Lipid nanoparticle cryoprotectant

Abstract

The present invention discloses a cryoprotectant for lipid nanoparticles. The cryoprotectant includes substances that form a glassy state during freezing, and also includes plasma and / or serum with a volume percentage of 5% to 70%. The cryoprotectant of the present invention solves the problems of impaired function and increased particle size during the cryopreservation of LNP. It has simple operation, wide applicability and low immune response, which is beneficial to the application of LNP in the development of clinical products and helps its promotion in the fields of clinical treatment and disease prevention.

Description

Technical Field

[0001] The present disclosure relates to the field of biomedicine, and in particular, to a cryoprotectant for lipid nanoparticles. Background Art

[0002] Lipid nanoparticles (LNPs) have important application values in fields such as nucleic acid drug delivery. However, as many LNP-based formulations approach the clinical application stage, the effects of their stability and optimal storage conditions (including temperature, physical state, and the use of cryoprotectants, etc.) on nanoparticle stability and efficacy have not been fully understood. The stability of nanoparticles generally refers to the maintenance of their physicochemical properties (such as size, charge) over a period of time. Lipid nanoparticles self-assemble due to the hydrophobic-hydrophilic and electrostatic interactions between their different components, but due to their thermodynamically unstable state, mechanical stress and chemical changes will occur over time, resulting in problems such as phospholipid hydrolysis or oxidation, nanoparticle aggregation and fusion, and increased membrane permeability, thus affecting their loading and release performance.

[0003] To extend the shelf life of lipid nanoparticles and promote their medium / long-term stability, common strategies include using stabilizers (such as polyethylene glycol-modified lipids), cryoprotectants (such as sucrose, trehalose, mannitol, etc.), and producing dry liposome products through lyophilization. Among them, cryoprotectants are widely used in biological applications. However, currently, LNP lyophilization technology faces many obstacles. For example, (1) high cost and high equipment requirements: Lyophilization requires expensive equipment, with large acquisition, maintenance, and operation costs, and the operation has strict requirements for equipment performance and parameter control, and the technical threshold is high; (2) impaired function: The lyophilization process will damage the structure and function of LNPs, such as destroying the lipid membrane structure and affecting the drug encapsulation stability, reducing the efficacy; (3) function decline over time: Under the protection of existing cryopreservation buffers, the function of LNPs still gradually declines during long-term storage, such as the transfection efficiency decreases, and the high-efficiency delivery ability cannot be maintained for a long time, etc.; (4) increased particle size affects performance: The particle size gradually increases during storage, and the physicochemical properties are changed due to aggregation or fusion, affecting the in vivo behavior, reducing the performance as a drug delivery carrier, and increasing the risk of adverse reactions. Therefore, although the cryopreservation of cryopreservation buffers in the prior art has certain effects, it cannot prevent problems such as the gradual reduction of LNP function over time, so a new cryoprotectant is needed to solve the above problems. Summary of the Invention

[0004] Technical Problems to be Solved

[0005] One aspect of the present disclosure provides a cryoprotectant for lipid nanoparticles in view of the defects such as impaired function existing in the cryopreservation buffer of lipid nanoparticles (LNPs) in the prior art.

[0006] Specifically, the inventor of the present invention creatively uses a new cryoprotectant to solve the following problems existing in the prior art:

[0007] (1) Overcoming the problem of the decline in the cryopreservation function of LNP in the prior art.

[0008] Although the cryopreservation buffer in the prior art has a certain effect on cryopreservation, it cannot prevent the gradual decline of LNP function over time and cannot meet the requirement of being consistent with the in vitro and in vivo functions of fresh LNP. This technical solution solves this problem, ensures that the function of LNP does not decline after long-term cryopreservation at ultra-low temperature, maintains its efficient drug delivery and transfection capabilities, such as ensuring the effective transport and expression of nucleic acid drugs in gene therapy or vaccine research and development, improving the effectiveness and stability of LNP as a drug carrier, and meeting the clinical and research needs for the functional stability of LNP.

[0009] (2) Solving the problems of unstable particle size and aggregation and fusion of LNP during cryopreservation at ultra-low temperature.

[0010] Under the cryopreservation technology of the cryopreservation buffer in the prior art, the particle size of LNP will gradually increase, indicating the existence of aggregation and fusion phenomena, which affect its physicochemical properties and application effects. This technical solution can achieve small changes in the particle size of LNP during long-term cryopreservation at ultra-low temperature, approaching the particle size state when stored at 4°C without cryoprotectant, reducing the occurrence of aggregation and fusion events, thereby maintaining the good dispersibility and uniformity of LNP, enhancing the stability of its interaction with cells, ensuring accurate delivery to the target site in vivo to play a role, and improving the accuracy and efficacy of drug delivery.

[0011] (3) Reducing the operation difficulty and cost limitation of LNP cryopreservation technology at ultra-low temperature.

[0012] The freeze-drying technology of LNP has high costs and complex equipment requirements, which limit its application in many laboratories and clinical products. This technical solution provides a simple cryopreservation method that does not require high equipment investment and complex operation processes, is applicable to various laboratory scales, reduces the technical threshold, enables more research institutions to conduct long-term cryopreservation research on LNP, and at the same time provides an economically feasible solution for the storage of clinical LNP products, promoting the wide application and development of LNP technology in the clinical field.

[0013] Technical solution:

[0014] A cryoprotectant for lipid nanoparticles, the cryoprotectant includes substances that form a glassy state during freezing, and the cryoprotectant also includes plasma and / or serum with a volume percentage of 5% to 70%.

[0015] Further, in some embodiments, the substance that forms a glassy state during freezing may include one or several selected from sugars, polymers, amino acids, polyols, hydroxyethyl starch, or cyclodextrin.

[0016] Still further, the above-mentioned plasma and / or serum may be human-derived plasma and / or serum.

[0017] In one embodiment, the cryoprotectant of the lipid nanoparticles described in the present disclosure is composed of the following components: glucose at a volume percentage of 5%, human plasma (Sigma-Aldrich, product catalog number H4522) at a volume percentage of 35%, and the rest is PBS buffer.

[0018] Another aspect of the present disclosure is to provide a method for preparing the above cryoprotectant. After the plasma and / or serum are sterilized, they are mixed with the substance that forms a glassy state during freezing in proportion.

[0019] Another aspect of the present disclosure is to provide a lipid nanoparticle composition, which includes lipid nanoparticles and the above cryoprotectant.

[0020] Further, in some embodiments, the volume ratio of the above lipid nanoparticles to the cryoprotectant is 1:1 to 3.

[0021] Another aspect of the present disclosure is to provide a method for preserving lipid nanoparticles. The lipid nanoparticles are uniformly mixed with the above cryoprotectant at a volume ratio of 1:1 to 3 and stored at -100°C to -20°C.

[0022] Further, in some embodiments, the fluctuation range of the particle size of the lipid nanoparticles during storage is not greater than ±20% of the initial particle size. The particle size of the above lipid nanoparticles can be measured by conventional means in the prior art, such as Dynamic Light Scattering (DLS), Nanoparticle Tracking Analysis (NTA), Transmission Electron Microscopy (TEM), Scanning Electron Microscopy (SEM), Laser Diffraction (LD), Atomic Force Microscopy (AFM), Field-Flow Fractionation (FFF), Centrifugal Sedimentation, Size Exclusion Chromatography (SEC), and combinations of the above methods.

[0023] Further, in some embodiments, the decrease in the transfection efficiency of the stored lipid nanoparticles compared to the transfection efficiency of the initial lipid nanoparticles is not greater than 10%. In some embodiments, the "stored" generally refers to being measured after storage of the lipid nanoparticles by the storage method for about 3 days, about 5 days, about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 1 month, about 1.5 months, about 2 months, about 2.5 months, about 3 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 12 months. Preferably, in some embodiments, the storage time is within about 4 weeks. The transfection efficiency of the lipid nanoparticles can be detected by methods well-known in the prior art. For example, in one embodiment, the transfection efficiency of the lipid nanoparticles is determined by transfecting the green fluorescent protein (GFP) mRNA carried by the LNP into HEK-293T cells and then detecting GFP expression.

[0024] Another aspect of the present disclosure is to provide a nucleic acid preparation, which includes the above cryoprotectant.

[0025] Another aspect of the present disclosure is to provide the use of the cryoprotectant of the above lipid nanoparticles in the preparation of nucleic acid drugs. In some embodiments, the nucleic acid drugs include mRNA drugs, siRNA drugs, antisense oligonucleotide (ASO) drugs, plasmid DNA (pDNA) drugs, CRISPR-related nucleic acid drugs, aptamer drugs, and ribozyme drugs.

[0026] Another aspect of the present disclosure is to provide the use of the cryoprotectant of the above lipid nanoparticles in the preparation of vaccines. In some embodiments, the vaccines include mRNA vaccines, DNA vaccines, self-amplifying RNA (saRNA) vaccines, and circular RNA (circRNA) vaccines.

[0027] Beneficial effects:

[0028] (1) Solved the problems of impaired function and increased particle size during the cryopreservation of LNP.

[0029] It has been proven by experiments that the cryoprotectant of the present invention can maintain the functional stability of LNP, achieve no decrease in function after ultra-low temperature preservation, and be consistent with the in vivo and in vitro functions of fresh LNP.

[0030] (2) Improvement in operational simplicity.

[0031] Compared with the traditional LNP freeze-drying technology, the technical solution of the present invention is extremely simple to operate. The traditional freeze-drying technology requires complex equipment to precisely control parameters such as the freezing rate and vacuum degree. The operation process involves multiple steps and requires professional technicians for operation and maintenance. In contrast, the present invention only needs to configure a commercial component (with reliable source and simple pretreatment) into a cryoprotectant, then mix it with LNP in proportion, and after simple operations such as medium-speed vortexing and dot centrifugation, it can be placed in an -80°C refrigerator for freezing. The whole process does not require special equipment and complex parameter regulation, and ordinary laboratory technicians can be proficient in operating it after simple training. In actual operation, it may take 2 - 3 days to complete a traditional freeze-drying operation, and at least 2 professional technicians are required to monitor and operate the equipment throughout the process. However, with the technical solution of the present invention, from preparing materials to completing the freezing operation, one technician can complete it within half a day, greatly shortening the operation time and reducing the labor input.

[0032] (3) Wide applicability and low immune response.

[0033] The technical solution of the present invention is applicable to all occasions, which benefits from its simple operation and low requirements for equipment. Whether it is a large scientific research institution, a small laboratory or other scenarios, as long as there are basic cell culture and conventional cryogenic storage equipment (such as an -80°C refrigerator), the LNP cryopreservation method of the present invention can be implemented. Moreover, since human plasma can be used as part of the cryoprotectant, it has good biocompatibility and has natural advantages in clinical applications. The components in human plasma are similar to the human physiological environment, which can reduce the immunogenicity of LNP during storage and application. It is beneficial to the application of LNP in clinical products and helps its promotion in the fields of clinical treatment and disease prevention. Description of the Drawings

[0034] Figure 1 This is a result graph of the effect of cryoprotectants on the transfection efficiency of LNP-GFP in the embodiments of the present disclosure. Two LNP formulations with different transfection efficiencies, namely ALC-L (green) and ALC-H (red), were selected for verification experiments. The LNP packaging GFP was mixed with the cryoprotectants of samples 1-8 at a ratio of 1:1 or 1:3 respectively, and then stored in an -80°C environment. After 4 weeks of storage, it was used to transfect 293T cells (the transfection conditions were 10 ng GFP mRNA and a transfection duration of 24 hours). The GFP expression level was measured by flow cytometry (using the average fluorescence intensity of relative green fluorescent protein as an index). The research results showed that in the case of no cryoprotectant and storage at 4°C, the functions of both ALC-L and ALC-H showed a gradually decreasing trend. In sharp contrast, when various cryoprotectants in this embodiment were used to store LNP-GFP at -80°C, the function of LNP did not decline. In addition, this study also observed that with the increase in the content of the cryopreservation solution in some samples, the transfection efficiency of LNP increased by 20% - 40%. After statistical analysis, this increase was statistically significant. In summary, this study shows that the cryoprotectants in this embodiment can effectively maintain the functions of LNPs with different transfection efficiencies, providing a reliable strategy for the preservation of LNP; in this result graph, the results are mean ± SEM, and only the statistical significance of the magnitude is shown (ns = not significant; p < 0.05; p < 0.01; p < 0.001);

[0035] Figure 2Effects of different cryoprotectants on the transfection efficiency and particle size of LNP-GFP in the embodiments of the present disclosure. LNP packaging GFP was mixed with Sample 1 and Sample 2 in this embodiment at a ratio of 1:1, and then stored in an environment of -80°C. After 1 day and 4 weeks of storage respectively, it was used to transfect 293T cells (the transfection conditions were 10 ng GFP mRNA and a transfection duration of 24 hours). The GFP expression level was measured by flow cytometry (using the average fluorescence intensity of relative green fluorescent protein as an index), and the particle size of LNP was evaluated. In this way, the transfection efficiency and particle size distribution changes of LNP under different storage conditions were compared. The test conditions included: a control group (without cryoprotectant), single-component cryopreservation solutions containing 5% or 10% glucose, single-component cryopreservation solutions containing 5% or 35% human plasma, and cryopreservation solutions combined with glucose and human plasma. The research results showed that in the case of no protectant and storage at 4°C, the functions of ALC-L and ALC-H both gradually decreased. Although single-component sugar or plasma components could maintain the LNP function to a certain extent, the effect was far less than that of the cryoprotectants in this embodiment. When the cryoprotectants in this embodiment were used to store LNP-GFP at -80°C, the LNP function did not decline. In addition, after long-term storage of LNP at -80°C using the cryoprotectants in this embodiment, the fluctuation range of the particle size was not greater than ±20% of the initial particle size. After statistical analysis, this fluctuation was not statistically significant. In summary, this study shows that the cryoprotectants in this embodiment can effectively maintain the structure and function of LNP. In this result graph, the results are mean ± SEM, and only the statistical significance of the size is shown (ns = not significant; p < 0.05; p < 0.01; p < 0.001);

[0036] Figure 3 Graph of in vivo function test results of two LNPs under different storage conditions on Day 1, the second week, and the fourth week in the embodiments of the present disclosure. The upper part is the bioluminescence images of mice on Day 1, the second week, and the fourth week under different storage conditions; the lower part is the quantitative analysis of the corresponding bioluminescence signal intensity. The graph shows the changes in the in vivo imaging signals of two groups, ALC-L (green) and ALC-H (red). Over time, the signal of the control group without protectant and stored at 4°C decreased rapidly, while the groups added with cryoprotectants (especially 35% human plasma + 5% glucose) maintained a good signal for a long time under the condition of -80°C. The cryopreservation effect was significantly better than that of single-component glucose and human plasma, indicating that the two-component cryoprotectant can significantly improve the retention of LNP function. In this result graph, the results are mean ± SEM, and only the statistical significance of the size is shown (ns = not significant; p < 0.05; p < 0.01; p < 0.001);

[0037] Figure 4 This is a graph showing the measurement results of the levels of IL-6 inflammatory factors in vivo at 4 hours and 24 hours after cryopreservation of two types of LNPs in the embodiments of the present disclosure. In this experiment, after cryopreservation of two types of LNPs, the levels of IL-6 inflammatory factors in vivo at 4 hours and 24 hours were measured at different doses. The experimental subjects were C57 mice, and they were injected with LNP ALC-L and ALC-H respectively. The doses were set as 0.05 mg / kg, 0.5 mg / kg, and 5 mg / kg of mRNA. Among them, ALC-L was stored at 4°C without cryoprotectant (labeled in green), ALC-H was stored at 4°C without cryoprotectant (labeled in red), and the group stored in a cryopreservation solution containing 35% human plasma + 5% glucose at -80°C (labeled in blue). The experimental results showed that when delivering a high dose of mRNA (5 mg / kg), both ALC-L and ALC-H would trigger an acute inflammatory response. However, it is worth noting that compared with the group without cryoprotectant, the group with cryoprotectant did not cause additional immune responses. This indicates that when using a cryoprotectant to protect LNPs, the induced immune response is smaller, and the main acute immune response is caused by the LNPs themselves. And after 24 hours, the inflammatory response gradually returns to normal. In this result graph, the results are the mean ± SEM, and only the statistical significance of the magnitude is shown (ns = not significant; p < 0.05; p < 0.01; p < 0.001). Detailed implementation manners

[0038] The present invention discloses a cryoprotectant for lipid nanoparticles. Those skilled in the art can draw on the content of this article and appropriately modify the process parameters to achieve it. It should be particularly pointed out that all similar substitutions and modifications are obvious to those skilled in the art, and they are all regarded as included in the present invention. And relevant personnel can obviously make changes or appropriate alterations and combinations to the content described herein without departing from the content, spirit, and scope of the present invention to implement and apply the technology of the present invention.

[0039] In this disclosure, unless otherwise specified, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Unless otherwise expressly stated, throughout the specification and claims, the term "comprising" or variations thereof such as "include" or "including" etc. will be understood to include the stated element or component, without excluding other elements or other components. The term "a" (or "an") includes plural referents. The term "plural" refers to two or more. Terms such as "such as", "for example", etc. are intended to indicate exemplary embodiments and are not intended to limit the scope of this disclosure.

[0040] In this disclosure, when a range of values is provided, it should be understood that unless the context clearly indicates otherwise, the endpoints are included in the range and each intermediate value between the upper and lower limits of the range and any other specified value or intermediate value within the specified range, as well as any value within the smaller range between the specified values, are encompassed.

[0041] In this disclosure, the term "about" generally means varying within a range of 0.5% - 10% above or below the specified value, for example, varying within a range of 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10% above or below the specified value.

[0042] In the present disclosure, unless otherwise specified, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Definitions of common terms in molecular biology can be found in Lewin’s GENES, Twelfth Edition, Jocelyn E. Krebs, Elliott S. Goldstein, Stephen T. Kilpatrick, published by Jones & Bartlett Learning. Definitions of common terms in biochemistry can be found in Lehninger Principles of Biochemistry, Eighth Edition, David L. Nelson, Michael M. Cox, published by W. H. Freeman. Definitions of common terms in cell biology can be found in Molecular Biology of the Cell, Sixth Edition, Bruce Alberts, Alexander Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter, published by Garland Science. Definitions of common terms in genetics can be found in Genetics: Analysis of Genes and Genomes, Eighth Edition, Daniel L. Hartl, Maryellen Ruvolo, published by Jones & Bartlett Learning.

[0043] Unless otherwise specified, experimental techniques herein employ conventional techniques of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics, and recombinant DNA, which can be found in standard books such as Molecular Cloning: A Laboratory Manual; Cell Biology: A Laboratory Handbook, etc.

[0044] Term:

[0045] The term "Lipid Nanoparticles" (LNPs) is a nanoscale delivery system composed of lipid molecules. Lipid nanoparticles can be complexed with bioactive compounds (such as nucleic acids and / or polypeptides), and are widely used for the encapsulation and targeted transport of drugs, nucleic acids (such as mRNA, siRNA), or other bioactive molecules. Generally, the particle size of LNPs is 1 - 100 nm. Generally, any method known in the art can be used to prepare the lipid nanoparticles of the present disclosure, as well as to prepare the complex of bioactive compounds and the lipid nanoparticles. For example, as described in Biochim Biophys Acta 1979, 557:9. The preservation method of lipid nanoparticles is crucial for their stability and function, especially in drug delivery and vaccine development. Cryopreservation (-20°C to -80°C) is the most commonly used long-term preservation method, while lyophilization technology can significantly improve stability and convenience. By optimizing the formulation and preservation conditions, the efficiency and reliability of LNPs in drug delivery and vaccine development can be ensured. In some embodiments, the cryoprotectant described in the present disclosure can be applicable to ordinary cryopreservation at low temperature, and can also be applicable to lyophilization preservation. In some embodiments, in addition to the two types of components described in the present disclosure, the cryoprotectant may further include additives well-known in the art to achieve corresponding functions. For example, buffers (such as including but not limited to, PBS buffer, Tris buffer, HEPES buffer), antioxidants (such as including but not limited to, α-tocopherol (vitamin E), BHT (butylated hydroxytoluene)), stabilizers (such as including but not limited to, polyethylene glycol-modified lipids, polysorbate (Tween), poloxamer), lipid auxiliary components (such as including but not limited to, DSPC, DOPE, cholesterol), polymers (such as including but not limited to, polyvinylpyrrolidone (PVP), hydroxypropyl methylcellulose (HPMC)), amino acids (such as including but not limited to, histidine), metal ion chelators (such as including but not limited to, EDTA), etc. The lyophilization preservation of LNPs can be carried out using techniques well-known in the art. For example, the method described in Liangxia Ai et al. Lyophilized mRNA-lipid nanoparticle vaccines with long-term stability and high antigenicity against SARS-CoV-2, Cell Discovery volume 9, Article number: 9 (2023).

[0046] The term "substance that forms a glassy state during freezing" refers to a substance that forms a glassy state (amorphous state) during freezing or lyophilization (freeze-drying). Such a substance can ensure the stability of the product by inhibiting ice crystal growth, reducing phase separation, and protecting the structural integrity of active ingredients such as proteins, liposomes, vaccines, etc. In the prior art, such substances are often used as cryoprotectants or lyoprotectants for lipid nanoparticles. In some embodiments, exemplary examples include, but are not limited to, saccharides (e.g., trehalose, sucrose, lactose, maltose, glucose), polymers (e.g., polyvinylpyrrolidone (PVP), polyethylene glycol (PEG), Ficoll (polysucrose)), amino acids (e.g., glycine, sodium glutamate), polyols (e.g., mannitol, sorbitol, glycerol, xylitol), cyclodextrin, hydroxyethyl starch (HES), etc.

[0047] The term "plasma" is the liquid component of blood, accounting for approximately 55% of the total blood volume. It is a pale yellow viscous liquid mainly composed of water, proteins, electrolytes, hormones, metabolic wastes, and nutrients, etc. Plasma contains fibrinogen and is obtained by centrifuging whole blood treated with anticoagulants such as heparin and EDTA. In the present disclosure, the term "serum" can be used interchangeably with "plasma". Serum does not contain fibrinogen (which is consumed during the coagulation process) and is obtained by centrifuging after natural coagulation of blood. In some embodiments, plasma and serum have the same function. Therefore, in the cryoprotectants of the present disclosure, plasma, serum, or a mixture of plasma and serum in any proportion can be included. In some embodiments, the plasma or serum is derived from humans or other animals, such as mice, rats, cows (including fetal cows, calves, adult cows, newborn calves), rabbits, sheep (including goats, sheep), horses, chickens, pigs, dogs, donkeys, guinea pigs, etc. In one embodiment, the plasma and / or serum is derived from humans. In some embodiments, the plasma and / or serum is sterile. Any suitable method in the prior art can be used to sterilize the above-mentioned plasma and / or serum as long as its activity is not affected. For example, filtration treatment using a filter membrane.

[0048] Lipid nanoparticle composition:

[0049] The lipid nanoparticle composition provided by the present disclosure includes:

[0050] i) Lipid nanoparticles (LNPs) can be used to deliver bioactive agents to cells, tissues, or animals. In some embodiments, exemplary cells include mesenchymal stem cells, hematopoietic stem cells (HSCs), monocytes, endothelial progenitor cells (EPCs), neural stem cells (NSCs), limbal stem cells (LSCs), tissue-specific primary cells or cells derived therefrom (TSCs), induced pluripotent stem cells (iPSCs), ocular stem cells, pluripotent stem cells (PSCs), embryonic stem cells (ESCs), and cells for organ or tissue transplantation.

[0051] ii) A bioactive agent delivered by the i) lipid nanoparticles, which forms a complex with the LNP. In some embodiments, exemplary bioactive agents include mRNA, siRNA, CRISPR-Cas gene editing system components, DNA vaccines and gene therapy components, small molecule drugs and chemotherapeutic drugs (e.g., doxorubicin, paclitaxel), antisense oligonucleotides (ASOs), circular RNAs (circRNAs), immunomodulators.

[0052] iii) Optionally includes buffers (e.g., including but not limited to, PBS buffer, Tris buffer, HEPES buffer), antioxidants (e.g., including but not limited to, α-tocopherol (vitamin E), BHT (butylated hydroxytoluene)), stabilizers (e.g., including but not limited to, polyethylene glycol-modified lipids, polysorbate (Tween), poloxamer), lipid co-components (e.g., including but not limited to, DSPC, DOPE, cholesterol), polymers (e.g., including but not limited to, polyvinylpyrrolidone (PVP), hydroxypropyl methylcellulose (HPMC)), amino acids (e.g., including but not limited to, histidine), metal ion chelators (e.g., including but not limited to, EDTA).

[0053] iv) Sugars (e.g., trehalose, sucrose, lactose, maltose, glucose), polymers (e.g., polyvinylpyrrolidone (PVP), polyethylene glycol (PEG), Ficoll), amino acids (e.g., glycine, sodium glutamate), polyols (e.g., mannitol, sorbitol, glycerol, xylitol), cyclodextrin, hydroxyethyl starch (HES).

[0054] v) Plasma or serum derived from humans or other animals (e.g., mice, rats, cattle (including fetal cattle, calves, adult cattle, neonatal cattle), rabbits, sheep (including goats, sheep), horses, chickens, pigs, dogs, donkeys, guinea pigs).

[0055] In some embodiments, the volume ratio of the solution composed of i) and ii) above to the solution composed of iii) - v) is 1:1 - 3, e.g., 1:1, 1:1.2, 1:1.4, 1:1.6, 1:1.8, 1:2, 1:2.2, 1:2.4, 1:2.6, 1:2.8, 1:3. In one embodiment, the above volume ratio is 1:1. In some embodiments, in the solution composed of iii) - v) above, the volume percentage of v) is 5% - 70%. For example, 5%, 10%, 20%, 25%, 30%, 40%, 45%, 50%, 60%, 70%.

[0056] Examples:

[0057] To enable those skilled in the art to better understand the technical solutions of the present invention, the present invention will be further described in detail below with reference to specific examples.

[0058] Example 1: Preparation of lipid nanoparticle composition.

[0059] 1. Preparation of LNP.

[0060] For the convenience of detecting the quality and function of LNP after cryopreservation, in this example, GFP fluorescent protein mRNA packaged by LNP is used as an example. Those skilled in the art can select other targets according to the actual situation, and the quality and function of their cryopreservation should be the same or similar to this example.

[0061] (1) Construct an in vitro transcription plasmid template of Luci - GFP mRNA using the method in the prior art: pIVT - T7 - 5UTR - Luciferase - E2A - GFP - U3.Hba - A90 - backbone P2197.

[0062] (2) In vitro transcribe the nucleic acid drug Luci - GFP mRNA:

[0063] The in vitro transcribed Luci-GFP plasmid containing the T7 promoter (TAATACGACTCACTATAGGG) was digested with enzymes to obtain a linear template. 90 A's were specifically added during template construction to facilitate subsequent addition of a polyA tail to the 3' end of the mRNA to enhance stability. Transcription was carried out using the HiScribe™ T7 mRNA Kit. CleanCap AG was added to the IVT reaction system for co-transcriptional capping, and N1-methylpseudouridine (m1ψ) was used to replace uridine to reduce immunogenicity. After incubating at 37°C for 4 hours, DNase I was used to precisely degrade the residual DNA template, and the mRNA was purified using the Monarch ® RNA Cleanup Kit. The concentration was measured by Nanodrop and the bands were verified by gel electrophoresis to provide high-quality nucleic acid raw materials for subsequent applications.

[0064] (3)Packaging LNP with a microfluidic pump:

[0065] According to the N / P ratio (charge ratio of nucleic acid to cationic lipid) of 6 and the required nucleic acid mass, the amount of cationic lipid required was calculated. The lipids were dissolved in absolute ethanol to form the oil phase according to the molar ratios of the ALC-L formula (ALC-0315: PEG: cholesterol: phospholipid (DSPC) = 46.3: 1.6: 42.7: 9.4) and the ALC-H formula (ALC-0315: PEG: cholesterol: phospholipid (DSPC): sphingomyelin = 39: 1.6: 39.5: 4: 8: 8). Luci-GFP mRNA was added to a 50 mM sodium citrate solution with a pH of 4.0 as the aqueous phase. The LNP was packaged using microfluidic chip technology to construct an LNP system with specific functions and structures. By detecting the transfection of 293T cells with 10 ng of LNP-GFP, the GFP positive rate reached over 90%, meeting the requirements for subsequent detection of the cryoprotectant effect.

[0066] (4)Dialysis and filtration sterilization:

[0067] The above-obtained LNP packaging product was dialyzed using a SpectraPor ® BiotechGrade Cellulose Ester (CE) Dialysis Membrane with a molecular cut-off of 300 kDa (Spectrum lab). The dialysis buffer was 1xPBS. After dialysis for 1 hour, the PBS dialysis buffer was replaced with fresh PBS and dialysis continued for 2 hours. Subsequently, it was filtered through a 0.22 μm Millex ®-Filter with a GV FilterUnit (Millipore). The filter membrane is used for filtration and sterilization operations to remove impurities, unreacted substances, and potentially existing microorganisms, obtaining a pure LNP sample that meets the experimental requirements for subsequent mixing operations with cryoprotectants.

[0068] 2. Preparation of cryoprotectant.

[0069] In this experiment, commercially available human plasma is selected, specifically human male AB-type plasma from the United States (Sigma-Aldrich, product catalog number H4522). AB-type plasma is adopted because of its characteristic of reducing the probability of immune rejection reactions, which can provide strong support for the storage stability of LNP. All the obtained plasma needs to go through a strict aseptic filtration process to effectively remove potentially existing impurities, various microorganisms, etc., to maximize the purity of the plasma and avoid adverse interference with the subsequent experimental process and the storage effect of LNP. The cryoprotectant in the embodiments of the present disclosure may include plasma and / or serum with a volume percentage of 5% - 70%, and substances that form a glassy state during freezing. In addition, those skilled in the art can select other biocompatible components with similar functions, such as plasma from different sources (such as mouse plasma, bovine plasma, etc.), or use other sugars, polymers, etc. as cryoprotectant components. In addition, the volume percentage of plasma can also be adjusted according to specific needs, usually between 5% - 70%. For example, using a human plasma formulation of 10%, 30%, or 50% can all obtain good cryoprotection effects. For example, prepare the cryoprotectant according to the configuration in Table 1 below.

[0070] Table 1

[0071]

[0072] After configuration, store the cryoprotectant sample at 4°C to maintain its stability for subsequent use in a ratio of 1:1 - 1:3.

[0073] 3. Mixing operation of LNP and cryoprotectant.

[0074] According to specific experimental requirements, appropriate amounts of two LNPs (ALC-L and ALC-H) with different transfection efficiencies that have undergone previous treatment are taken. The cryoprotectant samples 1 to 8 pre-configured and stored at 4°C are mixed with the measured LNPs in a volume ratio of 1:1 or 1:3. The mixed system is stirred by using a Vortex Genie2 vortex oscillator at a medium speed of about 1500 - 2000 rpm to make the cryoprotectant and LNP fully mixed evenly, ensuring that the LNP can be evenly dispersed in the cryoprotectant, so that the cryoprotectant can fully exert its protective effect on the LNP and avoid differences in the protective effect caused by uneven local concentration. A dot-sling operation is performed to remove possible bubbles in the mixed solution. Since bubbles may cause problems such as local pressure changes and oxidative stress during the storage of LNP, removing bubbles is of crucial significance for ensuring the stability and quality of LNP storage.

[0075] 4. Cryogenic storage.

[0076] The mixed solution obtained through the above treatment is placed in a -80°C refrigerator to complete the cryopreservation process of LNP. In this ultra-low temperature environment, combined with the role of the cryoprotectant prepared in this example, long-term stable storage of LNP is expected to be achieved.

[0077] Example 2: Verification of cryopreservation effect.

[0078] 1. Influence of cryoprotectant on the quality parameters of cryopreserved LNP.

[0079] Using dynamic light scattering technology, the average particle size, polydispersity index (PDI), and zeta potential of the exemplary LNP samples obtained in Example 1 are measured by Zetasizer Nano (Malvern Instruments, Malvern, UK). The cryopreservation period is the first day and the fourth week. The results are as Figure 2 shown in A of Figure 2 and B of

[0080] 2. In vitro functional verification (transfection efficiency).

[0081] The LNP obtained in Example 1 after cryopreserving Samples 1 - 8 was used for the experiment of transfecting cells for 24 hours. The above LNP was taken out on the first day and / or the fourth week after cryopreservation. The specific operation is as follows: A certain amount (such as 10 ng) of LNP containing GFP mRNA was added to the 293T cell culture medium in 0.05 M / 96 wells. After culturing for 24 hours under standard culture conditions, the cells were collected, and data was collected using a flow cytometer, focusing on the GFP mean fluorescence intensity (GFP-MFI) index, which can accurately reflect the GFP expression level in cells. To reduce the interference of systematic errors, the measured GFP-MFI was divided by the GFP-MFI of 293T WT cells to obtain the relative value of GFP-MFI (Relative GFP MFI). Thus, the transfection efficiency of the cryopreserved LNP was evaluated and compared with the transfection efficiency of freshly prepared LNP to determine whether they are consistent or close. The results are as Figure 1 A of Figure 1 B, Figure 2 A of Figure 2 shown in B. The results show the comparison of transfection efficiency and particle size distribution changes under different storage conditions. The control group (Con) was LNP stored at 4°C without adding cryoprotectant. The cryopreservation conditions included no cryoprotectant (NO CPA), 5% or 10% glucose (Glc), and 5% or 35% human plasma (Plasma), or conditions combining the two. The single-component and the cryoprotectant in Example 1 had a significant effect as cryoprotectants in preserving LNP-GFP expression. Compared with the group without protectant, the relative fluorescence intensity of GFP was significantly increased. Among them, the cryoprotectant in Example 1 showed a better protection effect and was suitable for long-term cryopreservation of LNP.

[0082] 3. In vivo function verification.

[0083] Animal experiments were conducted according to the protocol approved by the Institutional Animal Care and Use Committee of SKLEH. The cryopreserved LNP and fresh LNP were diluted to Luci 1 μg / ml with PBS and injected into C57 mice at a dose of 0.02 mg / kg. Four hours after injection, the mice were subjected to in vivo imaging using a Spectrum small animal in vivo optical imaging system. By detecting the intensity and distribution of bioluminescence signals (Radiance, p / sec / cm² / sr), the distribution, retention, and expression of LNP in vivo were evaluated, and the differences in in vivo functions between the cryopreserved LNP and fresh LNP were compared to determine whether the cryopreservation process had a significant impact on the in vivo function of LNP, so as to comprehensively evaluate the consistency or closeness of the functional characteristics of cryopreserved LNP and fresh LNP.

[0084] The results are as Figure 3As shown. Among them, the upper part shows the bioluminescence images of mice at Day 1, the 2nd week, and the 4th week under different storage conditions; the lower part shows the quantitative analysis of the corresponding bioluminescence signal intensity. The figure shows the changes in in vivo imaging signals of two groups, ALC-L (green) and ALC-H (red). The results show that over time, the signal of the group without cryoprotectant decreased rapidly, while the group with cryoprotectant added (especially 35% human plasma + 5% glucose) maintained a better signal under the condition of -80°C, indicating that the combination of cryoprotectants can significantly improve the retention of LNP function.

[0085] 4. Determination of the level of mouse plasma IL-6 inflammatory factor.

[0086] 90 μl of whole blood was collected from the tail vein of mice 4 h and 24 h after injection of LNP and transferred to an EP tube containing 10 μl of 3.2% sodium citrate solution (i.e., 1:9) to anticoagulate the blood. The blood samples were centrifuged at 2000×g and 12°C for 20 min, and the supernatant was taken as plasma. The level of IL-6 in the plasma was detected using the Basic IL-6 Mouse ELISA Kit (Invitrogen). According to the instructions, the standard product was diluted into a series of concentrations for drawing a standard curve. The collected plasma samples were diluted appropriately (according to the ratio recommended in the instructions). The standard product and the diluted samples were added to the pre-coated microplate. The microplate was sealed with a sealing film and incubated in a constant temperature incubator for 2 h. After incubation, the microplate was washed using a plate washer. Then 100 μl of IL-6 Biotin Conjugate solution was added and incubated at room temperature for 30 min. After incubation, the microplate was washed using a plate washer. Then 100 μl of Streptavidin-HRP solution was added and incubated at room temperature for 30 min. After incubation, the microplate was washed using a plate washer. Substrate solution was added to each microplate and incubated in the dark for 15 - 20 min. Stop solution was added to stop the enzymatic reaction. The absorbance (OD450 value) of each microplate was read using a microplate reader. The concentration of IL-6 in the sample was calculated according to the standard curve.

[0087] The results are as Figure 4 shown in A, B, C, and D. The results show that when delivering a high dose of mRNA (5 mg / kg), both ALC-L and ALC-H can trigger an acute inflammatory response. However, it is worth noting that compared with the group without cryoprotectant added, the groups with cryoprotectant added did not cause additional immune responses. This indicates that when using cryoprotectants to protect LNP, the induced immune response is smaller, and the main acute immune response is caused by LNP itself, and after 24 h, the inflammatory response gradually returns to normal.

[0088] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A lipid nanoparticle composition, characterized in that: The lipid nanoparticle composition comprises lipid nanoparticles and a cryoprotectant, The cryoprotectant includes a substance that forms a glassy state during the freezing process, and the cryoprotectant also includes 5% to 70% by volume of plasma and / or serum; Wherein, the substance that forms a glassy state during the freezing process is at least one selected from glucose, trehalose, sucrose or mannitol.

2. The lipid nanoparticle composition according to claim 1, characterized in that The plasma and / or serum is plasma and / or serum derived from human.

3. The lipid nanoparticle composition according to claim 1, characterized in that The volume ratio of the lipid nanoparticles to the cryoprotectant is 1:1-3.

4. The lipid nanoparticle composition according to any one of claims 1 to 3, characterized in that The preparation method of the cryoprotectant is to sterilize the plasma and / or serum and then mix it with the substance that forms a glassy state during the freezing process according to a certain proportion.

5. A method for preserving lipid nanoparticles, characterized in that: The lipid nanoparticles are uniformly mixed with the cryoprotectant described in the lipid nanoparticle composition according to any one of claims 1 to 4 in a volume ratio of 1:1 to 3, and stored at -100°C to -20°C.

6. The storage method according to claim 5, characterized in that: The fluctuation range of the particle size of the lipid nanoparticles during storage is no more than ±20% of the initial particle size.

7. The storage method according to claim 6, characterized in that: The transfection efficiency of the preserved lipid nanoparticles decreases by no more than 10% compared with the transfection efficiency of the initial lipid nanoparticles.

Images