobial activity as defined in any one of claims 1 to 16 expressed in the host cells, wherein the endolysin polypeptide or fragment consists of the same endolysin polypeptide or fragment as defined in any one of claims 1 to 16, or wherein the endolysin polypeptide or fragment consists of two or more different endolysin polypeptides or fragments thereof as defined in any one of claims 1 to 16.

27. A whole cell composition comprising a population of whole host cells, wherein: The cells of the population comprise an endolysin polypeptide or fragment having antimicrobial activity as defined in any one of claims 1 to 16 expressed in the host cell, wherein the endolysin polypeptide or fragment consists of the same endolysin polypeptide or fragment as defined in any one of claims 1 to 16, or wherein the endolysin polypeptide or fragment consists of two or more different endolysin polypeptides or fragments thereof as defined in any one of claims 1 to 16.

28. The composition according to claim 26 or the whole cell composition according to claim 27, wherein The host cells of the population are host cells as defined in any one of claims 21 to 22.

29. The composition according to claim 26 or the whole cell composition according to claim 28, wherein The host cells of the population are cells of unicellular microorganisms, optionally yeast cells, bacterial cells (such as lactobacilli), fungal cells or algae cells.

30. The composition of any one of claims 26, 28 or 29, or the whole cell composition of any one of claims 27, 28 or 29, wherein The host cells of the population are algae cells, preferably unicellular algae cells, more preferably Chlamydomonas cells, and even more preferably Chlamydomonas reinhardtii cells.

31. The composition or whole cell composition according to claim 30, wherein The composition comprises dried biomass comprising the endolysin polypeptide or fragment having antimicrobial activity expressed in algal cells, preferably, wherein the composition or whole cell composition is spray dried.

32. A dried biomass composition comprising a cell lysate as defined in claim 23, and / or comprising a composition as defined in claim 29 or claim 30 and / or a whole cell composition, wherein: The dried biomass composition comprises: a cell lysate comprising the endolysin polypeptide or fragment having antimicrobial activity and / or a host cell comprising the endolysin polypeptide or fragment having antimicrobial activity expressed in the host cell.

33. The dried biomass composition according to claim 32, wherein: The host cells of the population are algae cells, preferably unicellular algae cells, more preferably Chlamydomonas cells, and even more preferably Chlamydomonas reinhardtii cells; preferably, wherein the dried biomass composition is spray-dried.

34. An antimicrobial formulation comprising an endolysin polypeptide or fragment having antimicrobial activity as defined in any one of claims 1 to 16 and a pharmaceutically acceptable carrier / excipient.

35. The antimicrobial formulation of claim 35, wherein: The preparation comprises a population of host cells, wherein the host cells of the population are defined according to any one of claims 21 to 22, or wherein the preparation comprises a cell lysate according to claim 23, or wherein the preparation comprises a composition according to any one of claims 24 to 31, or wherein the preparation comprises a dried biomass composition according to claim 32 or claim 33.

36. An animal food comprising: (a) one or more foods; and (b) an isolated endolysin polypeptide or fragment having antimicrobial activity according to any one of claims 1 to 16.

37. An animal food, comprising: (a) one or more foods; and (b) also includes: (i) the host cell according to claim 21 or 22; (ii) the cell lysate according to claim 23; (iii) a composition according to any one of claims 24 to 26 or any one of claims 28 to 31; (iv) a whole cell composition according to any one of claims 27 to 31; (v) a dried biomass composition according to claim 32 or claim 33; and / or (vi) An antimicrobial preparation according to claim 34 or claim 25.

38. Animal food according to claim 36 or claim 37, wherein The food is suitable for consumption by poultry, optionally broiler chickens, preferably chickens; or wherein the food is suitable for consumption by pigs, preferably pigs; or wherein the food is suitable for consumption by rodents, optionally mice or rats.

39. A host cell according to claim 21 or claim 22, a cell lysate according to claim 23, a composition according to any one of claims 24 to 26, a whole cell composition according to any one of claims 27 to 31, a dried biomass composition according to claim 32 or claim 33, an antimicrobial preparation according to claim 34 or 35, or an animal food according to any one of claims 36 to 38, comprising two or more different endolysin polypeptides or fragments having antimicrobial activity as defined in any one of claims 1 to 16.

40. The host cell, cell lysate, composition, whole cell composition, dried biomass composition, antimicrobial preparation or animal food of claim 39, wherein: The exhibited antimicrobial activity provided by two or more different endolysin polypeptides or fragments is a synergistic activity.

41. The cell lysate, composition, whole cell composition, dried biomass composition, antimicrobial preparation or animal food of claim 39 or claim 40, further comprising one or more additives having antimicrobial activity, and wherein, The additive is not an endolysin polypeptide or fragment.

42. The cell lysate, composition, whole cell composition, dried biomass composition, antimicrobial preparation or animal food of claim 41, wherein: The one or more additives are selected from the group consisting of antibiotic agents, biofilm degrading agents, biofilm inhibitors, chelating agents such as chitosan, EDTA and citric acid, bacteriostatic agents such as glycerol.

43. The cell lysate, composition, whole cell composition, dried biomass composition, antimicrobial preparation or animal food of any one of claims 39 to 42, further comprising one or more additives selected from the group consisting of stabilizers, anti-caking agents, prebiotics, probiotics and edible gels such as hydrophilic nutrient matrices.

44. The cell lysate, composition, whole cell composition, dried biomass composition, antimicrobial preparation or animal food according to any one of claims 39 to 43, wherein The cell lysate, composition, whole cell composition, antimicrobial preparation or animal food is spray-dried, freeze-dried or in powdered form.

45. An isolated endolysin polypeptide or fragment having antimicrobial activity according to any one of claims 1 to 16, a host cell according to claim 21 or claim 22, a cell lysate according to claim 23, a composition according to any one of claims 24 to 26, a whole cell composition according to any one of claims 27 to 31, a dried biomass composition according to claim 32 or claim 33, an antimicrobial preparation according to claim 34 or 35, or an animal food according to any one of claims 36 to 38, for use as a medicament.

46. ​​An isolated endolysin polypeptide or fragment having antimicrobial activity according to any one of claims 1 to 16, a host cell according to claim 21 or claim 22, a cell lysate according to claim 23, a composition according to any one of claims 24 to 26, a whole cell composition according to any one of claims 27 to 31, a dried biomass composition according to claim 32 or claim 33, an antimicrobial formulation according to claim 34 or 35, or an animal food according to any one of claims 36 to 38, for use in treating bacterial infections in animals.

47. Use of the isolated endolysin polypeptide or fragment with antimicrobial activity, host cell, cell lysate, composition, whole cell composition, dried biomass composition, antimicrobial preparation or animal food according to claim 46, wherein, The bacterial infection is a Clostridium perfringens infection, optionally an infection caused by a type A strain of Clostridium perfringens.

48. An isolated endolysin polypeptide or fragment having antimicrobial activity according to any one of claims 1 to 16, a host cell according to claim 21 or claim 22, a cell lysate according to claim 23, a composition according to any one of claims 24 to 26, a whole cell composition according to any one of claims 27 to 31, a dried biomass composition according to claim 32 or claim 33, an antimicrobial formulation according to claim 34 or 35, or an animal food according to any one of claims 36 to 38, for use in treating a disease or condition caused by infection with Clostridium perfringens, optionally an infection caused by a type A strain of Clostridium perfringens.

49. Use of the isolated endolysin polypeptide or fragment with antimicrobial activity, host cell, cell lysate, composition, whole cell composition, dried biomass composition, antimicrobial preparation or animal food according to claim 48, wherein, The diseases or illnesses caused by infection with Clostridium perfringens are food poisoning, gas gangrene, necrotizing enteritis, intestinal lesions and / or gastrointestinal infections.

50. A method for preventing or treating a disease or condition in an animal, the method comprising: Administering to an animal a prophylactically or therapeutically effective amount of an isolated endolysin polypeptide or fragment having antimicrobial activity according to any one of claims 1 to 16, a host cell according to claim 21 or claim 22, a cell lysate according to claim 23, a composition according to any one of claims 24 to 26, a whole cell composition according to any one of claims 27 to 31, a dried biomass composition according to claim 32 or claim 33, an antimicrobial formulation according to claim 34 or 35, or an animal food according to any one of claims 36 to 38.

51. A method for preventing or treating a disease or illness in a farmed animal, the method comprising: Administering a prophylactically or therapeutically effective amount of an animal food according to any one of claims 36 to 38 to an animal, optionally wherein the animal is a poultry animal, optionally a broiler chicken, preferably a chicken; or wherein the animal is a pig, preferably a pig.

52. The method of claim 51, wherein: The disease or condition is a bacterial infection, preferably a Clostridium perfringens infection, optionally wherein the Clostridium perfringens pathogen is a type A strain of Clostridium perfringens.

53. The method of claim 51, wherein: The disease or disorder is a disease or disorder caused by infection with Clostridium perfringens, optionally an infection caused by a type A strain of Clostridium perfringens, such as food poisoning, gas gangrene, necrotic enteritis, intestinal lesions and / or gastrointestinal infections.

54. A method for obtaining an isolated polypeptide or fragment having antimicrobial activity according to any one of claims 1 to 16, the method comprising: (d) culturing a host cell comprising a nucleic acid molecule according to claim 17, 19 or 20 and / or a recombinant polynucleotide expression vector according to claim 18, 19 or 20 in a culture system; (e) harvesting the cultured host cells and / or culture fluid; and (f) isolating the polypeptide or fragment from the host cell and / or culture medium.

55. A method for obtaining a dried biomass composition comprising an isolated endolysin polypeptide or fragment having antimicrobial activity according to any one of claims 1 to 16, the method comprising: (e) culturing the host cell according to claim 21 or claim 22 in a culture system under conditions where the endolysin polypeptide or fragment having antimicrobial activity is expressed; (f) harvesting and isolating the host cell from the culture system; (g) drying the host cells to form a dried biomass; and (h) formulating the dried biomass into a composition.

56. A method for obtaining a dried biomass composition comprising an isolated endolysin polypeptide or fragment having antimicrobial activity according to any one of claims 1 to 16, the method comprising: (e) culturing the host cell according to claim 21 or claim 22 in a culture system under conditions where the endolysin polypeptide or fragment having antimicrobial activity is expressed; (f) generating a lysate from the cultured host cells; (g) drying the lysate to form a dried biomass; and (h) formulating the dried biomass into a composition; wherein the lysate is produced by lysing host cells in situ in the culture system, or Therein, the lysate is produced by lysing the host cells after the host cells have been harvested and separated from the culture system.

57. A method for obtaining a dried biomass composition according to claim 55 or claim 56, wherein: The host cell is an algae cell, preferably a unicellular algae cell, more preferably a Chlamydomonas cell, and even more preferably a Chlamydomonas reinhardtii cell.

58. A method for obtaining a dried biomass composition according to any one of claims 55 to 57, wherein The step of drying to form a dried biomass comprises spray drying.

Images