Construction method and application of genetically engineered escherichia coli of fusion enzyme for synthesizing high molecular weight dextran

By constructing a genetically engineered Escherichia coli fusion enzyme and utilizing the sequential cascade catalysis of dextran sucrase and dextranase, the problem of uneven high molecular weight dextran products in traditional methods was solved, achieving efficient and low-cost synthesis of high molecular weight dextran.

CN119736325BActive Publication Date: 2026-01-27HEFEI UNIV OF TECH
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510089540.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-21
Publication Date
2026-01-27
Estimated Expiration
2045-01-21

AI Technical Summary

Technical Problem

Existing technologies are difficult to efficiently and directionally synthesize high molecular weight dextran. Traditional methods suffer from problems such as uneven product quality, high cost, or high energy consumption.

Method used

A genetically engineered Escherichia coli strain with fusion enzymes was constructed. By homologously recombinizing the dextran sucrase P473S gene and the dextran BMdex gene, a sequential cascade catalysis was formed, directly obtaining high molecular weight dextran.

Benefits of technology

This method enables the efficient and uniform synthesis of dextran with a weight-average molecular weight of 1500 kDa, simplifies the separation and purification steps, and reduces production costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119736325B_ABST
    Figure CN119736325B_ABST
Patent Text Reader

Abstract

The application discloses a construction method of a fusion enzyme Escherichia coli engineering bacterium capable of directionally synthesizing high molecular weight dextran and application thereof, and the construction method comprises the following steps: taking a P473S dextran sucrase gene and a dextranase BMdex gene as templates, homologously recombining two enzyme genes according to a catalytic order, and transforming the two enzyme genes into BL21 (DE3) Escherichia coli to obtain a fusion enzyme Escherichia coli BL21 (DE3) / dex-P473S-BMdex gene engineering bacterium capable of directionally synthesizing dextran with different high molecular weights. The dex-P473S-BMdex gene engineering bacterium constructed in the application can produce the fusion enzyme capable of directionally synthesizing high molecular weight dextran through fermentation expression; and 1500kDa dextran with concentrated molecular weight can be directly obtained through the catalysis of the fusion enzyme with sucrose as a substrate.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a method for constructing and applying a genetically engineered Escherichia coli strain capable of directionally synthesizing a high molecular weight dextran fusion enzyme. Background Technology

[0002] Dextran, also known as dextran, has the molecular formula (C6H12H2O). 10 O5) n Dextran is a microbial polysaccharide typically synthesized from sucrose by dextran sucrase derived from *Leuconostoc mesenteroides*. It is synthesized with α(1,6) glycosidic bonds as the main chain (over 50%) and α(1,3) glycosidic bonds as branches, and occasionally α(1,2) and α(1,4) glycosidic bonds as branches. Due to variations in the degree of polymerization, dextran exhibits significant molecular weight differences. Different molecular weights of dextran have different applications, primarily in the food and pharmaceutical industries. Dextran with a weight-average molecular weight greater than 1 MDa can be used as a column packing material in chromatography. Dextran with a weight-average molecular weight between 1 and 2 MDa can be used as a food additive to improve the texture properties of products including fermented dairy products and baked goods. Dextran with a weight-average molecular weight between 40 and 100 kDa can be used as a blood volume expander in the medical industry for the emergency treatment of clinical blood loss. Dextran 40 and dextran 70 can be used as plasma substitutes. Low molecular weight dextran (less than 2000 Da) has been shown to be a potential prebiotic.

[0003] Dextran sucrase is a glucosyltransferase belonging to the GH70 family. Dextran products catalyzed by wild-type dextran sucrase generally have high molecular weight and high viscosity, making them difficult to separate and purify. To control the molecular weight of dextran products, further degradation of high molecular weight dextran is often required using chemical, physical, or biological methods. Acid hydrolysis is a traditional chemical method for degrading high molecular weight dextran. Although acid hydrolysis is fast, the resulting dextran products contain large amounts of chlorides and exhibit product heterogeneity. Ultrasonic hydrolysis is a physical method for degrading high molecular weight dextran. While simple to operate, this method is energy-intensive and unsuitable for large-scale dextran production. However, using dextranase to degrade high molecular weight dextran provides a green, environmentally friendly, and highly efficient way to obtain dextran products.

[0004] Dextranases specifically catalyze the hydrolysis of the α-1,6 glycosidic bonds in dextran. Dextranases include exo- and endo-dextranases. Exo-dextranases act on the reducing or non-reducing ends of dextran, hydrolyzing the substrate to release glucose, isomaltose, or isomalttriose. Endo-dextranases, on the other hand, act on the internal glycosidic bonds of dextran, producing dextran of varying molecular weights, isomaltooligosaccharides (DP 2-10), panose, and glucose.

[0005] Currently, there are reports on fusing dextran sucrase and dextranase to construct fusion enzymes for the direct production of low molecular weight dextran. For example, by fusing these two enzymes and controlling the sucrose concentration to regulate the molecular weight of dextran, low molecular weight dextran was successfully produced, with the yield of the fusion enzyme being 30 times higher than that of a mixture produced by a two-enzyme method with equivalent activity. Furthermore, by adding linker peptides of different lengths between dextran sucrase and dextranase to construct fusion enzymes, an artificial bifunctional enzyme was successfully constructed that can directly convert sucrose into low molecular weight dextran (13,050 Da). By studying the temperature dynamics of the fusion enzyme, the two-stage catalytic efficiency of the fusion enzyme was successfully adjusted, improving the yield of low molecular weight homogeneous dextran (62%).

[0006] It is evident that low molecular weight dextran can be successfully produced by fusing dextran sucrase and dextran from different sources, but there are few reports on the targeted production of high molecular weight dextran by fusing the two enzymes. Summary of the Invention

[0007] The purpose of this invention is to provide a genetically engineered *Escherichia coli* strain capable of directionally synthesizing high molecular weight dextran, along with its construction method and applications. This invention utilizes the sequential cascade relationship between two enzymes to construct a fusion enzyme and directly obtain a relatively uniform high molecular weight dextran product using a one-step enzymatic method.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] Firstly, this invention provides a method for constructing a genetically engineered Escherichia coli strain capable of directionally synthesizing high molecular weight dextran. The method involves using the dextran sucrase P473S gene and the dextran BMdex gene as templates, sequentially performing homologous recombination of the dextran sucrase P473S gene and the dextran BMdex gene, and transforming them into BL21(DE3) Escherichia coli to obtain a genetically engineered Escherichia coli strain capable of directionally synthesizing different high molecular weight dextran.

[0010] For the construction method described above, preferably, it may include the following steps: (1) seamless ligation and molecular simulation of the P473S dextran sucrase gene and the dextran BMdex gene, (2) primer design, (3) construction of recombinant plasmid and (4) host bacterial transformation.

[0011] For the construction method described above, preferably, the seamless linking and molecular simulation of the P473S dextran sucrase gene and the dextran BMdex gene in step (1) involves using Discovery Studio 2019 software to perform sequence similarity comparison to search for templates, performing structural comparison and superposition of the templates, comparing the target sequence with the template sequence, generating a fusion enzyme model using MODELLER, and then performing a feasibility analysis.

[0012] For the construction method described above, preferably, the primer design in step (2) is based on the P473S dextran sucrase gene, the vector pET-28a-(+), and the dextran BMdex gene sequence, and the mutant primers are designed using SnapGene software as follows:

[0013] pET-28a-(+)-P473S Template:

[0014] Upstream primer:

[0015] 5'--TGGTCGGCATTGCTGACACAGCATTTCCATTATTATCAAA---3'

[0016] Downstream primer:

[0017] 5'--GAAAAGCACCCCGCTCGAGCACCACCACCACCACCACTGA--3'

[0018] BMdex template:

[0019] Upstream primer:

[0020] 5'--AAATGCTGTCAGCAATGCCGACCACCGGCCTGCGTCAG--3'

[0021] Downstream primer:

[0022] 5'--GGTGGTGGTGGTGGGTGCTCGAGCGGGGTGCTTTTCCA --3'.

[0023] For the construction method described above, preferably, the recombinant plasmid construction in step (3) is based on the P473S dextran sucrase gene and the vector pET-28a-(+) and the dextran BMdex sequence template. Using the designed primers, the original template is digested by DMT using PCR amplification and seamless cloning techniques to obtain the recombinant expression plasmid pET-28a-(+)-dex-P473S-BMdex.

[0024] For the construction method described above, preferably, step (4) host transformation involves transforming the recombinant expression plasmid pET-28a-(+)-dex-P473S-BMdex into Escherichia coli competent cells BL21(DE3), followed by kanamycin resistance screening, enzyme digestion, bacterial PCR, and DNA sequencing verification.

[0025] Secondly, the present invention can obtain a genetically engineered Escherichia coli BL21(DE3) / dex-P473S-BMdex strain capable of directionally synthesizing high molecular weight dextran fusion enzyme through the above-described construction method.

[0026] Thirdly, this invention also provides the application of the *Escherichia coli* BL21(DE3) / dex-P473S-BMdex genetically engineered strain, which is capable of directionally synthesizing high molecular weight dextran, in the catalytic conversion of sucrose to high molecular weight dextran. Preferably, the high molecular weight dextran has a weight-average molecular weight of 1400-1600 kDa. The sucrose conversion rate can reach over 86%.

[0027] In the above-mentioned application, a preferred method is to first ferment the genetically engineered Escherichia coli BL21(DE3) / dex-P473S-BMdex to express the fusion enzyme, and then obtain high molecular weight dextran using sucrose as a substrate through fusion enzyme catalysis.

[0028] For the aforementioned application, preferably, the fermentation expression of the fusion enzyme by the genetically engineered *Escherichia coli* BL21(DE3) / dex-P473S-BMdex strain may include the following steps: Inoculating the genetically engineered *Escherichia coli* BL21(DE3) / dex-P473S-BMdex strain at a volume fraction of 0.5% into LB medium containing 40–60 μg / ml kanamycin, rotating at 250 r / min, and culturing at 37 °C for 16 hours; adding 4 mL of the above culture medium to 200 mL of medium A, and culturing on a shaker at 37 °C; when the enriched bacterial culture is diluted 10-fold with distilled water to obtain the OD... 600At 0.20–0.24, 500 μL of IPTG can be added to induce enzyme production. Fermentation is induced at 15 °C for 3.5–4 hours. The inducing bacterial suspension is centrifuged at 8000 r / min for 15 min at 4 °C, with one centrifuge tube corresponding to one bottle of bacterial suspension. Then, distilled water is added and the suspension is shaken and centrifuged again. 15–20 mL of acetate-calcium acetate buffer (pH 5.4) is added to each centrifuge tube, shaken and mixed, then placed in an ice-water bath and sonicated for 15 min. After centrifugation, the supernatant is the fusion enzyme capable of directionally synthesizing high molecular weight dextran, with an enzyme activity of 70–100 U / mL. Each liter of the A medium contains 5 g glycerol, 5 g glucose, 10 g peptone, 10 g potassium nitrate, 17.105 g Na2HPO4·12H2O, 3 g KH2PO4, 1 g NH4Cl, and 0.1 mmol / L MgSO4·7H2O.

[0029] The fusion enzyme for the directed synthesis of dextran, prepared by fermentation of the genetically engineered bacteria described in this invention, uses sucrose as a substrate and, through bifunctional catalysis, can directly obtain dextran with a molecular weight concentrated around 1500 kDa. Based on the sequential cascade catalytic relationship (polymerization and hydrolysis) between dextran sucrase and dextranase, the synergistic catalysis of dextran sucrase and dextranase to produce low molecular weight dextran has been studied. Although Gan Weiwei et al. obtained a low molecular weight major product (e.g., 5241 Da) through the synergistic catalysis of dextran sucrase and dextranase, there were still medium molecular weight byproducts (19374 Da, 8295 Da). Sharma et al. obtained isomaltooligosaccharides (DP3-7) through the co-immobilization catalysis of dextranase and dextranase, but the degree of polymerization was not uniform. Therefore, the one-step production of dextran with uniform molecular weight is an urgent problem to be solved. This invention utilizes the dextran sucrase YG mutant P473S (Source: Int J Biol Macromol 2017.10.023) constructed by Li Mengqi et al. and the dextran sucrase gene BMdex (Genbank No. BAA76382.1) as templates. The two enzyme genes are sequentially homologously recombinated and transformed into BL21(DE3) Escherichia coli to obtain the BL21(DE3) / dex-P473S-BMdex genetically engineered bacteria. After fermentation expression, a fusion enzyme for the directed synthesis of high molecular weight dextran can be obtained. Using sucrose as a substrate, the fusion enzyme catalyzes the direct synthesis of 1500kDa dextran (T1500). Under the same conditions and reaction time, the fusion enzyme expressed by engineered bacteria BL21(DE3) / dex-P473S-5rl-BMdex has a smaller and more concentrated molecular weight than the product catalyzed by the two-enzyme free enzyme, and the yield of dextran T1500 can reach 32.6% after 24 hours of reaction.

[0030] The BL21(DE3) / dex-P473S-BMdex genetically engineered bacteria constructed in this invention can be fermented at 37°C under controlled conditions, induced with IPTG at 15°C, and the crude enzyme solution is crushed in a pH 5.4 acetate-calcium acetate buffer solution. The product is then catalyzed at 30°C, ultimately yielding dextran with a weight-average molecular weight of 1500 kDa. This invention can specifically produce 1500 kDa dextran, simplifying the separation and purification steps, reducing production costs, and providing a foundation for better application in production. Attached Figure Description

[0031] Figure 1The diagram shows the construction of the dextran sucrase fusion plasmid and the dextran enzyme fusion plasmid. The P473S dextran sucrase gene and the vector pET-28a-(+) and the dextran enzyme BMdex gene were extracted as shown in the right figure. The two were then combined through seamless ligation to obtain the left figure.

[0032] Figure 2 This is a three-dimensional structural simulation diagram of the dextran sucrase and dextran fusion enzyme using Discovery Studio 2019 software;

[0033] Figure 3 This is a diagram of the one-step directional catalysis and dual-enzyme synergistic catalysis mechanism of the present invention; sucrose is degraded into fructose and high molecular weight dextran by dextran sucrase P473S, and then generated into stable and uniform dextran under the catalysis of dextranase BMdex.

[0034] Figure 4 This is the HPLC chromatogram of the molecular weight of dextran T1500, the enzyme-catalyzed product of the fusion enzyme of this invention; the molecular weight characterization of the dextran product with uniform molecular weight of 1500 kDa generated by the fusion enzyme after successful fusion in 16.38 min under the catalysis of sucrose.

[0035] Figure 5 This is the one-dimensional hydrogen spectrum of the dextran T1500, a product of this invention.

[0036] Figure 6 This is a comparison of the synergistic catalytic and fusion enzyme catalytic results of dextran sucrase P473S and free dextran BMdex enzyme. Detailed Implementation

[0037] The following embodiments are further illustrations of the present invention and serve as explanations of the technical content of the present invention. However, the essence of the present invention is not limited to the embodiments described below. Those skilled in the art can and should know that any simple changes or substitutions based on the spirit of the present invention should fall within the protection scope claimed by the present invention.

[0038] Example 1

[0039] A method for constructing a fusion enzyme *E. coli* capable of directionally synthesizing dextran with a weight-average molecular weight of 1500 kDa is disclosed. Using the dextran sucrase P473S gene and the dextranase BMdex gene as templates, the two enzyme genes are sequentially homologously recombinated and transformed into *E. coli* BL21(DE3), resulting in the *E. coli* BL21(DE3) / dex-P473S-BMdex genetically engineered bacterium capable of directionally synthesizing T1500 dextran. The *E. coli* BL21(DE3) / dex-P473S-BMdex genetically engineered bacterium, abbreviated as dex-P473S-BMdex, has the accession number CGMCC No. 33058 and was deposited on December 13, 2024, at the China General Microbiological Culture Collection Center (No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing), and is classified as *Escherichia coli*.

[0040] The construction method specifically includes the following steps:

[0041] (1) Molecular simulation: P473S dextran sucrase protein and BMdex dextran sucrase protein were sequence similarity searched using Discovery Studio 2019 software. The templates were then structurally compared and superimposed. The target sequence was compared with the template sequence and a fusion enzyme model was generated using MODELLER. Then, a feasibility analysis was performed.

[0042] (2) Primer design: Based on the P473S dextran sucrase gene, the vector pET-28a-(+), and the dextran BMdex sequence, the following mutant primers were designed using SnapGene software:

[0043] pET-28a-(+)-P473S Template:

[0044] Upstream primer:

[0045] 5'----- TGGTCGGCATTGCTGACACAGCATTTCCATTATTATCAAA -----3'

[0046] Downstream primer:

[0047] 5'-----GAAAAGCACCCCGCTCGAGCACCACCACCACCACCACTGA-----3'

[0048] BMdex template:

[0049] Upstream primer:

[0050] 5'-----AAATGCTGTCAGCAATGCCGACCACCGGCCTGCGTCAG-----3'

[0051] Downstream primer:

[0052] 5'-----GGGTGGTGGTGGTGGTGCTCGAGCGGGGTGCTTTTCCA -----3'.

[0053] (3) Construction of the recombinant plasmid: Based on the P473S dextran sucrase gene and the vector pET-28a-(+) and the dextran BMdex sequence template, the recombinant expression plasmid pET-28a-(+)-dex-P473S-BMdex was obtained by using the designed primers, PCR amplification and seamless cloning technology, and digestion of the original template by DMT.

[0054] (4) Host transformation: The recombinant expression plasmid pET-28a-(+)-dex-P473S-BMdex was transformed into Escherichia coli competent cells BL21(DE3). After kanamycin resistance screening, enzyme digestion, bacterial PCR and DNA sequencing verification, the fusion enzyme Escherichia coli engineered strain BL21(DE3) / dex-P473S-BMdex genetically engineered strain suitable for the directional synthesis of dextran was obtained.

[0055] Host transformation can specifically include the following steps:

[0056] (1) Take 100 μL of Escherichia coli BL21(DE3) competent cell suspension (purchased from Beijing TransGen Biotech Co., Ltd.) from a -80 ℃ freezer and thaw it on ice;

[0057] (2) Add the prepared recombinant expression plasmid solution, add about 5 μl of plasmid DNA to every 50 μl competent cells, shake gently, and place on ice for 30 minutes;

[0058] (3) Heat shock in a 42 ℃ water bath for 45 seconds, and then quickly place on ice to cool for 2 minutes;

[0059] (4) Add 500 ml of sterilized LB liquid medium (without antibiotics) to the tube, mix well, and incubate at 37 °C for 1 hour to allow the bacteria to return to normal growth and express the resistance gene encoded by the plasmid.

[0060] (5) After shaking the above bacterial solution, take 100 μL and spread it on a screening plate containing antibiotics. Place it face up for half an hour. When the bacterial solution is completely absorbed by the culture medium, invert the culture medium and incubate at 37 °C for 16 to 18 hours. Select positive colonies and verify them by bacterial solution PCR to obtain the engineered Escherichia coli BL21(DE3) / dex-P473S-2rl-BMdex gene engineered bacteria that can directionally synthesize dextran.

[0061] Example 2

[0062] Expression of the dextran fusion enzyme in the engineered Escherichia coli BL21(DE3) / dex-P473S-2rl-BMdex strain.

[0063] The genetically engineered bacteria BL21(DE3) / dex-P473S-BMdex were inoculated at a rate of 0.5% into LB medium containing 40–60 μg / ml kanamycin and cultured at 37 °C for 16 hours at 250 r / min. 2 mL of the culture was then added to 200 mL of medium A and cultured on a shaker at 37 °C. The OD of the enriched bacterial culture was calculated by diluting the solution 10-fold with distilled water. 600 Add 500 μL of IPTG at 0.20–0.24°C to induce enzyme production. After fermentation at 15°C for 3.5–4 hours, the mixture is broken up and centrifuged. Each liter of the A medium contains 5 g glycerol, 5 g glucose, 10 g peptone, 10 g potassium nitrate, 17.105 g Na₂HPO₄·12H₂O, 3 g KH₂PO₄, 1 g NH₄Cl, and 0.1 mmol / L MgSO₄·7H₂O.

[0064] Example 3

[0065] The fermentation production of dextran fusion enzyme by the engineered E. coli strain BL21(DE3) / dex-P473S-BMdex includes the following steps:

[0066] The genetically engineered bacteria BL21(DE3) / dex-P473S-BMdex were inoculated at a volume fraction of 0.5% into LB medium containing 40–60 μg / ml kanamycin and cultured at 37 °C for 16 hours at 250 r / min. 2 mL of the culture was then added to 200 mL of medium A and incubated on a shaker at 37 °C. The OD of the enriched bacterial culture was calculated by diluting the culture 10-fold with distilled water. 600At 0.20–0.24, add 500 μL of IPTG to induce enzyme production. Maintain fermentation at 15 °C for 3.5–4 hours. Centrifuge the inducing bacterial suspension at 8000 r / min for 15 min at 4 °C, with one centrifuge tube corresponding to one bottle of bacterial suspension. Then add distilled water, shake and wash, and centrifuge again. Add 15–20 mL of acetate-calcium acetate buffer (pH 5.4) to each centrifuge tube, shake well, place in an ice-water bath, sonicate for 15 min, centrifuge, and the supernatant is the crude enzyme solution of the fusion enzyme dex-P473S-BMdex, with an enzyme activity of 70–100 U / mL. Each liter of culture medium A contains 5 g glycerol, 5 g glucose, 10 g peptone, 10 g potassium nitrate, 17.105 g Na2HPO4·12H2O, 3 g KH2PO4, 1 g NH4Cl, and 0.1 mmol / L MgSO4·7H2O.

[0067] Example 4

[0068] The applications of the fusion enzyme of this invention for the targeted synthesis of dextran T1500 are as follows:

[0069] The crude enzyme solution of the fusion enzyme dex-P473S-BMdex obtained in Example 3 was used to react with sucrose. The enzyme reaction system was prepared with 10% sucrose, 10 mmol / L acetate-calcium buffer (pH=5.4), and 5 U / ml enzyme activity. The reaction was carried out in a water bath at 30°C and 120-150 pm for 24 hours. The reaction solution was then removed and boiled in water for 10 min to stop the reaction. Centrifugation was used to remove inactivated enzyme protein. Dialysis was performed using a 500 kDa dialysis bag for 48 hours to remove small molecule sugars from the reaction solution, followed by drying. The dried product was detected by differential liquid chromatography under the following conditions: GPC column, differential detector, mobile phase: pure water, flow rate: 0.6 mL / min. Figure 5 To characterize dextran using one-dimensional proton NMR spectroscopy, the dextran product catalyzed by the fusion enzyme after successful fusion is mainly composed of α-(1,6) glycosidic bonds and α-(1,3) glycosidic bonds.

[0070] Comparative Example 1

[0071] Free dextran sucrase P473S and dextran sucrase Bmdex were prepared using an engineered bacterial induction method. Specifically, *E. coli* BL21(DE3) / P473S genetically engineered bacteria were cultured at 37°C for 16 hours, and 4 mL of the bacterial culture was transferred to 200 mL of induction medium and incubated on a shaker at 37°C. OD 600At 2–4 minutes, 500 μL of IPTG can be added to induce enzyme production. Fermentation is induced at 25°C for 3.5–4 hours. The inducing bacterial suspension is then centrifuged at low temperature for 15 min to obtain bacterial cells. 15–20 mL of a pH 5.4 acetate-calcium acetate buffer solution is added, and the mixture is shaken and sonicated on ice for 15 min. After centrifugation, the supernatant is the free dextran sucrase P473S, with an enzyme activity of 120–150 U / mL. The same engineered bacterial induction method can be used to prepare free dextran sucrase Bmdex. Using 10% (w / v) sucrose as a substrate, it is dissolved in a pH 5.4, 10 mmol / L acetate-calcium acetate buffer solution. After the sucrose is completely dissolved, dextran sucrase P473S and dextran BMdex with a final enzyme activity of 5 U / mL are added simultaneously. The mixture is reacted in a 30°C water bath for 24 h at 160 rpm. After the reaction was complete, the mixture was boiled in a water bath for 10 minutes. After cooling to room temperature, the inactivated enzyme protein was removed by centrifugation. The mixture was then dialyzed using a 500 kDa dialysis bag for 48 hours to remove small sugar molecules from the reaction solution, followed by drying. The dried product was detected using differential liquid chromatography (HPLC) under the following conditions: GPC column, differential detector, mobile phase: pure water, flow rate: 0.6 mL / min. The molecular weight results were compared using HPLC as follows: Figure 6 .

[0072] from Figure 6 It can be seen that the product distribution of the fusion enzyme is more concentrated and more uniform than that of the free enzyme. The main elution time of the fusion enzyme product is 16.3 min, with a weight-average molecular weight of about 1500 kDa, and the D value of the dextran product of the fusion enzyme is 1.13 (Table 1). In contrast, the distribution index D of the free enzyme is greater than that of the fusion enzyme, indicating a greater degree of product dispersion, with a weight-average molecular weight of about 2240-7702 kDa, much higher than that of the fusion enzyme product. This is due to the "substrate channel" effect of the fusion enzyme. The high molecular weight dextran intermediate is promptly captured by the catalytically active site of the dextranase, and the fusion enzyme begins its hydrolytic function, breaking the α-1,6 glycosidic bond in the dextran, ultimately generating a dextran product with a molecular weight of 1500 kDa. This explains why fusion enzyme A produces a relatively uniform dextran product with a molecular weight of about 1500 kDa.

[0073] Table 1. Comparison of products of fusion enzyme and free enzyme

[0074] enzymes Mw (kDa) D value Fusion enzyme 1500 1.13 Free enzymes 2240—7702 1.21

[0075] It should be noted that the above-described technical content of this invention is merely an explanation and clarification to enable those skilled in the art to understand the technical essence of this invention, and therefore is not intended to limit the scope of protection of this invention. The scope of protection of this invention should be determined by the claims. Those skilled in the art should understand that any modifications, equivalent substitutions, and improvements made based on the essential spirit of this invention should be within the scope of protection of this invention.

Claims

1. A genetically engineered *Escherichia coli* BL21(DE3) / dex-P473S-BMdex strain capable of directionally synthesizing a high molecular weight dextran fusion enzyme, characterized in that: The BL21(DE3) / dex-P473S-BMdex genetically engineered bacterium was deposited at the China General Microbiological Culture Collection Center on December 13, 2024, with the accession number CGMCC No. 33058, and classified as Escherichia coli.

2. The application of the *Escherichia coli* BL21(DE3) / dex-P473S-BMdex genetically engineered strain capable of directionally synthesizing high molecular weight dextran as described in claim 1 in the catalytic conversion of sucrose to high molecular weight dextran, characterized in that... The high molecular weight dextran has a weight-average molecular weight of 1400-1600 kDa.

3. The application as described in claim 2, characterized in that, First, the genetically engineered Escherichia coli BL21(DE3) / dex-P473S-BMdex was fermented to express a fusion enzyme. Then, high molecular weight dextran was obtained by catalysis of the fusion enzyme using sucrose as a substrate.

4. The application as described in claim 3, characterized in that, The method for expressing the fusion enzyme through fermentation of *Escherichia coli* BL21(DE3) / dex-P473S-BMdex genetically engineered bacteria includes the following steps: *Escherichia coli* BL21(DE3) / dex-P473S-BMdex genetically engineered bacteria are inoculated at a volume fraction of 0.5% into LB medium containing 40–60 μg / ml kanamycin, and cultured at 37 °C for 16 hours at 250 r / min; 4 mL of the culture is added to 200 mL of medium A and incubated on a shaker at 37 °C. When the enriched bacterial culture is diluted 10-fold with distilled water to obtain the OD... 600 At 0.20–0.24, 500 μL of IPTG can be added to induce enzyme production. Fermentation is induced at 15 °C for 3.5–4 hours. The inducing bacterial suspension is centrifuged at 8000 r / min for 15 min at 4 °C, with one centrifuge tube corresponding to one bottle of bacterial suspension. Then, distilled water is added and the suspension is shaken and centrifuged again. 15–20 mL of acetate-calcium acetate buffer with pH 5.4 is added to each centrifuge tube, shaken and mixed, then placed in an ice-water bath and sonicated for 15 min. After centrifugation, the supernatant is the fusion enzyme that can directionally synthesize high molecular weight dextran, with an enzyme activity of 70–100 U / mL. Each liter of the A medium contains 5 g glycerol, 5 g glucose, 10 g peptone, 10 g potassium nitrate, 17.105 g Na2HPO4·12H2O, 3 g KH2PO4, 1 g NH4Cl, and 0.1 mmol / L MgSO4·7H2O.

Citation Information

Patent Citations

  • Preparation method of iron-dextrin

    CN107201387A

  • Enzymatic synthesis of soluble glucan fiber

    CN107580453A