A strain of Paecilomyces lilacinus for controlling multiple pathogens, and its isolation, purification method and application

Abstract

The present invention discloses a strain of Purpureocillium lilacinum for preventing and treating multiple pathogens, and a method for separating and purifying the same, and an application thereof. The Purpureocillium lilacinum strain is named Purpureocillium lilacinum GZUAS951025, and was deposited in the Guangdong Provincial Microbial Culture Collection Center on September 23, 2024, with a deposit number of GDMCC NO.65172. The Purpureocillium lilacinum strain isolated and purified by the present invention has a significant inhibitory effect on Phaseolus vulgaris, Microspores nivalis, Fusarium solani, Fusarium arvense, Fusarium equisetifolia, and Fusarium verticillioides, and can be widely used in preventing and treating multiple pathogenic diseases.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and particularly relates to a strain of Paecilomyces lilacinus for preventing and treating multiple pathogens, and a method for separating and purifying the strain and an application thereof. Background Art

[0002] As my country's agriculture develops from traditional agriculture to modern agriculture, the planting area and planting varieties are gradually increasing, and the problem of plant disease prevention and control is becoming more prominent. Plant diseases are mainly divided into: bacteria, fungi, viruses and nematodes. Among them, plant pathogenic fungi refer to fungi that can parasitize living plants and cause plant diseases. Currently, there are about 1.0×10 5 There are hundreds of fungi, over 8,000 of which can cause plant diseases. These diseases are often hidden, destructive, persistent, and difficult to control. For example, Fusarium, which causes root rot, can cause fusarium head blight in vegetables and rice, and wilt in cotton and bananas, affecting the quality and yield of many cash crops.

[0003] Agricultural pest control optimizes the crop growth environment through methods such as plowing, timely cultivation, crop rotation, soil disinfection, and soil replacement, blocking pathogen dormancy, transmission, and reproduction, and reducing and preventing the occurrence of diseases. However, this approach has limited effectiveness. Chemical pest control utilizes various pesticides, but this can easily lead to pesticide residues, increased resistance among pathogens, environmental pollution, and damage to the soil microbiome. With increasing attention to health, food safety, and the environment, biological pest control is gaining favor due to its low cost, safety, and environmental friendliness. Biocontrol bacteria control crops by secreting secondary metabolites, occupying ecological niches, and competing for nutrients. They can also be formulated into biocontrol agents and fertilizers for agricultural production, increasing production and efficiency.

[0004] Paecilomyces lilacinus is an endoparasitic fungus that is ubiquitous in nature. It is known for its excellent nematicidal activity and effective control of aphids, spider mites, and greenhouse whiteflies. Furthermore, it has inhibitory effects on various pathogens and can produce auxin-like substances that promote plant growth.

[0005] Currently, over fifty species of Paecilomyces lilacinus have been reported, all of which are insect and nematode pathogens. They are well-known for their excellent nematocidal abilities, characterized by high efficacy, pollution-free properties, and ease of preparation. With increasing research, their inhibitory effects against a variety of pathogens are also worthy of attention, not limited to insecticides. Currently, there are no reports on the inhibitory effects of Paecilomyces lilacinus against Phaseolus vulgaris, Microsporum nivalis, Fusarium solani, Fusarium equisetifolia, and Fusarium verticillioides. This study demonstrated the antifungal activity of Paecilomyces lilacinus against these pathogens using plate and pot experiments. Summary of the Invention

[0006] One of the objects of the present invention is to provide a strain of Paecilomyces lilacinus that can inhibit multiple pathogens, and the strain has a significant inhibitory effect on Phaseolus vulgaris, Microdochium nivalis, Fusarium solani, Fusarium arvense, Fusarium equisetifolia, and Fusarium spp.; a second object of the present invention is to provide a method for isolating and purifying a strain of Paecilomyces lilacinus that can inhibit multiple pathogens; a third object of the present invention is to provide an application of Paecilomyces lilacinus in the preparation of pathogen inhibitors, specifically in the preparation of antagonists to Phaseolus vulgaris, Microdochium nivalis, Fusarium solani, Fusarium arvense, Fusarium spp., Fusarium equisetifolia, and Fusarium spp.

[0007] In order to achieve the above object, the present invention is implemented through the following technical solutions:

[0008] The present invention discloses a strain of Purpureocillium lilacinum for preventing and controlling multiple pathogens. The strain is named Purpureocillium lilacinum GZUAS951025 and was deposited in the Guangdong Provincial Microbial Culture Collection on September 23, 2024 with a deposit number of GDMCC NO 65172.

[0009] The invention relates to the use of the Purpureocillium lilacinum GZUAS951025 in preparing pathogen inhibitors.

[0010] The inhibitor of the present invention specifically refers to the use of the Paecilomyces lilacinus strain in the preparation of any one or more antagonists of Microdochium quinoa, Microdochium nivale, Fusarium solani, Fusarium equisetifolia, and Fusarium pseudoverticillium.

[0011] The method for isolating and purifying Purpureocillium lilacinum GZUAS951025 of the present invention comprises the following steps:

[0012] S1: Collect fresh soil from betel nut trees using the five-point sampling method. Weigh the soil into a triangular flask, add sterile water, and mix well in a shaker. Remove the soil after half an hour to obtain a bacterial solution for later use.

[0013] S2. Take the evenly mixed soil stock solution, add sterile water to dilute it, repeat the above steps to obtain the bacterial dilution solution, take a certain concentration of the bacterial dilution solution and spread it on the PDA plate. Repeat three treatments. After culturing for 3 days, pick a single colony whose colony color changes from white to light purple and inoculate it into the PDA medium for purification culture.

[0014] Preferably, step S1 of the present invention is specifically as follows: collecting fresh areca palm soil, sampling by the five-point method, weighing 10 g of soil into a triangular flask, adding 100 mL of sterile water, mixing evenly in a shaker at 28° C. and 160 rpm, taking out after half an hour to obtain a bacterial solution for standby use.

[0015] Preferably, step S2 of the present invention is specifically as follows: take 1 mL of the uniformly mixed soil solution, add 9 mL of sterile water to dilute it, and repeat the above steps to obtain 10 -1 -10 -5 Bacteria-containing dilution, take 10 -2 -10 -5 100 μL of bacterial dilution with a concentration of 100 μL was spread on a PDA plate, and the treatment was repeated three times. After culturing for 3 days, a single colony whose colony color changed from white to light purple was picked and inoculated into a PDA medium for purification culture.

[0016] Compared with the prior art, the present invention has the following advantages:

[0017] 1. The Purpureocillium lilacinum GZUAS951025 obtained by the separation, purification and screening method of the present invention is a new strain that can inhibit multiple pathogens, and has inhibitory effects on Phaseolus vulgaris, Microdochium nivalis, Fusarium solani, Fusarium arvense, Fusarium equisetifolia, and Fusarium spp.

[0018] 2. The present invention confirmed through the broad-spectrum antibacterial test of Paecilomyces lilacinus that the inhibition rate of the Paecilomyces lilacinus strain on Phaseolus vulgaris was 60.6±1.02%, the inhibition rate of Fusarium solani was 60.25±1.87%, the inhibition rate of Fusarium solani was 49.98±3.77%, the inhibition rate of Microdochium nivalis was 48.61±2.74%, the inhibition rate of Fusarium equisetum was 35.29±1.1%, and the inhibition rate of Fusarium equisetum was 31.52±1.39%, indicating that the Paecilomyces lilacinus strain has a significant inhibitory effect on the above pathogens.

[0019] 3. The present invention confirms through a potted plant experiment on the prevention and control of Fusarium oxysporum disease by the fermentation liquid of the strain of Paecilomyces lilacinus that the fermentation liquid of the strain of Paecilomyces lilacinus can effectively inhibit the occurrence of the disease; after the root irrigation treatment of the fermentation liquid of the strain of Paecilomyces lilacinus, the disease index was significantly reduced compared with the control group with clear water, and the prevention and control effect was 55%.

[0020] Preservation information:

[0021] The isolated strain was classified and named as: Paecilomyces lilacinus GZUAS951025

[0022] Depository: Guangdong Provincial Microbial Culture Collection Center

[0023] Storage address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou

[0024] Deposit date: September 23, 2024

[0025] Deposit number: GDMCC NO.65172 BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 :PDA surface morphology of Paecilomyces lilacinus GZUAS951025

[0027] Figure 2 :Morphology of Paecilomyces lilacinus GZUAS951025 under microscope

[0028] Figure 3 :Phylogenetic tree of Paecilomyces lilacinus GZUAS951025

[0029] Figure 4 : Plate confrontation of Paecilomyces lilacinus against various pathogens (A: Phaseolus vulgaris, B: Microcystis nivalis, C: Fusarium solani, D: Fusarium solani, E: Fusarium equisetifolia, F: Fusarium verticillium)

[0030] Figure 5 : Potted plant experiment on the control of Fusarium wilt disease by using Paecilomyces lilacinus (plants not inoculated with Paecilomyces lilacinus (left), plants inoculated with Paecilomyces lilacinus (right)) DETAILED DESCRIPTION

[0031] The present invention will be described in further detail below in conjunction with specific examples and accompanying drawings. The following examples will help those skilled in the art to further understand the present invention, but are not intended to limit the present invention in any form. Unless otherwise defined, all scientific and technical terms used in the present invention have the same meanings as those commonly understood by those skilled in the art to which the present invention relates.

[0032] Example 1

[0033] Purpureocillium lilacinum GZUAS951025, named: Purpureocillium lilacinum GZUAS951025, was deposited in Guangdong Provincial Microbiological Culture Collection Center on September 23, 2024, with the deposit number: GDMCCNO.65172.

[0034] Example 2 Isolation and purification of Paecilomyces lilacinus

[0035] Step 1: Fresh soil from Areca palm trees in Hainan Province was collected using the five-point sampling method. 10 g of soil was weighed into a conical flask, and 100 mL of sterile water was added. The mixture was mixed evenly in a shaker at 28°C and 160 rpm. After half an hour, the soil was taken out for later use.

[0036] Step 2: Take 1 mL of the mixed soil stock solution, add 9 mL of sterile water to dilute, and repeat the above steps to obtain 10 -1 -10 -5 Bacteria-containing dilution, take 10 -2 -10 -5 100 μL of bacterial dilution with different concentrations was spread on PDA plates, with three replicates for each treatment; after culturing at 28°C for 3 days, single colonies whose colony color changed from white to light purple were picked and inoculated into new PDA culture medium for purification until a single uncontaminated colony grew.

[0037] Example 3 Isolation and purification of Paecilomyces lilacinus

[0038] Step 1: Collect fresh soil from Areca palm trees in Hainan Province using the five-point sampling method. Weigh 10 g of soil into a conical flask, add 100 mL of sterile water, and mix well in a shaker at 26°C and 150 rpm. Remove after half an hour for later use.

[0039] Step 2: Take 1 mL of the mixed soil stock solution, add 9 mL of sterile water to dilute, and repeat the above steps to obtain 10 -1 -10 -5 Bacteria-containing dilution, take 10 -2 -10 -5 100 μL of bacterial dilution with different concentrations was spread on PDA plates, with three replicates for each treatment; after culturing at 26°C for 4 days, single colonies whose colony color changed from white to light purple were picked and inoculated into new PDA culture medium for purification until a single uncontaminated colony grew.

[0040] Example 4 Isolation and purification of Paecilomyces lilacinus

[0041] Step 1: Fresh soil from Areca palm trees in Hainan Province was collected using the five-point sampling method. 10 g of soil was weighed into a conical flask, and 100 mL of sterile water was added. The soil was mixed evenly in a shaker at 30°C and 170 rpm. The soil was taken out after half an hour for later use.

[0042] Step 2: Take 1 mL of the mixed soil stock solution, add 9 mL of sterile water to dilute, and repeat the above steps to obtain 10 -1 -10 -5 Bacteria-containing dilution, take 10 -2 -10 -5 100 μL of bacterial dilution with different concentrations was spread on PDA plates, with three replicates for each treatment; after culturing at 30°C for 2 days, single colonies whose colony color changed from white to light purple were picked and inoculated into new PDA culture medium for purification until a single uncontaminated colony grew.

[0043] Example 5 Identification of Paecilomyces lilacinus

[0044] 1. Morphological Identification of Strains

[0045] The surface morphology of Paecilomyces lilacinus on PDA plates: 1-2 days after inoculation, white colonies are round in shape. On the third day, the colonies begin to turn pale purple from the center, with smooth edges. The colonies are flat, dense, and powdery. Under a microscope, individual hyphae branch off from the main hyphae, and smaller hyphae branch off from the conidia and produce spores. The conidia are single-celled, ovoid, and form discrete conidial chains. Figures 1 to 2 .

[0046] 2. Molecular Biological Identification of Strain

[0047] Using ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGA TATGC) sequences as primers, the isolated Paecilomyces lilacinus was identified by ITS molecular analysis. A phylogenetic tree was constructed based on the sequencing results to determine the species relationship. Figure 3 .

[0048] The ITS region sequence is as follows:

[0049] GCGGAGGGATCATTACCGAGTTATACAACTCCCAAACCCACTGTGAA

[0050] CCTTACCTCAGTTGCCTCGGCGGGAACGCCCCGGCCGCCTGCCCCCGCGCC

[0051] GGCGCCGGACCCAGGCGCCCGCCGCAGGGACCCCAAACTCTCTTGCATTA

[0052] CGCCCAGCGGGCGGAATTTCTTCTCTGAGTTGCACAAGCAAAAACAAATG

[0053] AATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACG

[0054] CAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGA

[0055] ATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTC

[0056] GAGCGTCATTTCAACCCTCGAGCCCCCCCGGGGGCCTCGGTGTTGGGGGA

[0057] CGGCACACCAGCCGCCCCCGAAATGCAGTGGCGACCCCGCCGCAGCCTCC

[0058] CCTGCGTAGTAGCACACACCTCGCACCGGAGCGCGGAGGCGGTCACGCCG

[0059] TAAAACGCCCAACTTTCTTAGAGTTGACCTCGGATCAGGTAGGAATACCCG

[0060] CTGAACTTAAGCATATC

[0061] ITS Identification:

[0062] Through homology comparison on the NCBI website (http: / / www.ncbi.nlm.nih.gov / BLAST), GZUAS951025 has the highest sequence homology with Purpureocillium lilacinum in Gene Bank, with a confidence level of up to 99%.

[0063] Example 6 Plate confrontation test of Paecilomyces lilacinus against various pathogens

[0064] Prepare PDA solid culture medium, activate the pathogens of Phaseolus vulgaris, Fusarium solani, Fusarium verticillioides, Microdochium nivalis, Fusarium equisetifolia, and Fusarium rot. The above pathogens are inoculated in the middle of the plate, and Paecilomyces lilacinus is inoculated on both sides of the pathogens. The culture is carried out at 28°C for five days, and the inhibition diameter is measured. The inhibition rate is calculated according to the formula: inhibition rate = (pathogen normal growth diameter - pathogen inhibited growth diameter) / pathogen normal growth diameter. The results are shown in Table 1. Figure 4 .

[0065] As can be seen from Table 1, the inhibition rate of the Paecilomyces lilacinus strain on the phaseolus vulgaris is 60.6±1.02%, the inhibition rate of Fusarium solani is 60.25±1.87%, the inhibition rate of Fusarium solani is 49.98±3.77%, the inhibition rate of Microdochium nivale is 48.61±2.74%, the inhibition rate of Fusarium equisetifolia is 35.29±1.1%, and the inhibition rate of Fusarium oxysporum is 31.52±1.39%, indicating that the Paecilomyces lilacinus strain has a significant inhibitory effect on the above pathogens.

[0066] Table 1 Inhibition rate of Paecilomyces lilacinus against various pathogens

[0067]

[0068] Example 7 Potted plant test of using Paecilomyces lilacinus to control Fusarium spp. disease on cotton

[0069] The plants were inoculated for the first time: the experimental group used the root irrigation method to inoculate the plants with a suspension of Paecilomyces lilacinus spores (1×10 6 CFU / mL) was added to the seedling pot, 20 mL per pot. The control group was only given the same amount of water. The second inoculation was carried out 7 days after the first inoculation. The experimental group and the control group were simultaneously inoculated with a spore suspension of Fusarium spp. (1×10 7 CFU / mL), add 30 mL per pot to the seedling pot. Repeat three times. Determine disease activity 10 days after inoculation. Observe the plants for disease activity.

[0070] Potted plant disease classification standards:

[0071]

[0072] (where Ni is the number of diseased plants at each level, i is the disease level index, and N is the total number of plants surveyed)

[0073]

[0074]

[0075] A potted plant experiment using a fermented liquid from the strain Paecilomyces lilacinus against Fusarium verticillioides confirmed its effectiveness in inhibiting the disease. A total of 30 plants were investigated. In the control group, 2, 9, 8, 9, and 2 plants were found in disease levels 0-4, respectively. In the experimental group, after root irrigation with the fermented liquid, 10, 15, 3, 2, and 0 plants were found in disease levels 0-4, respectively. Statistical calculations based on disease grading criteria revealed a disease index of 50% for the control group and 22.5% for the experimental group. The disease indexes were significantly lower than those in the water-treated control group. The control efficacy, calculated as (control group disease index - treatment group disease index) / control group disease index × 100%, was 55%.

[0076] Although the present invention has been described in detail above using general explanations, specific embodiments, and experiments, it will be apparent to those skilled in the art that modifications and improvements may be made thereto. Therefore, such modifications and improvements, without departing from the spirit of the present invention, are intended to be within the scope of protection claimed herein.

Claims

1. A strain of Paecilomyces lilacinus for controlling multiple pathogens, characterized in that: The strain was named Paecilomyces lilacinus ( Purple cilium lilacinum ) GZUAS951025, deposited in Guangdong Provincial Microbiological Culture Collection Center on September 23, 2024, with the deposit number GDMCC NO 65172.

2. The Paecilomyces lilacinus according to claim 1 ( Purple cilium lilacinum ) Use of GZUAS951025 in the preparation of pathogen inhibitors, wherein the pathogens are any one or more of Phaseolus vulgaris, Microdochium nivale, Fusarium solani, Fusarium arvense, Fusarium equisetifolia, and Fusarium spp.

Images