Sandalwood auxin response factor SaARF7 and application thereof

Abstract

The invention discloses a sandalwood auxin response factor SaARF7 and application of the sandalwood auxin response factor SaARF7. The transcription factor SaARF7 (the nucleotide sequence is as shown in SQE ID NO.1) responding to the auxin in the early stage is screened and cloned by combining phenotypes for regulating and controlling development of vascular tissues of sandalwood seedlings by the auxin with technical means of omics and molecular biology, and the application of the transcription factor SaARF7 is disclosed. The overexpression of SaARF7 can increase the biomass of overground stems and underground parts of plants, promote the maturation of secondary xylems and avoid teratogenesis; in the associated process, the overexpressed SaARF7 strain has a promoting effect on the number of aspirators, plant height and fruiting of parasitic plants. Especially, under the condition of less phosphorus, the bacillus subtilis has stronger adaptability to the bacillus subtilis and parasitic plants associated with the bacillus subtilis. The result provides a theoretical basis for researching the function of the sandalwood ARF family gene in the vascular development process, and also provides a practical basis for subsequently culturing high-value parasitic plants under poor soil conditions (such as phosphorus deficiency).

Description

Technical field:

[0001] The invention belongs to the field of biotechnology, and in particular relates to a sandalwood auxin response factor SaARF7 and application thereof. Background technology:

[0002] Sandalwood (Santalum album L.) is one of the most economically valuable tree species in the genus Santalum. It is world-famous for its mature roots and heartwood as well as the high-quality sandalwood oil extracted from them. my country is not the country of origin of sandalwood. Years of cultivation and production experience have shown that in addition to the long growth cycle of sandalwood, its semi-parasitic roots affect the development of its above-ground stems and underground parts, which in turn affects the accumulation of overall biomass and the production of essential oils. Slow wood development and semi-parasitism are direct factors that restrict the quality and yield of sandalwood, which to a large extent restricts the development of sandalwood production and affects the income and production enthusiasm of farmers who grow it.

[0003] As a unique organ of parasitic plants, haustoria act as a physiological bridge between parasitic plants and hosts to transfer nutrients and water. Unlike fully parasitic plants, haustoria produced in the roots of sandalwood are connected to the xylem inside the host roots to absorb water and inorganic salts from the host roots. Plant growth and development are closely related to endogenous hormones, among which auxin, as a central hub connecting other hormone metabolic pathways and signal molecule pathways, regulates multiple biological processes of plant development. Auxin concentration is regulated by many factors such as auxin synthesis and metabolic rate and intracellular and extracellular transport conditions. Auxin response factor (ARF) is an important early transcription factor that responds to auxin signals. It can bind to specific auxin response element sequences to activate or inhibit the expression of downstream genes, and plays an important role in organogenesis and secondary vascular tissue development. The number of members of the ARF gene family varies greatly among different species, ranging from a dozen to dozens. The functional research of different ARF subfamily genes or proteins in this family has received much attention. Previous studies on the functions of ARF family gene members have focused on non-parasitic plants, while no relevant reports have been reported on the functions of ARF transcription factors in parasitic plants. Our previous research results showed that auxin can effectively promote the development of lateral roots and haustoria in Santalum album. We screened a transcription factor SaARF7 that responds to auxin signals by combining omics and bioinformatics techniques. We studied its function using molecular biology, genetics, morphology and histochemical staining techniques. The results showed that overexpression of SaARF7 can promote the accumulation of biomass in the aboveground and underground parts of the plant, accelerate the maturation of secondary xylem, and play an active role in the parasitic process, which was not available in previous studies. Summary of the invention:

[0004] The invention provides a gene SaARF7 for regulating haustorium development in response to auxin and application thereof.

[0005] The present invention obtains a gene SaARF7 that responds to auxin signals by screening and cloning. The present invention connects the SaARF7 gene shown in SEQ ID No. 1 to a plant expression vector to obtain a SaARF7 overexpression recombinant vector, which is transformed into Agrobacterium to obtain an overexpression recombinant strain with a fusion FLAG to transform a plant.

[0006] The nucleotide sequence of the sandalwood auxin response factor SaARF7 of the present invention is shown in SEQ ID NO.1.

[0007] The present invention also provides a protein encoded by the sandalwood auxin response factor SaARF7, and its amino acid sequence is shown as SEQ ID NO.2.

[0008] The present invention also provides the use of the sandalwood auxin response factor SaARF7 in regulating the biomass of the above-ground and underground parts of the plant and the maturation of the secondary xylem.

[0009] Preferably, overexpression of the sandalwood auxin response factor SaARF7 can increase the biomass of the aboveground and underground parts of the plant, promote the maturation of the secondary xylem and not cause deformity.

[0010] The plant can be any plant, for example, sterile Nicotiana benthamiana.

[0011] The present invention also provides the use of the sandalwood auxin response factor SaARF7 in regulating plant height and fruiting and improving the ability to adapt to adverse conditions during the accompanying growth process.

[0012] Preferably, during the companionship process, the strain overexpressing the sandalwood auxin response factor SaARF7 not only promotes the plant height and fruiting of the parasitic plant, but is also relatively less affected by the parasitic plant. Under phosphorus-deficient culture conditions, the parasitic plants associated with the strain overexpressing the sandalwood auxin response factor SaARF7 and themselves both show stronger adaptability.

[0013] The parasitic plant may be any parasitic plant that uses tobacco as a host, such as Artemisia pine.

[0014] The present invention also provides a method for increasing the biomass of the above-ground and underground parts of a plant and promoting the maturation of secondary xylem without causing deformation, which is to over-express the sandalwood auxin response factor SaARF7 in the plant.

[0015] The present invention also provides a method for promoting plant height and fruiting of parasitic plants and improving phosphorus deficiency adaptability, which comprises over-expressing sandalwood auxin response factor SaARF7 in tobacco and then allowing the tobacco to coexist with the parasitic plant.

[0016] The parasitic plant may be any parasitic plant that uses tobacco as a host, such as Artemisia pine.

[0017] The present invention explores the effect of auxin on the development of haustorium vascular tissue of sandalwood seedlings. A gene SaARF7 that responds to auxin and is highly expressed in haustoria and stems was screened and cloned. Overexpression of SaARF7 can increase the biomass of the aboveground and underground parts of the plant, promote the maturation of secondary xylem without causing deformities; in the process of companionship, the strain overexpressing SaARF7 not only promotes the height and fruiting of parasitic plants, but also is relatively less affected by the parasitic plants. Especially under the culture conditions of insufficient phosphorus, the parasitic plants associated with the strain overexpressing SaARF7 and themselves show stronger adaptability. This shows that SaARF7 plays a positive role in the parasitic process. The above results provide a theoretical basis for studying the function of sandalwood ARF family genes in the vascular development process, and also provide a practical basis for the subsequent cultivation of high-value parasitic plants in phosphorus-deficient environments. Description of the drawings:

[0018] Figure 1 The phenotype of haustoria vascular development in Santalum album seedlings affected by auxin.

[0019] A and B are the morphological images of the underground parts of seedlings grown under IAA and control conditions for 30 days, respectively; C and D are the microscopic sections of root haustoria treated with IAA and control, respectively (PAS staining). Figure 1 AB, ruler: 2 cm; Figure 1 CD, scale bar: 75 μm.

[0020] Figure 2 Analysis of the expression pattern of SaARF7 gene.

[0021] A is the expression pattern of SaARF7 gene in different organs and tissues of Santalum album; B is the response of SaARF7 gene to auxin in haustoria.

[0022] Figure 3 This is the PCR gel image of SaARF7 gene amplification.

[0023] L1-L3 are the amplified products of SaARF7 gene under annealing temperatures of 65℃, 60℃ and 57℃ respectively; M is Trans2K marker.

[0024] Figure 4 This is the vector map of the SaARF7 gene overexpression plasmid.

[0025] Figure 5 For the identification and screening of transgenic strains.

[0026] A and B are gel images for identifying transgenic lines at the DNA level; C is a graph for identifying the SaARF7 gene expression level of transgenic lines at the mRNA level.

[0027] Figure 6 This is a microscopic structure of the stem of the SaARF7-OX3 transgenic line.

[0028] A, B, C and D are the phloroglucinol staining images of sections of wild-type IN10, overexpressed IN10, wild-type IN20 and overexpressed IN20, respectively; E is a statistical table of secondary xylem width, stem width and biomass of aboveground and underground parts. Figure 6 AD, scale bar: 200 μm.

[0029] Figure 7 This is a morphological picture of the SaARF7-OX3 transgenic line coexisting with Artemisia pine.

[0030] A is the morphological picture of the plant after 7 days of companion cultivation under sterile conditions; B is the morphological picture of the plant after 50 days of companion cultivation under soil culture conditions; C is the morphological picture of Artemisia pine seeds. Figure 7 A, scale: 1cm; Figure 7 B, ruler: 4cm; Figure 7 C, Scale bar: 400 μm. Figure 8 The response of SaARF7-OX3 transgenic line to phosphorus deficiency. Scale bar: 3 cm. Specific implementation method:

[0031] Example 1: Effect of auxin on the development of sandalwood seedlings

[0032] Sandalwood seedlings that were about 20 days after sowing and had the same developmental status were selected and treated with 10μM IAA (treatment group reagent) and DMSO (control group reagent). A mixed solution of 2.5% glutaraldehyde (Aladdin) + 2% paraformaldehyde (AlfaAesar) was used to fix the haustoria attached to the roots of the control group and the treatment group for 30 days of growth. After conventional semi-thin section preparation and sectioning, they were stained with PAS dye. Preliminary phenotypic observation results showed that compared with the control group seedlings, IAA promoted the development of sandalwood lateral roots and haustoria ( Figure 1 A and B). Microscopic results showed that IAA treatment induced the early formation and maturation of vascular tissue in the haustorium, and the front end of the haustorium was flat and disc-shaped; compared with the control, the accumulation of sugar substances in the inner and central areas of the cortex after IAA treatment was effectively promoted ( Figure 1 C and D).

[0033] Example 2: Cloning and expression pattern analysis of SaARF7 gene

[0034] Based on the transcriptome and auxin treatment data of early haustorium development, we screened for significantly differentially expressed genes that may be related to haustorium development. Among them, a member of the ARF family showed an up-regulated expression trend in the development of young and mature haustoria compared with roots. Based on the naming rules of similarity with homologous genes, it was annotated as Santalum ARF7 (SaARF7).

[0035] RNA of one-year-old sandalwood haustoria was extracted, and 1 μg RNA was reverse transcribed into cDNA. The sequence was searched using the internal database and the SaARF7 cloning primer pair (SaARF7-F: 5'-ATGCCGGCGAGCGGCGGCTT-3'; SaARF7-R: 5'-TCAAGCGTTCCCACCGTCAGAGC-3') was designed for PCR amplification. The 20 μL amplification system was: 10 μL Super Pfx mixture, 1 μL SaARF7-F, 1 μL SaARF7-R, 1 μL cDNA and 7 μL Nuclease-free water. The amplification program was set as follows: 98℃2min; 98℃10s, 57℃15s, 72℃1min, for a total of 30 cycles; 72℃10min. The results of agarose gel electrophoresis showed that a gene band of the target size was obtained, which was about 3300 bp. The amplified product was recovered using a gel recovery kit and connected to the pEASY-Blunt Zero cloning vector (full gold) to obtain pEASY-Blunt-zero-SaARF7. After sequencing, a 3300 bp nucleotide sequence (SEQ ID No.1) encoding the CDS of the SaARF7 gene and a protein sequence of 1100 amino acids (SEQ ID No.2) were obtained.

[0036]

[0037] GCATAGCTGCAGGAGGGGGGCAGTCAGGTTATACAGATGATGTTCCGTCTTGTTCCAC

[0038] GTCCCCTTCTGCAAACAACTGCCAAAATGGTGGTTCAATCAATGGTGAATGGTAGAACC

[0039] CATCCAAGCATGGTTGTGGGGGATGAGATTATTCAGTCATCTGCCACACTCTTGAGTCC

[0040] AAGTGGTTTAGAAACTATGACAACTACTGGTAACTTAATTAAGGATTTGCCACACAAG

[0041] TCTGATATCAAGCCTTCGTTAAACATACCAAAAGTCAAGGCCAAGGTGTTTTTGCCCA

[0042] ACAAGCATACTCGAATGTTGGTGGGGCCCCAATGGATTACTTGGATACGTCATCTTCGG

[0043] CTACTTCAGTAAGCCTTTCTCAGAATGATGCCCATTTGCAGCAAAATAACCCCCCACTG

[0044] TCATTTAACCAACAGCAACAGTCGATCCTGTTTAGAAGCACGAGTCAAGAAGTGGATA

[0045] CACAGGCTGATCAGAAGACAATGTTCATTTGGCACTAGCATTGATGGTCACCTGGG

[0046] AATACCCTTAGTTTCTGACACTTTACTAACGAAGGGCATGGGAGAGTCAGGCAAGGAT

[0047] TTTTCAAATACTCTTCGTTCAGGAGGGATGCTGTCCAACTTTGAAAACTCTAGAGATG

[0048] CTCAGCAGGAACTGTCATCCTCAATGGTTTCCCAATCCTTTGGAGTTCCAGATATTGCA

[0049] TTCAATTCGATTGATTCCACCTTAAACGATGAAAGCTTTGTGAATAGGGGCCCCTGGG

[0050] CCCCACCACCGCAACTTCCAAGAATGCGGACCTTTACCAAGGTATACAAGCGTGGAG

[0051] CTGTTGGTAGGTCCATTGATATCACCCGTTATTCAGGGTATGACGAACTTAAACAAGAT

[0052] CTGGCTCGTAGATTTGGGATAGAAGGGCAACTGGAAGACCAGCAGAGGATAGGCTGG

[0053] AAACTTGTGTACCTGGATCATGAGAATGACGTGCTGCTAGTGGGAGATGATCCTTGGG

[0054] AGGAGTTTGTGAATTGCGTCCGCTGCATCAGGATTTTGTCCCCTCAAGAAGTTCAGCA

[0055] GATGAGCTTAGATGGAGATTTCGGGAACAGTGTCCTTCCACATCAGGCATGCAGCAGC

[0056] TCTGACGGTGGGAACGCTTGA(SEQ ID No.1)

[0057]

[0058] To clarify the expression pattern of SaARF7 gene in different organs and tissues and its response to auxin, RNA was extracted from buds, leaves, stems, flowers, roots, young haustoria, mature haustoria and callus tissues of Santalum album using the instructions of the rapid RNA extraction kit. RNA from haustoria was extracted after 0 h, 15 min, 1 h, 2 h, 6 h and 18 h of IAA treatment. 1 μg RNA, genomic DNA remover and RT / RI enzyme mixing system (Quanshijin, Beijing, China), the reaction system is 20μl, add 5 times the volume of deionized water, mix by pipetting, and place in a -20℃ refrigerator for use. Gene expression was detected using ABI7500 qRT PCRsystem instrument. 2μL cDNA, gene-specific primers and Green qPCR SuperMix system. SaACTIN was used as the internal reference, and each sample was biologically replicated three times. The relative expression of genes was calculated using 2 -ΔΔCt Formula calculation.

[0059] The specific primer sequences are as follows:

[0060] qSaARF7-F: 5'-CAGCAGCAATCTTCTCCTCTT-3';

[0061] qSaARF7-R: 5'-GTGGTTGGTTATGGCCTAGAAT-3'.

[0062] qSaACTIN-F: 5'-GTCACACGGTGCCAATCTAT-3';

[0063] qSaACTIN-R: 5'-TACCCTCTCTCAGTCAGAATCTT-3'.

[0064] The experimental results showed that compared with other organs and tissues, the SaARF7 gene was expressed at higher levels in stems, young haustoria and mature haustoria ( Figure 2 A); and SaARF7 gene expression is induced by IAA ( Figure 2 B).

[0065] Example 3: Construction of SaARF7 gene overexpression vector

[0066] 50μL system: Use pEASY-Blunt-zero-SaARF7 sequencing plasmid as template, add F1 primer and R1 primer of pBWA(V)BS-3×flag-ccdB vector repeat sequence, 2×Biorun Pfu PCR Mix and Nuclease-free to amplify the target fragment. After 1% agarose gel electrophoresis, cut the target band (about 3300bp) ( Figure 3 ) and recovered, and the recovered product was labeled as rSaARF7.

[0067] The primer sequences are as follows:

[0068] F1: 5'-gattataaagatgatgatgatgataaaATGCCGGCGAGCGGCGGCTT-3';

[0069] R1: 5'-gtactgaagacagagctagttacaTCAAGCGTTCCCACCGTCAGAGC-3'.

[0070] The pBWA(V)BS-3×flag-ccdB vector (Biorun) was digested with BsaI, 20 μL system, incubated at 37°C for 1 h, and the vector digestion product was purified using a PCR purification kit. The purified product was labeled pBWA(V)BS-3×flag-ccdB(D).

[0071] Using the seamless cloning kit (#RDA01), rSaARF7 and pBWA(V)BS-3×flag-ccdB(D) were recombined and 5 μL of the ligation product was transformed into DH5a E. coli competent cells (Biorun), transformed according to the instructions, coated with kanamycin-resistant LB plates, cultured at 37°C for 12 hours, and single colonies were picked for inoculation and subsequent PCR identification. The following identification primers were used:

[0072] 35seq-F:5'-TTCATTTGGAGAGAACACGGGGGAC-3';

[0073] SaARF7-1R:5'-CCGAAAGCCTCTTTCCACT-3'.

[0074] The target band is about 731bp. Take 1-3 positive bands and send the corresponding bacterial solution to the company for sequencing. Keep the plasmid with correct sequencing and name it pBWA(V)BS-3×flag-SaARF7 plasmid ( Figure 4 ), referred to as SaARF7-OX plasmid, which is a fusion of SaARF7 and FLAG.

[0075] Example 4: Genetic transformation of SaARF7-OX plasmid and identification and screening of positive strains

[0076] Take 1μL SaARF7-OX plasmid and add it to 50μL GV3101 Agrobacterium competent cells, mix thoroughly and then transfer to the electroporation cup. After electroporation, add 1mL LB liquid medium, mix thoroughly and then transfer to a 1.5mL centrifuge tube, and culture at 30℃ and 180rpm for 30min. Take 50μL of the activated Agrobacterium liquid and inoculate it on the resistant LB solid medium, and culture it in the dark at 30℃ for 48h. Select a single colony for colony PCR. The electrophoresis bands of the positive control and the test colony are clear and the size is correct, and the negative control has no bands. Select the positive single colony for activation and expansion for subsequent transformation. Conventional leaf disc transformation, co-cultivation (MS+2mg / L 6-BA+0.2mg / L NAA), resistance screening (MS+2mg / L 6-BA+0.2mg / L NAA+15mg / LBasta+300mg / L cephalosporin), bud induction culture (MS+0.2mg / L 6-BA+0.1mg / L NAA+15mg / LBasta+300mg / L cephalosporin) and rooting culture (1 / 2MS+15mg / L Basta+100mg / L cephalosporin) were used to screen a batch of plants to be identified. Thirty-eight transgenic plants to be tested, about 8 cm long and with vigorous root growth, were marked with corresponding numbers No. 1-No. 38, and the front end of mature leaves was taken, and the genomic DNA was extracted using the CTAB method, and PCR detection was performed. BAS-F and BAS-R were used for initial screening of T0 positive seedlings. BAS-F: 5'-CGGCGACGAGCCAGGGATA-3'; BAS-R: 5'-GCACCATCGTCAACCACTACAT-3'. Agarose gel electrophoresis results showed that 25 strains (25 / 38) had clear bands at the target position ( Figure 5 A). Transplant the T0 positive seedlings into pots filled with sterile soil and vermiculite (volume ratio 1:1) and culture them until they produce mature seeds.

[0077] Take an appropriate amount of collected T0 generation positive seedlings, soak them in 75% alcohol for 30 seconds in a clean bench, then treat them with 6% sodium hypochlorite for 5 minutes, centrifuge briefly and remove the supernatant, and wash them 4 times with sterile water. After drying on sterile filter paper, use a pipette to evenly scatter them on the herbicide (15 mg / L) resistant MS medium. After about 10 days, select seedlings with green leaves and normal development and transplant them to sterilized nutrient soil pots for further cultivation. After two screenings and plantings, the T3 generation transgenic lines and wild types were used as subsequent research materials.

[0078] DNA was extracted from leaves of T3 transgenic SaARF7 and wild-type tobacco, and the 35seq- and SaARF7-1R identification primers ( Figure 5 B) RNA from the leaves of T3 transgenic SaARF7 and wild-type tobacco was extracted and reverse transcribed into cDNA. Wild-type Nicotiana benthamiana was used as a control and NbACTIN gene was used as an internal reference. The sequence is as follows:

[0079] qNbACTIN-F:5'-TGCAAAGACCAGCTCTTCTG-3';

[0080] qNbACTIN-R:5'-ATTCCTGCAGCTTCCATTCC-3'.

[0081] The qRT-PCR method was used to detect the expression of the SaARF7 gene in the transgenic strains. The results showed that compared with other samples, the relative expression of the gene in the transgenic strain SaARF7-OX3 was the highest ( Figure 5 C).

[0082] Example 5: Overexpression of SaARF7 induces thickening of secondary xylem

[0083] In order to study the effect of overexpression of SaARF7 gene on plant growth and development, the stable expression SaARF7-OX3 was selected for follow-up research. The plant height, stem diameter and number of lateral roots of transgenic and wild-type strains grown for 2 months were investigated. Statistical results showed that compared with WT, the plant height of SaARF7-OX3 strain did not change significantly, and the number of lateral roots increased significantly; the middle stem and base stem were wider than WT as a whole. In order to further clarify its effect on stem width, the 10th and 20th nodes of SaARF7-OX3 strain and WT were sliced ​​by hand, and the slice thickness was about 30μm. Preliminary morphological observations showed that overexpression of SaARF7 affects the formation of secondary xylem. The cross-section of each sample slice was stained with 1% pyrogallol. After staining for 30S, 1-2 drops of 25% hydrochloric acid were dripped and covered with a coverslip, and observed under a microscope. Figure 6 As shown in AD, the results of phloroglucinol staining were consistent with the preliminary observations. Compared with WT, the secondary xylem area of ​​the 10th and 20th nodes of the SaARF7-OX3 strain was significantly enlarged, and the width of the area was about 1.2 and 1.5 times that of WT, respectively; the stem width of the SaARF7-OX3 strain was 1.47 and 1.5 times that of WT, respectively ( Figure 6 E) In addition, SaARF7-OX3 lines accumulated more aboveground shoot and underground root biomass (dry weight) compared to WT.

[0084] Example 6: Function of SaARF7-OX3 in the parasitic process

[0085] The herbaceous parasitic plant Artemisia pine was used as the parasitic plant, and SaARF7-OX3 and wild-type tobacco were used as hosts to study the effects of SaARF7 gene overexpression on the development and parasitic process of the parasitic plant. The specific implementation method is as follows:

[0086] Take an appropriate amount of Artemisia pine seeds, treat them with 0.6% sodium hypochlorite for 5 minutes, rinse them with sterile water 4-5 times, place them on sterile filter paper and blow dry, and then inoculate them in 1 / 2MS medium. Take an appropriate amount of SaARF7-OX3 seeds, and the disinfection and screening methods are the same as described in Example 4. After culturing for 8 days, transfer Artemisia pine, SaARF7-OX3 seedlings and WT seedlings to a culture medium containing only agar and water for pre-cultivation for 2 days. The above materials were divided into 2 parts, one for sterile culture and the other for soil culture.

[0087] Aseptic culture was to transfer Artemisia pine and tobacco to a 1 / 2MS solid plate, and then place the root tips of Artemisia pine in contact with the root tips of SaARF7-OX3 and WT for companion culture. Soil culture was to transplant Artemisia pine and tobacco, which had been pre-cultured for 2 days and had root tips in contact, into a sterile nutrient soil: vermiculite (volume ratio 1:1) square pot for companion culture.

[0088] like Figure 7 As shown in the figure, after 7 days of aseptic culture under normal culture conditions, the root length and lateral root number of the SaARF7-OX3 strain were superior to those of the wild type. The number of haustoria associated with SaARF7-OX3 was 8, of which 4 had established vascular connections with the roots of SaARF7-OX3 ( Figure 7 A). Considering that various nutrients are relatively sufficient in the early stage of cultivation, Artemisia pine is a semi-parasitic plant. In addition to absorbing nutrients from tobacco, the roots at this stage can also directly absorb some nutrients from the culture medium. We continued to observe the strains cultivated under soil conditions. The results are as follows Figure 7 As shown in B, there are significant differences between Artemisia pine and each strain after 50 days of co-culture. Artemisia pine co-cultured with WT tobacco is at a disadvantage in terms of plant height and fruiting ( Figure 7 B), with the gradual establishment of the parasitic relationship and the loss of nutrients, Artemisia pine needs to absorb more nutrients from the host, resulting in the overall shortness and poor development of WT tobacco. However, Artemisia pine associated with SaARF7-OX3 has green leaves, large pods, and a large number of plump seeds ( Figure 7 C); SaARF7-OX plants have a certain resistance to parasitic plants, and the developed secondary xylem and root system can also obtain more nutrients from the soil to maintain demand. After 2 months of companionship, the height of SaARF7-OX3 plants is about 2 times that of WT ( Figure 7 B).

[0089] Example 7: Response of the SaARF7-OX3 strain to phosphorus deficiency

[0090] In the early stage of the cultivation of Artemisia pine, it was found that if no additional fertilizer was added in the later stage of soil cultivation, its leaves would easily turn purple. It was speculated that its development might be affected by the phosphorus content in the soil. Based on the data obtained under the previous stress conditions, compared with WT, the expression levels of genes responding to phosphorus deficiency and stress resistance genes in the SaARF7-OX3 strain were significantly upregulated. In order to study the effect of the SaARF7-OX3 strain on phosphorus deficiency in the companion process, we selected the Artemisia pine and various strains that were aseptically cultured for 7 days in Example 6 as materials, transferred them to a 1 / 3 phosphorus culture medium and cultured for 20 days, and then transplanted them into vermiculite pots for culture, and watered them every 3 days. The observation results showed that the WT tobacco and the Artemisia pine plants associated with WT tobacco were both short overall, and the Artemisia pine leaves were purple; the leaves of the Artemisia pine associated with SaARF7-OX3 tobacco were partially green, and the plant height was about twice that of the former ( Figure 8 ). This indicates that not only can the SaARF7-OX3 strain adapt to short-term phosphorus deficiency, but also has a certain positive effect on the parasitic plants' resistance to phosphorus deficiency.

Claims

1. Sandalwood auxin response factor SaARF7, characterized in that The nucleotide sequence is shown in SEQ ID NO.

1.

2. The protein encoded by the sandalwood auxin response factor SaARF7 according to claim 1, characterized in that The amino acid sequence is shown in SEQ ID NO.

2.

3. Use of the sandalwood auxin response factor SaARF7 according to claim 1 in regulating the biomass of the aboveground and underground parts of plants and the maturation of secondary xylem.

4. The use according to claim 3, characterized in that: Overexpression of the sandalwood auxin response factor SaARF7 increases the biomass of the aboveground and underground parts of the plant and promotes the maturation of the secondary xylem without causing deformation.

5. The use according to claim 3 or 4, characterized in that: The plant is sterile Nicotiana benthamiana.

6. Use of the sandalwood auxin response factor SaARF7 according to claim 1 in regulating plant height and fruiting and improving the ability to adapt to adversity during the companion growth process.

7. The use according to claim 6, characterized in that: During the companionship process, the strain overexpressing the sandalwood auxin response factor SaARF7 promoted the plant height and fruiting of the parasitic plant, and the parasitic plant itself was relatively less affected by the parasitic plant. Under the culture conditions of insufficient phosphorus, the parasitic plants and themselves associated with the strain overexpressing the sandalwood auxin response factor SaARF7 showed stronger adaptability.

8. The use according to claim 6 or 7, characterized in that: The parasitic plant is Artemisia pine.

9. A method for increasing the biomass of the above-ground and underground parts of a plant and promoting the maturity of secondary xylem without causing malformation, characterized in that: The method is to overexpress the sandalwood auxin response factor SaARF7 according to claim 1 in a plant.

10. A method for promoting plant height and fruiting of parasitic plants and improving their ability to adapt to phosphorus deficiency, characterized in that: The method is to over-express the sandalwood auxin response factor SaARF7 according to claim 1 in tobacco, and then make the tobacco symbiotic with a parasitic plant, preferably the parasitic plant is Artemisia pine.

Images