Parclostridium graciliatum Pt517 and application thereof in preparation of anti-inflammatory or antibacterial products

Abstract

The invention relates to the technical field of microorganisms, in particular to paraclostridium graciliatum Pt517 and application thereof in preparation of anti-inflammatory or antibacterial products. The preservation number of the paraclostridium graciliatum Pt517 is CGMCC (China General Microbiological Culture Collection Center) No. 31232. The bacteriostasis comprises the inhibition of escherichia coli, salmonella typhimurium, listeria monocytogenes or staphylococcus aureus. According to the invention, a strain of paraclostridium graciliatum with bacteriostatic and anti-inflammatory capacities is obtained through screening, and the paraclostridium graciliatum has relatively high safety to animals, has the effect of relieving infection symptoms of salmonella typhimurium, provides a new strategy for prevention and treatment of salmonella typhimurium, and has potential clinical application prospects.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to a paraclostridium tiliaceum Pt517 and an application thereof in preparing anti-inflammatory or antibacterial products. Background Art

[0002] Infectious gastrointestinal diseases are usually caused by ingesting water or food contaminated by intestinal pathogens. Among them, Salmonella is the most common pathogen of foodborne diseases and the main cause of diarrheal diseases. Salmonella is a common zoonotic foodborne pathogen with a wide host range, multiple serotypes, high morbidity and mortality, and poses a serious threat to human health and public health security.

[0003] According to the different surface antigens, Salmonella can be divided into more than 2,600 serotypes, among which the most common serotype is Salmonella typhimurium ( Salmonella typhimurium ). It has strong environmental adaptability and is widely present in nature. It can infect humans and a variety of animals, causing symptoms such as gastrointestinal inflammation, vomiting, diarrhea, abdominal pain, and fever. Patients with low immune function may develop severe systemic infection through the blood system, causing damage to tissues and organs and even death.

[0004] Antibiotics are the first choice for treating Salmonella infection. However, due to the extensive, long-term and unscientific use of antibiotics, Salmonella has become increasingly resistant to antibiotics. The emergence and development of resistance increases the difficulty of treating Salmonella infection, leading to an increased risk of death for patients. It also increases medical costs and economic burdens, making it more difficult to control the large-scale spread of Salmonella, and poses a great threat to public health and safety. In addition, antibiotics can also disrupt the balance of the host's intestinal flora, leading to intestinal dysfunction, resulting in problems such as diarrhea and inflammation associated with antibiotics.

[0005] Clostridium sulphate ( Paraclostridium tenue ) Formerly known as Eubacterium gracilis ( Eubacterium tenue ), which was later assigned to the genus Paraclostridium ( Paraclostridium ). Most of the reported strains of Paraclostridium tenuis were isolated from dairy products and fermented foods. Some strains were also isolated from infant fecal samples or tissue samples of human mummies. No strains of Paraclostridium tenuis with antibacterial effects have been reported so far. Summary of the invention

[0006] In order to solve the problems existing in the prior art, the present invention provides a paraclostridium tenuis Pt517 and an application thereof in the preparation of anti-inflammatory or antibacterial products.

[0007] The present invention separates and purifies a strain of Clostridium parahaemolyticum obtained from healthy human feces. Experiments show that the strain has good safety, high self-aggregation ability and surface hydrophobicity, and the strain has the effect of inhibiting the growth of pathogenic bacteria verified by in vitro experiments and animal experiments. The strain can inhibit the growth of pathogenic bacteria such as Salmonella typhimurium, Escherichia coli, Staphylococcus aureus and Listeria monocytogenes in vitro. Animal experiments have verified that the strain can reduce the load of Salmonella typhimurium in the liver and spleen of mice infected with Salmonella typhimurium, alleviate colitis and spleen damage caused by Salmonella typhimurium infection, and reduce the level of inflammatory factors, and is suitable for preventing and treating Salmonella typhimurium infection as a probiotic preparation.

[0008] In the first aspect, the present invention has carried out biological preservation of Clostridium tiliaceum Pt517, which was deposited on July 3, 2024 in the General Microbiological Center of China Microbiological Culture Collection Administration (referred to as CGMCC, address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code 100101), and is classified and named Paraclostridium tenue , the deposit number is CGMCC No.31232.

[0009] In a second aspect, the present invention provides a bacterial agent, comprising the aforementioned Paraclostridium tenuis Pt517 or a fermentation product thereof.

[0010] Furthermore, the bacterial agent is a solid bacterial agent, a liquid bacterial agent or a microbial bacterial agent, and the total viable count of the paraclostridium truncatum Pt517 in the bacterial agent is 1×10 7-10 CFU / mL.

[0011] In a third aspect, the present invention provides a method for preparing the aforementioned bacterial agent, comprising: inoculating Paraclostridium tenuis Pt517 into a culture medium for fermentation culture.

[0012] Furthermore, the culture medium is BHI culture medium, and the fermentation culture conditions include: culturing under anaerobic conditions at 35-40°C.

[0013] The bacterial liquid of Clostridium tenuis Pt517 obtained by culture can be prepared as a liquid bacterial agent directly or by adding auxiliary materials permitted in the field of microbial preparations. The bacterial bodies in the bacterial liquid can also be collected and mixed with auxiliary materials permitted in the field of microbial preparations such as lyophilization protectants, and then prepared as a dry powder bacterial agent by vacuum freeze-drying.

[0014] In a fourth aspect, the present invention provides a product, comprising the aforementioned Paraclostridium tenuis Pt517, or the aforementioned bacterial agent, or prepared by the aforementioned preparation method; the product is preferably an antibacterial agent or a drug.

[0015] In a fifth aspect, the present invention provides the aforementioned Clostridium tenuis Pt517, or the use of the aforementioned bacterial agent in inhibiting microorganisms; the microorganisms include: Escherichia coli, Salmonella, Listeria monocytogenes or Staphylococcus aureus.

[0016] The present invention further provides the use of the aforementioned Paraclostridium tiliaceum Pt517 or the aforementioned bacterial agent in the preparation of a product for any of the following applications: i) inhibiting salmonella infection, ii) anti-inflammatory, iii) resist intestinal damage, iv) Protects against spleen damage.

[0017] Furthermore, the intestinal damage includes: colon shortening or intestinal mucosal damage; and / or, The spleen injury includes: reduced expansion of the spleen's medullary sinuses, and reduced bleeding and congestion.

[0018] Furthermore, the inhibition of Salmonella infection includes: inhibiting weight loss, reducing the load of Salmonella, reducing the level of inflammatory factors or increasing the level of anti-inflammatory factors.

[0019] Furthermore, the reduction of inflammatory factors is the reduction of inflammatory factors in the serum of Salmonella-infected mice and DSS-induced colitis mice, and the inflammatory factors include: tumor necrosis factor-α (TNF-α), serum interleukin-1β (IL-1β) and interleukin-6 (IL-6).

[0020] Furthermore, the anti-inflammatory factors include interleukin-10 (IL-10).

[0021] The present invention has the following beneficial effects: The present invention screened and obtained a strain of Paraclostridium gracilis Pt517, which can inhibit the growth of pathogenic bacteria such as Salmonella typhimurium, Escherichia coli, Staphylococcus aureus and Listeria monocytogenes in vitro. Animal experiments have shown that the strain can reduce the load of Salmonella typhimurium in the liver and spleen of mice infected with Salmonella typhimurium, alleviate symptoms such as colitis and spleen damage caused by Salmonella typhimurium infection, reduce the level of inflammatory factors, and has no obvious toxic and side effects on experimental animals, providing a new strategy for the prevention and treatment of Salmonella typhimurium, and has a wide range of application value in medicines, foods and various forms of probiotic products, and has potential clinical application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0023] Figure 1 The evolutionary tree of Clostridium tiliaceum Pt517 and Clostridium bacteria provided in Example 1 of the present invention.

[0024] Figure 2 This is the effect of Clostridium tenuis Pt517 provided in Example 3 of the present invention on the body weight of mice infected with Salmonella typhimurium.

[0025] Figure 3 This is the effect of the paraclostridium tenuis Pt517 provided in Example 3 of the present invention on the load of Salmonella typhimurium in the organs of mice infected with Salmonella typhimurium.

[0026] Figure 4 The effect of Clostridium tenuis Pt517 provided in Example 3 of the present invention on the spleen weight and spleen index of mice infected with Salmonella typhimurium; wherein NC represents the normal control group, PBS represents the Salmonella typhimurium infection model group, and Pt517 represents the Clostridium tenuis Pt517 intervention group; the results are shown as x±SEM; N=6; *: P<0.05; **: P<0.01; ***: P<0.001.

[0027] Figure 5 This is the effect of Clostridium tenuis Pt517 provided in Example 3 of the present invention on the spleen tissue pathological results of mice infected with Salmonella typhimurium.

[0028] Figure 6 The effect of Paraclostridium tenuis Pt517 provided in Example 3 of the present invention on the colon phenotype and colon length of mice infected with Salmonella typhimurium; wherein NC represents the normal control group, PBS represents the Salmonella typhimurium infection model group, and Pt517 represents the Paraclostridium tenuis Pt517 intervention group; the results are shown as x±SEM; N=6; *: P<0.05; ***: P<0.001.

[0029] Figure 7 This is the effect of the Clostridium tenuis Pt517 provided in Example 3 of the present invention on the colon tissue pathological results of mice infected with Salmonella typhimurium.

[0030] Figure 8The effect of Clostridium tenuis Pt517 provided in Example 3 of the present invention on the content of inflammatory cytokines in the serum and ileum of mice infected with Salmonella typhimurium; wherein NC represents the normal control group, PBS represents the Salmonella typhimurium infection model group, and Pt517 represents the Clostridium tenuis Pt517 intervention group; the results are shown as x±SEM; N=6; *: P<0.05; **: P<0.01; ***: P<0.001. DETAILED DESCRIPTION

[0031] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be clearly and completely described below in conjunction with the drawings of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0032] The experimental methods involved in the following examples, unless otherwise mentioned, are all conventional methods in the art, for example, reference may be made to experimental manuals in the art, or the conditions recommended in the manufacturer's instructions.

[0033] Unless otherwise specified, the experimental materials and reagents involved in the following examples can be obtained from commercial sources.

[0034] Example 1 Isolation and identification of Clostridium tiliaceum Pt517 1. Strain Isolation (1) Prepare brain heart infusion agar medium, sterilize it at 121°C for 15 min, cool it to 50°C, shake it gently, add 5% defibrinated blood, mix well, and pour it into a culture dish; (2) Take an appropriate amount of healthy human fecal samples frozen in a -80 ℃ refrigerator and slowly thaw them on ice. After gradient dilution with PBS, transfer 100 μL of the sample suspension with different dilutions to BHI + 5% (v / v) defibrinated sheep blood culture medium and spread evenly; (3) Cultivate at 37°C under anaerobic conditions for 48 h; (4) Take out the culture dish, use a sterile inoculation loop to pick up a single white translucent colony and transfer it to a new solid culture medium for subculture purification, and transfer it three times in a row. The isolated and purified anaerobic bacteria was named Pt517, and the purified strain can be used for experiments or frozen storage.

[0035] 2. Preservation of strains This laboratory uses BHI medium containing 20% ​​glycerol as the bacterial preservation solution for freezing and preserving bacteria. The method is as follows: (1) Add 1.5 mL of sterile preservative solution to a 2 mL preservative tube and sterilize it under high pressure at 121 °C for 15 min for use; (2) Pt517 was transferred three times on a solid medium containing BHI + 5% (v / v) defibrinated sheep blood; (3) Use a sterile inoculating loop to scrape the colonies into a bacterial preservation tube and fully mix them into the bacterial preservation solution. Mix well and freeze at -80°C.

[0036] 3. Observation of colony appearance and bacterial morphology Pt517 grows well under anaerobic conditions, forming round, irregular-edged, bulging, smooth-surfaced translucent colonies on BHI+5% (v / v) defibrinated sheep blood medium, but does not grow under aerobic conditions. Under a microscope, the morphology of Paraclostridium gracilis is rod-shaped and Gram-staining positive.

[0037] 4. Extraction of total bacterial DNA A single colony of Pt517 was inoculated on a solid medium of BHI + 5% (v / v) defibrinated sheep blood and cultured anaerobically overnight at 37°C. DNA was extracted according to the instructions of the Bacterial Genomic DNA Extraction Kit (Promega).

[0038] 5. Taxonomic identification of bacteria Extract Pt517 genomic DNA, amplify the 16S rRNA gene of Pt517 with universal primers for 16S rRNA gene (27F: AGAGTTTGATCCTGGCTCA; 1492R: AAGTCGTAACAAGGTAGCCGT), sequence the PCR amplification product, and perform BLAST comparison on the NCBI online database. The PCR reaction conditions and the composition of the PCR system (30 μL) are as follows: PCR reaction system (30 μL): Premix Taq, 15 μL; ddH2O, 12 μL; upstream and downstream primers, 1 μL each; genomic DNA, 1 μL.

[0039] PCR amplification conditions: 94 °C pre-denaturation, 5 min; 94 °C denaturation, 0.5 min, 55 °C annealing, 0.5 min, 72 °C extension, 0.5 min, 30 cycles; 72 °C final extension, 1 min.

[0040]

[0041] The 16S rRNA sequencing results of Pt517 were compared by BLAST on NCBI, and the results showed that the strain with the highest homology to Pt517 was the type strain of Paraclostridium tenuis Paraclostridium tenue strain ATCC 25553 (99.03 %) and the type strain of Clostridium tenuis Paraclostridium tenue strain DSM 20695 (98.90 %), and the sequence identity exceeded the interspecies threshold of 98.75 %.

[0042] The 16S rRNA gene sequences of Clostridium with high homology (similarity>96%) were selected, and Clostridium butyricum JCM 1391 was used as the evolutionary outgroup. MEGA7 software was used to construct the Neighbor-Joining (NJ) phylogenetic tree based on 1000 samplings to determine the specific taxonomic position of Pt517. Figure 1 As shown, Pt517 and Paraclostridium tenue strain ATCC 25553 is the closest evolutionary relative. In summary, Pt517 was identified as Paraclostridium tenuissima.

[0043] The strain was sent to the General Microbiology Center of China Microbiological Culture Collection Administration for strain preservation. The strain number is CGMCC No.31232 and the preservation date is July 3, 2024. The proposed strain name is Paraclostridium tenue The depository is the General Microbiology Center of China Microbiological Culture Collection Administration, located at Institute of Microbiology, Chinese Academy of Sciences, Datun Road, Chaoyang District, Beijing, Postal Code: 100101.

[0044] Example 2 In vitro characteristics analysis of Clostridium tiliaceus Pt517 1. Hemolytic activity of Clostridium tiliaceum Pt517 The bacterial suspension of Paraclostridium tenuis Pt517 was inoculated on the surface of BHI + 5% (v / v) defibrinated sheep blood medium, and then cultured anaerobically at 37 °C for 24 h to observe whether a hemolytic ring appeared around the colony. If a hemolytic ring appeared around the colony, the hemolytic test was positive, otherwise it was negative. Staphylococcus aureus ATCC 25923 was used as a positive control, and LGG was used as a negative control.

[0045] The results showed that a transparent hemolytic ring appeared around the positive control strain Staphylococcus aureus 25923, which had hemolytic activity; no hemolytic ring was seen around the paraclostridium tiliaceum Pt517 and the negative control strain LGG, which meant that there was no hemolytic activity. This showed that the safety of paraclostridium tiliaceum Pt517 was good.

[0046] 2. Antibiotic sensitivity of Clostridium subtilis Pt517 The experiment used the antibiotic concentration gradient method (E-test method) according to the Clinical and Laboratory Standards Institute (CLSI) M100 standard, and selected the recommended test antibiotics for anaerobic bacteria, namely penicillin, ampicillin, amoxicillin, imipenem, meropenem, clindamycin, ceftriaxone sodium, moxifloxacin, tetracycline, and metronidazole to conduct antibiotic sensitivity tests on Clostridium fragilis Pt517. Bacteroides fragilis ATCC 25285 was selected as the quality control strain (QC). The suspension of Clostridium fragilis Pt517 with a McFarland turbidity of 0.5 was mixed with Bacteroides fragilis ( Bacteroides fragilis ) ATCC 25285 bacterial suspension was evenly spread on the surface of BM + 5% (v / v) defibrinated sheep blood culture medium, and the E-test strip was placed on the surface of the culture medium. After anaerobic culture at 37 ℃ for 24 h, the minimum inhibitory concentration (MIC) value was read and compared with the standard to determine its drug resistance.

[0047] The results are shown in Table 1, where S represents sensitive and R represents resistant. The Pt517 strain was sensitive to the 10 antibiotics selected in the experiment, including penicillin, ampicillin, amoxicillin, imipenem, meropenem, clindamycin, ceftriaxone sodium, moxifloxacin, tetracycline, and metronidazole, and had a high safety.

[0048] Table 1 Antibiotic sensitivity results of Clostridium tiliaceum Pt517

[0049] Note: S stands for sensitive, R stands for resistant, and QC stands for quality control strain (Bacteroides fragilis ATCC 25285).

[0050] 3. Hydrophobicity and self-aggregation ability of Clostridium tiliaceum Pt517 Hydrophobicity test: The McFarland turbidity of the suspension of Clostridium subtilis Pt517 and LGG (control strain) was adjusted to 1.0 with PBS, recorded as OD0. 2 mL of xylene was added to 2 mL of the bacterial suspension, and the mixture was thoroughly shaken and incubated in an anaerobic chamber at 37 °C for 1 h. The supernatant was aspirated and its McFarland turbidity was measured, recorded as OD1. Calculate the hydrophobicity of the bacterial surface: hydrophobicity = (OD0-OD1) / OD0×100%, and the results of 3 experiments were taken and the average value was calculated.

[0051] Evaluation of self-aggregation ability: The McFarland turbidity of the suspension of Clostridium subtilis Pt517 and LGG (control strain) was adjusted to 1.0 with PBS, recorded as OD0. After static culture at 37 °C in anaerobic conditions for 24 h, the McFarland turbidity was measured again, recorded as OD1. Calculation of self-aggregation ability: Self-aggregation ability = (OD0-OD1) / OD0×100%, take the results of 3 experiments and calculate the average value.

[0052] The results are shown in Table 2. The hydrophobicity and self-aggregation ability of Paraclostridium tenuis Pt517 were comparable to those of the positive control bacteria LGG, indicating that the strain had a certain intestinal colonization ability.

[0053] Table 2 Hydrophobicity and self-aggregation ability of Clostridium tiliaceum Pt517

[0054] 4. In vitro inhibitory effect of Clostridium tiliaceus Pt517 on pathogenic bacteria The agar overlay method was used to perform an in vitro antibacterial test on Clostridium tenuis Pt517. The colony counts of Clostridium tenuis Pt517 and pathogenic bacteria (Escherichia coli EDL933, Salmonella typhimurium SL1344, Listeria monocytogenes ATCC BAA-679, and Staphylococcus aureus ATCC 25923) were performed. The concentration of the bacterial solution of Clostridium tenuis Pt517 was adjusted to 1×10 8 CFU / mL, take 30 μl of bacterial droplets and inoculate them on the surface of BHI + 5% (v / v) defibrinated sheep blood medium, and culture them in an anaerobic box at 37 °C for 24 h. Prepare LB medium containing 0.6% agar and sterilize it by high pressure.

[0055] The concentration of the pathogenic bacteria solution was adjusted to 1×10 8 CFU / mL, 10 μL of bacterial suspension was added to 10 mL of sterilized LB medium and mixed, and the LB medium containing pathogenic bacteria was covered on the BHI+5% (v / v) defibrinated sheep blood medium formed by the colony of Clostridium subtilis Pt517. After culturing at 37 °C for 4 h, the diameter of the inhibition zone was measured, and the experimental results were taken 3 times and the average value was calculated. The in vitro antibacterial results of Clostridium subtilis Pt517 are shown in Table 3. The results show that Clostridium subtilis Pt517 has a certain inhibitory effect on the 4 common human pathogens selected in the experiment.

[0056] Table 3 Results of in vitro antibacterial experiments against Clostridium tiliaceum Pt517

[0057] Example 3 Effect of Clostridium tiliaceus Pt517 on the infection of Salmonella typhimurium 1. Establishment, grouping and treatment of the mouse model infected with Salmonella typhimurium Eighteen female BALB / c mice weighing (16 ± 1) g were randomly divided into three groups after adaptive feeding for 3 days: normal control group (NC group), Salmonella typhimurium infection model group (PBS group) and Clostridium tenuis Pt517 intervention group (Pt517 group), with 6 mice in each group. From day -7 to day 5, each mouse in the NC group and PBS group was intragastrically administered with 0.2 mL PBS daily, and each mouse in the Pt517 group was intragastrically administered with 0.2 mL of Clostridium tenuis Pt517 suspension (bacterial volume about 10 8 CFU / 0.2 mL), and the mice were gavaged for 13 consecutive days. On day 0, each mouse in the PBS group and the Pt517 group was given 0.1 mL of the Salmonella typhimurium SL1344 suspension (the amount of bacteria was about 10 8 CFU / 0.2 mL). Observe the health status of mice every day, weigh and record the weight of mice.

[0058] On the 6th day, the mice were euthanized and blood was collected from the eyeballs. The liver and spleen of the mice were dissected, and the weights of the liver and spleen were weighed and recorded. 0.1 g of liver and spleen were weighed and placed in sterile centrifuge tubes for later use. Part of the spleen tissue was cut and immersed in 4% paraformaldehyde for fixation. The ileum was separated and collected for later use. The colon was separated, the colon phenotype was observed, the colon length was measured and recorded, the colon images were taken and saved, and the colon tissue was then fixed with 4% paraformaldehyde.

[0059] The spleen and colon tissues of mice were immersed in 4% paraformaldehyde fixative, dehydrated, waxed, embedded, sectioned, and then stained with hematoxylin-eosin (HE). The pathological morphological changes of spleen and colon tissues were observed under an optical microscope at 20 times, 50 times, and 200 times.

[0060] After the collected mouse blood was allowed to stand for 3 h, it was centrifuged at 3000 r / min for 15 min, and serum was collected for the detection of inflammatory cytokines. The ileum tissue was rinsed with pre-cooled PBS and cut into pieces, and then fully ground on ice to make a tissue homogenate. The homogenate was centrifuged at 5000 r / min for 5-10 min, and the supernatant was collected to detect inflammatory cytokines. The concentrations of inflammatory cytokines TNF-α, IL-1β, IL-6, and IL-10 in serum and ileum tissue were detected using ELISA kits.

[0061] Add 1 mL of PBS and 3 mm steel beads to sterile centrifuge tubes containing 0.1 g of liver and spleen, respectively, grind the liver and spleen into tissue homogenate, dilute the tissue homogenate gradiently and drop it on Salmonella selective medium containing streptomycin (50 μg / mL), and count the colonies of Salmonella typhimurium in the liver and spleen of mice.

[0062] 2. In vivo safety of Clostridium tiliaceus Pt517 Before establishing the Salmonella typhimurium infection model (i.e., from day -7 to day 0), mice in the NC group and PBS group were gavaged with PBS daily, and mice in the Pt517 group were gavaged with Clostridium truncatum Pt517 suspension daily. The weight changes of mice infected with Salmonella typhimurium are shown in Tables 4 and Figure 2 The results showed that the weight of mice in each group increased steadily every day. The average weight gain of NC group, PBS group and Pt517 group was (0.39±0.24) g, (0.21±0.18) g and (0.23±0.12) g, respectively. There was no statistical difference in weight among the three groups (P>0.05). The feces of mice in each group were granular, the hair was shiny and smooth, the activity and mental state were good, and no abnormal state or death was observed. This shows that Clostridium tiliaceus Pt517 did not produce toxic effects on mice and had good safety.

[0063] 3. Effects of Clostridium tiliaceus Pt517 on the growth and body weight of mice infected with Salmonella typhimurium The mice in the NC group grew well, their fur was shiny and smooth, their food intake was normal, their mental state was good, and there was no death. After infection with Salmonella typhimurium, the mice in the PBS and Pt517 groups showed typical symptoms of Salmonella typhimurium infection, such as listlessness, messy fur, hunched backs, reduced activity, and decreased appetite.

[0064] As shown in Table 4 and Figure 2 As shown in the figure, the average weight of mice in the PBS group began to decrease from the first day after Salmonella typhimurium infection, while the average weight of mice in the Pt517 group began to decrease from the third day; and from the first day to the sixth day after Salmonella typhimurium infection, the average weight of mice in the PBS group was always lower than that of mice in the Pt517 group. Although there was no significant difference in the weight of the two groups, Paraclostridium tenuis Pt517 could alleviate the weight loss caused by Salmonella typhimurium infection to a certain extent, and played a certain protective role in mice.

[0065] Table 4 Daily body weight statistics of experimental mice (g)

[0066] Note: Compared with the PBS group, *, P<0.05; **, P<0.01.

[0067] 4. Effect of Clostridium tiliaceus Pt517 on the load of Salmonella typhimurium in the viscera of mice infected with Salmonella typhimurium like Figure 3As shown in A and B, the load of Salmonella Typhimurium in the liver and spleen of mice in the PBS group was significantly higher than that in the NC group (P<0.01), while the load of Salmonella Typhimurium in the liver and spleen of mice in the Pt517 group was significantly lower than that in the PBS group (P<0.05). This indicates that Salmonella Typhimurium can be translocated to organs such as the liver and spleen after infection; Paraclostridium tenuis Pt517 can reduce the load of Salmonella Typhimurium in the internal organs of mice infected with Salmonella Typhimurium and reduce the translocation of Salmonella Typhimurium.

[0068] 5. Effects of Clostridium tiliaceus Pt517 on the spleen of mice infected with Salmonella typhimurium The spleen weight and spleen index of each group of mice were Figure 4 As shown in A and B, the spleen weight and spleen index of mice in the PBS group were significantly higher than those in the NC group (P<0.001), while the spleen weight and spleen index of mice in the Pt517 group were significantly lower than those in the PBS group (P<0.05). This indicates that Paraclostridium tenuissima Pt517 can help alleviate the swelling of the spleen in mice caused by Salmonella typhimurium infection, reduce spleen damage, and have a certain protective effect on the spleen.

[0069] HE staining results of spleen ( Figure 5 ) showed that the spleen tissue structure of the NC group was clear, with occasional adhesion of white pulp (black arrow), and no obvious necrosis and other abnormalities in the red pulp and white pulp. In the PBS group, spleen tissue showed necrosis of many cells in the red pulp and a small number of cells in the white pulp (yellow arrow), condensation and fragmentation of the nuclei, unclear structure, and accompanied by more granulocyte infiltration (green arrow); more medullary sinus dilatation (red arrow), large-scale and small white pulp hemorrhage and congestion in the red pulp (blue arrow); and occasional adhesion of white pulp (black arrow). Compared with those in the PBS group, the spleens of the mice in the Pt517 group showed milder pathological symptoms. In the spleen tissue of the Pt517 group, necrosis of a large number of cells in the red pulp and a small number of cells in the white pulp were observed (yellow arrows), the nuclei were condensed and fragmented, the structure was unclear, and there were many granulocyte infiltrations (green arrows). The medullary sinuses were less dilated (red arrows), and a small amount of bleeding and congestion were observed in the red pulp (blue arrows). A small amount of white pulp was adhered to each other (black arrows), indicating that Clostridium tenuissima Pt517 alleviated the spleen tissue damage caused by Salmonella typhimurium infection.

[0070] 6. Effects of Clostridium tiliaceus Pt517 on the colon of mice infected with Salmonella typhimurium The results are as follows Figure 6As shown in A and B, the colon of mice in the NC group had better colon elasticity, and the intestinal feces were granular; the colon of mice in the PBS group had poor colon elasticity and congestion or edema, the intestinal feces were loose and soft, and the colon length was significantly shorter than that of the NC group (P<0.001); the colon of mice in the Pt517 group had better colon elasticity, the intestinal feces were granular and had no obvious edema, and the length was significantly longer than that of the PBS group (P<0.05), indicating that Paraclostridium tenuis Pt517 improved the colon phenotype and length of mice infected with Salmonella typhimurium to some extent.

[0071] Colon HE staining results ( Figure 7 ) showed that the structures of each layer of colonic tissue in the NC group were clear, and the mucosal epithelium was intact; the number of intestinal glands in the lamina propria was abundant, and goblet cells were distributed between epithelial cells; no obvious abnormalities such as necrosis and inflammatory cell infiltration were observed. In the PBS group, the number of colonic tissue folds was small, the mucosal layer was thin, and the local mucosal layer was eroded. The structures of the mucosal epithelium and the intestinal glands in the lamina propria were unclear, and a small amount of connective tissue hyperplasia and replacement (red arrows) were accompanied by a small amount of lymphocyte infiltration (yellow arrows). There was no obvious abnormality in the colonic tissue structure in the Pt517 group, no obvious inflammatory changes were observed, and occasional necrosis and shedding of mucosal epithelial cells were observed (black arrows); the number of intestinal glands in the lamina propria was abundant, and the number of goblet cells between epithelial cells was abundant. This shows that Paraclostridium tenuissus Pt517 alleviated the symptoms of colitis caused by Salmonella typhimurium infection and had a certain protective effect on the colon of mice.

[0072] 7. Effects of Clostridium tiliaceus Pt517 on serum and ileum inflammatory factors in mice infected with Salmonella typhimurium The results are shown in Table 5, Table 6 and Figure 8 As shown, compared with the NC group, the levels of inflammatory factors such as tumor necrosis factor-α (TNF-α), serum interleukin-1β (IL-1β) and interleukin-6 (IL-6) in the serum and ileum of mice in the PBS group were significantly increased (P<0.05); compared with the PBS group, the levels of tumor necrosis factor-α (TNF-α), serum interleukin-1β (IL-1β) and interleukin-6 (IL-6) in the serum and ileum of mice in the Pt517 group were significantly decreased (P<0.05); compared with the NC group, the level of anti-inflammatory factor interleukin-10 (IL-10) in the ileum of mice in the PBS group was significantly decreased (P<0.001); compared with the PBS group, the level of interleukin-10 (IL-10) in the ileum of mice in the Pt517 group was significantly increased (P<0.001), while there was no significant difference in the levels of serum interleukin-10 (IL-10) among the groups. The above results indicate that Paraclostridium tenuis Pt517 can reduce the levels of inflammatory factors in serum and ileum and increase the levels of anti-inflammatory factors, that is, Paraclostridium tenuis Pt517 can improve the inflammatory response caused by Salmonella typhimurium and has a certain anti-inflammatory effect.

[0073] Table 5 Concentration of inflammatory factors in mouse serum (pg / mL)

[0074] Note: Compared with the PBS group, *, P<0.05; **, P<0.01; ***, P<0.001.

[0075] Table 6 Concentration of inflammatory factors in mouse ileum (pg / mL)

[0076] Note: Compared with the PBS group, *, P<0.05; **, P<0.01; ***, P<0.001.

[0077] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A paraclostridium gracilis ( Paraclostridium tenue ) Pt517, characterized in that The deposit number of the Paraclostridium tiliaceum Pt517 is: CGMCC No.31232.

2. A bacterial agent, characterized in that The invention comprises the Paraclostridium tiliaceum Pt517 or a fermentation product thereof as described in claim 1.

3. The bacterial agent according to claim 2, characterized in that The bacterial agent is a solid bacterial agent, a liquid bacterial agent or a microbial bacterial agent, and the total number of viable bacteria of the paraclostridium tenuis Pt517 in the bacterial agent is 1×10 7-10 CFU / mL.

4. The method for preparing the bacterial agent according to claim 2 or 3, characterized in that: include: The paraclostridium tenuis Pt517 was inoculated into the culture medium for fermentation.

5. The preparation method according to claim 4, characterized in that: The culture medium is BHI culture medium, and the fermentation culture conditions include: culturing under anaerobic conditions at 35-40°C.

6. A product, characterized in that The product comprises the Paraclostridium tiliaceum Pt517 according to claim 1, or the bacterial agent according to claim 2 or 3, or is prepared by the preparation method according to claim 4 or 5; the product is preferably an antibacterial agent or a drug.

7. Use of the paraclostridium tiliaceum Pt517 according to claim 1 or the bacterial agent according to claim 2 or 3 in inhibiting microorganisms; the microorganisms include: coli, Salmonella, Listeria monocytogenes, or Staphylococcus aureus.

8. Use of the Paraclostridium tiliaceum Pt517 according to claim 1, or the bacterial agent according to claim 2 or 3, in the preparation of a product for any of the following applications: i) inhibiting salmonella infection, ii) anti-inflammatory, iii) resist intestinal damage, iv) Protects against spleen damage.

9. The use according to claim 8, characterized in that: The intestinal damage includes: colon shortening or intestinal mucosal damage; and / or, The spleen injury includes: reduced expansion of the spleen's medullary sinuses, and reduced bleeding and congestion.

10. The use according to claim 8, characterized in that: The inhibition of Salmonella infection includes: inhibiting weight loss, reducing the load of Salmonella, reducing the level of inflammatory factors or increasing the level of anti-inflammatory factors.

Images