Application of combination of Philligenin and dexmedetomidine in improvement of myocardial ischemia-reperfusion injury

Abstract

The invention discloses application of combination of Philligenin and dexmedetomidine in improvement of myocardial ischemia reperfusion injury, and belongs to the technical field of drug development. The pharmaceutical composition is prepared from Phillygenin and dexmedetomidine, wherein the Phillygenin and the dexmedetomidine are used as raw materials; the Phillygenin and the dexmedetomidine are combined for use, myocardial ischemia reperfusion injury can be reduced, and compared with single use of the phillygenin or the dexmedetomidine, the Phillygenin and the dexmedetomidine have a synergistic interaction effect. The compound can play a role in preventing and treating myocardial ischemia reperfusion injury, and a new target is provided for treatment of myocardial ischemia reperfusion.

Description

Technical Field

[0001] The invention discloses application of Phillygenin combined with dexmedetomidine in improving myocardial ischemia-reperfusion injury, and belongs to the technical field of drug development. Background Art

[0002] In the ranking of disease mortality rates worldwide, cardiovascular disease ranks first. Among the people who die from cardiovascular diseases, the largest number of people are caused by coronary heart disease, accounting for about 42%. Coronary heart disease is myocardial hypoxia and ischemic heart disease caused by atherosclerosis or dynamic changes in the coronary arteries of the heart, which leads to stenosis or even blockage of the vascular lumen. The full name is coronary atherosclerotic heart disease, also known as ischemic heart disease. Western medicine believes that lipid metabolism disorders and arterial wall dysfunction are the main causes of coronary heart disease. Chinese medicine has recorded symptoms such as "chest pain" and "chest pain" belonging to coronary heart disease in the "Nei Jing" and "Jingui Yaolue". However, although people have never stopped studying coronary heart disease, they have not yet found a cure for coronary heart disease. Patients with coronary heart disease can only rely on drugs to maintain long-term treatment, or surgical intervention, such as coronary angiography, coronary artery stent implantation, percutaneous transluminal coronary angioplasty, etc. However, complications such as intraoperative and postoperative bleeding, infection, heart failure and arrhythmia are often accompanied by coronary heart disease. At present, the purpose of most clinical treatments is to restore blood perfusion in the coronary arteries. However, although the heart can withstand short-term ischemia, it is easy to cause ischemic heart damage to worsen during the process of restoring blood perfusion after severe damage or long-term ischemia, resulting in symptoms such as arrhythmia, hemorrhagic necrosis, and low heart function, namely myocardial ischemia / reperfusion injury (MI / RI). The current treatment principle is to identify and correct reversible causes as early as possible, take timely intervention measures to avoid further damage, provide appropriate nutritional support, and actively prevent and treat complications.

[0003] Dexmedetomidine (DEX) is a highly effective and selective α2 adrenergic receptor agonist with antisympathetic, sedative and analgesic effects. By stimulating different types of α2 receptors, DEX can achieve a variety of therapeutic effects, including sedation, pain relief, anti-infection, cardiovascular regulation, etc. In recent years, a wealth of preclinical studies have shown that dexmedetomidine plays an important role in anti-ischemia-reperfusion injury. This effect is mainly achieved by affecting gene expression, regulating channel function, regulating neurotransmitter release, inhibiting inflammatory response, and reducing cell apoptosis and necrosis. However, due to the complexity of myocardial ischemia-reperfusion injury, which involves multiple cellular and molecular mechanisms, the clinical effect of dexmedetomidine in the treatment of myocardial ischemia-reperfusion injury is still limited.

[0004] Currently, it is difficult to achieve ideal treatment effects for MI / RI. Therefore, there is an urgent need for a drug treatment strategy that is better, safer, and has fewer side effects for MI / RI patients, so as to improve the quality of life and long-term prognosis of MI / RI patients. Summary of the invention

[0005] Phillygenin, a Chinese medicine monomer, is an important active ingredient isolated from the Chinese medicine Forsythia suspensa. Its molecular formula is C 21 H 24 O6. Dexmedetomidine combined with phillygenin can mediate the polarization of macrophages from M1 to M2, thereby improving myocardial ischemia-reperfusion injury and myocardial tissue lesions, reducing myocardial damage, and can be used to prepare drugs for preventing and treating myocardial ischemia-reperfusion injury.

[0006] The present invention provides a pharmaceutical composition or a medicine kit, which comprises a therapeutically effective amount of dexmedetomidine and a therapeutically effective amount of phillygenin, wherein the dexmedetomidine and phillygenin are used in combination to have an obvious synergistic effect;

[0007] The Phillygenin is a compound having a structure as shown in the following formula, or a stereoisomer or solvate thereof;

[0008]

[0009] The dexmedetomidine is a compound having a structure shown in the following formula, a stereoisomer or a solvate thereof:

[0010]

[0011] In one embodiment, the mass ratio of Phillygenin to dexmedetomidine is (2000-3500):(1-5); preferably, the mass ratio is 3000:1.

[0012] In one embodiment, the pharmaceutical composition consists of a first pharmaceutical composition and a second pharmaceutical composition; the first pharmaceutical composition comprises Phillygenin and a pharmaceutically acceptable pharmaceutical carrier or excipient; the second pharmaceutical composition comprises dexmedetomidine and a pharmaceutically acceptable pharmaceutical carrier or excipient.

[0013] In one embodiment, the pharmaceutical composition is used to treat or prevent myocardial ischemia-reperfusion injury.

[0014] In one embodiment, the myocardial ischemia-reperfusion injury is caused by cardiac surgery including but not limited to coronary artery bypass surgery, heart transplantation or coronary angioplasty.

[0015] In one embodiment, the first pharmaceutical composition is taken or injected 50 minutes before cardiac surgery; and the second pharmaceutical composition is taken or injected 20 minutes before cardiac surgery.

[0016] In one embodiment, the pharmaceutical composition consists of a first pharmaceutical composition that is taken or injected every day within two weeks before cardiac surgery; and a second pharmaceutical composition that is taken or injected 20 minutes before cardiac surgery.

[0017] In one embodiment, the cardiac surgery includes but is not limited to coronary artery bypass surgery, heart transplantation, or coronary angioplasty.

[0018] The present invention provides use of dexmedetomidine combined with Phillygenin or the above-mentioned pharmaceutical composition or kit in any of the following (a) to (e):

[0019] (a) preparing a drug for improving myocardial ischemia-reperfusion injury or ischemic cardiomyopathy; or improving myocardial ischemia-reperfusion injury or ischemic cardiomyopathy;

[0020] (b) preparing a drug for inhibiting myocardial ischemia-reperfusion-induced cardiomyocyte apoptosis; or inhibiting myocardial ischemia-reperfusion-induced cardiomyocyte apoptosis;

[0021] (c) preparing a drug for inhibiting the generation of reactive oxygen free radicals (ROS) after myocardial ischemia-reperfusion; or inhibiting the generation of reactive oxygen free radicals (ROS) after myocardial ischemia-reperfusion;

[0022] (d) preparing a drug for inhibiting apoptosis of cardiomyocytes after hypoxia and reoxygenation; or inhibiting apoptosis of cardiomyocytes after hypoxia and reoxygenation;

[0023] (e) preparing a drug for inhibiting the production of reactive oxygen free radicals (ROS) by myocardial cells after hypoxia and reoxygenation; or inhibiting the production of reactive oxygen free radicals (ROS) by myocardial cells after hypoxia and reoxygenation;

[0024] The combined use of dexmedetomidine and phillygenin has a significant synergistic effect;

[0025] The Phillygenin is a compound having a structure as shown in the following formula, or a stereoisomer or solvate thereof;

[0026]

[0027] The dexmedetomidine is a compound having a structure shown in the following formula, a stereoisomer or a solvate thereof:

[0028]

[0029] In one embodiment, the single dosage of Phillygenin is 10-35 mg / kg, and the administration frequency is once a day, once every two days, once every three days, or once every four days; the single dosage of dexmedetomidine is 3-50 μg / kg, and the administration frequency is once a day, once every two days, once every three days, or once every four days;

[0030] Optionally, the single dosage of Phillygenin is 15 mg / kg, and the administration frequency is once a day; the single dosage of dexmedetomidine is 5 μg / kg, and the administration frequency is once a day;

[0031] Optionally, the single dosage of Phillygenin is 20 mg / kg, and the administration frequency is once a day; the single dosage of dexmedetomidine is 10 μg / kg, and the administration frequency is once a day;

[0032] Optionally, the single dosage of Phillygenin is 35 mg / kg, and the administration frequency is once a day; the single dosage of dexmedetomidine is 50 μg / kg, and the administration frequency is once a day;

[0033] Optionally, the single dosage of Phillygenin is 30 mg / kg, and the administration frequency is once a day; the single dosage of dexmedetomidine is 10 μg / kg, and the administration frequency is once a day.

[0034] In one embodiment, the phillygenin and dexmedetomidine are contained as active ingredients in different formulations and are administered simultaneously or at different times.

[0035] In one embodiment, the combined administration route is selected from oral administration, parenteral administration, and transdermal administration, wherein the parenteral administration includes but is not limited to intravenous injection, subcutaneous injection, and intramuscular injection;

[0036] Preferably, Phillygenin is administered orally; and dexmedetomidine is administered by intravenous injection.

[0037] In one embodiment, the drug can be a tablet, pill, powder, lozenge, sachet, cachet, elixir, suspension, emulsion, solution, syrup, aerosol, ointment, soft and hard gelatin capsule, suppository, sterile injection solution or sterile packaged powder injection; in the present invention, the active ingredient is prepared into a drug so that it can quickly release, slowly release or delay the release of the active ingredient after administration to a subject.

[0038] In one embodiment, the medicament further comprises a pharmaceutically acceptable carrier.

[0039] In one embodiment, the pharmaceutical composition consists of a first pharmaceutical composition and a second pharmaceutical composition; the first pharmaceutical composition comprises Phillygenin and a pharmaceutically acceptable pharmaceutical carrier or excipient; the second pharmaceutical composition comprises dexmedetomidine and a pharmaceutically acceptable pharmaceutical carrier or excipient.

[0040] In one embodiment, the pharmaceutical composition is used to treat or prevent myocardial ischemia-reperfusion injury.

[0041] In one embodiment, the myocardial ischemia-reperfusion injury is caused by cardiac surgery including but not limited to coronary artery bypass surgery, heart transplantation or coronary angioplasty.

[0042] In one embodiment, the first pharmaceutical composition is taken or injected 50 minutes before cardiac surgery; and the second pharmaceutical composition is taken or injected 20 minutes before cardiac surgery.

[0043] In one embodiment, the pharmaceutical composition consists of a first pharmaceutical composition that is taken or injected every day within two weeks before cardiac surgery; and a second pharmaceutical composition that is taken or injected 20 minutes before cardiac surgery.

[0044] In one embodiment, the cardiac surgery includes but is not limited to coronary artery bypass surgery, heart transplantation, or coronary angioplasty.

[0045] The present invention also provides the use of Phillygenin in preparing a drug for enhancing the efficacy of dexmedetomidine in improving myocardial ischemia-reperfusion injury or ischemic cardiomyopathy.

[0046] In one embodiment, the Phillygenin is a compound having a structure as shown in the following formula, a stereoisomer or a solvate thereof:

[0047]

[0048] The dexmedetomidine is a compound having a structure shown in the following formula, a stereoisomer or a solvate thereof:

[0049]

[0050] The combined use of dexmedetomidine and phillygenin has an obvious synergistic effect.

[0051] In one embodiment, the drug contains the above-mentioned drug ingredients and pharmaceutically acceptable excipients.

[0052] In one embodiment, the auxiliary material includes any one of a carrier, a diluent, an excipient, a filler, a binder, a wetting agent, a disintegrant, an emulsifier, a solubilizer, a solubilizing agent, an osmotic pressure regulator, a surfactant, a coating material, a colorant, a pH regulator, an antioxidant, an antibacterial agent or a buffer, or a combination of at least two thereof.

[0053] In one embodiment, the carrier is one or more of a liposome and a nanoparticle.

[0054] In one embodiment, the excipient is one or more of mannitol, lactose, fatty acid, and polyethylene glycol.

[0055] In one embodiment, the dosage form of the drug includes any one of drops, oral liquid, tablets, capsules, granules, films, gels, powders, emulsions, pills or solutions.

[0056] In one embodiment, the administration route of the drug includes oral administration, sublingual administration, rectal administration, skin mucosal administration, inhalation administration or injection administration.

[0057] The present invention also provides the use of dexmedetomidine combined with phillygenin in the preparation of a drug or a drug kit or a drug combination for improving myocardial ischemia-reperfusion injury or ischemic cardiomyopathy; the combined use of dexmedetomidine and phillygenin has an obvious synergistic effect;

[0058] The Phillygenin is a compound having a structure as shown in the following formula, or a stereoisomer or solvate thereof;

[0059]

[0060] The dexmedetomidine is a compound having a structure shown in the following formula, a stereoisomer or a solvate thereof:

[0061]

[0062] In one embodiment, the dexmedetomidine and phillygenin may be administered simultaneously, formulated separately and co-administered, or formulated separately and administered sequentially.

[0063] In one embodiment, the mass ratio of Phillygenin to dexmedetomidine in the application is (2000-3500):(1-5); preferably, the mass ratio is 3000:1.

[0064] In one embodiment, the single dosage of Phillygenin is 10-35 mg / kg, and the administration frequency is once a day, once every two days, once every three days, or once every four days; the single dosage of dexmedetomidine is 3-50 μg / kg, and the administration frequency is once a day, once every two days, once every three days, or once every four days.

[0065] In one embodiment, the drug contains the above-mentioned drug ingredients and pharmaceutically acceptable excipients.

[0066] In one embodiment, the auxiliary material includes any one of a carrier, a diluent, an excipient, a filler, a binder, a wetting agent, a disintegrant, an emulsifier, a solubilizer, a solubilizing agent, an osmotic pressure regulator, a surfactant, a coating material, a colorant, a pH regulator, an antioxidant, an antibacterial agent or a buffer, or a combination of at least two thereof.

[0067] In one embodiment, the carrier is one or more of a liposome and a nanoparticle.

[0068] In one embodiment, the excipient is one or more of mannitol, lactose, fatty acid, and polyethylene glycol.

[0069] In one embodiment, the dosage form of the drug includes any one of drops, oral liquid, tablets, capsules, granules, films, gels, powders, emulsions, pills or solutions.

[0070] In one embodiment, the administration route of the drug includes oral administration, sublingual administration, rectal administration, skin mucosal administration, inhalation administration or injection administration.

[0071] In one embodiment, the pharmaceutical combination or kit consists of a first pharmaceutical composition and a second pharmaceutical composition; the first pharmaceutical composition comprises Phillygenin and a pharmaceutically acceptable pharmaceutical carrier or excipient; the second pharmaceutical composition comprises dexmedetomidine and a pharmaceutically acceptable pharmaceutical carrier or excipient.

[0072] In one embodiment, the pharmaceutical combination or kit is used to treat or prevent myocardial ischemia-reperfusion injury.

[0073] In one embodiment, the myocardial ischemia-reperfusion injury is caused by cardiac surgery including but not limited to coronary artery bypass surgery, heart transplantation or coronary angioplasty.

[0074] In one embodiment, the first pharmaceutical composition is taken or injected 50 minutes before cardiac surgery; and the second pharmaceutical composition is taken or injected 20 minutes before cardiac surgery.

[0075] In one embodiment, the pharmaceutical composition consists of a first pharmaceutical composition that is taken or injected every day within two weeks before cardiac surgery; and a second pharmaceutical composition that is taken or injected 20 minutes before cardiac surgery.

[0076] In one embodiment, the cardiac surgery includes but is not limited to coronary artery bypass surgery, heart transplantation, or coronary angioplasty.

[0077] The present invention also provides a method for improving myocardial ischemia-reperfusion injury which is not intended for the diagnosis and treatment of a disease, comprising administering a therapeutically effective amount of dexmedetomidine and a therapeutically effective amount of phillygenin to a subject in need thereof, wherein the therapeutically effective amount of dexmedetomidine and the therapeutically effective amount of phillygenin can be administered simultaneously, independently formulated and co-administered, or independently formulated and administered sequentially.

[0078] In one embodiment, the single dosage of Phillygenin is 10-35 mg / kg, and the administration frequency is once a day, once every two days, once every three days, or once every four days; the single dosage of dexmedetomidine is 3-50 μg / kg, and the administration frequency is once a day, once every two days, once every three days, or once every four days.

[0079] In one embodiment, the Phillygenin is a compound having a structure as shown in the following formula, a stereoisomer or a solvate thereof;

[0080]

[0081] The dexmedetomidine is a compound having a structure shown in the following formula, a stereoisomer or a solvate thereof:

[0082]

[0083] The present invention also provides the use of dexmedetomidine in preparing a medicine for enhancing the efficacy of Phillygenin in improving myocardial ischemia-reperfusion injury or ischemic cardiomyopathy.

[0084] In one embodiment, the Phillygenin is a compound having a structure as shown in the following formula, a stereoisomer or a solvate thereof:

[0085]

[0086] The dexmedetomidine is a compound having a structure shown in the following formula, a stereoisomer or a solvate thereof:

[0087]

[0088] The combined use of dexmedetomidine and phillygenin has an obvious synergistic effect.

[0089] In one embodiment, the drug contains the above-mentioned drug ingredients and pharmaceutically acceptable excipients.

[0090] In one embodiment, the auxiliary material includes any one of a carrier, a diluent, an excipient, a filler, a binder, a wetting agent, a disintegrant, an emulsifier, a solubilizer, a solubilizing agent, an osmotic pressure regulator, a surfactant, a coating material, a colorant, a pH regulator, an antioxidant, an antibacterial agent or a buffer, or a combination of at least two thereof.

[0091] In one embodiment, the carrier is one or more of a liposome and a nanoparticle.

[0092] In one embodiment, the excipient is one or more of mannitol, lactose, fatty acid, and polyethylene glycol.

[0093] In one embodiment, the dosage form of the drug includes any one of drops, oral liquid, tablets, capsules, granules, films, gels, powders, emulsions, pills or solutions.

[0094] In one embodiment, the administration route of the drug includes oral administration, sublingual administration, rectal administration, skin mucosal administration, inhalation administration or injection administration.

[0095] Beneficial effects:

[0096] The present invention relates to the use of dexmedetomidine combined with phillygenin in the preparation of a drug for improving myocardial ischemia-reperfusion injury or ischemic cardiomyopathy, which is disclosed for the first time. The combination of dexmedetomidine and phillygenin can reduce macrophage-mediated MI / RI myocardial injury and oxidative damage, has a protective effect on myocardial cells, has unexpected technical effects, and has significant progress in the treatment of myocardial ischemia-reperfusion injury or ischemic cardiomyopathy. The combination of dexmedetomidine and phillygenin in the present invention is superior to the use of dexmedetomidine alone in improving myocardial ischemia-reperfusion injury, and is also superior to the use of phillygenin alone. The combination of dexmedetomidine and phillygenin in the present invention exerts a synergistic effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0097] Figure 1 The combined use of phillygenin and dexmedetomidine improves the cardiac function of mice with myocardial ischemia-reperfusion injury; A shows that the combined use of drugs can reduce macrophage-mediated MI / RI myocardial injury; B shows that the combined use of drugs can alleviate MI / RI oxidative damage; C shows that the combined use of drugs can improve the levels of inflammatory factors in MI / RI.

[0098] Figure 2 The combined use of phillygenin and dexmedetomidine improves the cardiac function of mice with myocardial ischemia-reperfusion injury; A shows that the combined use of drugs can reduce macrophage-mediated MI / RI myocardial injury; B shows that the combined use of drugs can alleviate MI / RI oxidative damage; C shows that the combined use of drugs can improve the levels of inflammatory factors in MI / RI. DETAILED DESCRIPTION

[0099] In order to further explain the technical means and effects adopted by the present invention to achieve the predetermined invention purpose, the specific implementation methods, structures, features and effects of the present invention are described in detail below in conjunction with the accompanying drawings and preferred embodiments. The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0100] Unless otherwise specified, the following terms and phrases used herein are intended to have the following meanings. A particular term or phrase should not be considered to be uncertain or unclear in the absence of a special definition, but should be understood according to its ordinary meaning. When a trade name appears in this article, it is intended to refer to its corresponding commercial product or its active ingredient.

[0101] The term "pharmaceutically acceptable" refers to those compounds, materials, compositions and / or dosage forms which, within the scope of sound medical judgment, are suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response or other problems or complications, commensurate with a reasonable benefit / risk ratio.

[0102] Certain compounds of the present invention may exist in unsolvated or solvated forms, including hydrate forms. Generally speaking, solvated forms are comparable to unsolvated forms and are included within the scope of the present invention. Solvated forms are generally equivalent to unsolvated forms and are included within the scope of the present invention. Certain compounds of the present invention may exist in polymorphic or amorphous forms. Generally, for applications contemplated by the present invention, all physical forms are equivalent and are included within the scope of the present invention.

[0103] The compounds of the present invention may exist in specific geometric or stereoisomeric forms. The present invention contemplates all such compounds, including cis and trans isomers, (-)- and (+)-enantiomers, (R)- and (S)-enantiomers, diastereomers, (D)-isomers, (L)-isomers, atropisomers (or also referred to as rotational isomers), etc., and racemic mixtures and other mixtures thereof, such as mixtures enriched in enantiomers or diastereomers, all of which are within the scope of the present invention.

[0104] As used herein, an "effective amount" or "therapeutically effective amount" includes an amount sufficient to improve or prevent the symptoms or symptoms of a medical condition. An effective amount also means an amount sufficient to allow or facilitate diagnosis. The effective amount for a particular patient or veterinary subject may vary depending on factors such as the condition to be treated, the patient's overall health, the method, route and dosage of administration, and the severity of side effects. An effective amount may be the maximum dose or dosage regimen that avoids significant side effects or toxic effects.

[0105] "Subject", "individual" or "patient" are used interchangeably herein and refer to vertebrates, preferably mammals, more preferably humans. Mammals include, but are not limited to, mice, apes, humans, farm animals, sport animals, and pets.

[0106] The amount of compound administered may depend on the subject being treated, the subject's age, health, sex, and weight, the type of concurrent treatment (if any), the severity of the condition, the nature of the desired effect, the manner and frequency of treatment, and the judgment of the prescribing physician. The frequency of administration may also depend on the pharmacodynamic effect on arterial oxygen tension. However, the most preferred dosage may be adjusted for individual subjects, as will be understood by those skilled in the art and can be determined without undue experimentation. This generally includes adjusting the standard dosage (e.g., if the patient is of low weight, then reducing the dosage).

[0107] The term "pharmaceutical composition" refers to a mixture of one or more compounds or salts thereof of the present application and a pharmaceutically acceptable carrier. The purpose of the pharmaceutical composition is to facilitate administration of the compounds of the present application to an organism. The pharmaceutical composition of the invention may include one or more pharmaceutically acceptable salts, antioxidants, aqueous and non-aqueous carriers, and / or adjuvants such as preservatives, wetting agents, emulsifiers and dispersants.

[0108] The "pharmaceutical composition" of the present invention can also be administered to patients or subjects in need of such treatment in any suitable manner, such as oral, parenteral, rectal, pulmonary or topical administration. When used for oral administration, the pharmaceutical composition can be prepared into oral preparations, such as oral solid preparations, such as tablets, capsules, pills, granules, etc.; or, oral liquid preparations, such as oral solutions, oral suspensions, syrups, etc. When prepared into oral preparations, the pharmaceutical preparations may also contain suitable fillers, binders, disintegrants, lubricants, etc.

[0109] The term "pharmaceutically acceptable carrier" refers to those excipients that have no significant irritation to the organism and do not impair the biological activity and performance of the active compound. Suitable excipients are well known to those skilled in the art, such as carbohydrates, waxes, water-soluble and / or water-swellable polymers, hydrophilic or hydrophobic materials, gelatin, oils, solvents, water, liposomes, polymer micelles or inorganic nanocarriers.

[0110] The pharmaceutical composition of the present invention can be prepared into any pharmaceutically acceptable dosage form for oral, nasal, topical (including oral and sublingual), rectal, vaginal and / or parenteral administration, for example, it can be formulated into tablets, lozenges, capsules, pills, solutions, suspensions, syrups, injections, suppositories, inhalants or sprays.

[0111] The term "synergism" refers to the phenomenon that the combined effects of two drugs are more effective than their individual effects, as opposed to antagonism.

[0112] The term "treatment" includes prevention and treatment, for example, treatment of ischemic cardiomyopathy includes prevention and / or treatment of ischemic cardiomyopathy.

[0113] The "combined" administration method of the present invention is selected from simultaneous administration, independent formulation and co-administration or independent formulation and sequential administration.

[0114] In the present invention, the so-called "combination" or "combination use" is a mode of administration, which includes various situations in which two drugs are administered successively or simultaneously. Here, the so-called "simultaneous" refers to the administration of dexmedetomidine and phillygenin in the same administration cycle, for example, the two drugs are administered within 2 days or 1 day. The so-called "sequential or sequential" administration includes the situation in which dexmedetomidine and phillygenin are respectively administered in different administration cycles. These modes of administration all belong to the combined administration described in the present invention.

[0115] The dexmedetomidine described in the present invention is a commercially available product, and its molecular formula is C 13 H 16 N2, CAS No. 113775-47-6, has the following structural formula:

[0116]

[0117] The Phillygenin described in the present invention is a commercially available product, and its molecular formula is C 21 H 24 O6, CAS No. 487-39-8, structural formula is as follows:

[0118]

[0119] The mice used in the following examples were C57BL / 6J mice, 6-8 weeks old, purchased from Nanjing Sibeifu Biotechnology Company.

[0120] Example 1: Application of Phillygenin and Dexmedetomidine in Improving Myocardial Ischemia-Reperfusion Injury

[0121] The mice were randomly divided into 5 groups, with 6 mice in each group, namely sham operation group (Sham group, i.e. control group), myocardial ischemia-reperfusion group (MI / RI group, i.e. model group), Phillygenin + myocardial ischemia-reperfusion group (MI / RI+PHI group), DEX + myocardial ischemia-reperfusion group (MI / RI+DEX group), and Phillygenin + DEX + myocardial ischemia-reperfusion group (MI / RI+PHI+DEX group).

[0122] All five groups of mice were given normal feed and allowed to eat freely. After one week of adaptive feeding, the following results were obtained:

[0123] Phillygenin+DEX+myocardial ischemia-reperfusion group (MI / RI+PHI+DEX group): Phillygenin (15 mg / kg) (diluted with DMSO) was injected intraperitoneally 50 minutes before coronary artery ligation and ischemia, and DEX (5 μg / kg, diluted with normal saline) was injected intravenously 20 minutes before ligation to construct myocardial ischemia-reperfusion.

[0124] Phillygenin + myocardial ischemia-reperfusion group (MI / RI+PHI group): Phillygenin (30 mg / kg) (diluted with DMSO) was injected intraperitoneally 50 minutes before coronary artery ligation and ischemia, and an equal amount of normal saline was injected intravenously 20 minutes before ligation to construct myocardial ischemia-reperfusion.

[0125] DEX+myocardial ischemia-reperfusion group (MI / RI+DEX group): 50 minutes before coronary artery ligation and ischemia, an equal amount of normal saline was injected intraperitoneally, and 20 minutes before ligation, DEX (10 μg / kg, diluted with normal saline) was injected intravenously to construct myocardial ischemia-reperfusion.

[0126] Myocardial ischemia-reperfusion group (MI / RI group, i.e., model group): an equal volume of normal saline was injected intraperitoneally 50 minutes before coronary artery ligation and an equal volume of normal saline was injected intravenously 20 minutes before coronary artery ligation to establish myocardial ischemia-reperfusion.

[0127] Sham operation group (i.e., control group) received an equal volume of normal saline injected intraperitoneally 50 minutes before the sham operation and an equal volume of normal saline injected intravenously 20 minutes before the sham operation.

[0128] The specific method for constructing the myocardial ischemia-reperfusion model is as follows:

[0129] After using 2% isoflurane gas to anesthetize mice, endotracheal intubation was performed and respiratory support was given using a ventilator; then a small skin incision (about 1.2 cm) was made on the left chest, and the pectoralis major and pectoralis minor muscles were cut to expose the fourth intercostal space. A small hole was made in the fourth intercostal space with a needle holder to open the pleura and pericardium. With the needle holder slightly stretching the intercostal space, the heart was smoothly and gently "popped out" from the hole. The left coronary artery (LCA) was located using a 6-0 silk thread and the needle was inserted and ligated at a position about 3 mm from its upper end. When the anterior wall of the left ventricle turned pale, the ligation was considered successful. After ligation, the heart was immediately placed back into the chest cavity, and the longer end of the slipknot remained outside the chest. Manual suction was performed to prevent pneumothorax, and the muscles and skin were closed using a purse-string suture. At this time, the 30-minute ischemia timer was started. The mice were then allowed to breathe room air and monitored during the recovery period, which was generally completed within 3-5 minutes. After half an hour, the ligature was slowly withdrawn and reperfusion began. Reperfusion lasted 24 hours. In the sham operation group, the chest cavity was opened and then immediately closed and sutured, and the cardiac MI / RI model was not established.

[0130] The determination method and results of myocardial ischemia-reperfusion injury are as follows:

[0131] 1. The mouse hearts were collected, embedded in paraffin, and sliced. Immunofluorescence staining and DHE staining were performed in parallel. Microscope films were taken, and ImageJ software was used to measure myocardial damage and oxidative stress in each group.

[0132] The results are shown in Table 1:

[0133] Table 1

[0134]

[0135] like Figure 1 As shown in A, the combination of Phillygenin and dexmedetomidine can reduce macrophage-mediated MI / RI myocardial injury. After intraperitoneal injection of Phillygenin in the MI / RI+PHI group and the MI / RI+PHI+DEX group, and intravenous injection of DEX in the MI / RI+DEX group and the MI / RI+PHI+DEX group, the results of immunofluorescence staining of cardiac paraffin sections showed that the combination of Phillygenin and DEX had a better effect on preventing MI / RI myocardial injury.

[0136] like Figure 1As shown in B, the combination of Phillygenin and dexmedetomidine can reduce MI / RI oxidative damage. After intraperitoneal injection of Phillygenin in the MI / RI+PHI group and the MI / RI+PHI+DEX group, and intravenous injection of DEX in the DEX+MI / RI group and the MI / RI+PHI+DEX group, the DHE staining results of paraffin sections showed that the combination of Phillygenin and DEX had a better effect on preventing MI / RI myocardial injury.

[0137] In summary, the combined use of Phillygenin and DEX has a good effect on preventing MI / RI myocardial injury and oxidative damage, and exerts a synergistic effect compared with the use of Phillygenin or DEX alone.

[0138] 2. After sampling the mouse heart, RNA was extracted from the tissue and reverse transcribed into cDNA. Then, the mRNA levels of myocardial injury biomarker genes (IL-6, TNF-α, IL-1β, IL-10) in the five groups were detected by real-time PCR. The primer sequences are as follows.

[0139] IL-1β:

[0140] Reverse-5'AACACAGCCTGGATGGCTAC3' (SEQ ID NO.1);

[0141] Forward-5'TTGAGTCTGCACAGTTCCCC3' (SEQ ID NO.2);

[0142] IL-6:

[0143] Reverse-5'GTCCTGGGGAAGGCATTAGG3' (SEQ ID NO.3);

[0144] Forward-5'CACTTCACAAGTCGGAGGCT3' (SEQ ID NO.4);

[0145] IL-10:

[0146] Reverse-5'AGCACACTAGGTTTGCCGAG3' (SEQ ID NO.5);

[0147] Forward-5'CATTCCATCCGGGGTGACAA3' (SEQ ID NO.6);

[0148] TNF-α:

[0149] Reverse-5'GTAGATGCCGGGTGGTTCAA3' (SEQ ID NO.7);

[0150] Forward-5'GGCTTTCGGAACTCACTGGA3' (SEQ ID NO. 8).

[0151] β-actin:

[0152] Reverse-5'GTCGCACCTCCACATAGCTT3' (SEQ ID NO.9);

[0153] Forward-5'CCCGCGAGTACAACCTTCTT3' (SEQ ID NO. 10).

[0154] RT-PCR assay method: Total RNA was extracted from mouse heart tissue samples using TRIzol (CWBIO, China) according to the manufacturer's instructions. cDNA was prepared using III 1st Strand cDNA Synthesis SuperMix (Shanghai Yesen Biotechnology Co., Ltd.). Then, real-time PCR (RT-PCR) was performed using SYBR Green PCR Master Mix (Shanghai Yansheng Biotechnology Co., Ltd.) on an Applied Biosystems QuantStudio 3 (ThermoFisher, USA). -ΔΔCt The mRNA expression level normalized to β-actin was calculated by the method.

[0155] The results are shown in Table 2:

[0156] Table 2

[0157]

[0158]

[0159] like Figure 1 As shown in C, the combination of Phillygenin and dexmedetomidine down-regulated the mRNA expression levels of IL-6, TNF-α, and IL-1β genes in the heart, and up-regulated the mRNA expression level of IL-10 gene in the heart.

[0160] After intraperitoneal injection of Phillygenin and intravenous injection of DEX were given to the MI / RI+PHI and MI / RI+PHI+DEX groups, the mRNA expression of myocardial injury biomarker genes in the hearts of mice in different treatment groups was different.

[0161] The mRNA expression levels of biomarker IL-6, TNF-α, and IL-1β genes in MI / RI group mice were significantly higher than those in control group mice. The mRNA levels of biomarker genes IL-6, TNF-α, and IL-1β genes in MI / RI+DEXI group, MI / RI+PHI group, and MI / RI+PHI+DEX group were significantly decreased compared with MI / RI group, and the decrease was most significant in MI / RI+PHI+DEX group.

[0162] At the same time, the IL-10 gene mRNA expression level of mice in the MI / RI group was significantly lower than that in the control group. The IL-10 gene mRNA levels of the MI / RI+DEX group, MI / RI+PHI group, and MI / RI+PHI+DEX group were significantly increased compared with the MI / RI group, and the increase in the MI / RI+PHI+DEX group was the most significant.

[0163] The above results show that the combined use of Phillygenin and DEX improves the level of myocardial infarction in MI / RI mice, and has a synergistic effect compared with the use of Phillygenin or DEX alone.

[0164] Example 2: Application of Phillygenin and Dexmedetomidine in Improving Myocardial Ischemia-Reperfusion Injury

[0165] The mice were randomly divided into 5 groups, with 6 mice in each group, namely sham operation group (Sham group, i.e. control group), myocardial ischemia-reperfusion group (MI / RI group, i.e. model group), Phillygenin + myocardial ischemia-reperfusion group (MI / RI+PHI group), DEX + myocardial ischemia-reperfusion group (MI / RI+DEX group), and Phillygenin + DEX + myocardial ischemia-reperfusion group (MI / RI+PHI+DEX group).

[0166] The mice in the five groups were fed with ordinary feed and fed freely. After one week of adaptive feeding, the MI / RI+PHI group was intraperitoneally injected with Phillygenin (30 mg / kg / d) (diluted with DMSO) for 2 weeks; the MI / RI+PHI+DEX group was intraperitoneally injected with Phillygenin (15 mg / kg / d) (diluted with DMSO) for 2 weeks. The mice in the sham operation group, MI / RI group, and MI / RI+DEX group were intraperitoneally injected with an equal amount of normal saline every day for 2 weeks.

[0167] Two weeks later, myocardial ischemia-reperfusion models were established in the MI / RI group, MI / RI+DEX group, MI / RI+PHI group, and MI / RI+PHI+DEX group: the mice were subjected to coronary artery ligation and ischemia for 30 minutes and reperfusion for 24 hours.

[0168] Among them, the MI / RI+DEX group was intravenously injected with DEX (10 μg / kg, diluted with normal saline) 20 minutes before ligation; the MI / RI+PHI+DEX group was intravenously injected with DEX (5 μg / kg, diluted with normal saline) 20 minutes before ligation; the MI / RI group and MI / RI+PHI group were given an equal amount of normal saline intravenously in the same way 20 minutes before ligation; the sham operation group underwent sham operation and an equal amount of normal saline was intravenously injected in the same way 20 minutes before ligation.

[0169] After the model was established, the mice were given a merciful endpoint and samples were collected.

[0170] The specific method for constructing the myocardial ischemia-reperfusion model is as follows:

[0171] After using 2% isoflurane gas to anesthetize mice, endotracheal intubation was performed and respiratory support was given using a ventilator; then a small skin incision (about 1.2 cm) was made on the left chest, and the pectoralis major and pectoralis minor muscles were cut to expose the fourth intercostal space. A small hole was made in the fourth intercostal space with a needle holder to open the pleura and pericardium. With the needle holder slightly stretching the intercostal space, the heart was smoothly and gently "popped out" from the hole. The left coronary artery (LCA) was located using a 6-0 silk thread and the needle was inserted and ligated at a position about 3 mm from its upper end. When the anterior wall of the left ventricle turned pale, the ligation was considered successful. After ligation, the heart was immediately placed back into the chest cavity, and the longer end of the slipknot remained outside the chest. Manual suction was performed to prevent pneumothorax, and the muscles and skin were closed using a purse-string suture. At this time, the 30-minute ischemia timer was started. The mice were then allowed to breathe room air and monitored during the recovery period, which was generally completed within 3-5 minutes. After half an hour, the ligature was slowly withdrawn and reperfusion began. Reperfusion lasted 24 hours. In the sham operation group, the chest cavity was opened and then immediately closed and sutured, and the cardiac MI / RI model was not established.

[0172] The determination method and results of myocardial ischemia-reperfusion injury are as follows:

[0173] 1. The mouse hearts were collected, embedded in paraffin, and sliced. Immunofluorescence staining and DHE staining were performed in parallel. Microscope films were taken, and ImageJ software was used to measure myocardial damage and oxidative stress in each group.

[0174] The results are shown in Table 3:

[0175] Table 3

[0176]

[0177] like Figure 2 As shown in A, the combination of phillygenin and dexmedetomidine can reduce macrophage-mediated myocardial injury in MI / RI.

[0178] After 2 weeks of intraperitoneal injection of Phillygenin and intravenous injection of DEX in the MI / RI+PHI and MI / RI+PHI+DEX groups, the results of immunofluorescence staining of cardiac paraffin sections showed that the expression level of F4 / 80 in the MI / RI group was significantly increased compared with that in the control group, indicating that myocardial immune cells are active after MI / RI. The expression levels of F4 / 80 in the MI / RI+DEX, MI / RI+PHI and MI / RI+PHI+DEX groups were significantly decreased compared with the MI / RI group, and the decrease in the MI / RI+PHI+DEX group was the most significant.

[0179] like Figure 2 As shown in B, the combination of phillygenin and dexmedetomidine can reduce oxidative damage in MI / RI.

[0180] After 2 weeks of intraperitoneal injection of Phillygenin and intravenous injection of DEX in the MI / RI+PHI and MI / RI+PHI+DEX groups, the DHE staining results of paraffin sections showed that the ROS level of mice in the MI / RI group was significantly higher than that in the control group, but the ROS level of the MI / RI+DEX, MI / RI+PHI, and MI / RI+PHI+DEX groups was significantly lower than that in the MI / RI group, and the decrease in the MI / RI+PHI+DEX group was the most significant.

[0181] This indicates that the combined use of Phillygenin and DEX has a good effect in resisting MI / RI oxidative damage, and has a synergistic effect compared with the use of Phillygenin or DEX alone.

[0182] 2. After sampling the mouse heart, RNA was extracted from the tissue and reverse transcribed into cDNA. Then, the mRNA levels of the five groups of myocardial injury biomarker genes (IL-6, TNF-α, IL-1β, IL-10) were detected by real-time PCR. The mRNA expression levels of the mice in this example were measured using the primer sequences and RT-PCR determination method in Example 1.

[0183] The results are shown in Table 4:

[0184] Table 4

[0185]

[0186] like Figure 2As shown in C, the combination of Phillygenin and dexmedetomidine down-regulated the mRNA expression levels of IL-6, TNF-α, and IL-1β genes in the heart, and up-regulated the mRNA expression level of IL-10 gene in the heart.

[0187] After 2 weeks of intraperitoneal injection of Phillygenin and intravenous injection of DEX in the MI / RI+PHI and MI / RI+PHI+DEX groups, the mRNA expression of myocardial injury biomarker genes in the hearts of mice in different treatment groups was different.

[0188] The mRNA expression levels of biomarker IL-6, TNF-α, and IL-1β genes in the MI / RI group were significantly higher than those in the control group. The mRNA levels of biomarker genes IL-6, TNF-α, and IL-1β genes in the DEX+MI / RI group, MI / RI+PHI group, and MI / RI+PHI+DEX group were significantly decreased compared with the MI / RI group, and the decrease was most significant in the MI / RI+PHI+DEX group.

[0189] At the same time, the IL-10 gene mRNA expression level of mice in the MI / RI group was significantly lower than that in the control group. The IL-10 gene mRNA levels of the MI / RI+DEX group, MI / RI+PHI group, and MI / RI+PHI+DEX group were significantly increased compared with the MI / RI group, and the increase in the MI / RI+PHI+DEX group was the most significant.

[0190] The above results indicate that the combined use of Phillygenin and DEX improves the myocardial infarction level in MI / RI mice, and exerts a synergistic effect compared with the use of Phillygenin or DEX alone.

[0191] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A pharmaceutical composition or a kit comprising a therapeutically effective amount of dexmedetomidine and a therapeutically effective amount of phillygenin, wherein the dexmedetomidine and phillygenin are used in combination to have an obvious synergistic effect; The Phillygenin is a compound having a structure as shown in the following formula, or a stereoisomer or solvate thereof; The dexmedetomidine is a compound having a structure shown in the following formula, a stereoisomer or a solvate thereof:

2. Use of dexmedetomidine combined with phillygenin or the pharmaceutical composition or kit according to claim 1 in any one of the following (a) to (e): (a) preparing a drug for improving myocardial ischemia-reperfusion injury or ischemic cardiomyopathy; or improving myocardial ischemia-reperfusion injury or ischemic cardiomyopathy; (b) preparing a drug for inhibiting myocardial ischemia-reperfusion-induced cardiomyocyte apoptosis; or inhibiting myocardial ischemia-reperfusion-induced cardiomyocyte apoptosis; (c) preparing a drug for inhibiting the generation of reactive oxygen free radicals (ROS) after myocardial ischemia-reperfusion; or inhibiting the generation of reactive oxygen free radicals (ROS) after myocardial ischemia-reperfusion; (d) preparing a drug for inhibiting apoptosis of cardiomyocytes after hypoxia and reoxygenation; or inhibiting apoptosis of cardiomyocytes after hypoxia and reoxygenation; (e) preparing a drug for inhibiting the production of reactive oxygen free radicals (ROS) by myocardial cells after hypoxia and reoxygenation; or inhibiting the production of reactive oxygen free radicals (ROS) by myocardial cells after hypoxia and reoxygenation; The combined use of dexmedetomidine and phillygenin has an obvious synergistic effect.

3. The use according to claim 2, characterized in that: The phillygenin and dexmedetomidine are contained in different preparations as active ingredients and are administered simultaneously or at different times; Preferably, the single dosage of Phillygenin is 10-35 mg / kg, and the dosage frequency is once a day, once every two days, once every three days, or once every four days; the single dosage of dexmedetomidine is 3-50 μg / kg, and the dosage frequency is once a day, once every two days, once every three days, or once every four days.

4. The use according to claim 2, characterized in that: The drug also includes a pharmaceutically acceptable pharmaceutical carrier; Optionally, the combined administration route is selected from oral administration, parenteral administration, and transdermal administration; optionally, the parenteral administration includes but is not limited to intravenous injection, subcutaneous injection, and intramuscular injection.

5. The use of Phillygenin in the preparation of drugs for enhancing the efficacy of dexmedetomidine in improving myocardial ischemia-reperfusion injury or ischemic cardiomyopathy.

6. The use according to claim 5, characterized in that: The drug contains Phillygenin and pharmaceutically acceptable excipients; Optionally, the dosage form of the drug includes any one of drops, oral liquid, tablets, capsules, granules, films, gels, powders, emulsions, pills or solutions; Optionally, the administration routes of the drug include oral administration, sublingual administration, rectal administration, skin mucosal administration, inhalation administration or injection administration.

7. Use of dexmedetomidine combined with phillygenin in the preparation of a drug or a drug kit or a drug combination for improving myocardial ischemia-reperfusion injury or ischemic cardiomyopathy; the combined use of dexmedetomidine and phillygenin has an obvious synergistic effect.

8. The use according to claim 7, characterized in that: The dexmedetomidine and phillygenin may be administered simultaneously, formulated independently and co-administered, or formulated independently and administered sequentially.

9. The use according to claim 7, characterized in that: The single dosage of Phillygenin is 10-35 mg / kg, and the administration frequency is once a day, once every two days, once every three days, or once every four days; the single dosage of dexmedetomidine is 3-50 μg / kg, and the administration frequency is once a day, once every two days, once every three days, or once every four days.

10. Use of dexmedetomidine in the preparation of a drug for enhancing the efficacy of Phillygenin in improving myocardial ischemia-reperfusion injury or ischemic cardiomyopathy.

Images